OsDMC1 Is Not Required for Homologous Pairing in
Rice Meiosis1[OPEN]
Hongjun Wang, Qing Hu, Ding Tang, Xiaofei Liu, Guijie Du, Yi Shen, Yafei Li, and Zhukuan Cheng*
State Key Laboratory of Plant Genomics and Center for Plant Gene Research, Institute of Genetics and
Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China
ORCID IDs: 0000-0002-9702-3000 (H.W.); 0000-0002-3349-0056 (Q.H.).
Meiotic homologous recombination is pivotal to sexual reproduction. DMC1, a conserved recombinase, is involved in directing
single-end invasion between interhomologs during meiotic recombination. In this study, we identified OsDMC1A and
OsDMC1B, two closely related proteins in rice (Oryza sativa) with high sequence similarity to DMC1 proteins from other species.
Analysis of Osdmc1a and Osdmc1b Tos17 insertion mutants indicated that these genes are functionally redundant.
Immunolocalization analysis revealed OsDMC1 foci occurred at leptotene, which disappeared from late pachytene
chromosomes in wild-type meiocytes. According to cytological analyses, homologous pairing is accomplished in the Osdmc1a
Osdmc1b double mutant, but synapsis is seriously disrupted. The reduced number of bivalents and abnormal OsHEI10 foci in
Osdmc1a Osdmc1b establishes an essential role for OsDMC1 in crossover formation. In the absence of OsDMC1, early
recombination events probably occur normally, leading to normal localization of gH2AX, PAIR3, OsMRE11, OsCOM1, and
OsRAD51C. Moreover, OsDMC1 was not detected in pairing-defective mutants, such as pair2, pair3, Oscom1, and Osrad51c,
while it was loaded onto meiotic chromosomes in zep1, Osmer3, Oszip4, and Oshei10. Taken together, these results suggest that
during meiosis, OsDMC1 is dispensable for homologous pairing in rice, which is quite different from the DMC1 homologs
identified so far in other organisms.
Meiosis involves two successive rounds of nuclear
division combined with a single round of DNA replication (Petronczki et al., 2003). To ensure accurate
chromosome segregation, crossovers (COs) must form
between homologous chromosomes during meiosis I in
most eukaryotes. COs result from meiotic homologous
recombination (HR), which is initiated by a doublestrand break (DSB) produced through the catalysis of
conserved SPO11 proteins (Keeney et al., 1997; Youds
and Boulton, 2011). In Saccharomyces cerevisiae and
Schizosaccharomyces pombe, SPO11 proteins are covalently linked to the 59 termini of a DSB and released
together with a short DNA oligonucleotide. This process is mediated by the Mre11/Rad50/Xrs2-Nbs1
(MRX/N) complex and Sae2/Com1 (Neale et al.,
2005; Uanschou et al., 2007; Milman et al., 2009). Then,
1
This work was supported by grants from the National Natural
Science Foundation of China (31230038 and 31360260).
* Address correspondence to [email protected].
The author responsible for distribution of materials integral to the
findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is:
Zhukuan Cheng ([email protected]).
Z.C. and H.W. conceived the original screening and research
plans; Y.S. and Y.L. supervised the experiments; H.W., Q.H., and
G.D. performed most of the experiments; H.W., X.L., and D.T designed the experiments and analyzed the data; H.W. and Q.H. conceived the project and wrote the article with contributions of all the
authors; Z.C. supervised and complemented the writing.
[OPEN]
Articles can be viewed without a subscription.
www.plantphysiol.org/cgi/doi/10.1104/pp.16.00167
230
the MRX/N complex and Exo1 resect the 59 termini to
produce the 39 end of the DSB in yeast (Farah et al.,
2009; Zakharyevich et al., 2010). The 39 end is initially
protected by the replication protein A complex, which
is subsequently released when two strand-exchange
proteins, Radiation sensitive51 (Rad51) and Disrupted
Meiotic cDNA1 (Dmc1), are loaded onto the 39 end in
yeast and human (Fanning et al., 2006; Sung and
Klein, 2006).
Rad51 and Dmc1 are two Escherichia coli RecA homologs in yeast, mouse, and human (Bishop et al., 1992;
Shinohara et al., 1992; Habu et al., 1996). These proteins
catalyze strand exchange, as demonstrated in vitro
(Sung, 1994; Li et al., 1997; Sehorn et al., 2004). In most
eukaryotes that have been investigated, Rad51 is present in both mitotic and meiotic cells, whereas Dmc1 is
found specifically in meiotic cells (Neale and Keeney,
2006; Sung and Klein, 2006). In budding yeast, available
evidence indicates that Rad51 activity is attenuated by
Hed1 to facilitate interhomolog repair directed by
Dmc1 (Tsubouchi and Roeder, 2006). Additionally,
Rad51 and Dmc1 form nucleoprotein filaments on
single-stranded DNA. These proteins then conduct
homology searches and catalyze the formation of homologous joint molecules (JMs). Dmc1 directs JM formation between the interhomolog chromosome, with
Rad51 acting as an accessory factor, suggesting that
Dmc1 is specifically involved in ensuring the generation of COs. However, Rad51 can direct JM formation
between intersister chromosomes in the event that
Dmc1 fails to form JMs between interhomologs. Thus,
Plant PhysiologyÒ, May 2016, Vol. 171, pp. 230–241, www.plantphysiol.org Ó 2016 American Society of Plant Biologists. All Rights Reserved.
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
The Role of OsDMC1 in Meiosis
Rad51 may play an important role in a fail-safe mechanism for JM formation in budding yeast (Cloud
et al., 2012).
In S. cerevisiae, mutations in DMC1 lead to abnormal
synapsis and meiotic arrest (Bishop et al., 1992). In
mouse, dmc12/2 knockouts are sterile due to asynapsis
or nonhomologous synapsis in spermatocytes (Pittman
et al., 1998; Yoshida et al., 1998). Mutation of AtDMC1
results in asynapsis and random chromosome segregation during meiosis I in Arabidopsis thaliana but does
not cause meiotic arrest (Couteau et al., 1999). AtDMC1
promotes interhomolog-biased DSB repair governed by
the axial element protein ASY1 (Sanchez-Moran et al.,
2007). Furthermore, ATR kinase is involved in regulating AtDMC1 accumulation at meiotic DSB sites.
The elimination of ATR allows AtDMC1 to mediate
meiotic DSB repair, even in the absence of AtRAD51
(Kurzbauer et al., 2012).
OsDMC1A and OsDMC1B are two conserved rice
(Oryza sativa) DMC1 genes with highly similar exonic
sequences (Kathiresan et al., 2002). Whether they play
functionally redundant roles in meiosis has not yet been
confirmed. Moreover, their roles in meiosis remain to be
explored. pair2, pair3, Oscom1, or Osrad51c mutants in
rice exhibit serious pairing defects; these mutants are
referred to as asynaptic mutants (Wang et al., 2011; Ji
et al., 2012; Tang et al., 2014). By contrast, zep1, Osmer3,
Oszip4, and Oshei10 do not exhibit defective pairing
(Wang et al., 2009, 2012; Wang et al., 2010; Shen et al.,
2012). Analysis of these mutants has provided clues
about the actual role of rice DMC1 in meiosis.
Here, we characterized OsDMC1A and OsDMC1B
using a reverse genetic approach, demonstrating their
functional redundancy in meiosis. Cytological analysis
revealed serious CO formation defects in the Osdmc1a
Osdmc1b double mutant. However, homologous pairing was probably accomplished in this mutant. The
depletion of OsRAD51C in the Osdmc1a Osdmc1b
background resulted in deficient pairing and nonhomologous associations, suggesting that OsRAD51C is
not entirely epistatic to OsDMC1. Furthermore, a series
of immunolocalization experiments revealed that
OsDMC1 was depleted in pair2, pair3, Oscom1, and
Osrad51c. By contrast, this protein was loaded normally
onto meiotic chromosomes in zep1, Osmer3, Oszip4, and
Oshei10. These results imply that rice DMC1 plays a role
in meiosis, which has yet to be fully elucidated.
