MicroRNA-200c Contributes to Injury From Transient Focal
Cerebral Ischemia by Targeting Reelin
Creed M. Stary, MD, PhD; Lijun Xu, MD; Xiaoyun Sun, MD; Yi-Bing Ouyang, PhD;
Robin E. White, PhD; Jason Leong, MD; John Li; Xiaoxing Xiong, MD; Rona G. Giffard, MD, PhD
Downloaded from http://stroke.ahajournals.org/ by guest on June 16, 2017
Background and Purpose—MicroRNA (miR)-200c increases rapidly in the brain after transient cerebral ischemia but its
role in poststroke brain injury is unclear. Reelin, a regulator of neuronal migration and synaptogenesis, is a predicted
target of miR-200c. We hypothesized that miR-200c contributes to injury from transient cerebral ischemia by targeting
reelin.
Methods—Brain infarct volume, neurological score and levels of miR-200c, reelin mRNA, and reelin protein were assessed
in mice subjected to 1 hour of middle cerebral artery occlusion with or without intracerebroventricular infusion of miR200c antagomir, mimic, or mismatch control. Direct targeting of reelin by miR-200c was assessed in vitro by dual
luciferase assay and immunoblot.
Results—Pretreatment with miR-200c antagomir decreased post–middle cerebral artery occlusion brain levels of miR-200c,
resulting in a significant reduction in infarct volume and neurological deficit. Changes in brain levels of miR-200c inversely
correlated with reelin protein expression. Direct targeting of the Reln 3′ untranslated region by miR-200c was verified with
dual luciferase assay. Inhibition of miR-200c resulted in an increase in cell survival subsequent to in vitro oxidative injury.
This effect was blocked by knockdown of reelin mRNA, whereas application of reelin protein afforded protection.
Conclusions—These findings suggest that the poststroke increase in miR-200c contributes to brain cell death by inhibiting
reelin expression, and that reducing poststroke miR-200c is a potential target to mitigate stroke-induced brain
injury. (Stroke. 2015;46:00-00. DOI: 10.1161/STROKEAHA.114.007041.)
Key Words: infarction, middle cerebral artery ◼ microRNAs ◼ reperfusion injury ◼ stroke
M
icroRNAs (miRs) are endogenous, short (≈20 nucleotides) single-stranded RNAs that regulate gene expression by inhibiting translation of specific target mRNAs.
Members of the miR-200 family are upregulated in the brain
after transient cerebral ischemia,1 but their role in strokerelated injury is not understood. Studies in tumor and endothelial cells demonstrate a proapoptotic role for miR-200c,2–4
suggesting that poststroke increases in miR-200c may contribute to neuronal cell death.
Computational analysis of potential neuronal targets of
miR-200c identifies reelin, an extracellular matrix protein
essential for proper neuronal migration in the developing
brain5,6 and in maintaining synaptogenesis in adulthood.7
Reelin coordinates neuronal cell survival by inhibiting apoptosis8 and may play a protective role in the response to cerebral ischemia–reperfusion injury, as reelin-deficient mice are
more susceptible to injury after transient cerebral ischemia.9
Therefore, in the present study, we sought to determine (1)
whether miR-200c contributes to brain cell death subsequent
to transient cerebral ischemia, (2) whether reducing miR-200c
with antagomir pretreatment could decrease the severity of
acute stroke injury, and (3) whether the effect of miR-200c on
neuronal cell death is mediated by inhibition of reelin.
Methods
More details are provided in the online-only Data Supplement.
Animals and In Vivo Experimental Protocols
All experimental protocols using animals were approved by the
Stanford University Animal Care and Use Committee, and in accordance with National Institutes of Health guidelines. Adult male
CB57/B6 mice (aged, 8–10 weeks; Charles River) were randomly
assigned by coin flip to either intracerebroventricular pretreatment with miR-200c antagomir, mimic, or mismatch-control and
subjected to 1-hour middle cerebral artery occlusion (MCAO).
Neurological score and infarct volume were assessed by a blinded
observer after 24 hours of reperfusion. In a second set of experiments, animals were randomly divided and pretreated with either
intracerebroventricular miR-200c antagomir or control infusion 24
hours before 1 hour MCAO, and then euthanized at 1, 3, and 24
hours of reperfusion for analysis of brain levels of miR-200c, reelin
mRNA, and reelin protein.
Received August 13, 2014; final revision received November 27, 2014; accepted December 15, 2014.
