(G6PD) deficiency is the most common enzyme deficiency in the

Introduction
Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common
enzyme deficiency in the world [1, 2]. A preponderance of evidence has recently
emerged to indicate that G6PD deficiency affects cells other than that of erythrocytes
[3-13]. Mouse embryonic stem cells with disrupted G6PD gene are extremely
sensitive to H2O2 and to the sulfhydryl group-oxidizing agent diamide [14]. In
addition, there appears to be a strong somatic cell selection against G6PD-null cells,
suggesting an important role of G6PD in the development and/or survival of oocytes
[14]. We have shown that G6PD-deficient human foreskin fibroblasts (HFF)
underwent growth retardation and accelerated cellular senescence during their serial
cultivation [5]. Moreover, we have also shown that sodium nitroprusside (SNP), a
nitric oxide donor, stimulated growth of normal HFF but induced apoptosis in
G6PD-deficient HFF [4]. These findings indicate that G6PD-deficiency renders
cellular redox status abnormal thus affecting cells besides red cells. However, how
G6PD-deficiency may affect viral infectivity has not been thoroughly studied.
Oxidative stress has been found to affect viral proliferation and virulence [15-22].
Consumption of high iron diet resulted in elevated oxidative stress and co-elevation of
coxsackie B3 virus titers in mice [20]. Increase in oxidative stress and inadequate
antioxidant response were also related to the severity of liver damage and replication
status of virus in hepatitis B virus infection [17, 19]. Moreover, selenium- and
vitamin-E deficiency converted benign strain of coxsackie B3 virus to virulent strain
and caused myocarditis due to oxidative-induced mutations in the viral genome [20,
22, 23]. Similar to what was found for coxsackie B3 virus, host deficiency in
selenium led to an increase in influenza virus mutation and resulted in a more virulent
phenotype [21]. Although accumulating evidence suggests that cellular redox status
plays an important role in affecting the pathogenicity of influenza virus and coxsackie
B3 virus, how the cellular redox status may affect the proliferation and pathogenecity
of other virus besides these two types of virus remains largely undefined.
How oxidative stress may affect viral infection to airway cells has not been clearly
defined. In addition to a large intracellular sources of oxidants including
mitochondrial electron transport system, cytochrome P450 reactions and the nitric
oxide synthase system, pulmonary cells are exposed to approximately 8000 liters of
oxygen rich air per day as well as toxic particles such as ozone and other oxidants
[24]. Recent studies indicate that diesel exhaust enhanced influenza virus infections in
respiratory epithelial cells [25, 26]. Human coronavirus 229E (HCoV 229E), a
common pathogen for respiratory tract infection, belongs to large, enveloped RNA
virus in the order Nidovirales [27] and with high affinity toward airway cells [28, 29].
The genome is typical of coronaviruses containing genes for replicase, spike, small
1
envelope, membrane, and nucleocapsid in 5’ to 3’ directions [30]. For a long time
these viruses are known to cause only relatively mild clinical problem such as
common cold [31, 32]. Recent identification of a novel coronavirus as causative agent
of Severe Acute Respiratory Syndrome (SARS) catches much attention [33, 34].
However, how oxidative stress can affect coronavirus has not been investigated.
Therefore, the objective of the current study is to delineate whether oxidative stress
can affect HCoV 229E infection toward cells by using G6PD-deficient cells as a
model for cells with increased oxidative stress.
In this study, we used HCoV 229E to infect G6PD-deficient fibroblasts and
G6PD-knockdown A549 cells. Both G6PD-deficient and G6PD-knockdown cells
exhibited enhanced susceptibility to virus-induced cell death. The enhanced
virus-induced cell death was not caused by the increase in HCoV 229E receptor,
CD13, but by the increase in viral gene expression and in viral particle production.
Moreover, ectopic expression of G6PD in G6PD-deficient fibroblasts or antioxidant
treatment could attenuate the increase in susceptibility to HCoV 229E infection. This
result demonstrates that G6PD deficiency enhanced the HCoV 229E infection in an
oxidative stress-dependent manner, and the phenomena could be modulated by
altering the host redox status.
2
Results
G6PD-deficient fibroblasts exhibited enhanced susceptibility to HCoV 229E-induced
cell death
G6PD deficiency is a common disease worldwide, but there is no information
linking G6PD deficiency with viral pathology. To investigate whether G6PD
deficiency could affect viral infection, G6PD-deficient fibroblasts (HFF1) and normal
fibroblasts (HFF3) were subjected to HCoV 229E infection and cell viability was
determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)
assay [35]. We found that 0.025 to 0.1 M.O.I. of virus to infect cells was a suitable
concentration range of virus inoculum and also found that the cell viability of
G6PD-deficient and normal fibroblasts was different under this concentration range
after 72 h post-infection (Fig. 1A). Then we further compared the susceptibility of
normal and G6PD-deficient fibroblasts to HCoV 229E at 0.025 to 0.1 M.O.I. range
and at different time points of post-infection. We found that the cell viability was
significantly (p< 0.05) lower (8%) in HFF1 than that in HFF3 at 0.1 M.O.I after 48 h
post-infection (Fig. 1B), and the difference in cell viability expanded to 18% after 72
h post-infection when the cells were infected with 0.1 M.O.I. HCoV 229E (Fig. 1C).
These data show that G6PD-deficient fibroblasts had increased susceptibility to
HCoV 229E-induced cell death, especially at 72 h post-infection.
3
G6PD-knockdown A549 epithelial cells also showed enhanced susceptibility to HCoV
229E-induced cell death
In order to investigate whether the enhanced susceptibility of G6PD-deficient
fibroblasts to HCoV 229E infection was cell specific, G6PD-knockdown stable cells
from human lung epithelial carcinoma cell line A549 were used. Three
G6PD-knockdown stable cell lines, A549-5.8, A549-5.18 and A549-5.20, as well as a
control cell line transfected with pCI-neo vector only, A549-5S-5, were selected. The
G6PD activity of A549-5.8, A549-5.18 and A549-5.20 expressed only 18.6, 22.4 and
5.9% G6PD activity of the control cell line A549-5S-5, respectively (Fig. 2A). The
decrease in G6PD expression was confirmed by western blot analysis of G6PD
protein (Fig. 2B). Without virus infection, there was no difference for the growth rate
among A549-5S-S, A549-5.8, A549-5.18 and A549-5.20 cells (data not shown). Then
we determined the cell viability of G6PD-knockdown cells upon HCoV 229E
infection. These G6PD-knockdown epithelial cells (A549-5.8, A549-5.18 and
A549-5.20) showed significant increase in cell death induced by HCoV 229E
infection as compared with control cells (A549-5S-5) at 24 h, 48 h and 72 h
post-infection, respectively (Fig. 2C-E). These data demonstrate that enhanced
susceptibility to HCoV 229E-induced cell death in G6PD-deficient fibroblasts was not
cell-type specific, and the phenomena also could be found in G6PD-knockdown
4
epithelial cells.
