Eider females form non-kin brood-rearing coalitions

Molecular Ecology (2005) 14, 3903–3908
doi: 10.1111/j.1365-294X.2005.02694.x
Eider females form non-kin brood-rearing coalitions
Blackwell Publishing, Ltd.
M A R K U S Ö S T ,* E M M A V I T I K A I N E N ,* P E T E R W A L D E C K ,† L I S E L O T T E S U N D S T R Ö M ,*
K A I L I N D S T R Ö M ,* T U U L A H O L L M É N ,‡ J . C H R I S T I A N F R A N S O N § and M I K A E L K I L P I ¶
*Department of Biological and Environmental Sciences, PO Box 65 (Biocentre 3, Viikinkaari 1), FI-00014 University of Helsinki,
Finland, †Department of Zoology, Animal Ecology, PO Box 463, SE-40530 Göteborg, Sweden, ‡Alaska SeaLife Center and School
of Fisheries and Ocean Sciences, University of Alaska Fairbanks, PO Box 1329, Seward, AK 99664, USA, §US Geological Survey,
National Wildlife Health Center, 6006 Schroeder Road, Madison, WI 53711, USA, ¶Aronia Research Centre, Åbo Akademi University
& Sydväst Polytechnic, Raseborgsvägen 9, FI-10600 Ekenäs, Finland
Abstract
Kin selection is a powerful tool for understanding cooperation among individuals, yet
its role as the sole explanation of cooperative societies has recently been challenged on
empirical grounds. These studies suggest that direct benefits of cooperation are often overlooked, and that partner choice may be a widespread mechanism of cooperation. Female
eider ducks (Somateria mollissima) may rear broods alone, or they may pool their broods
and share brood-rearing. Females are philopatric, and it has been suggested that colonies
may largely consist of related females, which could promote interactions among relatives.
Alternatively, shared brood care could be random with respect to relatedness, either because
brood amalgamations are accidental and nonadaptive, or through group augmentation,
assuming that the fitness of all group members increases with group size. We tested these
alternatives by measuring the relatedness of co-tending eider females in enduring coalitions
with microsatellite markers. Females formed enduring brood-rearing coalitions with each
other at random with respect to relatedness. However, based on previous data, partner choice
is nonrandom and dependent on female body condition. We discuss potential mechanisms
underlying eider communal brood-rearing decisions, which may be driven by the specific
ecological conditions under which sociality has evolved in this species.
Keywords: body condition, brood amalgamation, direct fitness, kin selection, partner choice,
Somateria mollissima
Received 1 December 2004; revision received 28 April 2005; accepted 11 July 2005
Introduction
Cooperation can evolve by shared genes, reciprocity,
mutualism or group selection (e.g. Sachs et al. 2004). Ever
since Hamilton’s (1964) seminal paper on the conditions
under which altruism can spread in a population gained
wide recognition in the late 1970s, many studies of social
evolution have focused on the role of relatedness in the
origin and maintenance of sociality. Facilitated by modern
molecular techniques, intragroup relatedness has been
measured in a great variety of social systems (Ross 2001).
The majority of cooperating individuals among social insects
(Queller & Strassmann 1998) and many cooperatively
Correspondence: Markus Öst, Fax: +358-(0)9-191 57694; E-mail:
[email protected]
© 2005 Blackwell Publishing Ltd
breeding birds and mammals (Griffin & West 2003) are
indeed related to each other, as expected under kin
selection.
The relative importance of direct and indirect fitness
benefits in outweighing the costs of caring for nondescendant
offspring is currently under debate, since recent empirical
findings have challenged the view that kin selection can
provide a satisfactory general explanation of cooperative
societies (Clutton-Brock 2002; Avilés et al. 2004). Instead,
these studies suggest that direct benefits could be sufficient to maintain cooperation in some social systems
(Clutton-Brock 2002), and that partner choice may be a
widespread but so far underrated evolutionary mechanism
for cooperation (Noë 2001; Sachs et al. 2004). Cases where
cooperators are unrelated are particularly interesting, because
such groups of cooperators should confer direct fitness
3904 M . Ö S T E T A L .
Fig. 1 Study area. Sampling colonies for
eiders are shown in black, and adjacent
groups of small islets with a small sample
size that were combined in molecular
analyses are encircled.
benefits on all their members (Bernasconi & Strassmann
1999). These cases also highlight the need to put greater
emphasis on the other two parameters of Hamilton’s
inequality — the costs and benefits of cooperation —
which are a function of the specific ecological and demographic conditions under which sociality evolves (Avilés
et al. 2004).