From the Department of Anesthesia, Stanford University School of Medicine, CA (C.M.S, L.X., X.S., Y.-B.O., J. Leong, J. Li, X.X., R.G.G.); and
Department of Biology, Westfield State University, MA (R.E.W.).
The online-only Data Supplement is available with this article at http://stroke.ahajournals.org/lookup/suppl/doi:10.1161/STROKEAHA.
114.007041/-/DC1.
Correspondence to Rona G. Giffard, MD, PhD, Department of Anesthesia, Stanford University, 300 Pasteur Dr, Stanford, CA 94305-5117. E-mail
[email protected]
© 2015 American Heart Association, Inc.
Stroke is available at http://stroke.ahajournals.org
DOI: 10.1161/STROKEAHA.114.007041
1
2 Stroke February 2015
Intracerebroventricular Pretreatment
Mice were anesthetized with 2% isoflurane by facemask and placed
in a stereotaxic frame. A 26-gauge brain infusion cannula was placed
stereotaxically into the left lateral ventricle (bregma, −0.58 mm;
dorsoventral, 2.1 mm; lateral, 1.2 mm) as previously described.10
miR-200c antagomir (3 pmol/g body weight in 2 μL), mimic or
mismatch-control (Life Technologies) was mixed with cationic lipid
DOTAP (4 μL; 6 μL total volume; Roche) and infused for 20 minutes.
Transient Focal Cerebral Ischemia (MCAO)
Downloaded from http://stroke.ahajournals.org/ by guest on June 16, 2017
Mice (n=124 for all treatment groups and analyses) were anesthetized with 2% isoflurane and focal cerebral ischemia was produced
by 1 hour of MCAO with a 6-0 monofilament followed by reperfusion as previously described.10,11 Sham-operated mice (n=12) underwent ligation of the external carotid artery but no suture insertion.
Temperature and respiratory rate were monitored continuously and
rectal temperature was maintained at 37±0.5°C with a heating pad.
After the appropriate duration of reperfusion, mouse brains were
rapidly removed after transcardial perfusion with ice cold PBS followed by 4% paraformaldehyde in PBS to assess infarct volume, or
after perfusion only with PBS for reverse transcription quantitative
polymerase chain reaction or protein analysis. Mice with no evidence of acute neurological deficit (control=3/24; antagomir=2/14;
mimic=2/14), which died <24 hours after surgery (control=3/50; antagomir=4/48; mimic=1/17), or with evidence of significant bleeding
(control=6/50; antagomir=7/48; mimic=2/17) were excluded from
analysis. No significant difference (P<0.05) was observed between
treatment groups in number of excluded animals.
Neurological Score and Measurement of Cerebral
Infarction Area
Neurological performance was assessed and scored before euthanization as previously described10 from a score of 0 (no observable
neurological deficit) to 4 (unable to walk spontaneously). Mice were
then deeply anesthetized and transcardially perfused with saline followed by 4% paraformaldehyde, and brains were removed. After
coronal sectioning of brains into 50-μm sections with a vibratome
and staining with Cresyl Violet (EMD Chemicals), infarct volume
was quantified by a blinded observer and corrected for edema using
Image J software (v1.46, National Institutes of Health) as described
previously.11
Dual Luciferase Target Validation and Reporter
Assay
The luciferase reporter assay was performed as described previously.12 Briefly, mouse neuroblastoma (N2a) cells were cotransfected
with 0.25-ng Firefly luciferase control reporter plasmid, 0.05-ng
Renilla luciferase target reporter with Reln 3′ untranslated region
(UTR), and 40 ng miRNA expression vector using Lipofectamine
2000 (Invitrogen). Luminescence was assessed using a Promega
Dual-Luciferase assay kit (E1960) with automated microplate reader
(Infinite M1000 Pro, Tecan). In an additional set of experiments, we
tested a second potential target of miR-200c identified by computational predictive algorithms (Targetscan.org, release v6.2), Grp75
(Hsp9a/Hsp75/mortalin), a mitochondrial-localized member of the
HSP70 family known to play a role in neuroprotection.13
Cell Culture Transfection and Injury
N2a cells were grown in high-glucose DMEM (Invitrogen, Carlsbad)
supplemented with 8% fetal bovine serum (Hyclone) and antibiotics
(50 U/mL penicillin+50 μg/mL streptomycin; Invitrogen) in a humidified atmosphere containing 5% CO2 at 37°C. Cells were transfected with 20 pmol miR-200c mimic, inhibitor, or mismatch-control
(Thermo Scientific), with and without 20 pmol Reln small interfering
RNA (Life Technologies) using Lipofectamine 2000 (Invitrogen).