RESULTS
and Os11g0146800, were designated OsDMC1A and
OsDMC1B, respectively. Both OsDMC1A and OsDMC1B
contain 344 amino acid residues and share 99% identity in amino acid sequence. These proteins were
collectively designated as OsDMC1 in this study.
Multiple sequence alignment of OsDMC1 with its
orthologs revealed its high evolutionary conservation
in eukaryotes, especially in monocots (Supplemental
Fig. S1).
Two Tos17 insertion lines, NF8016 (Osdmc1a) and
NE1040 (Osdmc1b), were identified from the public
rice insertion line database (Hirochika et al., 1996;
Yamazaki et al., 2001). The insertion site within locus
OsDMC1A was mapped to exon 10 and that of
OsDMC1B to intron 11 (Supplemental Fig. S2). Both
Osdmc1a and Osdmc1b exhibited normal vegetative
growth and fertility (Fig. 1, A–C). To determine
whether these genes are functionally redundant, we
generated an Osdmc1a Osdmc1b double mutant by
crossing homozygous Osdmc1a and Osdmc1b single
mutant plants. The Osdmc1a Osdmc1b plants exhibited
wild-type growth and development but were completely sterile (Fig. 1D). Pollen grains from Osdmc1a,
Osdmc1b, and wild-type plants were round, while those
from Osdmc1a Osdmc1b plants were empty and
shrunken (Fig. 1, E–H). In addition, we calculated the
rate of seed-setting in these lines. Unlike the 91.25%
seed-setting rate in the wild type, 90.16% in Osdmc1a
and 89.67% in Osdmc1b, the seed-setting rate was 0% in
Osdmc1a Osdmc1b. Thus, OsDMC1A and OsDMC1B
may function redundantly in the process of rice
reproduction.
Real-time RT-PCR revealed that the expression of
OsDMC1 was highest in young panicles of the wild
type. However, OsDMC1 expression was extremely
low in leaves and roots. Moreover, its expression level
was near zero in young panicles of Osdmc1a Osdmc1b,
suggesting that the aberrant OsDMC1 transcripts were
degraded in the double mutant (Supplemental Fig. S3A).
An antibody against OsDMC1 was raised in mouse using the conserved sequence between OsDMC1A and
OsDMC1B. To detect the specificity of anti-OsDMC1,
we performed a western-blot assay. The OsDMC1 antibody could clearly recognize the recombinant protein
OsDMC1B with the His tag and OsDMC1 protein in
crude extracts from the young panicles of the wild type,
Osdmc1a, and Osdmc1b, but no signal was detected in
the protein sample of Osdmc1a Osdmc1b (Supplemental
Fig. S3B). Thus, anti-OsDMC1 could specifically recognize the native OsDMC1.
Characterization of OsDMC1A and OsDMC1B
We used the Arabidopsis DMC1 amino acid sequence as a query in a BLAST search against the rice
proteome (Klimyuk and Jones, 1997), yielding a list of
53 proteins, which were ranked according to their
BLAST scores. Two of these proteins share the highest
similarity with AtDMC1 according to BLAST analysis.
These proteins, which are encoded by Os12g0143800
OsDMC1 Is Loaded onto Chromosomes during Early
Prophase I
To define the spatial and temporal distribution of
OsDMC1 during meiosis in rice, we conducted a dual
immunolocalization assay in wild-type meiocytes using specific polyclonal antibodies against OsREC8
and OsDMC1 individually. OsREC8, a conserved
Plant Physiol. Vol. 171, 2016
231
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
Wang et al.
Figure 1. Phenotypic characterization
of the Osdmc1a OsDMC1B, OsDMC1A
Osdmc1b, and Osdmc1a Osdmc1b
mutants. A to D, Comparison of wildtype, Osdmc1a OsDMC1B, OsDMC1A
Osdmc1b, and Osdmc1a Osdmc1b
mutant plants. E to H, Pollen grains
stained with 1% I2-KI solution in wildtype, Osdmc1a OsDMC1B, OsDMC1A
Osdmc1b, and Osdmc1a Osdmc1b
plants. Bars = 50 mm.
meiosis-specific component of the cohesion complex,
can be used as a marker for meiotic chromosomes (Shao
et al., 2011). In the wild type, OsDMC1 signals initially
appeared as punctate foci on chromosomes at leptotene
(Fig. 2A), gradually appearing as dense dot-like signals
on zygotene chromosomes (Fig. 2B). During early
pachytene, the signals began to attenuate (Fig. 2C).
They rapidly diminished at pachytene (Fig. 2D) and
were absent from late pachytene chromosome axes (Fig.
2E). At zygotene, the localization of OsDMC1 in
Osdmc1a and Osdmc1b meiocytes was similar to that of
the wild type (Supplemental Fig. S4, A and B). Furthermore, no OsDMC1 signals were detected in Osdmc1a
Osdmc1b meiocytes (Supplemental Fig. S4C), indicating
that Osdmc1a Osdmc1b is a null mutant.
The Meiotic Process Is Disturbed in Osdmc1a
Osdmc1b Meiocytes
To clarify the cause of sterility in Osdmc1a Osdmc1b,
we investigated the chromosome behavior in wild-type
and Osdmc1a Osdmc1b meiocytes via 49,6-diaminophenylindole (DAPI) staining. In the wild type, meiotic chromosomes appeared as thin threads at leptotene
(Supplemental Fig. S5A). The chromosomes further
condensed and initiated homologous pairing and synapsis during zygotene (Supplemental Fig. S5B). At
pachytene, the chromosomes appeared as thick
threads when the synaptonemal complex (SC) was
fully assembled between homologous chromosomes
(Supplemental Fig. S5C). Paired chromosomes underwent further condensation at diakinesis; 12 bivalents
connected by chiasmata were observed at this stage
(Supplemental Fig. S5D). At metaphase I, 12 extremely
condensed bivalents aligned in an orderly manner on
the equatorial plate (Supplemental Fig. S5E). During
anaphase I, homologous chromosomes separated and
migrated to opposite poles of the cell (Supplemental
Fig. S5F). Regular dyads then formed at telophase I
(Supplemental Fig. S5G). In the second meiotic division, sister chromatids separated, ultimately giving rise
to tetrad microspores (Supplemental Fig. S5, H and I).
In Osdmc1a and Osdmc1b, a similar meiotic process was
observed, and 12 bivalents could be observed from diakinesis to metaphase I (Supplemental Fig. S6, A–D).
In Osdmc1a Osdmc1b, meiotic chromosomes behaved
normally from leptotene to zygotene (Fig. 3, A and B).
Almost all homologous chromosomes became aligned
well (indicated with arrows), but some regions of the
chromosomes could not complete synapsis at pachytene. The empty or bubble-like regions (indicated arrowheads) were observed between each pair of aligned
chromosomes (Fig. 3C). Unlike the wild type, which
formed 12 bivalents, ;24 condensed univalent chromosomes were scattered in the mutant nuclei at
diakinesis (Fig. 3D). Subsequently, the univalent chromosomes unequally separated to opposite poles of the
cell at late metaphase I. Meanwhile, approximately two
bivalents aligned to the equatorial plate in some cells
(Fig. 3E). The bivalents were divided into two poles at
anaphase I (Fig. 3F). At telophase I, unbalanced dyads
formed (Fig. 3G). During the second division, different
numbers of chromatids were aligned to the two metaphase II equatorial plates (Fig. 3H). Abnormal tetrads
with microspores of different sizes were detected after
meiosis II (Fig. 3I). These results suggest that meiotic
defects lead to the sterility of Osdmc1a Osdmc1b.