Enhanced virus-induced cell death could not be attributed to the increase in HCoV
229E receptor CD13 in G6PD-deficient cells
Since HCoV 229E belongs to coronaviridae group I and needs receptors (CD13)
to infect cells [36], we investigated whether HCoV 229E-induced cell death of
G6PD-deficient cells could be attributed to the elevation of CD13 in these cells. Flow
cytometry and western blot analysis revealed no significant difference in CD13
expression between G6PD-deficient and normal fibroblasts (Fig. 3A and 3B).
Interestingly, G6PD-knockdown epithelial cells (A549-5.8, A549-5.18 & A549-5.20)
expressed less CD13 on their cell surface than their control cells (A549-5S-5) (Fig.
3C and 3D), indicating that the enhanced susceptibility to HCoV 229E infection in
G6PD-deficient fibroblasts and G6PD-knockdown epithelial cells could not be
attributed to the increased expression of the viral receptor CD13.
G6PD deficiency promoted HCoV 229E viral particle production and viral gene
expression
We next determined whether G6PD deficiency results in an increase production of
viral particles in the following experiment. In this notion, viral particles were
quantified by plaque assay at 24 and 48 h post-infection in G6PD-deficient and
control cells. By using A549 plaque assay to determine the viral titer, the amount of
5
viral particles from G6PD-deficient fibroblasts (Fig. 4A) was found to be 3 fold more
than that found in normal fibroblasts at 0.1 M.O.I. after 24 h post-infection (Fig. 4B).
Interestingly, after 48 h post-infection, the difference in viral production between
G6PD-deficient fibroblasts and normal fibroblasts was not as dramatic as that at 24 h
post-infection, but the amount of viral particles from G6PD-deficient cells was still
higher than their control ones. Similar findings were also observed in
G6PD-knockdown A549 cells (Fig. 4C), and the amount of viral particles from
G6PD-knockdown A549 were much higher than that from control A549-5S-5 both at
24 h and 48 h post-infection.
To determine whether enhanced viral particle production in G6PD-deficient cells
was caused by an increase in viral gene expression, RT-PCR technique was applied
using HCoV 229E specific primers representing partial sequence of nucleocapsid.
Since the actual nucleocapsid gene expression was not significantly different between
G6PD-deficient and control cells at 2 h post-infection, the gene expression at 2 h
post-infection was normalized to 1. In G6PD-deficient fibroblasts, viral gene
expression at 4, 6, 8, 10 h post-infection was 2, 29, 470, 1601 fold higher than 2 h
post-infection, respectively. However, in normal fibroblasts, viral gene expression at 4,
6, 8, 10 h post-infection was 1, 6, 47, 155 fold higher than 2 h post-infection,
respectively (Table 1). Likewise, the viral gene expression was similar in A549 stable
6
clones with G6PD-knockdown (A549-5.8, A549-5.18 and A549-5.20) and showed
much higher fold of increase than that in normal control (A549-5S-5) (Table 1). These
data indicate that host cellular G6PD activity modulates viral gene expression.
Ectopic expression of G6PD in fibroblasts ameliorated the enhanced susceptibility to
HCoV 229E infection
To further confirm that enhanced susceptibility to HCoV 229E-induced cell death
as well as enhanced cellular viral production was modulated by cellular G6PD activity,
G6PD-deficient cells (HFF1) were infected with G6PD-expressing retroviral vector,
LGIN and LKGIN [5], and these cells were used to test the effects of G6PD
replenishment on HCoV 229E-induced cell death and viral gene expression. LGIN
and LKGIN expressed 11.1 and 12.8 fold more G6PD activity than their control LEIN
(Fig. 5A), and the increase in G6PD activity was also confirmed by western blot data
(Fig. 5B). It should be pointed out that the cell doubling time was not significantly
different for the passages of LEIN, LGIN, and LKGIN chosen for the subsequent
experiments. The expression of CD13 in LGIN and LKGIN was not significantly
different from the control LEIN (Fig. 5B). However, when the susceptibility of these
cells to HCoV 229E-induced cell death was compared, LEIN showed significantly
decreased viability comparing to LGIN and LKGIN at 72 h post-infection (Fig. 5C).
The viral nucleocapsid gene expression of HCoV 229E in LEIN, LGIN and LKGIN
7
were also determined by quantitative RT-PCR. G6PD-overexpressing fibroblasts
(LGIN and LKGIN) showed significantly decreased viral gene expression comparing
to their control, LEIN (Fig. 5D). Taken together, these data provide strong support to
the notion that cellular G6PD activity modulated cellular susceptibility to viral
infection.
G6PD-knockdown epithelial cells suffered elevated oxidative stress after virus
post-infection
Since G6PD-deficient cells favored viral replication, the redox status of
G6PD-deficient cell was determined by testing cellular ROS level using flow
cytometric technique in combination with DCF staining and by quantifying cellular
NADPH/NADP+, intracellular GSH level using HPLC method. In the basal condition,
G6PD deficient fibroblasts (HFF1) and G6PD-knockdown epithelial cells (A549-5.8)
had lower NADPH/NADP+ ratio and intracellular GSH level than that in control cells
(HFF3 and A549-5S-5) (Table 2). All these data confirmed that G6PD-knockdown
cells had less reducing power than their control ones. Concommitant with the
decrease in cellular reducing power, G6PD-knockdown epithelial cells showed
significant higher production of ROS by DCF-staining (Fig. 6) than that in their
control upon viral infection. Taken together, the diminishment in reducing power and
enhanced ROS production were indicative that G6PD-knockdown epithelial cells
8
exhibited higher oxidative stress than the control cells after viral infection.
Antioxidant had protective effect against viral infection
We then evaluated whether ectopic application of antioxidant provides a
protective effect against virus infection in G6PD-knockdown cells. Toward this end,
the antioxidant, α-lipoic acid, was applied in culture medium for 5 h before virus
infection. A549 cells pre-treated with antioxidant were significantly less susceptible to
virus-induced cell death than control cells after 48 h post-infection at 0.1 M.O.I. (Fig.
7A). ROS production of these epithelial cells was determined and the cells that
pretreated with antioxidant produced less ROS following virus infection than cells
without antioxidant pretreatment (Fig. 7B). In addition, viral gene (nucleocapsid)
expression in G6PD-knockdown cells that treated with or without antioxidant was
determined by Q-PCR. After using 0.1 M.O.I. virus to infect cells, the viral gene
expression in G6PD-knockdown cells pretreated with antioxidant was lower than that
in cells without antioxidant pretreatment (Fig. 7C). Together, these data support the
notion that the susceptibility to HCoV 229E infection was associated with the cellular
redox status.