Cells were either harvested for analysis of miR-200c, reelin mRNA
or reelin protein or subjected to injury 24 hours after transfection. In
an additional set of experiments, cells were incubated with 0, 50, 100,
or 500 ng/μL recombinant reelin protein 1 hour before, and during,
injury. Injury was induced by exposure to 500 μmol/L H2O2 in serumfree DMEM for either 18 or 24 hours14 and cell death was quantified
by measuring lactate dehydrogenase–released dead cells as previously described.15
Reverse Transcription Quantitative Polymerase
Chain Reaction
Total RNA was isolated with TRIzol (Invitrogen). Reverse transcription was performed as previously described16 using the TaqMan
MicroRNA Reverse Transcription Kit for miR-200c and total RNA
(Applied Biosystems). Predesigned primer/probes for polymerase
chain reaction were obtained from Life Technologies for mouse
Reln and GAPDH mRNA, miRNA-200c, and U6 small nuclear RNA
(U6). Quantitative polymerase chain reaction reactions were conducted as previously described16 using the TaqMan Assay Kit (Applied
Biosystems). Measurements for reelin mRNA were normalized to
within-sample GAPDH, whereas miR-200c was normalized to U6
(ΔCt). Comparisons were calculated as the inverse log of the ΔΔCT
from controls.17
Reelin Protein Analysis
Immunoblotting was performed as previously described.11 Briefly,
50 μg of protein/sample was separated on a 4% to 10% Bis–Tris
mini-gel (Life Technologies), and electrotransferred to immobilon
polyvinylidene fluoride membrane (Millipore Corp). Membranes
were blocked and incubated with primary antibody against fulllength reelin (1:500, Abcam, No. ab78540) and β-actin (1:3000,
LiCOR Bioscience, No. 926–42210), washed and incubated with
1:15 000 the appropriate conjugated secondary antibody (LiCOR
Bioscience, No. 926–32212, No. 926–68021). Immunoreactive
bands were visualized using the LICOR Odyssey infrared imaging
system. Densitometric analysis was performed using Image J software (v1.46, National Institutes of Health). Reelin band intensity
was normalized to β-actin.
Statistical Analysis
All cell culture data represent ≥3 independent experiments. All data
reported are mean±SEM. Statistical analysis was performed using
t test if only 2 conditions were anaylzed. One-way ANOVA with
Bonferroni post-test was used for multiple comparisons. A P value of
< 0.05 was considered significant in all analyses.
Results
Reduction of miR-200c Protects the Brain From
Transient Focal Cerebral Ischemia
Decreasing miR-200c has been shown to improve cell survival after in vitro ischemia in neuronal SH-SY5Y cells.18
We investigated the effect of miR-200c inhibition in transient focal cerebral ischemia. Pretreatment with intracerebroventricular infusion of miR-200c antagomir resulted in
significant knockdown of miR-200c to ≈13% of control values, whereas pretreatment with miR-200c mimic increased
miR-200c ≈40-fold (Figure 1A). After miR-200c antagomir
pretreatment and MCAO infarct volume was significantly
decreased, ≈30% relative to control animals (Figure 1B and
1C). Gross motor function, estimated by neurological score
24 hours after reperfusion, was significantly improved with
antagomir pretreatment (Figure 1D). In contrast, animals pretreated with miR-200c mimic were not significantly different
from mismatch-control in either infarct volume or neurological score.
Stary et al miR-200c Contributes to Stroke Injury 3
Downloaded from http://stroke.ahajournals.org/ by guest on June 16, 2017
Figure 1. A, Brain microRNA (miR)-200c levels after intracerebroventricular (ICV) pretreatment decrease with miR-200c antagomir
(Antag) and increase with mimic, relative to mismatch-control
(cont). B, Representative cresyl violet–stained brain sections
from mice subjected to ICV pretreatment, 1 hour middle cerebral
artery occlusion (MCAO), and 24 hours of reperfusion. Regions
of infarct are lighter in color. C, Effect of altering miR-200c levels
on injury: quantification of infarct volume averaged for 4 levels
demonstrated significant protection with miR-200c antagomir
pretreatment compared with either control or mimic. D, Neurological score in post-MCAO mice: miR-200c antagomir pretreatment resulted in significantly improved neurological outcome
(lower score). *P<0.05 compared with control (n=11–23 animals
per group).