OsDMC1 Is Not Required for Meiotic DSB Formation
H2AX is an isoform of histone H2A. Upon DSB formation, phosphorylated H2AX (gH2AX) rapidly accumulates around the break site, making gH2AX a useful
cytological marker for detecting DSB formation in most
eukaryotes (Dickey et al., 2009). Therefore, we conducted dual immunolocalization in wild-type and
232
Plant Physiol. Vol. 171, 2016
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
The Role of OsDMC1 in Meiosis
appear as dense, dot-like signals on chromosomes during early prophase I (Ji et al., 2012, 2013). We therefore
conducted immunolocalization analyses of Osdmc1a
Osdmc1b meiocytes using OsCOM1 and OsMRE11 polyclonal antibodies. Both of these proteins were loaded
onto chromosomes normally during early meiosis (Fig.
4, A and B), indicating that OsCOM1 and OsMRE11 act
independently of OsDMC1 during early recombination. Additionally, normal dense dot-like OsRAD51C
signals appeared on chromosome axes in Osdmc1a
Osdmc1b during zygotene (Fig. 4C), suggesting that
DSB end resection can occur in Osdmc1a Osdmc1b.
OsDMC1 Is Vital to Synapsis, But Not to
Homologous Pairing
Figure 2. Dual immunolocalization of OsREC8 and OsDMC1 during
prophase I in wild-type meiocytes. A, Leptotene; B, zygotene; C, early
pachytene; D, pachytene; E, late pachytene. OsREC8 signals (red)
indicate meiotic chromosome axes. OsDMC1 signals are in green.
Bars = 5 mm.
Osdmc1a Osdmc1b meiocytes using polyclonal antibodies against gH2AX and OsREC8. In wild-type
meiocytes, gH2AX signals appeared as dots and
patchy areas at zygotene (Supplemental Fig. S7A). In
Osdmc1a Osdmc1b, the pattern of gH2AX signals was
similar to that of the wild type at a similar stage
(Supplemental Fig. S7B). Additionally, to determine
whether the DSB number was affected in Osdmc1a
Osdmc1b, the intensity of gH2AX signals was detected
using IPLab4.0 in wild-type and mutant meiocytes
individually. Compared with the wild type, no obvious difference was found (Supplemental Fig. S8),
suggesting that DSB formation may occur as normal
in the mutant.
DSB End Resection May Occur in Osdmc1a Osdmc1b
Since DSBs formed in Osdmc1a Osdmc1b, we next
explored whether DSB end processing was impaired in
this mutant. OsCOM1 and OsMRE11 are essential for
DSB end resection in rice. OsCOM1 and OsMRE11 foci
We also monitored the assembly status of the SC in
Osdmc1a Osdmc1b meiocytes via immunolocalization
studies using antibodies against PAIR3, PAIR2, and
ZEP1. PAIR3, an axis-associated protein, is essential for
homologous pairing (Wang et al., 2010). In Osdmc1a
Osdmc1b, the localization of PAIR3 was not affected
from leptotene to pachytene, implying its normal
installation on chromosome axes independent of
OsDMC1 (Fig. 4D). In the wild type, PAIR2 staining
showed punctate signals at leptotene. PAIR2 proteins
became increasingly depleted from the synaptic chromosomes during zygotene and completely disappeared
from chromosomes after the synapsis was completed at
pachytene (Wang et al., 2011). ZEP1 can be used to
monitor synapsis in rice. The signal of ZEP1 was first
detected as punctate foci at leptotene. Then, ZEP1
gradually elongated and formed short linear signals
during zygotene. At pachytene, elongated ZEP1 signals
appear along paired homologous chromosomes (Wang
et al., 2010). Similar to that in the wild type, PAIR2 and
ZEP1 proteins were normally loaded on leptotene
chromosomes in Osdmc1a Osdmc1b (Fig. 5A). However,
during zygotene to pachytene, their localization
appeared abnormal. ZEP1 appeared as only a few short
lines on chromosomes, and PAIR2 was retained as a
linear signal. Upon careful examination, we found that
the PAIR2 signals disappeared on regions where ZEP1
was loaded (Fig. 5, B and C, indicated with arrows).
Taken together, these results indicate that synapsis is
disrupted due to the aberrant functioning of OsDMC1.
The bouquet stage occurs during prophase I. At this
stage, telomeres attach to the inner nuclear envelope
and form a cluster. The bouquet is thought to facilitate
homologous pairing (Harper et al., 2004; Zickler, 2006).
To monitor bouquet formation during meiocytes, we
performed fluorescence in situ hybridization (FISH)
analysis in wild-type and Osdmc1a Osdmc1b meiocytes
using pAtT4 as a probe, which recognizes telomerespecific sequences (Zhang et al., 2005). In both wildtype and Osdmc1a Osdmc1b meiocytes, telomeres were
clustered within a confined region at early zygotene
(Fig. 6, A and B), suggesting that bouquet formation
occurs independently of OsDMC1.
Plant Physiol. Vol. 171, 2016
233
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
Wang et al.
Figure 3. Meiosis in the Osdmc1a Osdmc1b
double mutant. A, Leptotene; B, zygotene; C,
pachytene. Some fine alignment regions are
marked with arrows. The poor alignment regions
are indicated with arrowheads. D, Diakinesis; E,
metaphase I; F, anaphase I; G, telophase I; H,
metaphase II; I, telophase II. Chromosomes were
stained with DAPI. Bars = 5 mm.
To determine chromosome pairing behavior in
Osdmc1a Osdmc1b meiocytes, we first performed FISH
analysis on both wild-type and mutant meiocytes using
5s rDNA as a probe; 5s rDNA is a tandemly repetitive
sequence that only exists on the short arm of chromosome 11 close to the centromere in rice. During early
pachytene, two side-by-side 5S rDNA signal were observed in both the wild type and Osdmc1a Osdmc1b,
indicating that homologous pairing might occur at this
stage (Fig. 6, C and D). At metaphase I, two obvious 5S
rDNA signals were detected on one pair of homologous
chromosomes in the wild type (Fig. 6I). By contrast,
there were a few bivalents in most Osdmc1a Osdmc1b
meiocytes, ;9.76% (n = 41) of which contained 5S
rDNA signals on one bivalent at the corresponding
stages (Fig. 6J). Thus, bivalents might occur between
homologs in Osdmc1a Osdmc1b.
The pairing status of chromosomes at early pachytene was further investigated by the chromosomespecific FISH with four BAC clone probes, a0018B15,
a0083M01, a0088I16, and a0002E05. These four probes
all locate on chromosome 11, of which a0018B15 and
a0088I16 are on the short arm and are detected as green
FISH signals; a0083M01 and a0002E05 are on the long
arm and are detected as red FISH signals. In wild-type
meiocytes (n = 25), we observed two adjacent green or
red signals at early pachytene, indicating the perfect
pairing loci of the chromosome arm (Fig. 6, E and G).
Similar FISH signals were also observed in most
Osdmc1a Osdmc1b meiocytes (n = 53) during the corresponding stage (Fig. 6, F and H). We found that nearly
92.45% of the mutant meiocytes exhibited two closely
adjacent green signals when using a0018B15 as a probe
of the short arm. Meanwhile, about 88.68% of the mutant cells presented two side-by-side red signals when
using a0083M01 as a probe of the long arm (Fig. 6F).