9
Discussion
A preponderance of evidence has indicated that viral infection increases oxidative
stress in host cells [37-40]. However, only limited information is available concerning
how the redox status can affect viral behavior in the host cells [15, 41]. For example,
in selenium- and vitamin E-deficient mice the virulent of coxsackie B3 virus has been
changed causing myocarditis [18]. Our current study, using G6PD-deficient cells as a
model system, clearly indicates that increased oxidative stress renders G6PD-deficient
cells more susceptible to viral infection than their controls (Table 1 and Fig 6). Such
abnormality can be ameliorated by the antioxidant agent such as lipoic acid. These
data provide additional support to the notion that the redox status of the host plays an
important role to affect viral infectivity.
Increased viral infection in G6PD-deficient cells could be, in part, attributed to
increase viral receptor in these cells or due to the enhanced production of viral
particles inside these cells. HCoV 229E belongs to group I coronavirus and infects
human cells through receptor aminopeptidase N (CD13) [36, 42]. Since
G6PD-deficient cells do not express higher CD13 on their cell surface than their
control as demonstrated by flow cytometry and western blot (Fig. 3), one can rule out
the possibility that
enhanced susceptibility to
HCoV 229E infection of
G6PD-deficient cells is due to an increase in human receptor CD13 on these cells. On
10
the other hand, enhanced production of viral particles in G6PD-deficient cells was
clearly supported by increased plaque formation (Fig. 4) and by elevated viral gene
(nucleocapsid) expression (Table 1) following virus infection. Thus, G6PD-deficiency
provides a more suitable milieu for viral replication than that provided by
non-G6PD-deficient cells.
One condition which favors viral replication is high oxidative stress.
G6PD-knockdown cells produce more ROS than normal counterparts (Fig. 6) and
have lower cellular GSH content (Table 2) than their control cells during viral
infection. The low GSH content in G6PD-knockdown cells has been related to low
NADPH to NADP+ ratio in these cells (Table 2). Since these changes in redox status
of G6PD-knockdown cells are accompanied by an increase in viral nucleocapsid gene
expression in these cells (Table 1), these findings are consistent with the postulate that
increased oxidative stress in G6PD-knockdown cells promotes viral gene expression.
Increasing evidence shows that ROS play important roles in regulating signal
transduction and controls cellular physiology [43-45]. It has also been shown that
virus infection could up-regulate promoter, like NF-κB, or transcription factor, like
STAT3, to influence cellular gene expression as a consequence of increase in
oxidative stress [46-48]. Altering redox status can also affect proinflammatory
cytokines production [49, 50] and thus influences the antiviral mechanism of
11
G6PD-deficient cells.
Since increased susceptibility of G6PD-knockdown cells to HCoV 229E
infection has been correlated with the ROS production, then antioxidants pretreatment
should be useful to attenuate the phenomena. Indeed, when G6PD-knockdown cells
are pretreated with lipoic acid, the enhanced susceptibility of these cells to virus
infection can be attenuated (Fig. 7). Lipoic acid is synthesized by eukaryotic cells and
is not considered as a vitamin. Lipoic acid and its reduced form dihydrolipoic acid are
involved in defense against oxidative stress and apoptosis [51, 52]. Our finding that
lipoic acid could diminish ROS production in G6PD-knockdown cells (Fig. 7)
supports the postulate that oxidative stress contributes to the enhanced susceptibility
of these cells to HCoV 229E infection. Moreover, this finding also suggests that
antioxidant treatment may have particular health benefit to G6PD-deficient subjects
against viral infection.
All in all, our findings provide strong support to the notion that redox status of host
cells modulates the infectivity of viral pathogen. Our findings also have major
medical implication. Unpublished observation in our laboratory indicates that
G6PD-deficient individuals are more prone to hepatitis viral infection. This
unpublished observation together with the findings reported in the current article
reveal that enhanced oxidative stress in G6PD-deficient individuals may increase their
12
susceptibility to viral infection. Moreover, our findings also suggest that antioxidants
intakes may be helpful to G6PD-deficient subjects against viral infection.
13
Experimental procedures
Reagents and antibodies
Dulbecco’s modified Eagle’s medium (DMEM), trypsin, penicillin, streptomycin
and amphotericin B were purchased from Invitrogen (Carlsbad, CA, USA). The
G6PD antibody was from Genesis Biotech (Taiwan). The anti-actin and anti-CD13
antibodies were from Santa Cruz Biotechnologies (Santa Cruz, CA, USA).
Lipofectamine 2000 (LF2000) transfection reagents and DCFH-DA were from
Invitrogen (Carlsbad, CA, USA). Antibiotic G418 sulfate and α-lipoic acid were from
Promega (Madison, WI, USA).
Cell culture
Primary human foreskin fibroblasts prepared from G6PD-deficient individual
(HFF1) and non-G6PD deficient individual (HFF3) as well as G6PD overexpressing
fibroblasts (LGIN & LKGIN) were described previously [10]. Lung epithelial
carcinoma cell line A549 was from American Type Culture Collection (ATCC). All
cells were cultured in DMEM supplemented with 10% FCS, 100 units/ml of penicillin,
100 units/ml of streptomycin, and 0.25 mg/ml of amphotericin B at 37 in a
humidified atmosphere of 5% CO2 with or without 300 µg/ml G418 dependent on
transfection or not. The cells were sub-cultured at a ratio of 1:8 before the cultures
were confluent. Human fetal lung fibroblast (MRC-5) was purchased from ATCC
14
(CCL-171) and maintained in minimum essential medium (MEM) supplemented with
10% FCS and antibiotics.
Generation of G6PD-knockdown A549 cells by RNAi technique
All possible G6PD-RNAi sequences were confirmed by transient transfection.
RNAi expression vector pTOPO-U6 had the EcoRV and BbsI sites for insertion of
RNAi sequences [53]. In addition, BglII and DraIII cloning sites were designed for
release of the complete RNAi expression cassette and for insertion into pCI-neo [54]
expression vector. For the plasmids G6PD–143, the complementary oligonucleotides
G6PD-143S (5′- ACACACATATTCATCATCGAA
GCTTGGATGATGAATATGTGTGT-3′) and G6PD–143AS (5′-GGATACACACA
TATTCATCATCCAAGCTTCGATGATGAATATGTGTGT-3′), were annealed. The
annealing of G6PD-143S/G6PD–143AS generated sites corresponding to the blunt
end and the overhang that matched the EcoRV- and BbsI- digested pTOPO-U6. The
ligation between the annealed oligo-nucleotides and pTOPO-U6 at the EcoRV and
BbsI cloning sites generated pTOPO G6PD-143. pTOPO G6PD-143 was tested by
transient transfect into K562 to determine the protein expression of G6PD. Complete
RNAi expression cassette was removed by digestion of BglII and DraIII and was
inserted into pCI-neo mammalian expression vector for stable transfection as
described previously. All cells that stably transfected with vector only (A549-5S-5) or
15
G6PD-RNAi (A549-5.8, A549-5.18 & A549-5.20) were grown in 300 µg of G418/ml.