3 hours of reperfusion brain levels of reelin protein were significantly decreased (Figure 2A and 2B). These findings agree
with previous data showing an inverse correlation between
reelin and miR-200c expression in developing submandibular cells.19 To further define a functional relationship between
miR-200c and reelin in the development of injury after transient cerebral ischemia, we assessed post-MCAO brain levels
of reelin mRNA and uncleaved reelin protein in animals subjected to miR-200c knockdown before MCAO. We observed
a significant decrease in miR-200c with antagomir relative
to mismatch-control–pretreated animals at baseline and all
reperfusion time-points (Figure 3A). An effect of miR-200c
knockdown on reelin expression was also observed: both preMCAO levels and levels at the 3 hours reperfusion time-point
in miR-200c antagomir-pretreated animals demonstrated
significantly increased reelin protein (Figure 3C and 3D).
However, miR-200c suppression by antagomir did not alter
reelin mRNA levels (Figure 3B), suggesting that inhibition
of reelin expression by miR-200c occurred via translational
silencing rather than mRNA degradation.
Validation of the 3′UTR of Reln as a Direct Target
of miR-200c
To date, only predictive and correlative evidence19 has been
presented suggesting reelin mRNA is a direct target of miR200c (mature miR-200c sequence listed in Figure IA in the
online-only Data Supplement). The 3′UTR of Reln contains 2
Brain Levels of Reelin Decrease After MCAO
Brain levels of miR-200c after MCAO significantly increased
≈17-fold at 1 hour of reperfusion (Figure 2A), before returning
to baseline levels by 24 hours of reperfusion. Conversely, by
Figure 2. A, Time course of brain levels of microRNA (miR)-200c
(), reelin mRNA (), and uncleaved reelin protein () in mice
subjected to 1 hour middle cerebral artery occlusion (MCAO).
B, Examples of immunoblots for reelin and actin after MCAO at
the 3 hours reperfusion time-point. Although the levels of
miR-200c increased by 1 hour of reperfusion (A), levels of
uncleaved reelin protein (A and B) decreased by 3 hours,
suggesting translational inhibition. *P<0.05 compared with sham
control (n=8 animals per group).
Figure 3. In mice pretreated with intracerebroventricular infusion of microRNA (miR)-200c antagomir, after middle cerebral
artery occlusion (MCAO) miR-200c expression in the brain significantly decreased relative to control (A). Although reelin mRNA
remained unchanged (B), uncleaved reelin protein increased (C
and D), suggesting silencing by miR-200c rather than degradation. *P<0.05 compared with pre-MCAO control (n=8–11 animals
per group).
4 Stroke February 2015
Downloaded from http://stroke.ahajournals.org/ by guest on June 16, 2017
potential binding sites for miR-200c (Targetscan.org, release
v6.2; Figure 4A). To validate direct targeting of the Reln 3′UTR
by miR-200c, we used the dual luciferase gene reporter assay
in N2a cells. The full-length mouse Reln 3′UTR (1119 nt) was
cloned (forward primer: GGACTTGGCGAACAGAAAGC;
reverse primer: CTAGTCAGAGGCTACAGGGC) and
inserted into the Renilla luciferase reporter vector phRL-TK
(Promega). We generated a mutant of mouse miR-200c with
3 base substitutions within the seed region (nt 47–53 of the
mouse sequence, AAUACUG to AAAAGUC). Both wildtype and mutant inserts were confirmed by DNA sequencing
(Stanford Protein and Nucleic Acid Facility). Luciferase activity with the 3′UTR of Reln present was significantly decreased
by exposure to miR-200c compared with the miR-200c seed
mutant control (Figure 4B). We further assessed the effect
of miR-200c levels on reelin protein expression in N2a cells
by immunoblot after changing levels with miR-200c mimic,
inhibitor, or mismatch-control. Transfection with miR-200c
mimic significantly decreased, and inhibitor significantly
increased, reelin protein expression (Figure 4C), indicating
that the luciferase data are also reflected in changes in protein
levels in this cell line.
We tested a second potential target of miR-200c predicted by homology, the mitochondrial chaperone Grp75
(Hsp9a). The 3′UTR of Hsp9a shares the same seed sequence
homology with miR-200c as the Reln 3′UTR (Figure IB in
the online-only Data Supplement). The Hsp9a 3′UTR was
cloned (primers listed in Figure IC in the online-only Data
Supplement) and assessed with dual luciferase assay. In N2a
cells, dual luciferase assay with the Hsp9a 3′UTR and miR200c yielded no change in luciferase activity (Figure ID in
the online-only Data Supplement), indicating that Grp75 is
likely not a direct target of miR-200c in these cells.
