Cardiovascular Research 53 (2002) 460–469
www.elsevier.com / locate / cardiores
TNFa decreases aMHC expression by a NO mediated pathway: role
of E-box transcription factors for cardiomyocyte specific gene
regulation
Denise Hilfiker-Kleiner a , Andres Hilfiker a , Bernhard Schieffer a , David Engel b , Douglas
L. Mann b , Kai C. Wollert a , Helmut Drexler a , *
a
Department of Cardiology and Angiology, Medizinische Hochschule Hannover, Carl-Neuberg Strasse 1, 30625 Hannover, Germany
b
Winters Center for Heart Failure Research, Baylor College of Medicine, 2002 Holocombe Boulevard, Houston, TX 77030, USA
Received 20 July 2001; accepted 12 September 2001
Abstract
Objective: Tumor necrosis factor a (TNFa) is thought to play a key role in the pathogenesis of cardiac failure. In the myocardium,
TNFa enhances the expression of inducible nitric oxide synthase (iNOS). Nitric oxide (NO) has been shown to affect b-agonistdependent cardiac contractility and relaxation. It is not clear, however, whether TNFa mediated NO release has sustained cardiac effects,
by altering expression of cardiomyocyte specific genes such as a-myosin heavy chain (aMHC). Methods: Neonatal rat ventricular
cardiomyocytes (CM) were stimulated with TNFa and / or the NOS inhibitor nitro-L-arginine (L-NNA). Protein binding to the E-box
enhancer element in the aMHC promoter was evaluated by electrophoretic mobility shift assay (EMSA) and transcriptional activity of the
E-box consensus motif was determined by luciferase assay. mRNA levels of the endogenous aMHC gene were assessed by RT–PCR. In
vivo studies were performed in transgenic mice with cardiac specific over-expression of TNFa. Results: CM treated with TNFa exhibited
decreased levels of aMHC transcripts (6968% of control), the effect of TNFa was reversed by L-NNA (94614% of control). As shown
by EMSA, TNFa reduced protein binding to the aMHC E-box enhancer motif via NO dependent pathways. Addition of the NO-donor
sodium nitroprusside (SNP) to CM nuclear extracts dose dependently disrupted protein binding to the aMHC E-box. Furthermore,
exposure of CM to TNFa or SNP decreased transcription from an E-box luciferase-reporter construct (TNFa: 74612%; SNP 250 mM:
72610%; SNP 500 mM: 66611% of control). In myocardial tissue of TNFa transgenic mice, increased nitrotyrosine staining, decreased
protein binding to the aMHC E-box motif and reduced expression of aMHC (62626%) were observed. Conclusions: The present study
shows that TNFa reduces aMHC transcript levels in cardiomyocytes. Our data obtained in cultured CM and in TNFa transgenic mice
support the notion that TNFa exerts these effects by NO and E-box dependent mechanisms in vitro and possibly in vivo.  2002
Elsevier Science B.V. All rights reserved.
Keywords: Cell culture / isolation; Cytokines; Gene expression; Heart failure; Nitric oxide
1. Introduction
Patients with chronic heart failure (CHF) display elevated plasma and cardiac levels of the pro-inflammatory
cytokine tumor necrosis factor a (TNFa) [1,2]. TNFa
promotes cardiac hypertrophy, ventricular dilatation, negative inotropy and CHF in experimental studies [3–9],
*Corresponding author: Tel.: 149-511-532-3840; fax: 149-511-5325412.
E-mail address: [email protected] (H. Drexler).
suggesting that TNFa may play a pathophysiological role
in CHF.
TNFa effects are mediated through several signaling
cascades including protein kinase C, mitogen-activated
protein kinases and inducible nitric oxide synthase (iNOS)
[3,8–10]. Nitric oxide (NO) has been implicated in the
negative inotropic effects of TNFa [11]. It is not known,
however, whether TNFa mediated increase in NO production affects cardiomyocyte gene expression.
Myosin heavy chains are the ‘molecular motor’ of the
Time for primary review 18 days.
0008-6363 / 02 / $ – see front matter  2002 Elsevier Science B.V. All rights reserved.
PII: S0008-6363( 01 )00463-1
D. Hilfiker-Kleiner et al. / Cardiovascular Research 53 (2002) 460 – 469
heart, and contractile properties heavily depend on the
isoform composition of myosin heavy chain proteins.