Similar results were also obtained using other two BAC
probes a0088I16 and a0002E05 (Fig. 6H). Therefore, the
homolog pairing is probably achieved independently of
OsDMC1.
Crossover Formation Is Basically Suppressed in
Osdmc1a Osdmc1b
COs, which are necessary for the formation of stable
bivalents, appear as cytological chiasmata at diakinesis.
Chiasmata exhibit the same molecular events as COs
and can be used to count the number of COs per cell
(Jones, 1984). From diakinesis to metaphase I, the main
cytological defect in Osdmc1a Osdmc1b was the presence of abundant univalents. However, a few bivalents
were occasionally observed during metaphase I (Fig.
3E). In addition, we calculated the rate of bivalent
generating in Osdmc1a Osdmc1b. Unlike the 100% bivalent rate in the wild type (n = 146), about 60.15% of observed Osdmc1a Osdmc1b meiocytes (n = 133) produced
one to two bivalents at metaphase I (Supplemental Fig.
S9). The mean number of bivalents was highly reduced
to 1.83 per cell (n = 133) in Osdmc1a Osdmc1b compared
with 12 per cell in the wild type. These results imply
that OsDMC1 is necessary for the formation of most
crossovers.
OsMER3, OsZIP4, and OsHEI10 are ZMM proteins in
rice whose defects lead to dramatically reduced numbers of COs. In wild-type meiocytes, OsMER3, OsZIP4,
234
Plant Physiol. Vol. 171, 2016
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
The Role of OsDMC1 in Meiosis
signals ultimately restricted to prominent foci specifically localized to chiasma sites at late pachytene
(Wang et al., 2009, 2012; Shen et al., 2012). In this
study, we carried out immunolocalization studies in
Osdmc1a Osdmc1b using antibodies against OsMER3,
OsZIP4, and OsHEI10. We did not detect obvious
differences in the localizations of OsMER3, OsZIP4,
and OsHEI10 at zygotene (Fig. 7, A–C). As meiosis
progressed, the distribution of OsHEI10 began to
change. At late pachytene, the number of prominent,
dot-like signals was dramatically reduced in Osdmc1a
Osdmc1b compared with the wild type (mean, 23.79;
n = 30), and most OsHEI10 signals appeared as
sparser foci at this stage (Fig. 7D; mean, 4.87; n = 21).
Thus, the aberrant functioning of OsHEI10 might
cause the dramatic reduction in the number of COs in
Osdmc1a Osdmc1b.
The Loading of OsDMC1 May Depend on Factors
Necessary for Homologous Pairing
Figure 4. Immunolocalization of several meiotic proteins in Osdmc1a
Osdmc1b meiocytes. A to C, Immunolocalization of OsCOM1 (A),
OsMRE11 (B), and OsRAD51C (C) at zygotene. D, Immunolocalization
of PAIR3 at pachytene. OsREC8 signals are in red. All the other protein
immunosignals are in green. Bars = 5 mm.
and OsHEI10 produce dense, dot-like signals at early
zygotene. The number of OsMER3 and OsZIP4 foci
rapidly decreases at late zygotene, with OsHEI10
To further explore the role of OsDMC1 in meiosis, we
performed immunolocalization studies (using a specific
OsDMC1 polyclonal antibody) in pair2, pair3, Oscom1,
OsMRE11RNAi, Osrad51c, zep1, Osmer3, Oszip4, and
Oshei10. pair2, pair3, Oscom1, OsMRE11 RNAi, and
Osrad51c exhibit defects in homologous pairing (Wang
et al., 2011; Ji et al., 2012, 2013; Tang et al., 2014). zep1,
Osmer3, Oszip4, and Oshei10 display normal homologous pairing (Wang et al., 2009, 2012; Wang et al., 2010;
Shen et al., 2012). OsDMC1 was never detected on
zygotene chromosomes in pair2, pair3, Oscom1,
OsMRE11RNAi, and Osrad51c (Fig. 8, A–E), while its localization was not affected at zygotene in zep1, Osmer3,
Oszip4, and Oshei10 (Fig. 8, F–I). These results suggest
Figure 5. Synapsis is disturbed in Osdmc1a
Osdmc1b. A to C, Immunolocalization of
PAIR3 (blue), PAIR2 (red), and ZEP1 (green)
in Osdmc1a Osdmc1b meiocytes at leptotene (A), zygotene (B), and pachytene (C).
Arrows indicate regions where PAIR2 disappeared as ZEP1 is being loaded. Bars =
5 mm.
Plant Physiol. Vol. 171, 2016
235
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
Wang et al.
that the function of OsDMC1 depends on meiotic
pairing factors.
OsRAD51C is required for homologous pairing
and meiotic DSB repair in rice (Tang et al., 2014). The
triple mutant Osdmc1a Osdmc1b Osrad51c was generated by introducing Osdmc1a Osdmc1b into the
Osrad51c background. In the triple mutant, the meiotic defects of Osdmc1a Osdmc1b were greatly exaggerated by the presence of Osrad51c, leading to the
serious pairing defect at pachytene (Fig. 9, A and E),
irregularly shaped univalents at diakinesis (Fig. 9, B
and F), and chromosome entanglements at metaphase I (Fig. 9, C and G). Compared with Osrad51c,
Osdmc1a Osdmc1b Osrad51c contained chromosome
bridges with fewer fragments at anaphase I (Fig. 9, D
and H). FISH analysis with the 5s rDNA probe was
also carried out in Osdmc1a Osdmc1b Osrad51c. At
pachytene, two separated 5s rDNA signals were observed (Supplemental Fig. S10A). At metaphase I,
two signals were still separated and observed locating on chromosome entanglements (Supplemental
Fig. S10B). In addition, we also determined the intensity of gH2AX signals in the triple mutant. Compared with the wild type, no obvious difference was
detected at zygotene in the triple mutant (Supplemental
Fig. S8). Taken together, the failure pairing and serious nonhomologous associations occurred, while
the DSB formation was not impaired in the triple
mutant.
DISCUSSION
OsDMC1 Is Not Required for Homologous Pairing, But It
Functions in SC Assembly
Figure 6. OsDMC1 is not essential for bouquet formation and homologous pairing. A and B, Bouquet formation analysis using FISH
with the telomere-specific pAtT4 probe in the wild type (A) and
Osdmc1a Osdmc1b (B). C to H, Analysis of the chromosome pairing
by FISH using probes 5S rDNA, a0018B15, a0083M01, a0088I16,
and a0002E05. BAC clones at early pachytene in the wild type (C, E,
and G) and Osdmc1a Osdmc1b (D, F, and H). I and J, Analysis of the
bivalent formation at metaphase I by FISH using the 5S rDNA probe in
the wild type (I) and Osdmc1a Osdmc1b (J). The inset in (J) shows the
magnified image of the framed region. Chromosomes (blue) were
stained with DAPI. pAtT4, 5S rDNA, a0083M01, and a0002E05 FISH
signals are in red. a0018B15 and a0088I16 FISH signals are in green.
Bars = 5 mm.
In this study, we determined that OsDMC1A and
OsDMC1B are functionally redundant during meiosis. It is generally believed that bouquet formation is
necessary for homologous pairing (Scherthan, 2001).
In Osdmc1a Osdmc1b, bouquet formation was similar
to that of the wild type, implying that early chromosome alignment does not depend on OsDMC1.
Unlike Atdmc1 (Pradillo et al., 2012; Da Ines et al.,
2012), mutation of OsDMC1 did not lead to serious
pairing defects. In the earlier work, the RNAi to
OsDMC1 led to homolog pairing defect (Deng and
Wang, 2007). This defect observed in OsDMC1-RNAi
lines might be caused by nonspecific knockdown of
other genes.