Female eider ducks (Somateria mollissima) may rear
broods alone, or they may pool their broods and share
brood-rearing duties (Öst et al. 2003a). Females are
strongly philopatric (Baillie & Milne 1989; Swennen 1990;
Bustnes & Erikstad 1993), with reduced gene flow among
colonies (Tiedemann & Noer 1998; Tiedemann et al. 1999).
Hence, eider colonies might largely consist of related
females (Tiedemann & Noer 1998). Thus, the natural history of eiders is consistent with the conditions that would
favour kin selection in post-hatch brood amalgamation,
but so far this possibility remains untested. Alternatively,
the decision of shared brood care could be completely
random with respect to relatedness. This scenario could
hold true if brood amalgamations are purely accidental
and nonadaptive, as has been suggested for ducks
(Munro & Bédard 1977; Afton 1993; Savard et al. 1998).
More generally, if the fitness of all group members
increases with the size of their group, cooperative
behaviour could be maintained by group augmentation
alone, regardless of kin composition (Kokko et al. 2001;
Clutton-Brock 2002; Avilés et al. 2004). Here we show by
using molecular markers that neither of these opposing
views applies to our study population — co-tending eider
females are unrelated to each other, yet partner choice
is nonrandom (Öst et al. 2003a), and we discuss potential
mechanisms underlying communal brood-rearing decisions
in this species.
Materials and methods
Field data
This study was carried out at Tvärminne Zoological Station
(59°50′N, 23°15′E), on the Baltic Sea in southwestern
Finland during 1997–2002. Eider females during late
incubation were captured on the nest with hand nets, a
blood sample was taken from the jugular or ulnar vein, and
females were given 3 × 3-cm flags with a unique colour
combination attached to a primary (Kilpi et al. 2001).
Altogether 596 females were marked with flags during
1997–2002 (Öst et al. 2003b), and blood samples were
collected from 96 different birds from 18 nesting islands
(Fig. 1). Because blood sampling was possible only when
a person with the approval of the University of Helsinki
Institutional Animal Care Committee was present, we do
not have blood samples from all females. However, blood
samples were taken on many different occasions in all
years, so the risk of targeting a nonrepresentative subfraction of the population is low.
We monitored the tagged females for at least 30 days
after hatching. All observations of a known female during
1 day constituted one observation. At each sighting of a
female we recorded her identity, whether she was attending a brood, and the total number of females and ducklings
in the brood. Each focal brood was followed long enough
to ensure correct assessment of the brood-rearing status
of all females attending the brood (Öst et al. 2003a). This
assessment is straightforward, as nontending females are
not tolerated within broods and are promptly chased away
by the tending female(s) (Öst et al. 2003b). A coalition was
defined as enduring if at least two individually known
females and their ducklings had consistently associated
© 2005 Blackwell Publishing Ltd, Molecular Ecology, 14, 3903–3908
C O - T E N D I N G E I D E R F E M A L E S A R E U N R E L A T E D 3905
Table 1 Microsatellite loci used in the study to assess relatedness among 96 eider females: primer sequence, annealing temperature (Ta),
allele size, number of alleles per locus (NA), observed heterozygosity (HO), and gene diversity (D) (Nei 1987)
Locus
Primer sequence
Ta
Allele size
NA
HO
D
Sfiµ3
Sfiµ4
Sfiµ5
Sfiµ7
Sfiµ9
Fields & Scribner 1997
Fields & Scribner 1997
Fields & Scribner 1997
Fields & Scribner 1997
F: TTCCTTCCAACCCAAGACATTC′
R: AAACTTCCAACCATTCTTCAAGG′
F: TCCAGCTGAAGCTACAAGACATG′
R: CCACTTACTACATGCTGCGTGC′
F: CTTCTGCAAGCCTCATCACCATG′
R: TAAGCCAAAGCTCTAGTCACTTGC′
Fields & Scribner 1997
52
57
50
52
60
123–129 bp
167–189 bp
154–202 bp
195–330 bp
128–140 bp
3
8
8
25
7
0.343
0.692
0.817
0.881
0.771
0.327
0.676
0.770
0.947
0.680
60
184–230 bp
10
0.809
0.806
65
203–215 bp
3
0.295
0.307
50
72–86 bp
6
0.556
0.570
Sfiµ10
Sfiµ11
Aalu1
over a period of at least 2 weeks (Öst et al. 2003a). Of
our sample of 96 genotyped females, 41 birds formed
24 enduring brood-rearing coalitions with each other,
24 females were lone tenders, and the remaining 31 birds
were either transient crèchers, abandoners, or the only
known coalition partner in an enduring coalition. Three
genotyped females formed enduring coalitions in more
than 1 year.