Expression of the two isoforms present in the adult
mamalian heart, a- and b-myosin heavy chain (aMHC and
bMHC), has received close attention in the past. In
experimental models of cardiac hypertrophy and failure
and in patients with CHF, a down-regulation of aMHC
and an up-regulation of bMHC is observed. This shift in
isoform composition results in a reduction of contractile
velocity and reduced energy expenditure [12–14].
Expression of the aMHC gene is restricted to the heart
and is controlled mostly at the level of transcription [15],
making it an excellent target to analyze mechanisms of
cardiac specific gene regulation. Among several positive
and negative cis-acting elements, the E-box motif
(CANNTG) represents an enhancer element which has
been implicated in the hemodynamic and cAMP-dependent
transcriptional control of the aMHC gene, although flanking M-CAT, CarG, A / T-rich and MEF2 motifs further
specify transcriptional regulation [12,16–21]. In addition,
studies in skeletal muscle demonstrate NO dependent
regulation of E-box transcriptional activities [22] suggesting that the E-box might be susceptible to NO dependent transcriptional regulation also in cardiomyocytes.
In this study, we present evidence that TNFa depresses
aMHC gene expression by NO-dependent mechanisms in
vitro, possibly via decreased transcriptional activity of the
E-box enhancer element, located in the aMHC promoter.
Additional studies in transgenic mice with cardiac specific
overexpression of TNFa suggest that these mechanisms
may also operate in vivo.
2. Methods
Cell culture media, recombinant TNFa, sodium nitroprusside (SNP), N-nitro-L-arginine (L-NNA) and all other
chemicals were purchased from Sigma.
2.1. Cardiomyocyte isolation and transfection
Primary cardiomyocytes (CM) were isolated from 1- to
3-day-old Sprague–Dawley rats [23]. Cells were plated at
a density of 5310 4 cells per cm 2 in DMEM / M199
supplemented with 10% horse serum and 5% FCS. After
24 h, cells were switched to serum-free medium. CM were
transfected for 6 h with luciferase-reporter plasmids containing the thymidine kinase minimal promoter (pmin-tkluc) or the min-tk fused to a basic E-box motif (CACGTG)
(pM4-min-tk-luc) [24] using Lipofectamin (GIBCO) in
DMEM / M199 supplemented with 5% FCS. After transfection, CM were washed and kept for 24 h in DMEM / M199
before stimulation. Transfection efficiency was controlled
by co-transfection with a vector expressing constitutively
active green fluorescence protein (pAdTrackCMV, [31]).
No difference in the number of transfected cells was
461
observed 24 h after treatment. Luciferase assays (Luciferase Assay Kit, Promega) were performed with whole cell
lysates using equal amounts of protein (BIORAD Protein
Assay, Bradford, UK).
2.2. Tissue source
Transgenic mice with cardiac-specific TNFa over-expression (n54) and wildtype litter mates (n54) were
sacrificed at 1462 weeks of age. Left ventricular tissue
was isolated, snap-frozen in liquid nitrogen and stored at
2808C. TNFa transgenic mice display a transition to
cardiac dilatation by 12 weeks of age [25]. The studies
were performed in accordance with NIH guidelines for the
use of experimental animals (NIH Publication No. 85-23,
revised 1996).
2.3. RNA isolation and analysis
RNA was isolated from cells or mouse tissue by
TriZolE (GIBCO). cDNA was synthesized from 2 mg total
RNA (SuperScript II, GIBCO). RT–PCR was performed
using the following primers: rat G3PDH as published
previously [26], mouse aMHC according to gene bank
accession number M76599 (59-ACGGCCCTTTGACATCC-39, 59-CGGACACCTCTCCCTGAG-39). For verification of RT–PCR products, amplified cDNAs were initially
subcloned into pGEM-T (Promega) and sequenced. Samples were tested for equal G3PDH content before aMHC
RT–PCR was performed under linear amplification conditions. Bands were densiometrically scanned using
Quantity One (BIORAD).