In many eukaryotes, recombination-dependent homologous recognition is an important component of
the homologous pairing mechanism. This process
relies on DNA/DNA interchromosomal interactions
that occur as a result of the initial steps in Spo11induced DSB repair. After the 59 DNA ends of DSBs
are resected, the resulting 39 single-stranded DNA can
invade the intact DNA duplex of a homologous chromosome, which is catalyzed by Rad51 and Dmc1
recombinases, generating intermediates capable of
236
Plant Physiol. Vol. 171, 2016
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
The Role of OsDMC1 in Meiosis
These results suggest that OsDMC1 functions in chromosome synapsis in rice.
Functional Divergence in RAD51-Like Genes in Rice
Figure 7. Immunolocalization of several ZMM proteins in Osdmc1a
Osdmc1b meiocytes. A, OsMER3 (green) in a zygotene meiocyte. B,
OsZIP4 (green) in a zygotene meiocyte. C, OsHEI10 (green) in a zygotene meiocyte. D, OsHEI10 (green) in a late pachytene meiocyte.
PAIR2 signals (red) indicate meiotic chromosome axes. Bars = 5 mm.
assessing homology (Naranjo, 2012). Eukaryotic
Rad51 and Dmc1 can stabilize strand exchange intermediates in precise three-nucleotide steps. Triplet
recognition strictly depends on correct Watson-Crick
pairing. Rad51 and Dmc1 can both step over mismatches, but only Dmc1 can stabilize mismatched
triplets (Lee et al., 2015). Programmed DSB formation
and its end resection probably occur in Osdmc1a
Osdmc1b, as gH2AX, OsCOM1, and OsMRE11 were
regularly detected at early prophase I. Introducing
Osrad51c into the Osdmc1a Osdmc1b background led to
serious pairing defects, suggesting that OsRAD51C
plays a role in recombination-dependent pairing processes. Taken together, we suspect that other RecA
proteins, including OsRAD51C, may serve as directors
of homology searches to promote pairing in rice, while
OsDMC1 probably helps stabilize the single-end
invasion process.
OsDMC1 is not required for the recombinationdependent pairing process, but it does play a role in
synapsis. PAIR3, an axial element-associated protein of
the SC, is required for synapsis in rice (Wang et al.,
2011). In Osdmc1a Osdmc1b, PAIR3 signals were normal
during early meiosis I. However, signals from ZEP1, a
transverse filament protein of the SC, did not coincide
with chromosomes at pachytene in Osdmc1a Osdmc1b.
In addition to RAD51 and DMC1, rice possesses five
RAD51 paralogs, including OsRAD51B, OsRAD51C,
OsRAD51D, OsXRCC2, and OsXRCC3 (Lin et al.,
2006). Of these, mutations in OsRAD51C, OsRAD51D,
or OsXRCC3 disturb homologous pairing, causing the
production of large chromosome fragments at metaphase I. However, the roles of OsRAD51B and
OsXRCC2 in rice during meiosis have not been demonstrated (Byun and Kim, 2014; Tang et al., 2014;
Zhang et al., 2015). In Arabidopsis, mutations in
AtRAD51C or AtXRCC3 lead to the presence of entangled chromosomes interconnected by chromatin bridges,
while AtRAD51B, AtRAD51D, and AtXRCC2 have
not been proven to participate in meiosis. These proteins have partially redundant functions in mitotic
DNA repair (Pradillo et al., 2014). It seems that the
functional divergence also exists among rice RAD51
paralogs.
In budding yeast, Rad51 directs intersister JM formation, representing an important fail-safe mechanism
when Dmc1-dependent interhomolog JM formation
fails (Cloud et al., 2012). This mechanism allows meiotic
DSBs to be repaired, but it ultimately leads to homologous pairing defects. By contrast, we determined that
the disruption of OsDMC1 did not affect homologous
pairing, but it led to the formation of almost 24 univalents. Therefore, OsRAD51 may direct the meiotic repair of DSBs using the intersister as a template in
Osdmc1a Osdmc1b.
Abnormal DSB Repair Mechanisms Might Be Activated in
Osdmc1a Osdmc1b Osrad51c
HR, nonhomologous end joining (NHEJ) and ectopic
recombination (ER) may be involved in DSBs repair.
However, meiotic DSBs are mainly repaired through
HR because ER or NHEJ pathways would result in
error-prone chromosome associations. NHEJ and ER
are usually repressed during meiosis unless HR process
is disturbed (Goedecke et al., 1999; Goldman and
Lichten, 2000). The NHEJ pathway joins double-strand
DNA ends, leading to chromosome associations. Considering aberrant chromosome entanglements in
Osdmc1a Osdmc1b Osrad51c, the NHEJ pathway might
be activated following loss of OsDMC1 and OsRAD51C.
However, it is still not enough to explain why chromosome entanglements occurred in this triple mutant
because this kind of defect can also be caused by abnormal ER. ER is often eliminated by recombinationdependent pairing process. In budding yeast, the
strand exchange capacity of Rad51 is shut down to facilitate Dmc1-mediated interhomolog recombination
(Tsubouchi and Roeder, 2006; Busygina et al., 2012).
Plant Physiol. Vol. 171, 2016
237
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
Wang et al.
Figure 8. Immunolocalization of OsDMC1 in
different meiotic mutants. A to I, OsDMC1 signals
(green) were detected in pair2 (A), pair3 (B),
Oscom1 (C), OsMRE11RNAi (D), Osrad51c (E),
zep1 (F), Osmer3 (G), Oszip4 (H), and Oshei10
(I). OsREC8 signals (red) indicate meiotic chromosome axes. Bars = 5 mm.
Moreover, a dmc1 mutation increased unequal sister
chromatid recombination (Grushcow et al., 1999;
Thompson and Stahl, 1999). Additionally, Rad51
and Dmc1 suppress meiotic ectopic recombination
(Shinohara and Shinohara, 2013). We propose that
OsRAD51C, together with OsDMC1, might be involved
in suppressing ER in meiosis, which could explain why
chromosome entanglements were produced in Osdmc1a
Osdmc1b Osrad51c, but not in Osdmc1a Osdmc1b or
Osrad51c. Therefore, we suspect OsDMC1 plays a duel
role in meiotic recombination. This protein may not only
be essential for interhomolog recombination, but also be
required for the suppression of abnormal DSB repair
pathways such as ER and NHEJ when OsRAD51C is
nonfunctional.
CO Formation Is Strongly Disrupted in the Absence
of OsDMC1
ZMM proteins in all organisms investigated to date
play a role in crossover formation, including ZIP1,
ZIP2, ZIP3, ZIP4, MSH4, MSH5, and MER3 in budding
yeast (Lynn et al., 2007). In this study, COs were almost
absent in Osdmc1a Osdmc1b, although the normal localization of OsMER3 and OsZIP4 to meiotic chromosomes occurred, suggesting that the recruitment of both
proteins is not dependent on OsDMC1. Other rice
RAD51-like proteins may act in recruiting these proteins during meiosis. In meiotic mouse cells, RAD51
interacts with MSH4 (Neyton et al., 2004). In addition,
RAD51 and ZIP3 directly interact in yeast (Agarwal
Figure 9. Abnormal meiotic chromosome
behaviors in Osrad51c and Osdmc1a Osdmc1b
Osrad51c at pachytene (A and E), diakinesis
(B and F), metaphase I (C and G), and anaphase I
(D and H). Chromosomes were stained with
DAPI. Bars = 5 mm.