Molecular markers
We genotyped the females at 6 – 8 microsatellite loci; DNA
was extracted from blood samples using the standard
phenol–chloroform protocol (Sambrook et al. 1989). Primer
sequences for Aalu1, Sfiµ3, Sfiµ4, Sfiµ5 and Sfiµ7 were
obtained from Fields & Scribner (1997). For Sfiµ9, Sfiµ10 and
Sfiµ11, we designed new primers (Table 1) within the flanking
areas of the repeat regions. Sequences for these were
obtained from GenBank (www.ncbi.nlm.nih.gov/GenBank/,
Accession nos AF180499, AF180500 and AF180501; Libants
et al. 2001).
Polymerase chain reaction (PCR) was carried out for
Sfiµ3, Sfiµ4 and Sfiµ7 in 10-µL volume containing 1 µL template DNA, 1× PCR-buffer for Dynazyme (Finnzymes),
0.1 U Dynazyme polymerase II (Finnzymes), 0.5 µm R and F
primers and 0.2 mm of each dNTP. The PCR products were
labelled internally by adding 5 µmol fluorescent [R110]
FdCTP (Applied Biosystems) to each reaction. For Sfiµ5
Sfiµ9, Sfiµ10, Sfiµ11 and Aalu1, we used fluorescencelabelled forward primers (HEX, FAM or NED), and
PCRs were carried out in 10-µL volume containing 1 µL
template DNA, 1× PCR buffer for Dynazyme (Finnzymes),
0.5 µm of R and F primers, 0.2 mm of each dNTP and
0.25 U Dynazyme polymerase II (Finnzymes). All reactions
were carried out in Peltier PTC-100 Thermal Cycler with an
initial denaturation step at 95 °C for 4 min, followed by
34 cycles at 94 °C for 45 s, the locus-specific annealing temperature (Table 1) for 45 s, elongation at 72 °C for 1 min, and
© 2005 Blackwell Publishing Ltd, Molecular Ecology, 14, 3903–3908
a final elongation step at 72 °C for 10 min. The size of the
fragments were determined with the MegaBACE 1000
sequencer (Amersham Biosciences) (Sfiµ5, Sfiµ9, Sfiµ10,
Sfiµ11 and Aalu1) or ABI PRISM® 377 sequencer (Sfiµ3,
Sfiµ4 and Sfiµ7) using an internal genescan® 400HD[ROX]
size standard (PE Applied Biosystems).
Analysis of genetic structure and relatedness
We first tested all loci for deviation from Hardy–Weinberg
equilibrium and for linkage disequilibrium between all
pairs of loci with genepop 3.4 (Raymond & Rousset 1995).
We then analysed population structuring within the study
area by first estimating the inbreeding coefficients (FIS) and
the within-population differentiation coefficients (FST)
using fstat 2.9.3 (Goudet 2001) (5000 permutations; Fig. 1),
and then using baps (Corander et al. 2003) to identify
grouping within the entire population independent of the
islands.