2.4. Electrophoretic mobility shift assay ( EMSA)
EMSA was performed as described previously [27,28]
with some modifications. In brief: protein extracts from
various mouse tissues were obtained by homogenization in
Totex-buffer (20 mM Hepes pH 7.5, 400 mM NaCl, 1 mM
MgCl 2 , 0.5 mM EDTA, 0.1 mM EGTA, 20% Glycerol,
1% Nonidet P-40, supplemented with 5 mM DTT, 0.01%
Aprotinin, and 1 mM PMSF). CM were scraped into PBS,
briefly centrifuged and lysed in Totex-buffer. Protein
concentrations were determined (BIORAD, Protein Assay,
Bradford). Oligonucleotides: an E-box element located at
position 247 in the aMHC promoter (aMHC E-box)
59GACTCCAAATTTAGGCAGCAGGCACGTGGAATGAGC39 [21] and an E-box element of the MCK promoter
(MCK E-box) 59CCCAACACCTGCTGCCTGCTGAGCC39 [22] were end-labeled with T4 polynucleotide kinase
(NEB). Then, 10–20 mg protein were incubated with 1 ng
of labeled oligonucleotide in 20 ml binding buffer (25 mM
Hepes pH 7.5, 5 mM MgCl 2 , 1 mM KCl, 0.05 mg / ml
dIdC, 0.1 mg / ml BSA, 1 mM DTT, 0.01% Aprotinin, 1
462
D. Hilfiker-Kleiner et al. / Cardiovascular Research 53 (2002) 460 – 469
mM PMSF) for 30 min on ice. DNA–protein complexes
were separated on 5% polyacrylamide gels and subjected
to autoradiography. Bands were finally scanned using
Quantity One (BIORAD).
2.5. Nitrotyrosine immunohistochemistry
Paraffin embedded myocardial sections from TNFa
transgenic and wildtype mice were deparaffinized in
xylene and rehydrated in graded EtOH concentrations.
Endogenous peroxidase activity was blocked by treating
sections with 1% H 2 O 2 for 15 s. Sections were then
blocked in 2% goat serum in PBS for 1 h. Incubation with
the primary anti-nitrotyrosine polyclonal antibody (Upstate
Biotech., 5 mg / ml) was performed in a humidified
chamber for 1 h. Sections were subsequently washed in
PBS and incubated with a biotinylated secondary antibody
(Vectastain ABC elite secondary antibody, 1:50 dilution),
followed by incubation with an avidin–biotin detection
system and the peroxidase substrate, diaminobenzidine
(DAB) according to the manufacturer’s instructions (Vector Labs). The sections were finally counterstained with
hematoxylin and visualized by light microscopy.
2.6. Statistical analysis
All data are given as mean6S.D. of at least three
separate experiments. Differences were evaluated by
ANOVA. Statistical significance was defined as P,0.05.
3. Results
3.1. TNFa decreases the level of a MHC mRNA in
cardiomyocytes through nitric oxide-dependent
mechanisms
Ventricular myocytes (CM) were treated with recombinant TNFa (20 ng / ml) for 48 h, and aMHC transcripts
levels were assessed by RT–PCR. TNFa treated cells
exhibited a marked decrease (P,0.02) in aMHC mRNA
concentration (Fig. 1).
To examine the role of nitric oxide (NO) in mediating
TNFa effects on aMHC transcript levels, we employed the
NOS inhibitor L-NNA (500 mM). Addition of L-NNA 30
min prior to treatment with TNFa abolished the inhibitory
effect of TNFa on aMHC mRNA expression in CM
(P,0.02) (Fig. 1). L-NNA alone did not significantly
increase aMHC mRNA levels (data not shown).
3.2. TNFa attenuates E-box protein binding activities
via nitric oxide
aMHC transcription is regulated in part by E-box
dependent mechanisms [21,29]. At least three DNA–protein complexes with different migration properties were
observed when nuclear extracts from CM were incubated
with the aMHC E-box oligonucleotide (Fig. 2A). Specificity of binding was confirmed by adding a 100-fold
excess of unlabeled aMHC E-box oligonucleotide, which
abolished DNA-protein binding of the three complexes
(data not shown).
Exposure of CM to TNFa (20 ng / ml, 48 h) significantly
reduced (P,0.05) DNA-protein binding of the complex
indicated by arrow 3 (Fig. 2). Additional complexes,
indicated by arrows 1 and 2 (Fig. 2), were not affected by
TNFa. Addition of L-NNA (500 mM) restored E-box
binding in TNFa treated cells (Fig. 2A). L-NNA alone did
not significantly affect E-box binding (data not shown).