Infection with HCoV 229E
Strain 229E of human coronavirus was kindly provided from Dr. Lai MM
(Academia Sinica, Taiwan) and propagated in monolayer of MRC-5 cells and purified
by centrifugation. The virus titer was determined by plaque assay [55]. Virus pools
were aliquoted, quick frozen on dry ice, and stored at -70 until used.
G6PD activity
G6PD activity was measured at 340 nm by the reduction of NADP+ in the
presence of glucose-6-phosphate as described [56]. In brief, cells were collected by
centrifugation at 500 × g at 4 for 10 min. Cell pellets were re-suspended in 1 ml of
extraction buffer (20 mM Tris-HCl (pH 8.0), containing 3 mM MgCl2, 1 mM EDTA,
0.02% (w/v) β-mercaptoethanol, 0.1% triton X-100 and 1 µM ε-amino-n-caproic acid)
then chilled immediately in an ice bath and disrupted by sonication. Cell lysate was
centrifuged at 13,000 × g at 4 for 15 min, and the supernatant was used for the
assay. A typical assay mixture consisted of 50 µg of protein in 1 ml of G6PD assay
buffer (50 mM Tris-HCl pH 7.8, with 50 mM MgCl2, 4 mM G6P, and 4 mM NADP+).
Change in absorbance at 340 nm was monitored spectrophotometrically.
Virus infection and MTT assay
For each MTT assay, 2 × 104 cells were seeded in a 12-well dish. Twenty-four
16
hours later, the culture was subjected to HCoV 229E infection. Cells were infected
with HCoV 229E at different M.O.I.. For quantification of the degree of cell death in
cell culture, we employed the viability MTT assay. At different times after infection
(24 h, 48 h & 72 h p.i.), 10% tetrazolium was added to the medium and incubated at
37 for 4 h. The reaction was terminated by dimethyl sulfoxide solution and the
absorbance was determined at 490 nm and 650 nm in an ELISA microplate reader
(Spectramax 340PC384; Molecular Devices). Cell viability was calculated as
percentage of control cells using the formula: (A490-A650) of treated cells × 100/
(A490-A650) of control cells.
Western blot analysis
Cells were harvested and solubilized for 30 min at 4 in 50 mM Tris-HCl pH 7.5
containing 1% Nonidet P (NP)-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1
mM EDTA, 1 mM sodium fluoride, 1 mM sodium orthovanadate, 1 mM PMSF, 1 µg
of aprotinin/ml and 1 µg of leupetin/ml. Cell extracts were subjected to SDS-PAGE.
Gels were electroblotted onto polyvinylidene difluoride membrane in Towbin transfer
buffer (25 mM Tris-HCl, 192 mM glycine and 20% methanol). Membranes were
treated for 1 h in blocking buffer, probed with first antibody overnight, and washed
twice, followed by incubation with secondary antibody for 1 h. After an additional
washing step, immunoblots were visualized using the ECL detection system.
17
Measurements of cell specific receptors for HCoV 229E
Cell surface membrane receptors for CD13 were measured by flow cytometry as
previously described [57]. In brief, cells were harvested and washed by FABS (1×PBS,
1% FBS and 0.1% sodium azide), then probed with first antibody CD13 (1:50) on ice
for 30 min and washed twice with FABS, followed by incubating with
FITC-conjugated goat anti-mouse secondary antibody (dilution 1/1000) in the dark on
ice for 30 min. Cells were washed twice with FABS and fluorescence was determined
by flow cytometry (Becton Dickinson FACScan) followed by analysis with
CELLQuest software.
RNA isolation, RT and Q-PCR
Total RNA was isolated from HCoV-infected cells by using RNeasy Mini Kit
(Qiagene). RT-PCR was also performed with Superscript III reverse transcriptase
(Invitrogen) and AmpliTaq Gold DNA polymerase (Applied Biosystems). To quantify
the DNA fragment, two HCoV 229E specific oligonucleotide primers of nucleocapsid
were
used:
5’
AGGCGCAAGAATTCAGAACCAGAG
3’
and
5’
AGCAGGACTCTGATTACGAGAAAG 3’. To 1 µl of the RT mixture the following
was added: 25 µl of 2 × SYBR Green Mix buffer (ABI PCR master mix), 5 µl of
primer mixture (10 pmole each) and the total volume was adjusted to 50 µl with water.
The real-time quantitative polymerase chain reaction was carried out in a sequence
18
detection system GeneAmp®5700 (Applied Biosystems). The PCR conditions were
optimized as follows: 95 for 10 min, and 40 cycles each of 95 for 30 s, 66 for
45 s, and 72 for 30 s. The intensity of fluorescence, which is a direct measurement
of the amount of amplified product, is measured with each cycle. The threshold at
which significant amplification of first detected is determined, and all samples are
evaluated by determining how quickly each sample reaches this threshold. The cycle
at which this threshold is achieved is recorded as the Ct value. Data were normalized
with primers for a housekeeping gene, actin. A sample with no template was included
to ensure the absence of primer dimmer.
Plaque assay
Lung carcinoma cell line A549 was used for plaque assay because HCoV 229E
was propagated and could form cytopathic effect (CPE) in A549 cells as compared to
MRC-5 cells. Ten-fold serial dilution of virus was made in DMEM without serum.
500 µl of each dilution was used to infect A549 cells, grown in 6-well plate, for 1 h at
37. The virus inoculum was aspirated off and the monolayer was washed once with
1 ml of phosphate buffer saline. The monolayer was overlaid with 3 ml of the 1:9
mixture of 3% agarose and DMEM followed by incubation at 37 until plaques were
developed. After 3 days post-infection, cells were stained with 0.5% crystal violet.
Plaques were counted by direct observation and the titer of virus was calculated.
19
Quantification of cellular NADPH and NADP+
A total of 1.25 × 107 cells were harvested and washed by 1×PBS twice. To extract
NADP+, 300 µl cell pellet suspension was added to 100 µl of 0.1 M HCl. While on ice,
the cells were incubated for 1 min, and then neutralized with 100 µl 0.1 M NaOH
followed by the addition of 300 µl Tris-HCl buffer (pH 6.8). The mixture was
centrifuged at 3000 g for 10 min to remove insoluble material. For determination of
NADPH, 300 µl cell pellet was treated with 100 µl 0.1 M NaOH then incubated on
ice for 1 min. The suspension was neutralized with 100 µl 0.1 M HCl and 300 µl of 1
M Tris-HCl buffer (pH 11) was added. The mixture was centrifuged at 3000 g for 10
min to remove insoluble material. All these steps are done in the same day and
followed by HPLC determination of NADP+ and NADPH.