To assess whether related females preferably form
brood-rearing associations together, we estimated the pairwise relatedness between all pairs of females using the
pairwise relatedness option in kinship 1.1.2 (Goodnight &
Queller 1999). We compared the average genetic similarity
of the 24 pairs of brood-rearing females which had formed
enduring coalitions with each other with that of 24 pairs
drawn at random from the total pool of 96 females. All
pairwise relatedness estimates were calculated against
the background allele frequencies of the total population
(Goodnight & Queller 1999).
Results
All loci were polymorphic with 3–25 alleles per locus and
a gene diversity ranging from 0.33 to 0.95 (Table 1). Tests
for linkage disequilibrium showed all loci were unlinked
and showed no significant deviance from Hardy–Weinberg
equilibrium (χ2 = 16, d.f. = 16, P = 0.4501).
3906 M . Ö S T E T A L .
We found no significant differentiation between nesting
islands at the scale studied here (FST = 0.004, P = 0.331),
and we found no significant inbreeding (FIS = −0.012,
P = 0.11). This also implies that no null alleles were present
in any of the loci included in the analysis. Similarly, the
analysis with baps detected no differentiation among
islands while the highest posterior probability (P = 0.9975)
was for a population structure in which all the islands
clustered together. However, when each individual was considered separately independent of the island structure, we
found 10 subgroups (posterior probability 0.8816), with an
average within-group relatedness of 0.143 (95% confidence
intervals obtained by bootstrapping over loci: lower 0.066,
upper 0.231; fstat 2.9.3).
Females forming enduring brood-rearing associations
had on average relatedness of r = −0.058 (SD = 0.240,
N = 24). We compared this value to the average relatedness
obtained by randomly sampling (without replacement)
24 female pairs 1000 times out of all the possible female
combinations. In 857 cases we found a relatedness value as
high or higher than the observed one. Therefore the observed
pairs were not on average more related than any random
pair of females in the population. Since the sample size
is limited we tested our power to detect deviations from
average relatedness values of r = 0.1, r = 0.125 and r = 0.250.
Because we are testing against an expected value we used
a power test based on a one-sample t-test. We estimated
the standard deviation (SD = 0.262) from all possible
female pairs (N = 4556) and our power to detect the
above-mentioned deviations are 0.819, 0.914, and 1.0,
respectively. Out of the 24 pairs of females that formed
an enduring coalition, only three pairs (12.5%) comprised
closely related females (r ≥ 0.250). The relatedness matrix
for all 96 females in the population contained 787 pairs
(17.3%) with a relatedness above 0.25, which would correspond to half-siblings. Given these values, our three pairs
of highly related females forming a brood-rearing coalition
could have been obtained by chance (χ2 = 0.28, d.f. = 1,
P = 0.60).
Discussion
Here we have shown that coalitions in female eiders
are not formed between relatives. These results add to a
growing number of studies indicating that kin-based social
interactions are not a fundamental condition for cooperative
animal societies. The near-zero relatedness between
co-tending females is not due to the absence of relatives
to join, as our Bayesian analysis revealed clusters of
closely related females in the population. Hence, our data
should be sufficient to identify related pairs and detect
positive relatedness had this been the case. Interestingly,
the clusters detected with baps were uncoupled with
nesting islands and post-hatch brood rearing sites.
Our results may seem surprising, considering that the
natural history of eiders may be expected to result in nesting aggregations of related females (Tiedemann & Noer
1998), thus promoting interactions among relatives. However, in our study population, the spatial structure of nesting colonies is somewhat different from that of previously
studied populations. Based on 15 years of ringing recovery
data, breeding philopatry of adult females is extremely
high in our population (M. Kilpi & M. Öst, unpublished
data), despite the presence of many adjacent small breeding colonies (Öst & Kilpi 2000; Fig. 1). However, unlike
breeding philopatry, strict natal philopatry apparently
does not hold over the very fine-scaled spatial structure
considered here, in contrast to the large, relatively isolated
populations studied elsewhere (Baillie & Milne 1989;
Swennen 1990; Bustnes & Erikstad 1993).