Densitometric analyses of the binding intensity of complex
3 (Fig. 2, arrow 3) are summarized in Fig. 2B.
3.3. Sodium-nitroprusside ( SNP) and TNFa decrease
transcriptional activity of an E-box luciferase plasmid in
CM
To investigate whether protein binding to the aMHC
E-box is directly affected by nitric oxide, DNA-binding
reactions of nuclear extracts isolated from CM were
incubated with the NO donor SNP in the presence of 1
mM DTT (Fig. 3A). SNP releases NO in the presence of
DTT and increases nitrosoactive stress in binding reactions
[30]. DNA–protein binding was disrupted dose-dependently by SNP (Fig. 3A). To determine whether TNFa and
NO attenuate not only DNA–protein binding, but also
E-box dependent gene transcription, CM were transfected
with a luciferase-reporter construct driven by an E-box
promoter (pM4-min-tk-luc) [24]. CM transfected with the
E-box promoter luciferase-reporter plasmid displayed significantly (P,0.05) higher luciferase activities as compared to CM transfected with a control plasmid (Fig. 3B).
Addition of TNFa or SNP significantly reduced (P,0.05)
luciferase activities in E-box promoter luciferase-reporter
plasmid transfected cells (Fig. 3B).
3.4. Mice with cardiac specific over-expression of TNFa
display enhanced nitrotyrosine staining, and a decrease
in E-box binding and a MHC transcript levels
Cardiac specific over-expression of TNFa in mice
results in concentric hypertrophy which transitions to a
dilated cardiac phenotype by 12 weeks of age [25]. TNFa
transgenic mice (age: 1462 weeks) exhibited significantly
reduced (P,0.05) aMHC mRNA levels as compared to
wildtype siblings (Fig. 4). To investigate whether the
reduction in aMHC expression was associated with increased NO production, we determined the NO content in
wildtype and in TNFa transgenic myocardium. Nitrotyrosine staining in cross sections served as a marker for
increased NO production. Nitrotyrosine staining was almost absent in wildtype hearts (Fig. 5, panel A and B). By
contrast, there was abundant nitrotyrosine staining in
D. Hilfiker-Kleiner et al. / Cardiovascular Research 53 (2002) 460 – 469
463
Fig. 1. (A) Analysis of aMHC mRNA levels by RT–PCR in CM after exposure to TNFa (20 ng / ml) with or without pre-incubation (30 min) with L-NNA
(500 mM). G3PDH content was used as an internal control. (B) Bar graph summarizing results obtained from four individual cell preparations, performed
in duplicates. * P,0.02; n.s., not significant.
TNFa transgenic hearts (Fig. 5, panel C and D) consistent
with high levels of nitric oxide in mutant mice. The same
staining pattern was observed in additional three mutant
and three wildtype mice.
The aMHC E-box oligonucleotide forms several DNA–
protein complexes of different migration properties when
incubated with extracts of spleen, liver, skeletal muscle
and heart (Fig. 6A). In mouse hearts, four major complexes
were observed (Fig. 6A). The fact that an unrelated E-box
containing oligonucleotide (derived from the muscle
creatine kinase promoter, MCK E-box [22]) was recognized by at least three protein complexes with identical
migration properties (Fig. 6B and C, arrows 1, 3 and 4),
which were fully competed away by 100-fold excess of
unlabeled aMHC E-box oligonucleotide (data not shown),
confirmed the specificity of these three DNA–protein
complexes to the E-box motif within the aMHC E-box
oligonucleotide. In order to investigate whether increased
nitrotyrosine staining in TNFa over-expressing myocardium correlates with a reduction of E-box binding, we
analyzed E-box binding in myocardial extracts from
wildtype and TNFa transgenic mice, using both the
aMHC E-box and the MCK E-box oligonucleotides.