Figure 4. Reln 3′-untranslated region (UTR) is a direct target
of microRNA (miR)-200c. Predicted binding for miR-200c:Reln
3′UTR (A) was assessed by dual luciferase activity assay in N2a
cells cotransfected with Renilla (Ren) Reln 3′UTR target reporter,
Firefly (Ff) control reporter, plus either wild-type miR-200c or
seed mutant (SM). A reduction in luciferase activity with wild-type
but not SM control indicated that miR-200c recognizes the Reln
3′UTRs (B). Uncleaved reelin protein expression (C) decreases in
N2a cells treated with mimic, and increases in cells treated with
inhibitor, relative to mismatch-control–treated cells. All cell culture experiments were performed in triplicate, *P<0.05 compared
with control (n=4–6 wells per condition).
miR-200c Contributes to Neuronal Cell Death by
Inhibiting Reelin Expression
Because miRs can theoretically target a large number of
different genes, we investigated whether reduction of reelin expression by miR-200c might be a mechanism contributing to cell death. We compared cells with increased
or decreased levels of miR-200c using mimic and inhibitor. Cultures were also treated with small interfering RNA
to Reln or control to reduce reelin mRNA expression.
After altering miR-200c levels using mimic and inhibitor
(2513±113- and 0.68±0.06-fold change, respectively, relative to control), N2a cells were subjected to 500 μmol/L
H2O2 exposure in serum-free medium for 18 hours and
assayed for cell death. Inhibition of miR-200c significantly
decreased, whereas miR-200c mimic increased cell death
from this injury paradigm (Figure 5A). Reelin mRNA was
effectively decreased (to 0.22±0.05) with small interfering RNA, and this abolished the protective effect of miR200c inhibition (Figure 5A), confirming a role for reelin in
the mechanism of miR-200c–mediated cell death. Finally,
exogenous application of recombinant reelin at 50, 100, or
500 ng/μL provided significant protection (Figure 5B) from
24 hours of H2O2/serum deprivation.
Discussion
In the present study, we investigated the role of miR-200c in the
evolution of injury after transient cerebral ischemia by altering
brain levels of miR-200c before transient focal cerebral ischemia. Using antagomir pretreatment, we have demonstrated for
the first time that preventing the early increase in miR-200c in
the brain subsequent to transient focal cerebral ischemia is protective. We confirmed the protective effect of miR-200c knockdown in an in vitro model using oxidative stress.
We most consistently observed a protective effect with
miR-200c inhibition, although increasing levels with miR200c mimic did not result in further injury in vivo. This may
be because of the high endogenous poststroke levels of miR200c, whereby any further increase with mimic did not result
in additional translational suppression. Previous studies investigating the role of miR-200c in neuronal injury have reported
varying outcomes. Lee et al18 demonstrated that inhibition of
miR-200c decreased cell death after in vitro ischemia in neuronal SH-SY5Y cells. This finding agrees with several previous
studies2–4 in other cells implicating miR-200c as contributing
to cell death by targeting and silencing antiapoptotic genes.
However, increased survival subsequent to in vitro ischemia
in the absence of reperfusion was also reported with overexpression of miR-200c.18 These seemingly conflicting results
may be because of different ischemic injury protocols; previous findings indicate that brain levels of miR-200c increase
substantially 3 hours after a transient period of ischemia, but
not after a 3-hours period of fixed ischemia,1 suggesting that
reperfusion may be an important component in miR-200c
induction and function. This agrees with previous findings
in endothelial cells where oxidative stress induced increased
expression of miR-200c, causing apoptosis and growth arrest.4
A second major finding of this study is that reelin is a direct
target of miR-200c, and that reduction of reelin by miR-200c
Stary et al miR-200c Contributes to Stroke Injury 5
Figure 5. A, Cell death after in vitro reperfusion injury (18 hours serum deprivation plus
500 μmol/L H2O2) increased in cells transfected with microRNA (miR)-200c mimic
but decreased with miR-200c inhibitor.
