The Plant Journal (2008) 56, 364–375
doi: 10.1111/j.1365-313X.2008.03605.x
Molecular basis of the functional specificities of phototropin
1 and 2
Yusuke Aihara1, Ryohei Tabata2, Tomomi Suzuki1, Ken-ichiro Shimazaki2 and Akira Nagatani1,*
Department of Botany, Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan, and
2
Department of Biology, Faculty of Science, Kyushu University, Ropponmatsu, Fukuoka 810-8560, Japan
1
Received 24 February 2008; revised 25 April 2008; accepted 6 June 2008; published online 15 August 2008.
*
For correspondence (fax +81 75 753 4126; e-mail [email protected]).
Summary
A blue-light photoreceptor in plants, phototropin, mediates phototropism, chloroplast relocation, stomatal
opening, and leaf-flattening responses. Phototropin is divided into two functional moieties, the N-terminal
photosensory and the C-terminal signaling moieties. Phototropin perceives light stimuli by the light, oxygen
or voltage (LOV) domain in the N-terminus; the signal is then transduced intramolecularly to the C-terminal
kinase domain. Two phototropins, phot1 and phot2, which have overlapping and distinct functions, exist in
Arabidopsis thaliana. Phot1 mediates responses with higher sensitivity than phot2. Phot2 mediates specific
responses, such as the chloroplast avoidance response and chloroplast dark positioning. To elucidate the
molecular basis for the functional specificities of phot1 and phot2, we exchanged the N- and C-terminal
moieties of phot1 and phot2, fused them to GFP and expressed them under the PHOT2 promoter in the phot1
phot2 mutant background. With respect to phototropism and other responses, the chimeric phototropin
consisting of phot1 N-terminal and phot2 C-terminal moieties (P1n/2cG) was almost as sensitive as phot1;
whereas the reverse combination (P2n/1cG) functioned with lower sensitivity. Hence, the N-terminal moiety
mainly determined the sensitivity of the phototropins. Unexpectedly, both P1n/2cG and P2n/1cG mediated
the chloroplast avoidance response, which is specific to phot2. Hence, chloroplast avoidance activity
appeared to be suppressed specifically in the combination of N- and C-terminal moieties of phot1. Unlike the
chloroplast avoidance response, chloroplast dark positioning was observed for P2G and P2n/1cG but not for
P1G or P1n/2cG, suggesting that a specific structure in the N-terminal moiety of phot2 is required for this
activity.
Keywords: phototropin, blue light, Arabidopsis, LOV, photosensitivity, chloroplast relocation.
Introduction
In order to adapt to fluctuating environments, plants have
evolved mechanisms to perceive environmental stimuli. To
sense and respond to light stimuli, higher plants possess at
least four classes of photoreceptors: red/far-red photoreversible phytochromes (Mathews, 2006); UV-A/blue-lightabsorbing phototropins and cryptochromes; and ZTL/FKF/
LKP2 receptors (Banerjee and Batschauer, 2005). Among
these photoreceptors, phototropin mediates responses such
as phototropism (Huala et al., 1997; Sakai et al., 2001),
chloroplast relocation (Jarillo et al., 2001; Kagawa et al.,
2001), light-induced stomatal opening (Kinoshita et al.,
2001), and leaf flattening (Sakamoto and Briggs, 2002).
These responses optimize photosynthesis and minimize
photodamage.
364
Phototropin consists of two major functional moieties, the
N-terminal photosensory and the C-terminal signaling moieties. Within the N-terminal moiety, two light, oxygen, or
voltage (LOV) domains, LOV1 and LOV2, each bind noncovalently to a flavin mononucleotide chromophore, which
confers the photochemical activity. The C-terminal kinase
fragment, lacking the N-terminal photosensory moiety,
exhibits constitutive kinase activity both in vitro (Matsuoka
and Tokutomi, 2005) and in vivo (Kong et al., 2007). The
LOV2 domain, but not the LOV1 domain, is essential for the
basic biological functions of phototropins (Cho et al., 2007;
Christie et al., 2002). The Jahelix residing within the LOV2/
kinase linker region changes conformation in response to
light (Harper et al., 2003; Harper et al., 2004). The LOV2
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd
Domain-swap analysis of phot1 and phot2 365
domain is thought to physically interact with the kinase
domain to regulate the kinase activity (Matsuoka and
Tokutomi, 2005; Tokutomi et al., 2008).