Binding analyses of both oligonucleotides revealed re-
464
D. Hilfiker-Kleiner et al. / Cardiovascular Research 53 (2002) 460 – 469
Fig. 2. (A) Representative EMSA showing protein binding to the aMHC E-box oligonucleotide in nuclear extracts (10 mg) of CM exposed to TNFa (20
ng / ml) alone or after treatment with L-NNA (500 mM, 30 min). Arrows 1, 2 and 3 point to major DNA-protein complexes detected in CM. Arrow 3 points
to a DNA-protein complex that is regulated by TNFa and L-NNA. (B) The bar graph summarizes densitometric analyses of the DNA–protein complex 3
from three individual cell preparations. * P,0.05; n.s., not significant.
duced DNA–protein binding of two complexes (Fig. 6B
and C, arrow 3 and 4). Similar findings were observed in
additional three transgenic and two wildtype mice.
4. Discussion
Our study demonstrates for the first time that TNFa
mediated increased production of nitric oxide in the heart
has sustained effects, by altering transcription: (1) from a
common muscle specific enhancer element, E-box; and (2)
of the cardiac specific gene, aMHC.
Serum levels of TNFa are elevated in patients with CHF
and expression of TNFa emerges in cardiomyocytes of
failing hearts [1,2,32]. Mice with cardiac specific overexpression of TNFa develop a profound dilated cardiomyopathy-like phenotype and activation of the fetal
gene program [6,33], indicating a role for TNFa in the
pathogenesis of CHF. Most studies so far have focused on
the induction of cardiac hypertrophy and remodeling by
TNFa [25,34,35]. In contrast, we examined the impact of
TNFa on the transcriptional regulation of aMHC, a key
protein of the cardiomyocyte contractile apparatus, which
is down-regulated in the failing myocardium [12–14].
aMHC gene expression is regulated mainly at the level
of transcription [15]. Our observation that aMHC downregulation by TNFa was achieved in part by NO dependent pathways raised the question whether NO directly
affects transcriptional regulation of aMHC. Indeed, NO
directly interfered with protein binding to the aMHC
E-box motif in CM nuclear extracts, indicating that
transcription factors binding to the E-box are sensitive to
redox modification or nitrosylation. In our studies, shortterm and direct incubation of cell lysates with the NOdonor SNP was more efficient in disrupting protein binding
to the E-box as compared to chronic whole cell stimulation
with TNFa. Differences in NO concentration and timekinetics may explain this observation (rapid NO release
from SNP vs. delayed and extended NO-synthesis following TNFa stimulation). However, other mechanism(s)
cannot be excluded. Our observation, that TNFa and SNP,
decreased transcriptional activity of an E-box luciferasereporter plasmid, demonstrates that TNFa and NO not
only alter E-box binding, but also decrease E-box depen-
D. Hilfiker-Kleiner et al. / Cardiovascular Research 53 (2002) 460 – 469
465
Fig. 3. (A) Representative EMSA performed with nuclear extracts from CM, to which increasing concentrations of SNP were added (10 mg, 1 mM DTT,
15 min on ice). (B) Transient transfection analysis of CM with luciferase reporter plasmids containing a minimal promoter (pmin-tk-luc) or the basic E-box
promoter, CACGTG, (pM4-min-tk-luc). TNFa and SNP were added immediately after transfection and promoter activities were measured after 24 h.
Experiments were performed in triplicates and the bar graph summarizes data from three individual cell preparations. * P,0.05.
Fig. 4. (A) Quantification of aMHC mRNA content in LV of wildtype and TNFa transgenic mice by RT–PCR. G3PDH content served as internal control.
(B) The bar graph summarizes data obtained from four wildtype and four transgenic mice. * P,0.05.
466
D. Hilfiker-Kleiner et al. / Cardiovascular Research 53 (2002) 460 – 469
Fig. 5. Nitrotyrosine staining in myocardial sections from wildtype and TNFa transgenic mice. Panels A (310 magnification) and B (340 magnification) show nitrotyrosine staining in wildtype
whereas panels C (310 magnification) and D (340 magnification) show nitrotyrosine staining in TNFa transgenic mice.