Since eider females receive no genetic returns of cooperating, kin selection will be absent, and the formation of
brood-rearing coalitions must be controlled by the balance
between direct fitness benefits and costs. Brood care in
eiders entails costs; in our study population, females tending small ducklings feed on nonpreferred food (Öst & Kilpi
1999), whereas in other populations, feeding areas of
adults and young may be spatially separated (Gorman &
Milne 1972). Nonetheless, the costs of caring for nondescendant young in joint broods are probably low, as individual females feed more but are less vigilant when more
females are present (Öst et al. 2002). Thus grouping benefits may promote shared care among post-incubating energetically stressed females, yet mitigate costs of caring for
an enlarged brood. However, also the expected benefits of
caring for additional young are probably low, as duckling
survival in eider broods is independent of brood size
(Bustnes & Erikstad 1991). In our study population, the
ratio of ducklings to females actually decreases as female
group size increases (Öst et al. 2003b). This decelerating
group productivity function in itself presents a dilemma.
Stable groups of nonrelatives are predicted not to occur
when per capita reproduction declines with increasing
group size and entry is group controlled, as is the rule in
animals with social dominance relationships (Giraldeau &
Caraco 2000). Coalition formation by eiders is characterized by frequent aggression, and the presence of female
dominance hierarchies (Munro & Bédard 1977; Öst 1999).
However, stable groups can form under these conditions if
dominants and subordinates reproduce unevenly (Reeve
& Emlen 2000). Nonetheless, the most prevalent stable
group size in eiders is only two females (Öst et al. 2003b),
which may be influenced by the lack of relatedness among
the participating females.
Although co-tending eider females are unrelated, our
previous data show that partner choice is nonrandom:
‘lone tenders’ are on average in better body condition than
females forming coalitions (Kilpi et al. 2001), and females
© 2005 Blackwell Publishing Ltd, Molecular Ecology, 14, 3903–3908
C O - T E N D I N G E I D E R F E M A L E S A R E U N R E L A T E D 3907
in better condition are found in coalitions with females in
poor condition, not with other females in good condition
(Öst et al. 2003a). Body condition is thus a criterion for partner choice, which might be expected in a capital breeder
(Meijer & Drent 1999) subject to severe, environmentally
induced weight loss during nesting (e.g. Parker & Holm
1990). Birds are sensitive to their own ability to provide
care and they adjust their parental effort accordingly (e.g.
Pettifor et al. 1988), so female body condition may be considered an ‘ecological constraint’ affecting the cost–benefit
ratio of cooperation (Öst et al. 2003b). Hence, a female in
good condition may be less likely to enter a coalition unless
her reproductive share is large enough to equate her reproductive success under lone tending. Conversely, a female
in poor condition is more likely to enter a coalition because
her odds of successfully rearing a brood on her own are
low, and thus she is willing to accept even a low share of
reproduction in a coalition (Öst et al. 2003a). As a result,
females in relatively good condition join females in poor
condition, whereas the females in best condition tend
alone.
How could female eiders sense the quality of prospective partners, since it seems unlikely that females would
be able to cue in on each others’ body conditions directly?
One possibility is parental investment in vigilance, which
can easily be assessed by other females, and positively correlated with body condition, both within and between coalitions (M. Öst, R. C. Ydenberg & C. W. Clark, unpublished).
Females also frequently change coalition partners soon
after ducklings are hatched, before settling in their final
group (Öst et al. 2003a). Cooperation can evolve by partner
choice even if individuals interact only once (Sachs et al.
2004), in contrast with reciprocal altruism (Trivers 1971).
Our current longitudinal data on individual females are
as yet insufficient to distinguish between alternative
mechanisms of reciprocation.
Great behavioural flexibility distinguish vertebrate
societies, and the selective forces responsible for cooperation
may vary even among populations of the same species
(e.g. Olendorf et al. 2004). Relatedness plays no role in
post-hatch brood amalgamation of eiders in our population,
but it may do so in other waterfowl parental care decisions.
For example, host and ‘parasite’ parent are related in
goldeneyes (Bucephala clangula) (Andersson & Åhlund
2000). We therefore strongly encourage further studies
measuring the relatedness between co-tending females
in other eider populations, as well as research into the kin
composition of amalgamated broods of waterfowl in
general.