HPLC (Waters; model 2695) separation was carried out with a C18 3-µm
reversed-phase column. The mobile phase consisted of a gradient of buffer A (0.1 M
KH2PO4, 5 mM tetrabutylammonium hydrogen sulfate, 2.5% (v/v) acetonitril, pH 6.0)
and buffer B (0.1 M KH2PO4, 5 mM tetrabutylammonium hydrogen sulfate, 25% (v/v)
acetonitril, pH 5.5). After injection of 20-50 µl of sample, the column was initially
eluted at 0.8 ml/min for 3 min with buffer A, followed by 2 min elution with buffer A
containing 11% buffer B and finally a 25 min elution by a buffer gradient with buffer
B gradually increased to 100%. Before the application of next sample, the column
20
was re-equilibrated for 10 min with 100% buffer A. HPLC separations were
performed at room temperature. Detection was done spectroscopically at 260 nm. The
identities of peaks were confirmed by co-elution with standards. Quantitative
measurements were made on the basis of the injection of standard solutions with
known concentration.
Intracellular GSH measurement
Cells (4×105) were acidified with 300 µl of 1% (wt/vol) meta-phosphoric acid and
centrifuged to precipitate the proteins. The supernatant was filtered and
chromatographed on an Intersil 4.6 × 250 mm ODS3 column eluted with mobile
phase containing 49 % of buffer A (10 mM NaH2PO4 and 0.3 mM octane sulfonic
acid adjusted to pH 2.7 with phosphoric acid) and 51% of buffer B (10 mM NaH2PO4,
0.3 mM octane sulfonic acid, and 10% acetonitrile adjusted to pH 2.7 with phosphoric
acid) and a flow rate of 0.8 ml/min. An ESA Coulochem II detector (Waters Alliance
Systems, Milford, MA) was used for analysis. The guard cell was set at 950 mV,
electrode 1 and 2 at 400 mV, electrode 3 at 650 mV, electrode 4 at 700 mV, electrode
5 at 800 mV, electrode 6 at 850 mV, electrode 7 at 900 mV and electrode 8 at 950 mV.
Quantification was obtained by integration relative to the internal standard.
Direct ROS determination by DCF staining
ROS production was determined using 2’,7’-dichlorodihydrogluorescein diacetate
21
(DDFH-DA; Invitrogen). After the cells were treated for 24 h with control media or
virus inoculum, the cells were washed with PBS and then loaded for 30 min with
DCFH-DA (20 µM) in serum free medium. The acetoxymethyl group on DCF-DA is
cleaved by nonspecific esterase within the cells, resulting in a nonfluorescent charged
molecule that does not cross the cell membrane. Intracellular ROS irreversibly oxidize
the DCFH-DA to dichlororluorescein (DCF), which is a fluorescent product. After
treatment, the media was removed, and the cells were harvested and determined by
flow cytometry (Becton Dickinson FACScan) and the data were analyzed with
CELLQuest software.
Statistical analysis
Data are expressed as a mean ± SEM of several experiments. Statistical
differences between the means of two groups were analyzed by the Student’s t test. A
value of p < 0.05 was considered significant.
Acknowledgements
This project is supported by grants from Chang Gung University (CMRPD140041),
from the National Science Council of Taiwan (NSC94-2320-B182-041), and by a
grant from Ministry of Education (EMRPD150241). The technical support in RNAi
plasmid construction from the RNAi core laboratory of Chang Gung University is
appreciated.
22
Reference:
1. Frank JE. Diagnosis and management of G6PD deficiency. Am Fam Physician
2005;72:1277-82
2. Arese P, De Flora A. Pathophysiology of hemolysis in glucose-6-phosphate
dehydrogenase deficiency. Semin Hematol 1990;27:1-40
3. Ho HY, Wei TT, Cheng ML and Chiu DT. Green tea polyphenol
epigallocatechin-3-gallate protects cells against peroxynitrite-induced cytotoxicity:
modulatory effect of cellular G6PD status. J Agric Food Chem 2006;54:1638-45
4. Cheng ML, Ho HY, Liang CM, et al. Cellular glucose-6-phosphate dehydrogenase
(G6PD) status modulates the effects of nitric oxide (NO) on human foreskin
fibroblasts. FEBS Lett 2000;475:257-62
5. Ho HY, Cheng ML, Lu FJ, et al. Enhanced oxidative stress and accelerated cellular
senescence in glucose-6-phosphate dehydrogenase (G6PD)-deficient human
fibroblasts. Free Radic Biol Med 2000;29:156-69
6. Tsai KJ, Hung IJ, Chow CK, Stern A, Chao SS and Chiu DT. Impaired production
of nitric
oxide,
superoxide,
and
hydrogen peroxide
in
glucose
6-phosphate-dehydrogenase-deficient granulocytes. FEBS Lett 1998;436:411-4
7. Tseng CP, Huang CL, Chong KY, Hung IJ and Chiu DT. Rapid detection of
glucose-6-phosphate dehydrogenase gene mutations by denaturing high-performance
liquid chromatography. Clin Biochem 2005;38:973-80
8. Nicol CJ, Zielenski J, Tsui LC and Wells PG. An embryoprotective role for
glucose-6-phosphate dehydrogenase in developmental oxidative stress and chemical
teratogenesis. Faseb J 2000;14:111-27
9. Ayene IS, Stamato TD, Mauldin SK, et al. Mutation in the glucose-6-phosphate
dehydrogenase gene leads to inactivation of Ku DNA end binding during oxidative
stress. J Biol Chem 2002;277:9929-35
10. Cheng ML, Ho HY, Wu YH and Chiu DT. Glucose-6-phosphate
dehydrogenase-deficient cells show an increased propensity for oxidant-induced
senescence. Free Radic Biol Med 2004;36:580-91
11. Cheng AJ, Chiu DT, See LC, Liao CT, Chen IH and Chang JT. Poor prognosis in
nasopharyngeal cancer patients with low glucose-6-phosphate-dehydrogenase activity.