D. Hilfiker-Kleiner et al. / Cardiovascular Research 53 (2002) 460 – 469
467
Fig. 6. (A) Representative EMSA showing protein binding to the aMHC E-box oligonucleotide in protein extracts (20 mg) derived from different wildtype
(WT) mice organs, i.e. spleen, liver, skeletal muscle and heart. Arrows 1 to 5 point to major DNA-protein complexes, arrows 1 to 4 indicate DNA–protein
complexes observed in the heart. (B) Representative EMSA showing protein binding to the aMHC E-box oligonucleotide using myocardial protein extracts
(20 mg) from wildtype (WT) or TNFa transgenic (TG) mice. (C) Representative EMSA showing protein binding to the MCK E-box oligonucleotide using
myocardial protein extracts (20 mg) from WT and TG mice. Competition assays were performed with WT protein extracts using 100-fold excess of
unlabeled aMHC E-box oligonucletide (B) or with 100-fold excess of unlabeled MCK E-box oligonucletide (C). Similar results were obtained with
additional two WT and three TG mice.
dent transcription. Transcriptional regulation by redox and
nitrosoactive stress has been described for several transcription factors including AP-1, Sp-1, NF-kB and p53
[36]. It has been shown in skeletal muscle that the E-box
binding transcription factor JunD is regulated by nitrosoactive stress [22].
E-box motifs have been implicated in cell cycle control
as well as in muscle differentiation. bHLH transcription
factors including c-Myc, Max, MAD, MyoD, myogenin
and JunD bind to E-box motifs [22,24,37]. In cardiomyocytes, several tissue-specific and ubiquitously expressed E-box binding transcription factors, e.g. transcription enhancer factor 1 (TEF1), Max, upstream stimulatory
factor 1 (USF1) [21,38], have been described. Our finding
that E-box DNA–protein binding complexes show a heartspecific pattern may indicate that E-boxes are involved in
cardiomyocyte specific gene expression. In rat cardiomyocyte culture, three DNA–protein complexes were
detected by EMSA. By contrast, four complexes were
observed in mouse cardiac tissue. Although we have not
specifically addressed the reason(s) for this disparity, it is
possible that heart extracts contain additional DNA–binding proteins, which are expressed only in non-cardiomyocytes, i.e. cell types that are much less abundant in
cardiomyocyte cultures. Species differences (cardiomyocytes from rats, tissue from mice) are less likely to
explain the different number of DNA–protein complexes,
because, similar to the situation in mouse heart tissue, we
have detected four DNA–protein complexes by EMSA in
rat heart tissue (data not shown). Interestingly, binding
intensities of complexes predominantly observed in the
myocardium, are decreased in failing hearts of TNFa
transgenic mice, implicating a regulation by TNFa. It will
be interesting to elucidate whether E-box binding transcription factors are affected in their expression levels
and / or activity by TNFa and / or nitrosoactive stress in the
heart. So far, we do not know the transcription factor
composition of individual E-box binding complexes in CM
or mouse hearts. In preliminary studies, however, we have
observed reduced expression of JunD in TNFa over-
468
D. Hilfiker-Kleiner et al. / Cardiovascular Research 53 (2002) 460 – 469
expressing mice (data not shown). In future experiments
we will analyze whether JunD is an E-box binding
transcription factor in CM and whether it is susceptible to
regulation by TNFa and / or nitrosoactive stress.
Cell culture models have limitations and may not always
reflect the in vivo situation. Therefore, we used TNFa
transgenic mice to confirm our in vitro data. In this model,
we observed increased NO production (nitrotyrosine staining) and reduced E-box binding as well as decreased
mRNA levels of aMHC. These observations support the
notion that TNFa may suppress aMHC expression via NO
and E-box dependent mechanisms also in the in vivo
situation.
[12]
[13]
[14]
[15]
[16]
Acknowledgements
We are grateful to Silvia Gutzke for technical support.
This study was supported in part by the Deutsche Forschungsgemeinschaft (SFB 244).
[17]
[18]
References
[19]
[1] Levine B, Kalman J, Mayer L et al. Elevated circulating levels of
tumor necrosis factor in severe chronic heart failure. N Engl J Med
1990;323:236–241.
[2] Torre-Amione G, Kapadia S, Benedict C et al. Proinflammatory
cytokine levels in patients with depressed left ventricular ejection
fraction: a report from the Studies of Left Ventricular Dysfunction
(SOLVD). J Am Coll Cardiol 1996;27:1201–1206.
[3] Yokoyama T, Vaca L, Rossen RD et al. Cellular basis for the
negative inotropic effects of tumor necrosis factor-alpha in the adult
mammalian heart. J Clin Invest 1993;92:2303–2312.