Cotransfection with Reln small interfering
RNA (siRNA) abolished the protective effect
of miR-200c inhibition. B, Cell death after
24-hour serum deprivation plus 500 μmol/L
H2O2 was significantly attenuated by application of recombinant reelin protein. All cell
culture experiments were performed in triplicate, *P<0.05 compared with control (n=8
wells per condition).
Downloaded from http://stroke.ahajournals.org/ by guest on June 16, 2017
with antagomir pretreatment contributes at least in part to
stroke-related injury. In the present study, we observed only
a modest and transient increase in reelin expression in vivo
after miR-200c suppression with antagomir, which may be the
result of cell-type or regional heterogeneity in reelin expression, and additional cellular factors regulating reelin expression.20 The half-life of antagomir to miR-200c is not known,
so the decrease in reelin expression at 24 hours may also be
because of loss of antagomir. However, our observations in
cell culture demonstrated a greater alteration in reelin expression with changing levels of miR-200c, supporting our findings using the dual luciferase assay that reelin is a direct target
of miR-200c. Because additional targets of miR200c may be
relevant for stroke, future studies will need to knockdownspecific targets to assess their relevance for protection.
Although previous studies have established the role of reelin in neurodevelopment,21 little is known about the functional
role reelin plays in neuroprotection. Reelin-deficient mice
provide a loss-of-function model but display early neurological dysfunction and greater susceptibility to excitotoxicity,9
and it is currently unknown whether they develop compensatory changes in cell survival signaling which could complicate interpretation of results using these mice. Therefore, we
performed in vitro reelin loss-of-function experiments using
small interfering RNA to demonstrate that the protective
effect of miR-200c inhibition is lost when reelin expression is
concurrently downregulated. Moreover, our findings demonstrate for the first time that exogenous application of recombinant reelin provides significant protection from oxidative
injury in vitro, highlighting a possible clinical role for reelin
in the acute phase of stroke treatment. As the role of reelin in
modulating neuronal growth is well established, future studies
investigating the use of post-treatment interventions modulating miR-200c and reelin levels may prove interesting and
relevant to future clinical treatment and recovery. Although
we did not investigate the intracellular mechanisms contributing to reelin-mediated cytoprotection, previous studies
demonstrate that reelin triggers disabled-1 phosphorylation
and downstream activation of the progrowth and prosurvival
phosphoinositide 3-kinase/protein kinase B pathway through
both canonical (via apolipoprotein-E receptor 2 and very low
density lipoprotein receptor activation22) and noncanonical
(α3β1integrin23/cadherin-related neuronal receptor24) signaling pathways, ultimately contributing to maintenance of
mitochondrial homeostasis. In vivo, reelin may also indirectly
promote neuronal cell survival via glia-mediated mechanisms:
reelin binds and activates disabled-1 in radial glial cells, astrocyte precursor cells traditionally viewed as providing neuronal
support and guidance primarily during embryonic development.25 Recent evidence suggests that radial glia persist and
proliferate in the adult brain.26 Moreover, terminally differentiated astrocytes may have the capacity to reactivate their
stem cell potential after injury, helping to protect and repair
adult neurons.27 Extending the findings in the present study to
investigations delineating the mechanisms of reelin-mediated
neuronal protection and neuron-glial coupling and differentiation may yield further insight into potential future therapies
for stroke.
In summary, the major novel findings of this study are
(1) brain levels of miR-200c influence injury severity after
MCAO; (2) reducing levels of miR-200c with antagomir
reduces infarct size and improves neurobehavioral outcome;
(3) miR-200c directly targets reelin expression; (4) miR-200c
regulation of neuronal cell survival occurs, at least in part, by
altered reelin expression; and (5) treatment with reelin protein
promotes neuronal cell survival. These results suggest that
inhibiting brain levels of miR-200c and upregulating reelin
expression in the acutely injured brain may have clinical use
to both minimize the evolution of injury and enhance recovery.
Acknowledgments
We would like to thank William Magruder for assistance in article
preparation, and Jeong-mi Moon, MD, for assistance with the N2a
cell injury model.
Sources of Funding
This work was supported by the American Heart Association 14FTF19970029 and National Institutes of Health T32-GM089626 awarded
to Dr Stary and National Institutes of Health R01-NS084396 and
R01-NS080177 to Dr Giffard.
Disclosures
None.
References
1. Lee ST, Chu K, Jung KH, Yoon HJ, Jeon D, Kang KM, et al. MicroRNAs
induced during ischemic preconditioning. Stroke. 2010;41:1646–1651.
doi: 10.1161/STROKEAHA.110.579649.