Jpn J Cancer Res 2001;92:576-81
12. Tas S, Donmez AA, Kirali K, Alp MH and Yakut C. Aortic valve replacement for
a patient with glucose-6-phosphate dehydrogenase deficiency and autoimmune
hemolytic anemia. J Card Surg 2005;20:380-1
13. Sobngwi E, Gautier JF, Kevorkian JP, et al. High prevalence of
glucose-6-phosphate dehydrogenase deficiency without gene mutation suggests a
23
novel genetic mechanism predisposing to ketosis-prone diabetes. J Clin Endocrinol
Metab 2005;90:4446-51
14. Pandolfi PP, Sonati F, Rivi R, Mason P, Grosveld F and Luzzatto L. Targeted
disruption of the housekeeping gene encoding glucose 6-phosphate dehydrogenase
(G6PD): G6PD is dispensable for pentose synthesis but essential for defense against
oxidative stress. Embo J 1995;14:5209-15
15. Friel H, Lederman H. A nutritional supplement formula for influenza A (H5N1)
infection in humans. Med Hypotheses 2006;67:578-87
16. Valyi-Nagy T, Dermody TS. Role of oxidative damage in the pathogenesis of viral
infections of the nervous system. Histol Histopathol 2005;20:957-67
17. Beck MA, Handy J and Levander OA. Host nutritional status: the neglected
virulence factor. Trends Microbiol 2004;12:417-23
18. Beck MA. Nutritionally induced oxidative stress: effect on viral disease. Am J
Clin Nutr 2000;71:1676S-81S
19. Bolukbas C, Bolukbas FF, Horoz M, Aslan M, Celik H and Erel O. Increased
oxidative stress associated with the severity of the liver disease in various forms of
hepatitis B virus infection. BMC Infect Dis 2005;5:95
20. Beck MA, Shi Q, Morris VC and Levander OA. Benign coxsackievirus damages
heart muscle in iron-loaded vitamin E-deficient mice. Free Radic Biol Med
2005;38:112-6
21. Nelson HK, Shi Q, Van Dael P, et al. Host nutritional selenium status as a driving
force for influenza virus mutations. Faseb J 2001;15:1846-8
22. Beck MA. Selenium and host defence towards viruses. Proc Nutr Soc
1999;58:707-11
23. Beck MA, Handy J and Levander OA. The role of oxidative stress in viral
infections. Ann N Y Acad Sci 2000;917:906-12
24. Cantin AM, White TB, Cross CE, Forman HJ, Sokol RJ and Borowitz D.
Antioxidants in cystic fibrosis Conclusions from the CF Antioxidant Workshop,
Bethesda, Maryland, November 11-12, 2003. Free Radic Biol Med 2007;42:15-31
25. Ito T, Okumura H, Tsukue N, Kobayashi T, Honda K and Sekizawa K. Effect of
diesel exhaust particles on mRNA expression of viral and bacterial receptors in rat
lung epithelial L2 cells. Toxicol Lett 2006;165:66-70
26. Jaspers I, Ciencewicki JM, Zhang W, et al. Diesel exhaust enhances influenza
virus infections in respiratory epithelial cells. Toxicol Sci 2005;85:990-1002
27. Weiss SR, Navas-Martin S. Coronavirus pathogenesis and the emerging pathogen
severe acute respiratory syndrome coronavirus. Microbiol Mol Biol Rev
2005;69:635-64
28. Wang G, Deering C, Macke M, et al. Human coronavirus 229E infects polarized
24
airway epithelia from the apical surface. J Virol 2000;74:9234-9
29. Chilvers MA, McKean M, Rutman A, Myint BS, Silverman M and O'
Callaghan C.
The effects of coronavirus on human nasal ciliated respiratory epithelium. Eur Respir
J 2001;18:965-70
30. Brian DA, Baric RS. Coronavirus genome structure and replication. Curr Top
Microbiol Immunol 2005;287:1-30
31. Pene F, Merlat A, Vabret A, et al. Coronavirus 229E-related pneumonia in
immunocompromised patients. Clin Infect Dis 2003;37:929-32
32. Chibo D, Birch C. Analysis of human coronavirus 229E spike and nucleoprotein
genes demonstrates genetic drift between chronologically distinct strains. J Gen Virol
2006;87:1203-8
33. Yu CH, Liu le T, Liu S, et al. [Enhanced-real time PCR: A highly sensitive method
for SARS-coronavirus detection.]. Beijing Da Xue Xue Bao 2006;38:211-3
34. Tan YJ, Lim SG and Hong W. Understanding the accessory viral proteins unique
to the severe acute respiratory syndrome (SARS) coronavirus. Antiviral Res
2006;72:78-88
35. Massa EM, Farias RN. Effect of auto-oxidized phospholipids on oxidative enzyme
assays based on tetrazolium salt reduction. Biochim Biophys Acta 1983;746:209-15
36. Nomura R, Kiyota A, Suzaki E, et al. Human coronavirus 229E binds to CD13 in
rafts and enters the cell through caveolae. J Virol 2004;78:8701-8
37. Riva DA, de Molina MC, Rocchetta I, Gerhardt E, Coulombie FC and Mersich SE.
Oxidative stress in vero cells infected with vesicular stomatitis virus. Intervirology
2006;49:294-8
38. Piccoli C, Scrima R, D'
Aprile A, et al. Mitochondrial dysfunction in hepatitis C
virus infection. Biochim Biophys Acta 2006;1757:1429-37
39. Wang T, Weinman SA. Causes and consequences of mitochondrial reactive
oxygen species generation in hepatitis C. J Gastroenterol Hepatol 2006;21 Suppl
3:S34-7
40. Sezer S, Tutal E, Aldemir D, et al. Hepatitis C infection in hemodialysis patients:
Protective against oxidative stress? Transplant Proc 2006;38:406-10
41. Ryan-Harshman M, Aldoori W. The relevance of selenium to immunity, cancer,
and infectious/inflammatory diseases. Can J Diet Pract Res 2005;66:98-102
42. Wentworth DE, Tresnan DB, Turner BC, et al. Cells of human aminopeptidase N
(CD13) transgenic mice are infected by human coronavirus-229E in vitro, but not in
vivo. Virology 2005;335:185-97
43. Hasnain SE, Begum R, Ramaiah KV, et al. Host-pathogen interactions during
apoptosis. J Biosci 2003;28:349-58
44. Kaimul Ahsan M, Nakamura H, Tanito M, Yamada K, Utsumi H and Yodoi J.
25
Thioredoxin-1 suppresses lung injury and apoptosis induced by diesel exhaust
particles (DEP) by scavenging reactive oxygen species and by inhibiting
DEP-induced downregulation of Akt. Free Radic Biol Med 2005;39:1549-59
45. Liu T, Castro S, Brasier AR, Jamaluddin M, Garofalo RP and Casola A. Reactive
oxygen species mediate virus-induced STAT activation: role of tyrosine phosphatases.