[4] Pagani FD, Baker LS, Hsi C et al. Left ventricular systolic and
diastolic dysfunction after infusion of tumor necrosis factor-alpha in
conscious dogs. J Clin Invest 1992;90:389–398.
[5] Mann DL, Young JB. Basic mechanisms in congestive heart failure.
Recognizing the role of proinflammatory cytokines. Chest
1994;105:897–904.
[6] Kubota T, McTiernan CF, Frye CS et al. Dilated cardiomyopathy in
transgenic mice with cardiac-specific overexpression of tumor
necrosis factor-alpha. Circ Res 1997;81:627–635.
[7] Muller-Werdan U, Schumann H, Fuchs R et al. Tumor necrosis
factor alpha (TNF alpha) is cardiodepressant in pathophysiologically
relevant concentrations without inducing inducible nitric oxide(NO)-synthase (iNOS) or triggering serious cytotoxicity. J Mol Cell
Cardiol 1997;29:2915–2923.
[8] Muller-Werdan U, Schumann H, Loppnow H et al. Endotoxin and
tumor necrosis factor alpha exert a similar proinflammatory effect in
neonatal rat cardiomyocytes, but have different cardiodepressant
profiles. J Mol Cell Cardiol 1998;30:1027–1036.
[9] Finkel MS, Oddis CV, Jacob TD et al. Negative inotropic effects of
cytokines on the heart mediated by nitric oxide. Science
1992;257:387–389.
[10] Clerk A, Harrison JG, Long CS et al. Pro-inflammatory cytokines
stimulate mitogen-activated protein kinase subfamilies, increase
phosphorylation of c-Jun and ATF2 and upregulate c-Jun protein in
neonatal rat ventricular myocytes. J Mol Cell Cardiol
1999;31:2087–2099.
[11] Stein B, Frank P, Schmitz W et al. Endotoxin and cytokines induce
direct cardiodepressive effects in mammalian cardiomyocytes via
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
induction of nitric oxide synthase. J Mol Cell Cardiol
1996;28:1631–1639.
Nadal-Ginard B, Mahdavi V. Molecular basis of cardiac performance. Plasticity of the myocardium generated through protein
isoform switches. J Clin Invest 1989;84:1693–1700.
Calderone A, Takahashi N, Izzo Jr. NJ et al. Pressure- and volumeinduced left ventricular hypertrophies are associated with distinct
myocyte phenotypes and differential induction of peptide growth
factor mRNAs. Circulation 1995;92:2385–2390.
Lowes BD, Minobe W, Abraham WT et al. Changes in gene
expression in the intact human heart. Downregulation of alphamyosin heavy chain in hypertrophied, failing ventricular myocardium. J Clin Invest 1997;100:2315–2324.
Izumo S, Lompre AM, Matsuoka R et al. Myosin heavy chain
messenger RNA and protein isoform transitions during cardiac
hypertrophy. Interaction between hemodynamic and thyroid hormone-induced signals. J Clin Invest 1987;79:970–977.
Baker DL, Dave V, Reed T et al. A novel E box /AT-rich element is
required for muscle-specific expression of the sarcoplasmic reticulum Ca 21 -ATPase (SERCA2) gene. Nucleic Acids Res
1998;26:1092–1098.
Gupta MP, Gupta M, Zak R. An E-box / M-CAT hybrid motif and
cognate binding protein(s) regulate the basal muscle-specific and
cAMP-inducible expression of the rat cardiac alpha-myosin heavy
chain gene. J Biol Chem 1994;269:29677–29687.
Izumo S, Mahdavi V. Thyroid hormone receptor alpha isoforms
generated by alternative splicing differentially activate myosin HC
gene transcription. Nature 1988;334:539–542.
Molkentin JD, Jobe SM, Markham BE. Alpha-myosin heavy chain
gene regulation: delineation and characterization of the cardiac
muscle-specific enhancer and muscle-specific promoter. J Mol Cell
Cardiol 1996;28:1211–1225.
Sartorelli V, Webster KA, Kedes L. Muscle-specific expression of
the cardiac alpha-actin gene requires MyoD1, CArG-box binding
factor, and Sp1. Genes Dev 1990;4:1811–1822.