238
Plant Physiol. Vol. 171, 2016
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
The Role of OsDMC1 in Meiosis
and Roeder, 2000). OsHEI10 may specifically promote
the early selection of recombination intermediates to
become class I COs (Wang et al., 2012). OsDMC1 facilitates the retention of OsHEI10 on meiotic chromosomes, as the localization of OsHEI10 during the later
stages of meiosis is disturbed in Osdmc1a Osdmc1b. It is
likely that the production of recombination intermediates is depressed in the absence of OsDMC1, ultimately
leading to defective class I CO formation.
The results of this study provide new insight into the
role of OsDMC1 during rice meiosis. Our findings reveal that OsDMC1 is not required for homologous
pairing in rice. However, the specific role of OsDMC1 in
suppressing NHEJ and ER requires further study.
MATERIALS AND METHODS
Plant Materials
The rice (Oryza sativa) japonica cultivar Nipponbare was used as the wild
type in our study. Two Tos17 insertion lines NF8016 and NE1040 were named as
Osdmc1a and Osdmc1b separately. Their seeds were kindly provided by the Rice
Genome Resource Center of the National Institute of Agrobiological Sciences.
Other mutant materials of the pair2, pair3, Oscom1, OsMRE11RNAi, Osrad51c,
zep1, Oszip4, Osmer3, and Oshei10 were from our previous study. All plant
materials were grown in paddy fields. The double mutant Osdmc1a Osdmc1b
was made by crossing homozygotes of appropriate mutant lines. The triple
mutant Osrad51c Osdmc1a Osdmc1b was generated from crossing the Osdmc1a/+
Osdmc1b/+ double heterozygote and the Osrad51c/+ single heterozygote. The
genotypes were identified by PCR to the F2 population derived from selfing F1
plants heterozygous for alleles.
Tos17 Insertion Site Analysis
The Tos17 inserted region of NF8016 was amplified by using a pair of
primers TOSP12F (ATTGTTAGGTTGCAAGTTAGTTAAGA) and TOS12R
(TCAGGTTCATTTCCGACACA). That of NE1040 was done by primer
pairs TOS11F (ATTGTTAGGTTGCAAGTTAGTTAAGA) and TOS11R
(CTTTGCCTTTCCTCAGCATC). The amplification products from NF8016 and
NE1040 were cloned into pMD18-T vector (Takara) and sequenced separately.
Real-Time PCR for Transcript Expression Analysis
Total RNA was separately extracted from the leaf, root, and panicle of
Nipponbare as well as panicle of Osdmc1a Osdmc1b. The Bio-Rad CFX96 realtime PCR instrument was used to perform real-time PCR analysis. EvaGreen
was used as the fluorescent dye (Biotium). The real-time PCR was performed
with the specific primers DMC1-RT1F (GTCCAAGCAGTACGACGAAG) and
DMC1-RT1R (TCTCCAGAGTTTATCCCTTGC) for OsDMC1 as well as ActinF
(CTGACAGGATGAGCAAGGAG) and ActinR (GGCAATCCACATCTGCTGGA)
for ACTIN. Each experiment was replicated three times. The experimental results
were analyzed by Bio-Rad CFX Manager analysis software.
Antibody Production
Total RNAs were extracted from wild-type young (30 to 50 mm) panicles
using the TRIzol reagent (Invitrogen). After being treated by DNase I (Invitrogen),
they were reversely transcribed to synthesize cDNA using the oligo(dT) primer
and Superscript III kit (Invitrogen). A 528-bp fragment of OsDMC1B coding
region (GenBank accession number AB079874) was amplified by PCR primer
pairs BF with a BamHI site (AGGATCCATGGCGCCGTCCAAGCAG) and BR
with an XhoI site (ACTCGAGTCGTTCAGGCCGGAATGTT). The PCR product
was then cloned into the pMD18-T vector (Takara) and reinserted into the
pGEX4T-2 vector (Amersham). The GST fusion OsDMC1B peptide containing
amino acids residues 1 to 176 was expressed and purified (Wang et al., 2009).
The polyclonal antibody was obtained with the fusion peptide immunizing
a mouse.
Western-Blot Assay
Proteins were extracted from rice panicles with buffer solution containing
50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.5% NP40, and 1 mM phenylmethylsulfonyl fluoride. Insoluble materials were removed by centrifugation.
The OsDMC1B coding region was cloned into the pET30a vector (Novagen) and
purified using a Ni2+-charged column (Qiagen). Protein samples were separated by SDS-PAGE on a 12% polyacrylamide gel and electroblotted onto
polyvinylidene difluoride membrane (Amersham). Western blots were performed with OsDMC1 antibodies diluted 1/10,000 and anti-mouse IgG antibodies conjugated to horseradish peroxidase (Abcam) diluted 1/20,000. Signals
were detected after adding Immobilon ECL (Millipore).
Immunofluorescence Analysis
Fresh young panicles were first fixed in 4% (w/v) paraformaldehyde for
30 min at room temperature. Chromosome preparation and immunofluorescence
analysis were conducted according to previous descriptions (Wang et al., 2009).
The immunofluorescence analysis used the following primary antibodies:
rabbit antibodies to OsREC8 (Shao et al., 2011), PAIR2 (Wang et al., 2011), and
mouse antibodies to OsREC8, PAIR3, OsCOM1, OsMRE11, OsRAD51C, ZEP1,
OsZIP4, OsMER3, and OsHEI10 individually (Wang et al., 2009, 2011, 2012;
Wang et al., 2010; Ji et al., 2012, 2013; Shen et al., 2012; Tang et al., 2014). All
above antibodies were previously generated in our laboratory. Additionally, a
561-bp fragment of PAIR3 cDNA (amino acids 248 to 393) was inserted into the
vector pGEX4T-2. The guinea pig antibody to PAIR3 was generated with the
PAIR3 fusion protein. The second antibodies, including rhodamine-conjugated
goat anti-rabbit antibody, fluorescein isothiocyanate-conjugated sheep antimouse antibody, and AMCA-conjugated goat anti-guinea pig antibody were
used for fluorescence detection.
Cytological Procedures and Data Analysis
Young panicles containing pollen mother cells entering meiosis were fixed in
Carnoy’s solution (ethanol:glacial acetic acid, 3:1) and stored at –20°C to be used
in the following chromosome spreading. Pollen mother cells at the meiotic stage
were squashed on slides and stained with acetocarmine. Coverslips were then
covered on the slides. The slides were frequently frozen in liquid nitrogen. They
were dehydrated through an ethanol series (70, 90, and 100%) after coverslips
were removed. DAPI in an antifade solution (Vector Laboratories) is used to
counterstain chromosomes on the slides (Wang et al., 2009).
Fluorescence in Situ Hybridization
FISH analysis was conducted according to Zhang et al. (2005). The pAtT4
clone contains telomeric repeats. The pTa794 clone has 5S rRNA genes from
wheat (Triticum aestivum; Cuadrado and Jouve, 1994). Four BAC clone on
chromosome 11, a0018B15, a0083M01, a0088I16, and a0002E05, were also used
as probes to monitor the chromosome arm pairing. a0018B15 and a0088I16 are
located on the short arm. a0083M01 and a0002E05are located on the long arm.
Chromosomes were counterstained with DAPI. Original images were observed
under Zeiss A2 fluorescence microscope and captured with a DVC1412 CCD
camera using software IPLab4.0.
Computational and Database Analysis
Protein sequence similarity searches were performed in the NCBI (www.
ncbi.nlm.nih.gov/BLAST). Gene structure schematic diagrams were generated
by GSDS (http://gsds.cbi.pku.edu.cn/index.php). The multiple sequence
alignment diagram was generated in GenDoc software. All pictures were further modified by Adobe Photoshop CS3.