J Biol Chem 2004;279:2461-9
46. Waris G, Livolsi A, Imbert V, Peyron JF and Siddiqui A. Hepatitis C virus NS5A
and subgenomic replicon activate NF-kappaB via tyrosine phosphorylation of
IkappaBalpha and its degradation by calpain protease. J Biol Chem
2003;278:40778-87
47. Agostini M, Di Marco B, Nocentini G and Delfino DV. Oxidative stress and
apoptosis in immune diseases. Int J Immunopathol Pharmacol 2002;15:157-164
48. Waris G, Turkson J, Hassanein T and Siddiqui A. Hepatitis C virus (HCV)
constitutively activates STAT-3 via oxidative stress: role of STAT-3 in HCV
replication. J Virol 2005;79:1569-80
49. Tse HM, Milton MJ, Schreiner S, Profozich JL, Trucco M and Piganelli JD.
Disruption of innate-mediated proinflammatory cytokine and reactive oxygen species
third signal leads to antigen-specific hyporesponsiveness. J Immunol
2007;178:908-17
50. Wu Y, Cui J, Bao X, et al. Triptolide attenuates oxidative stress, NF-kappaB
activation and multiple cytokine gene expression in murine peritoneal macrophage.
Int J Mol Med 2006;17:141-50
51. Rydkina E, Sahni SK, Santucci LA, Turpin LC, Baggs RB and Silverman DJ.
Selective modulation of antioxidant enzyme activities in host tissues during Rickettsia
conorii infection. Microb Pathog 2004;36:293-301
52. Biewenga G, de Jong J and Bast A. Lipoic acid favors thiolsulfinate formation
after hypochlorous acid scavenging: a study with lipoic acid derivatives. Arch
Biochem Biophys 1994;312:114-20
53. Tseng CP, Huang CL, Huang CH, et al. Disabled-2 small interfering RNA
modulates cellular adhesive function and MAPK activity during megakaryocytic
differentiation of K562 cells. FEBS Lett 2003;541:21-7
54. Huang CL, Cheng JC, Liao CH, et al. Disabled-2 is a negative regulator of
integrin alpha(IIb)beta(3)-mediated fibrinogen adhesion and cell signaling. J Biol
Chem 2004;279:42279-89
55. Kuo L, Masters PS. The small envelope protein E is not essential for murine
coronavirus replication. J Virol 2003;77:4597-608
56. Chiu DT, Liu TZ. Free Radical and Oxidative Damage in Human Blood Cells. J
Biomed Sci 1997;4:256-259
26
57. Lachance C, Arbour N, Cashman NR and Talbot PJ. Involvement of
aminopeptidase N (CD13) in infection of human neural cells by human coronavirus
229E. J Virol 1998;72:6511-9
27
Table 1. Increased viral gene (nucleocapsid) expression in G6PD-deficient fibroblasts
(HFF1) and G6PD-knockdown cells (A549-5.8, A549-5.18 and A549-5.20) as
compared to normal fibroblasts (HFF3) and vector-only controls (A549-5S-5)
Post-infection /Viral gene expression (Fold)
Cell
HFF3
2h
4h
6h
1
1.06±0.85
6.34±0.81
8h
10 h
47.01±6.85
*
155.42±43.44
*
1601.27±349.69*
HFF1
1
1.56±0.06
28.84±3.27
A549-5S-5
1
3.06±0.54
9.66±3.09
A549-5.8
1
13.71±4.56
68.29±7.17* 3586.70±642.819*
N. D.
A549-5.18
1
11.82±5.45
59.83±7.19* 3315.55±210.65*
N. D.
A549-5.20
1
9.16±2.45 258.01±74.29* 5300.41±313.08*
N. D.
467.88±89.41
410.94±49.19
N. D.
Data are the means ± SEM, n=4. Number at 4, 6, 8 and 10 h post-infection were
normalized to that at 2 h post-infection.
* p <.05, G6PD-deficient or knockdown cells vs their control cells at the same
post-infection hour.
N. D. not determined.
28
Table 2. NADPH/NADP+ ratio and intracellular GSH in G6PD-deficient fibroblasts,
G6PD-knockdown epithelial cells, and their control cells with or without viral
infection.
[NADPH]/[NADP+]
Cells
HFF3
(normal fibroblast)
1.32 ± 0.32
GSH at basal
condition
(µmole/g of protein)
35.73 ± 1.99
HFF1
(G6PD-deficient)
0.59 ± 0.13*
27.97 ± 2.17*
N.D.
2.63 ± 0.19
85.68 ± 2.84
66.26 ± 0.86
2.09 ± 0.37*
70.71 ± 3.84*
49.50 ± 1.53*
A549-5S-5
(vector only control)
A549-5.8
(G6PD-knockdown)
GSH at 48h post-viral
infection (µmole/g of
protein)
N.D.
Pyridine nucleotide expressed as NADPH/NADP ratio and total intracellular GSH
amount in cells measured by HPLC. Values are means ± SD, n = 5.
* Significantly different from their control and p <.05.
N. D. not determined.
29
Figure Legends
Fig. 1 Increased cell death in G6PD-deficient fibroblasts following HCoV 229E
infection. Different M.O.I. of HCoV 229E was added to the same passage of
fibroblast cells (PDL 12) and after 48 h (B) and 72 h (A and C) post-infection the cell
viability was determined by MTT assay. All the cell viability was determined by the
absorbance of MTT assay and expressed as percent of the respective HCoV
229E-infected nonexposed control. Data are the means ± SEM, n=4. *p <.05, HFF1
(G6PD-deficient fibroblasts) vs HFF3 (normal fibroblasts) at the same virus titer.
Fig. 2 Increased cell death in G6PD-knockdown A549 epithelial cells following
HCoV 229E infection. The indicated A549 vector and G6PD-knockdown cells were
harvested for G6PD activity assay (A) and western blot of G6PD protein (B). G6PD
activity was given in IU/mg of protein in cell lysate. Cell viability of
G6PD-knockdown A549 and their control with HCoV 229E virus infection at
different M.O.I. for 24 (C), 48 (D) & 72h (E) was shown. Data are the means ± SEM,
n=4. *p <.05; **p <.01, vector only A549-5S-5 vs G6PD-knockdown A549-5.8,
A549-5.18 or A549-5.20 epithelial cells.
Fig. 3 Cell surface CD13 receptor expression in G6PD-deficient and normal
30
fibroblasts, as well as in G6PD-knockdown epithelial A549 and their vector only
control. The amount of surface receptor CD13 of G6PD-deficient fibroblasts (HFF1),
normal fibroblasts (HFF3), G6PD-knockdown epithelial cell line (A549-5.8,
A549-5.18 & A549-5.20) and their control cells (A549-5S-5) was determined by flow
cytometry (A and C), and by western blot (B and D) as described in Experimental
procedures.