Acknowledgements
We thank Anette Bäck, Katja Helle, Kim Jaatinen, Patrik Karell,
Lili Mantila, Heidi Nyman, Henry Pihlström, Tobias Tamelander
© 2005 Blackwell Publishing Ltd, Molecular Ecology, 14, 3903–3908
and Mats Westerbom for help in the field. Tvärminne Zoological
Station provided working facilities. Financial support was
provided by the Academy of Finland (grants no. 51895 and 104582
to MÖ, grant no. 163390 to MK), and Wilhelm and Martina
Lundgrens Science fund (PW). We thank Malte Andersson and
two anonymous reviewers for valuable comments on the
manuscript.
References
Afton AD (1993) Post-hatch brood amalgamation in lesser scaup:
female behavior and return rates, and duckling survival. Prairie
Naturalist, 25, 227–235.
Andersson M, Åhlund M (2000) Host–parasite relatedness shown
by protein fingerprinting in a brood parasitic bird. Proceedings of
the National Academy of Sciences, USA, 97, 13188–13193.
Avilés L, Fletcher JA, Cutter AD (2004) The kin composition of
social groups: trading group size for degree of altruism.
American Naturalist, 164, 132–144.
Baillie SR, Milne H (1989) Movements of eiders Somateria mollissima
on the east coast of Britain. Ibis, 131, 321–335.
Bernasconi G, Strassmann JE (1999) Cooperation among unrelated
individuals: the ant foundress case. Trends in Ecology & Evolution,
14, 477–482.
Bustnes JO, Erikstad KE (1991) Parental care in the common eider
(Somateria mollissima): factors affecting abandonment and adoption of young. Canadian Journal of Zoology, 69, 1538–1545.
Bustnes JO, Erikstad KE (1993) Site fidelity in breeding common
eider Somateria mollissima females. Ornis Fennica, 70, 11–16.
Clutton-Brock TH (2002) Breeding together: kin selection and
mutualism in cooperative vertebrates. Science, 296, 69–72.
Corander J, Waldmann P, Sillanpää MJ (2003) Bayesian analysis of
genetic differentiation between populations. Genetics, 163, 357–374.
Fields RL, Scribner KT (1997) Isolation and characterization of
novel waterfowl microsatellite loci: cross-species comparisons
and research applications. Molecular Ecology, 6, 161–164.
Giraldeau L-A, Caraco T (2000) Social Foraging Theory. Princeton
University Press, Princeton, New Jersey.
Goodnight KF, Queller DC (1999) Computer software for performing likelihood tests of pedigree relationship using genetic
markers. Molecular Ecology, 8, 1231–1234.
Gorman ML, Milne H (1972) Crèche behaviour in the common
eider Somateria m. mollissima L. Ornis Scandinavica, 3, 21–25.
Goudet J (2001) FSTAT version 2.9.3, a program to estimate and test
gene diversities and fixation indices. Available from http://
www.unil.ch/izea/softwares/fstat.html.
Griffin AS, West SA (2003) Kin discrimination and the benefit of
helping in cooperatively breeding vertebrates. Science, 302,
634–636.
Hamilton WD (1964) The genetical theory of social behavior, I and
II. Journal of Theoretical Biology, 7, 1–52.
Kilpi M, Öst M, Lindström K, Rita H (2001) Female characteristics
and parental care mode in the crèching system of eiders, Somateria
mollissima. Animal Behaviour, 62, 527–534.
Kokko H, Johnstone RA, Clutton-Brock TH (2001) The evolution
of cooperative breeding through group augmentation. Proceedings of the Royal Society of London. Series B, Biological Sciences, 268,
187–196.
Libants S, Oswald K, Olle E, Scribner K (2001) Isolation of microsatellite loci from the spectacled eider, Somateria fischeri. Unpublished. Available from http://www.ncbi.nlm.nih.gov/Genbank/.
3908 M . Ö S T E T A L .
Meijer T, Drent R (1999) Re-examination of the capital and income
dichotomy in breeding birds. Ibis, 141, 399 – 414.
Munro J, Bédard J (1977) Crèche formation in the common eider.
Auk, 94, 759–771.
Nei M (1987) Molecular Evolutionary Genetics. Columbia University
Press, New York.