Xiao Q, Ojamaa K. Regulation of cardiac alpha-myosin heavy chain
gene transcription by a contractile-responsive E-box binding protein.
J Mol Cell Cardiol 1998;30:87–95.
Buck M, Chojkier M. Muscle wasting and dedifferentiation induced
by oxidative stress in a murine model of cachexia is prevented by
inhibitors of nitric oxide synthesis and antioxidants. EMBO J
1996;15:1753–1765.
Wollert KC, Taga T, Saito M et al. Cardiotrophin-1 activates a
distinct form of cardiac muscle cell hypertrophy. Assembly of
sarcomeric units in series via gp130 / leukemia inhibitory factor
receptor-dependent pathways. J Biol Chem 1996;271:9535–9545.
Sommer A, Burkhardt H, Keyse SM et al. Synergistic activation of
the mkp-1 gene by protein kinase A signaling and USF, but not
c-Myc. FEBS Lett 2000;474:146–150.
Sivasubramanian N, Coker ML, Kurrelmeyer KM et al. Left
ventricular remodeling in transgenic mice with cardiac restricted
overexpression of tumor necrosis factor. Circulation 2001;104:826–
831.
Schieffer B, Schieffer E, Hilfiker-Kleiner D et al. Expression of
angiotensin II and interleukin 6 in human coronary atherosclerotic
plaques: potential implications for inflammation and plaque instability. Circulation 2000;101:1372–1378.
Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription
initiation by RNA polymerase II in a soluble extract from isolated
mammalian nuclei. Nucleic Acids Res 1983;11:1475–1489.
Wollert KC, Heineke J, Westermann J et al. The cardiac fas (APO-1 /
CD95) receptor / Fas ligand system: relation to diastolic wall stress
in volume-overload hypertrophy in vivo and activation of the
transcription factor AP-1 in cardiac myocytes. Circulation
2000;101:1172–1178.
Molkentin JD, Markham BE. An M-CAT binding factor and an
RSRF-related A-rich binding factor positively regulate expression of
D. Hilfiker-Kleiner et al. / Cardiovascular Research 53 (2002) 460 – 469
[30]
[31]
[32]
[33]
[34]
the alpha-cardiac myosin heavy-chain gene in vivo. Mol Cell Biol
1994;14:5056–5065.
Bates JN, Baker MT, Guerra RJ, et al. Nitric oxide generation from
nitroprusside by vascular tissue. Evidence that reduction of the
nitroprusside anion and cyanide loss are required. Biochem Pharmacol 1991; S157–S165.
He TC, Zhou S, da Costa LT et al. A simplified system for
generating recombinant adenoviruses. Proc Natl Acad Sci USA
1998;95:2509–2514.
Testa M, Yeh M, Lee P et al. Circulating levels of cytokines and
their endogenous modulators in patients with mild to severe
congestive heart failure due to coronary artery disease or hypertension. J Am Coll Cardiol 1996;28:964–971.
Bryant D, Becker L, Richardson J et al. Cardiac failure in transgenic
mice with myocardial expression of tumor necrosis factor-alpha.
Circulation 1998;97:1375–1381.
Siwik DA, Chang DL, Colucci WS. Interleukin-1beta and tumor
[35]
[36]
[37]
[38]
469
necrosis factor-alpha decrease collagen synthesis and increase
matrix metalloproteinase activity in cardiac fibroblasts in vitro. Circ
Res 2000;86:1259–1265.
Kubota T, Bounoutas GS, Miyagishima M et al. Soluble tumor
necrosis factor receptor abrogates myocardial inflammation but not
hypertrophy in cytokine-induced cardiomyopathy. Circulation
2000;101:2518–2525.
Sun Y, Oberley LW. Redox regulation of transcriptional activators.
Free Radic Biol Med 1996;21:335–348.
Evans SM, Walsh BA, Newton CB et al. Potential role of helix-loophelix proteins in cardiac gene expression. Circ Res 1993;73:569–
578.
Gupta MP, Amin CS, Gupta M et al. Transcription enhancer factor 1
interacts with a basic helix-loop-helix zipper protein. Max, for
positive regulation of cardiac alpha-myosin heavy-chain gene expression. Mol Cell Biol 1997;17:3924–3936.