Accession Numbers
The sequences used for alignment analysis can be found in the GenBank/
EMBL data libraries under the following accession numbers: OsDMC1A,
AAM76791; OsDMC1B, NP_001065738; ZmDMC1 (Zea mays), AEQ16523;
AtDMC1 (Arabidopsis thaliana), AEE76687; PtDMC1 (Populus trichocarpa),
EEF00835; ScDMC1 (Saccharomyces cerevisiae), AAB64706; SpDMC1
(Schizosaccharomyces pombe), BAA28671; and MmDMC1 (Mus musculus),
BAA10969.
Plant Physiol. Vol. 171, 2016
239
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
Wang et al.
Supplemental Data
The following supplemental materials are available.
Supplemental Figure S1. Alignment of different DMC1 orthologs from
Oryza sativa, Zea mays, Arabidopsis thaliana, Populus trichocarpa, Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Mus musculus.
Supplemental Figure S2. Gene structures of OsDMC1A and OsDMC1B.
Supplemental Figure S3. Osdmc1a Osdmc1b is a null double mutant.
Supplemental Figure S4. Immunolocalization of OsDMC1 at zygotene in
Osdmc1a OsDMC1B, OsDMC1A Osdmc1b, and Osdmc1a Osdmc1b meiocytes.
Supplemental Figure S5. Meiosis in wild-type meiocytes.
Supplemental Figure S6. The meiotic behavior in Osdmc1a OsDMC1B and
OsDMC1A Osdmc1b meiocytes.
Supplemental Figure S7. The dual immunolocalization of OsREC8 and
gH2AX at zygotene in wild-type and Osdmc1a Osdmc1b meiocytes.
Supplemental Figure S8. The relative intensity of gH2AX staining signals
at zygotene in the wild type, Osdmc1a Osdmc1b, and Osdmc1a Osdmc1b
Osrad51c.
Supplemental Figure S9. Quantification of bivalents at metaphase I in the
wild type and Osdmc1a Osdmc1b.
Supplemental Figure S10. FISH analysis with probe 5S rDNA in Osdmc1a
Osdmc1b Osrad51c.
Received January 30, 2016; accepted March 7, 2016; published March 9, 2016.
LITERATURE CITED
Agarwal S, Roeder GS (2000) Zip3 provides a link between recombination
enzymes and synaptonemal complex proteins. Cell 102: 245–255
Bishop DK, Park D, Xu L, Kleckner N (1992) DMC1: a meiosis-specific
yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell 69: 439–456
Busygina V, Saro D, Williams G, Leung WK, Say AF, Sehorn MG, Sung
P, Tsubouchi H (2012) Novel attributes of Hed1 affect dynamics and
activity of the Rad51 presynaptic filament during meiotic recombination. J Biol Chem 287: 1566–1575
Byun MY, Kim WT (2014) Suppression of OsRAD51D results in defects in
reproductive development in rice (Oryza sativa L.). Plant J 79: 256–269
Cloud V, Chan YL, Grubb J, Budke B, Bishop DK (2012) Rad51 is an
accessory factor for Dmc1-mediated joint molecule formation during
meiosis. Science 337: 1222–1225
Couteau F, Belzile F, Horlow C, Grandjean O, Vezon D, Doutriaux MP
(1999) Random chromosome segregation without meiotic arrest in both
male and female meiocytes of a dmc1 mutant of Arabidopsis. Plant Cell
11: 1623–1634
Cuadrado A, Jouve N (1994) Mapping and organization of highly-repeated
DNA sequences by means of simultaneous and sequential FISH and
C-banding in 6x-triticale. Chromosome Res 2: 331–338
Da Ines O, Abe K, Goubely C, Gallego ME, White CI (2012) Differing
requirements for RAD51 and DMC1 in meiotic pairing of centromeres
and chromosome arms in Arabidopsis thaliana. PLoS Genet 8: e1002636
Deng Z-Y, Wang T (2007) OsDMC1 is required for homologous pairing in
Oryza sativa. Plant Mol Biol 65: 31–42
Dickey JS, Redon CE, Nakamura AJ, Baird BJ, Sedelnikova OA, Bonner
WM (2009) H2AX: functional roles and potential applications. Chromosoma 118: 683–692
Fanning E, Klimovich V, Nager AR (2006) A dynamic model for replication protein A (RPA) function in DNA processing pathways. Nucleic
Acids Res 34: 4126–4137
Farah JA, Cromie GA, Smith GR (2009) Ctp1 and Exonuclease 1, alternative nucleases regulated by the MRN complex, are required for efficient
meiotic recombination. Proc Natl Acad Sci USA 106: 9356–9361
Goedecke W, Eijpe M, Offenberg HH, van Aalderen M, Heyting C (1999)
Mre11 and Ku70 interact in somatic cells, but are differentially expressed
in early meiosis. Nat Genet 23: 194–198
Goldman AS, Lichten M (2000) Restriction of ectopic recombination by
interhomolog interactions during Saccharomyces cerevisiae meiosis. Proc
Natl Acad Sci USA 97: 9537–9542
Grushcow JM, Holzen TM, Park KJ, Weinert T, Lichten M, Bishop DK
(1999) Saccharomyces cerevisiae checkpoint genes MEC1, RAD17 and
RAD24 are required for normal meiotic recombination partner choice.
Genetics 153: 607–620
Habu T, Taki T, West A, Nishimune Y, Morita T (1996) The mouse and
human homologs of DMC1, the yeast meiosis-specific homologous recombination gene, have a common unique form of exon-skipped transcript in meiosis. Nucleic Acids Res 24: 470–477
Harper L, Golubovskaya I, Cande WZ (2004) A bouquet of chromosomes.
J Cell Sci 117: 4025–4032
Hirochika H, Sugimoto K, Otsuki Y, Tsugawa H, Kanda M (1996) Retrotransposons of rice involved in mutations induced by tissue culture.