Fig. 4 Elevated viral particle production in G6PD-deficient cells as indicated by
plaque assay. 0.1 M.O.I. of viruses were used for infection and plaque assay was
applied for measurement of virus titer. (A) Viral particle production as visualized by
plaque formation was higher in G6PD-deficient fibroblasts (HFF1) at 24 h
post-infection comparing to normal fibroblasts (HFF3). (B) Virus production was
found to be higher in HFF1 than in HFF3, especially at 24h post-infection. (C)
Similar
data
were
found
that
viral
particle
production
was
higher
in
G6PD-knockdown A549 (A549-5.8, A549-5.18 and A549-5.20) than in their control
(A549-5S-5). Data are the means ± SEM, n=4. *p <.05; **p <.01, HFF1 vs HFF3,
vector only A549-5S-5 vs G6PD-knockdown A549-5.8 or A549-5.18 or A549-5.20
epithelial cells at 0.1 M.O.I. of HCoV 229E.
31
Fig. 5 Amelioration of virus-induced cell death and viral gene expression by
ectopic expression of G6PD. HFF1 cells were infected with control (LEIN), or
G6PD-expressing retroviruses (LGIN & LKGIN). Expression of G6PD activity by
activity assay (A), CD13 and G6PD protein (B) by western blot are shown. (C) Cell
viability of LEIN, LGIN & LKGIN after infection with HCoV 229E at different
M.O.I. for 72h was shown. (D) After 8h post-infection viral gene expression
(nucleocapsid expression) as determined by Q-PCR is significantly decreasing in
G6PD over-expressed cells (LGIN & LKGIN) comparing to their control (LEIN).
Data are the means ± SEM, n=4. *p <.05; **p<.01, LGIN or LKGIN vs LEIN
fibroblasts.
Fig. 6 ROS production of G6PD-knockdown epithelial cells (A549-5.8) and
control cells (A549-5S-5) in basal condition and after virus-infection. A549 cells
were loaded with 20 µM DCF-DA for 30 min after exposure to 0 (basal condition) or
0.1 M.O.I. of HCoV 229E after 48 h post-infection. Fluorescence was measured using
Flow cytometry.
Fig. 7 Protective effect of antioxidants against virus infection at 48 h
post-infection in G6PD-knockdown cells pretreated with antioxidant 5 h before
32
viral infection. (A) A consistent protective effect by antioxidant lipoic acid (LA)
against virus-induced cell death was observed. (B) ROS production following virus
infection was attenuated by antioxidant (0.1 mM LA) pre-treatment. (C) Viral gene
(nuclecapsid) expression of antioxidant-pretreatment cells and control cells was
determined by Q-PCR after 2, 4, 6, 8 and 10 h post-infection with HCoV 229E
infection.
33
A
Cell viability
(% of uninfected control)
100
H FF 1 P D L 1 2 (7 2 h p .i.)
H FF 3 P D L 1 2 (7 2 h p .i.)
80
60
40
20
0 .0
0 .5
1.0
1 .5
2 .0
M .O .I.
Cell viability
(% of uninfected control)
100
*
C
*
*
80
60
40
20
100
Cell viability
(% of uninfected control)
B
HFF1 PDL12 (48 h p.i.)
HFF3 PDL12 (48 h p.i.)
80
*
*
*
60
40
20
HFF1 PDL12 (72 h p.i.)
HFF3 PDL12 (72 h p.i.)
0
0.00 0.02 0.04 0.06 0.08 0.10 0.12
0
0.00 0.02 0.04 0.06 0.08 0.10 0.12
M.O.I.
M.O.I.
Fig. 1
34
A
B
G6PD activity (IU/mg)
2.5
2.0
1.5
A549
A549
-5S-5
-5.8
A549 A549
-5.18
-5.20
G6PD
1.0
0.5
0.0
Actin
**
**
**
A549-5S-5 A549-5.8 A59-5.18 A549-5.20
Cell
C
D
24 h post-infection
*
*
100
*
80
60
40
20
A549-5S-5
A549-5.8
A549-5.18
A549-5.20
0
0.00 0.02 0.04 0.06 0.08 0.10 0.12
M.O.I.
E
Cell viability
(% of uninfected control)
100
A549-5S-5
A549-5.8
A549-5.18
A549-5.20
60
40
**
**
48 h post-infection
80
60
**
**
**
20
0
0.00 0.02 0.04 0.06 0.08 0.10 0.12
M.O.I.
Fig. 2
35
A549-5S-5
A549-5.8
A549-5.18
A549-5.20
**
40
20
0
0.00 0.02 0.04 0.06 0.08 0.10 0.12
M.O.I.
72 h post-infection
80
Cell viability
(% of uninfected control)
Cell viability
(% of uninfected control)
100
A
B
HFF1
(G6PD-deficient)
(PDL12)
PDL 12
HFF1 HFF3
CD13
Actin
HFF3
(control)
(PDL12)
C A549-5S-5
(control)
A549-5.8
(G6PD knockdown)
D
CD13
Actin
A549-5.18
(G6PD knockdown)
A549-5.20
(G6PD knockdown)
Fig. 3
36
A549
A549
-5S-5
-5.8
A549 A549
-5.18
-5.20
A
B
24 h postinfection
48 h postinfection
35
Plaque formation unit
(PFU*105/ml)
HFF1
HFF3
30
25
*
20
15
10
5
0
HFF1
HFF3
Cell
C
Plaque formation unit
(PFU*107/ml)
60
50
24 h postinfection
48 h postinfection
40
30
**
**
**
20
10
0
A549-5S-5 A549-5.8 A549-5.18 A549-5.20
Cell
Fig. 4
37
A
B
G6PD activity (IU/mg)
LEIN LGIN LKGIN
**
1.0
**
0.8
CD13
0.6
G6PD
0.4
Actin
0.2
0.0
LGIN
LKGIN
Cell
C
Cell viability
(% of uninfected control)
100
LEIN PDL40 (72 h p.i.)
LGIN PDL40 (72 h p.i.)
LKGIN PDL40 (72 h p.i.)
80
60
D
*
**
40
7000
Relative viral gene expression
LEIN
**
20
0
0.00 0.02 0.04 0.06 0.08 0.10 0.12
6000
LEIN
LGIN
LKGIN
5000
4000
3000
2000
1000
**
**
**
**
0
0
M.O.I.
2
4
6
8
Time (Post-infection, h)
Fig. 5
38
10
12
A549-5S-5
A549-5.8
Normal
condition
Normal
condition
Virus infection
Virus infection
Fig 6
39
A
B
A549-5S-5
Cell viability
(% of uninfected control)
100
w/o antioxidant
Control
0.01 mM LA
0.1 mM LA
90
with antioxidant
80
70
A549-5.8
60
w/o antioxidant
50
40
with antioxidant
A549-5S-5 A549-5.8 A549-5.18 A549-5.20
Cells
C
Relative viral gene expression
8000
A549-5S-5
A549-5.8
A549-5S-5 with LA pretreatment
A549-5.8 with LA pretreatment
7000
6000
5000
4000
3000
2000
1000
0
0
2
4
6
8
Tim e (Post-infection, hour)
Fig. 7
40
10
12