2. Schickel R, Park SM, Murmann AE, Peter ME. miR-200c regulates
induction of apoptosis through CD95 by targeting FAP-1. Mol Cell.
2010;38:908–915. doi: 10.1016/j.molcel.2010.05.018.
3. Chen CH, Xiao WW, Jiang XB, Wang JW, Mao ZG, Lei N, et al. A novel
marine drug, SZ-685C, induces apoptosis of MMQ pituitary tumor cells
by downregulating miR-200c. Curr Med Chem. 2013;20:2145–2154.
6 Stroke February 2015
Downloaded from http://stroke.ahajournals.org/ by guest on June 16, 2017
4. Magenta A, Cencioni C, Fasanaro P, Zaccagnini G, Greco S, SarraFerraris G, et al. miR-200c is upregulated by oxidative stress and induces
endothelial cell apoptosis and senescence via ZEB1 inhibition. Cell
Death Differ. 2011;18:1628–1639. doi: 10.1038/cdd.2011.42.
5. D’Arcangelo G, Miao GG, Chen SC, Soares HD, Morgan JI, Curran T.
A protein related to extracellular matrix proteins deleted in the mouse
mutant reeler. Nature. 1995;374:719–723. doi: 10.1038/374719a0.
6. Rice DS, Sheldon M, D’Arcangelo G, Nakajima K, Goldowitz D, Curran
T. Disabled-1 acts downstream of Reelin in a signaling pathway that
controls laminar organization in the mammalian brain. Development.
1998;125:3719–3729.
7. Pujadas L, Gruart A, Bosch C, Delgado L, Teixeira CM, Rossi D, et
al. Reelin regulates postnatal neurogenesis and enhances spine hypertrophy and long-term potentiation. J Neurosci. 2010;30:4636–4649. doi:
10.1523/JNEUROSCI.5284-09.2010.
8.Ohkubo N, Vitek MP, Morishima A, Suzuki Y, Miki T, Maeda
N, et al. Reelin signals survival through Src-family kinases that
inactivate BAD activity. J Neurochem. 2007;103:820–830. doi:
10.1111/j.1471-4159.2007.04804.x.
9. Won SJ, Kim SH, Xie L, Wang Y, Mao XO, Jin K, et al. Reelin-deficient
mice show impaired neurogenesis and increased stroke size. Exp Neurol.
2006;198:250–259. doi: 10.1016/j.expneurol.2005.12.008.
10. Xiong X, Barreto GE, Xu L, Ouyang YB, Xie X, Giffard RG. Increased
brain injury and worsened neurological outcome in interleukin-4 knockout mice after transient focal cerebral ischemia. Stroke. 2011;42:2026–
2032. doi: 10.1161/STROKEAHA.110.593772.
11. Han RQ, Ouyang YB, Xu L, Agrawal R, Patterson AJ, Giffard RG.
Postischemic brain injury is attenuated in mice lacking the beta2adrenergic receptor. Anesth Analg. 2009;108:280–287. doi: 10.1213/
ane.0b013e318187ba6b.
12. Trujillo RD, Yue SB, Tang Y, O’Gorman WE, Chen CZ. The potential
functions of primary microRNAs in target recognition and repression.
EMBO J. 2010;29:3272–3285. doi: 10.1038/emboj.2010.208.
13. Xu L, Voloboueva LA, Ouyang Y, Emery JF, Giffard RG. Overexpression
of mitochondrial Hsp70/Hsp75 in rat brain protects mitochondria,
reduces oxidative stress, and protects from focal ischemia. J Cereb Blood
Flow Metab. 2009;29:365–374. doi: 10.1038/jcbfm.2008.125.
14. Moon JM, Xu L, Giffard RG. Inhibition of microRNA-181 reduces
forebrain ischemia-induced neuronal loss. J Cereb Blood Flow Metab.
2013;33:1976–1982. doi: 10.1038/jcbfm.2013.157.
15. Xu L, Koumenis IL, Tilly JL, Giffard RG. Overexpression of bcl-xL protects astrocytes from glucose deprivation and is associated with higher
glutathione, ferritin, and iron levels. Anesthesiology. 1999;91:1036–1046.
16. Ouyang YB, Lu Y, Yue S, Xu LJ, Xiong XX, White RE, et al. miR181 regulates GRP78 and influences outcome from cerebral ischemia
in vitro and in vivo. Neurobiol Dis. 2012;45:555–563. doi: 10.1016/j.
nbd.2011.09.012.
17. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262.
18. Lee YJ, Johnson KR, Hallenbeck JM. Global protein conjugation by
ubiquitin-like-modifiers during ischemic stress is regulated by microRNAs and confers robust tolerance to ischemia. PLoS One. 2012;7:e47787.
doi: 10.1371/journal.pone.0047787.
19. Rebustini IT, Hayashi T, Reynolds AD, Dillard ML, Carpenter EM,
Hoffman MP. miR-200c regulates FGFR-dependent epithelial proliferation via Vldlr during submandibular gland branching morphogenesis.
Development. 2012;139:191–202. doi: 10.1242/dev.070151.
20. Abraham H, Meyer G. Reelin-expressing neurons in the postnatal and
adult human hippocampal formation. Hippocampus. 2003;13:715–727.
doi: 10.1002/hipo.10125.
21. Fatemi SH. Reelin glycoprotein: structure, biology and roles in health and
disease. Mol Psychiatry. 2005;10:251–257. doi: 10.1038/sj.mp.4001613.
22.Bock HH, Jossin Y, Liu P, Förster E, May P, Goffinet AM, et al.
Phosphatidylinositol 3-kinase interacts with the adaptor protein Dab1
in response to Reelin signaling and is required for normal cortical
lamination. J Biol Chem. 2003;278:38772–38779. doi: 10.1074/jbc.
M306416200.
23. Dulabon L, Olson EC, Taglienti MG, Eisenhuth S, McGrath B, Walsh
CA, et al. Reelin binds alpha3beta1 integrin and inhibits neuronal migration. Neuron. 2000;27:33–44.
24. Senzaki K, Ogawa M, Yagi T. Proteins of the CNR family are multiple
receptors for Reelin. Cell. 1999;99:635–647.
25. Rakic P. Guidance of neurons migrating to the fetal monkey neocortex.
Brain Res. 1971;33:471–476.
26. Kriegstein A, Alvarez-Buylla A. The glial nature of embryonic and adult
neural stem cells. Annu Rev Neurosci. 2009;32:149–184. doi: 10.1146/
annurev.neuro.051508.135600.
27. Robel S, Berninger B, Götz M. The stem cell potential of glia: lessons from
reactive gliosis. Nat Rev Neurosci. 2011;12:88–104. doi: 10.1038/nrn2978.
MicroRNA-200c Contributes to Injury From Transient Focal Cerebral Ischemia by
Targeting Reelin
Creed M. Stary, Lijun Xu, Xiaoyun Sun, Yi-Bing Ouyang, Robin E. White, Jason Leong, John
Li, Xiaoxing Xiong and Rona G. Giffard
Downloaded from http://stroke.ahajournals.org/ by guest on June 16, 2017
Stroke. published online January 20, 2015;
Stroke is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2015 American Heart Association, Inc. All rights reserved.
Print ISSN: 0039-2499. Online ISSN: 1524-4628
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://stroke.ahajournals.org/content/early/2015/01/20/STROKEAHA.114.007041
Data Supplement (unedited) at:
http://stroke.ahajournals.org/content/suppl/2015/01/20/STROKEAHA.114.007041.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Stroke can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office.
Once the online version of the published article for which permission is being requested is located, click
Request Permissions in the middle column of the Web page under Services. Further information about this
process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Stroke is online at:
http://stroke.ahajournals.org//subscriptions/
SUPPLEMENTAL MATERIAL
miR-200c Contributes to Injury From Transient Focal
Cerebral Ischemia by Targeting Reelin
Creed M. Stary, M.D., Ph.D., Lijun Xu, M.D., Xiaoyun Sun, M.D., YiBing Ouyang, Ph.D., Robin E. White, Ph.D., Jason Leong, John Li,
Xiaoxing Xiong, M.D., and Rona G. Giffard, M.D., Ph.D.
Supplemental Figure I. A, Mature miR-200c sequence. B, Hsp9a 3’UTR has
one potential binding site for miR-200c. C, Primers for Hsp9a 3’UTR. D, Binding
for miR-200c:Hsp9a 3’UTR was assessed by dual luciferase activity assay in
N2a cells co-transfected with Renilla (Ren) Hsp9a 3′UTR; Firefly (Ff), plus either
wild type miR-200c or seed mutant (SM) control. No reduction in luciferase
activity was observed with application of wild type miR-200c, indicating that miR200c does not target Hsp9a 3’UTR.