Proc Natl Acad Sci USA 93: 7783–7788
Ji J, Tang D, Wang K, Wang M, Che L, Li M, Cheng Z (2012) The role of
OsCOM1 in homologous chromosome synapsis and recombination in
rice meiosis. Plant J 72: 18–30
Ji J, Tang D, Wang M, Li Y, Zhang L, Wang K, Li M, Cheng Z (2013)
MRE11 is required for homologous synapsis and DSB processing in rice
meiosis. Chromosoma 122: 363–376
Jones GH (1984) The control of chiasma distribution. Symp Soc Exp Biol 38:
293–320
Kathiresan A, Khush GS, Bennett J (2002) Two rice DMC1 genes are differentially expressed during meiosis and during haploid and diploid
mitosis. Sex Plant Reprod 14: 257–267
Keeney S, Giroux CN, Kleckner N (1997) Meiosis-specific DNA doublestrand breaks are catalyzed by Spo11, a member of a widely conserved
protein family. Cell 88: 375–384
Klimyuk VI, Jones JD (1997) AtDMC1, the Arabidopsis homologue of the
yeast DMC1 gene: characterization, transposon-induced allelic variation
and meiosis-associated expression. Plant J 11: 1–14
Kurzbauer MT, Uanschou C, Chen D, Schlögelhofer P (2012) The recombinases DMC1 and RAD51 are functionally and spatially separated
during meiosis in Arabidopsis. Plant Cell 24: 2058–2070
Lee JY, Terakawa T, Qi Z, Steinfeld JB, Redding S, Kwon Y, Gaines WA,
Zhao W, Sung P, Greene EC (2015) DNA RECOMBINATION. Base
triplet stepping by the Rad51/RecA family of recombinases. Science 349:
977–981
Li Z, Golub EI, Gupta R, Radding CM (1997) Recombination activities of
HsDmc1 protein, the meiotic human homolog of RecA protein. Proc Natl
Acad Sci USA 94: 11221–11226
Lin Z, Kong H, Nei M, Ma H (2006) Origins and evolution of the recA/
RAD51 gene family: evidence for ancient gene duplication and endosymbiotic gene transfer. Proc Natl Acad Sci USA 103: 10328–10333
Lynn A, Soucek R, Börner GV (2007) ZMM proteins during meiosis:
crossover artists at work. Chromosome Res 15: 591–605
Milman N, Higuchi E, Smith GR (2009) Meiotic DNA double-strand break
repair requires two nucleases, MRN and Ctp1, to produce a single size
class of Rec12 (Spo11)-oligonucleotide complexes. Mol Cell Biol 29:
5998–6005
Naranjo T (2012) Finding the correct partner: the meiotic courtship. Scientifica (Cairo) 2012: 509073
Neale MJ, Keeney S (2006) Clarifying the mechanics of DNA strand exchange in meiotic recombination. Nature 442: 153–158
Neale MJ, Pan J, Keeney S (2005) Endonucleolytic processing of covalent
protein-linked DNA double-strand breaks. Nature 436: 1053–1057
Neyton S, Lespinasse F, Moens PB, Paul R, Gaudray P, Paquis-Flucklinger V,
Santucci-Darmanin S (2004) Association between MSH4 (MutS homologue 4) and the DNA strand-exchange RAD51 and DMC1 proteins during
mammalian meiosis. Mol Hum Reprod 10: 917–924
Petronczki M, Siomos MF, Nasmyth K (2003) Un ménage à quatre: the
molecular biology of chromosome segregation in meiosis. Cell 112:
423–440
Pittman DL, Cobb J, Schimenti KJ, Wilson LA, Cooper DM, Brignull E,
Handel MA, Schimenti JC (1998) Meiotic prophase arrest with failure of
chromosome synapsis in mice deficient for Dmc1, a germline-specific
RecA homolog. Mol Cell 1: 697–705
Pradillo M, López E, Linacero R, Romero C, Cuñado N, Sánchez-Morán E,
Santos JL (2012) Together yes, but not coupled: new insights into the
roles of RAD51 and DMC1 in plant meiotic recombination. Plant J 69:
921–933
240
Plant Physiol. Vol. 171, 2016
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.
The Role of OsDMC1 in Meiosis
Pradillo M, Varas J, Oliver C, Santos JL (2014) On the role of AtDMC1,
AtRAD51 and its paralogs during Arabidopsis meiosis. Front Plant Sci 5:
23
Sanchez-Moran E, Santos JL, Jones GH, Franklin FC (2007) ASY1 mediates AtDMC1-dependent interhomolog recombination during meiosis in
Arabidopsis. Genes Dev 21: 2220–2233
Scherthan H (2001) A bouquet makes ends meet. Nat Rev Mol Cell Biol 2:
621–627
Sehorn MG, Sigurdsson S, Bussen W, Unger VM, Sung P (2004) Human
meiotic recombinase Dmc1 promotes ATP-dependent homologous DNA
strand exchange. Nature 429: 433–437
Shao T, Tang D, Wang K, Wang M, Che L, Qin B, Yu H, Li M, Gu M,
Cheng Z (2011) OsREC8 is essential for chromatid cohesion and metaphase I monopolar orientation in rice meiosis. Plant Physiol 156:
1386–1396
Shen Y, Tang D, Wang K, Wang M, Huang J, Luo W, Luo Q, Hong L, Li
M, Cheng Z (2012) ZIP4 in homologous chromosome synapsis and
crossover formation in rice meiosis. J Cell Sci 125: 2581–2591
Shinohara A, Ogawa H, Ogawa T (1992) Rad51 protein involved in repair
and recombination in S. cerevisiae is a RecA-like protein. Cell 69:
457–470
Shinohara M, Shinohara A (2013) Multiple pathways suppress non-allelic
homologous recombination during meiosis in Saccharomyces cerevisiae.
PLoS One 8: e63144
Sung P (1994) Catalysis of ATP-dependent homologous DNA pairing
and strand exchange by yeast RAD51 protein. Science 265:
1241–1243
Sung P, Klein H (2006) Mechanism of homologous recombination: mediators and helicases take on regulatory functions. Nat Rev Mol Cell Biol
7: 739–750
Tang D, Miao C, Li Y, Wang H, Liu X, Yu H, Cheng Z (2014) OsRAD51C is
essential for double-strand break repair in rice meiosis. Front Plant Sci 5:
167
Thompson DA, Stahl FW (1999) Genetic control of recombination partner
preference in yeast meiosis. Isolation and characterization of mutants
elevated for meiotic unequal sister-chromatid recombination. Genetics
153: 621–641
Tsubouchi H, Roeder GS (2006) Budding yeast Hed1 down-regulates the
mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20: 1766–1775
Uanschou C, Siwiec T, Pedrosa-Harand A, Kerzendorfer C, SanchezMoran E, Novatchkova M, Akimcheva S, Woglar A, Klein F,
Schlögelhofer P (2007) A novel plant gene essential for meiosis is related to
the human CtIP and the yeast COM1/SAE2 gene. EMBO J 26: 5061–5070
Wang K, Tang D, Wang M, Lu J, Yu H, Liu J, Qian B, Gong Z, Wang X,
Chen J, Gu M, Cheng Z (2009) MER3 is required for normal meiotic
crossover formation, but not for presynaptic alignment in rice. J Cell Sci
122: 2055–2063
Wang K, Wang M, Tang D, Shen Y, Miao C, Hu Q, Lu T, Cheng Z (2012)
The role of rice HEI10 in the formation of meiotic crossovers. PLoS Genet
8: e1002809
Wang K, Wang M, Tang D, Shen Y, Qin B, Li M, Cheng Z (2011) PAIR3,
an axis-associated protein, is essential for the recruitment of recombination elements onto meiotic chromosomes in rice. Mol Biol Cell 22:
12–19
Wang M, Wang K, Tang D, Wei C, Li M, Shen Y, Chi Z, Gu M, Cheng Z
(2010) The central element protein ZEP1 of the synaptonemal complex
regulates the number of crossovers during meiosis in rice. Plant Cell 22:
417–430
Yamazaki M, Tsugawa H, Miyao A, Yano M, Wu J, Yamamoto S,
Matsumoto T, Sasaki T, Hirochika H (2001) The rice retrotransposon
Tos17 prefers low-copy-number sequences as integration targets. Mol
Genet Genomics 265: 336–344
Yoshida K, Kondoh G, Matsuda Y, Habu T, Nishimune Y, Morita T (1998)
The mouse RecA-like gene Dmc1 is required for homologous chromosome synapsis during meiosis. Mol Cell 1: 707–718
Youds JL, Boulton SJ (2011) The choice in meiosis - defining the factors that
influence crossover or non-crossover formation. J Cell Sci 124: 501–513
Zakharyevich K, Ma Y, Tang S, Hwang PY, Boiteux S, Hunter N (2010)
Temporally and biochemically distinct activities of Exo1 during meiosis:
double-strand break resection and resolution of double Holliday junctions. Mol Cell 40: 1001–1015
Zhang B, Wang M, Tang D, Li Y, Xu M, Gu M, Cheng Z, Yu H (2015)
XRCC3 is essential for proper double-strand break repair and homologous recombination in rice meiosis. J Exp Bot 66: 5713–5725
Zhang D, Yang Q, Bao W, Zhang Y, Han B, Xue Y, Cheng Z (2005)
Molecular cytogenetic characterization of the Antirrhinum majus
genome. Genetics 169: 325–335
Zickler D (2006) From early homologue recognition to synaptonemal
complex formation. Chromosoma 115: 158–174
Plant Physiol. Vol. 171, 2016
241
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2016 American Society of Plant Biologists. All rights reserved.