Noë R (2001) Biological markets: partner choice as the driving force
behind the evolution of mutualisms. In: Economics in Nature
(eds Noë R, Hammerstein P, van Hooff JARAM), pp. 93–118.
Cambridge University Press, Cambridge, UK.
Olendorf R, Getty T, Scribner K (2004) Cooperative nest defence in
red-winged blackbirds: reciprocal altruism, kinship or by-product
mutualism? Proceedings of the Royal Society of London. Series B,
Biological Sciences, 271, 177–182.
Öst M (1999) Within-season and between-year variation in the
structure of common eider broods. Condor, 101, 598–606.
Öst M, Kilpi M (1999) Parental care influences the feeding behaviour
of female eiders Somateria mollissima. Annales Zoologici Fennici, 36,
195–204.
Öst M, Kilpi M (2000) Eider females and broods from neighboring
colonies use segregated local feeding areas. Waterbirds, 23, 24–32.
Öst M, Mantila L, Kilpi M (2002) Shared care provides timebudgeting advantages for female eiders. Animal Behaviour, 64,
223–231.
Öst M, Ydenberg R, Kilpi M, Lindström K (2003a) Condition and
coalition formation by brood-rearing common eider females.
Behavioral Ecology, 14, 311– 317.
Öst M, Ydenberg R, Lindström K, Kilpi M (2003b) Body condition
and the grouping behavior of brood-caring female common
eiders (Somateria mollissima). Behavioral Ecology and Sociobiology,
54, 451–457.
Parker H, Holm H (1990) Patterns of nutrient and energy expenditure in female common eiders nesting in the high arctic. Auk,
107, 660–668.
Pettifor RA, Perrins CM, McCleery RH (1988) Individual optimization of clutch size in great tits. Nature, 336, 160–162.
Queller DC, Strassmann JE (1998) Kin selection and social insects.
Bioscience, 48, 165–175.
Raymond M, Rousset F (1995) genepop (version 1.2): population
genetics software for exact tests and ecumenicism. Journal of
Heredity, 86, 248–249.
Reeve HK, Emlen ST (2000) Reproductive skew and group size: an
N-person staying incentive model. Behavioral Ecology, 11, 640–647.
Ross KG (2001) Molecular ecology of social behaviour: analyses of
breeding systems and genetic structure. Molecular Ecology, 10,
265–284.
Sachs JL, Mueller UG, Wilcox TP, Bull JJ (2004) The evolution of
cooperation. Quarterly Review of Biology, 79, 135–160.
Sambrook J, Fritsch EF, Maniatus T (1989) Molecular Cloning: A
Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York.
Savard J-PL, Reed A, Lesage L (1998) Brood amalgamation in surf
scoters Melanitta perspicillata and other Mergini. Wildfowl, 49, 129–138.
Swennen C (1990) Dispersal and migratory movements of
eiders Somateria mollissima breeding in the Netherlands.
Ornis Scandinavica, 21, 17–27.
Tiedemann R, Noer H (1998) Geographic partitioning of mitochondrial DNA patterns in European eider Somateria mollissima.
Hereditas, 128, 159–166.
Tiedemann R, von Kistowski KG, Noer H (1999) On sex-specific
dispersal and mating tactics in the common eider Somateria
mollissima as inferred from the genetic structure of breeding
colonies. Behaviour, 136, 1145–1155.
Trivers RL (1971) The evolution of reciprocal altruism. Quarterly
Review of Biology, 46, 35–57.
This joint project involves a diverse array of research profiles.
Markus Öst’s main research interest is parental care cooperation
and conflict in waterfowl; an interest shared by Mikael Kilpi, who
also studies seabird conservation biology. Emma Vitikainen and
Liselotte Sundström, with a shared interest in eusocial insects,
provided genetic expertise. Peter Waldeck is currently doing his
PhD thesis on conspecific brood parasitism in ducks, Tuula
Hollmén and Christian Franson are studying contaminants and
disease of seaducks, and Kai Lindström’s prime research interests
are sexual selection and parental care in fish.
© 2005 Blackwell Publishing Ltd, Molecular Ecology, 14, 3903–3908