Although phototropins lack transmembrane domains and
membrane-spanning motifs, they are associated with the
plasma membrane (Harada et al., 2003; Kong et al., 2006;
Sakamoto and Briggs, 2002). Upon light irradiation, a
fraction of phot1 is released from the plasma membrane
(Sakamoto and Briggs, 2002; Wan et al., 2008) whereas a
fraction of phot2 associates with the Golgi apparatus (Kong
et al., 2006). The C-terminal kinase domain is responsible for
the association of phot2 with the plasma membrane and the
Golgi apparatus (Kong et al., 2007).
Phototropins have been found in various plant species.
The structural properties of phototropins are highly conserved from the unicellular green alga Chlamydomonas
reinhardtii to higher plants (Briggs et al., 2001a,b; Lariguet
and Dunand, 2005). The phototropin of Chlamydomonas
regulates the sexual lifecycle in response to blue light (BL)
(Huang and Beck, 2003). Regardless of their distant relationship, Chlamydomonas phototropin is functional in
Arabidopsis thaliana, suggesting that the basic mechanism
of action of phototropin is highly conserved (Onodera et al.,
2005).
There are two phototropin homologs in Arabidopsis,
phot1 and phot2, which share approximately 60% sequence
identity (Briggs and Christie, 2002; Jarillo et al., 2001). Phot1
and phot2 have overlapping and distinct functions in
Arabidopsis. They function redundantly in phototropism,
the chloroplast accumulation response, stomatal opening,
and leaf flattening (Kinoshita et al., 2001; Sakamoto and
Briggs, 2002). However, phot1 is much more sensitive than
phot2 in some of these responses (Sakai et al., 2001).
Although both phot1 and phot2 mediate the chloroplast
accumulation response, the avoidance response is solely
mediated by phot2 (Sakai et al., 2001). In addition, phot2, but
not phot1, is required for chloroplast accumulation at the
bottom of the cell in darkness, known as dark positioning
(Suetsugu et al., 2005). The functional specificities of phot1
and phot2 could be attributed to the differences in the gene/
protein structure between phot1 and phot2. However, little is
known about the structural bases for the functional
specialization.
In the present study we constructed chimeric phototropins in which the N-terminal and C-terminal moieties were
exchanged between phot1 and phot2. These chimeric
phototropins were fused to GFP (P1n/2cG and P2n/1cG
proteins) and expressed in the phot1 phot2 double mutant
of Arabidopsis under the control of the authentic PHOT2
promoter (P2-P1n/2cG and P2-P2n/1cG lines). The resulting transgenic plants were subjected to physiological
analyses to determine which of the N- and C-terminal
moieties is responsible for the properties specific to phot1
or phot2.
Results
Transgenic plants expressing chimeric phototropins
Phototropin consists of two functional moieties, the
N-terminal photosensory moiety and the C-terminal kinase
moiety (Briggs et al., 2001a,b). To investigate how each of
these moieties contributes to the functional specificities of
phot1 and phot2, they were exchanged between phot1 and
phot2, fused to GFP (P1n/2cG and P2n/1cG), and expressed
in the Arabidopsis phot1-5 phot2-1 double mutant background under the control of the authentic PHOT2 promoter
(Figure 1a). Full-length phot1 and phot2 fused to GFP (P1G
and P2G) were expressed as controls. The resulting lines
were designated as P2-P1n/2cG, P2-P2n/1cG, P2-P1G, and
P2-P2G. Several independent lines that exhibited GFP fluorescence were selected for each construct and subjected
to further analysis.
We first observed the morphological phenotypes in those
lines (Figure 1b). The rosette leaves of the phot1-5 phot2-1
(a)
(b)
Figure 1. Expression of chimeric phototropins in transgenic Arabidopsis.
(a) Schematic diagrams of the constructs, PP2-P1n/2cG, PP2-P2n/1cG, PP2-P1G,
and PP2-P2G.
(b) Complementation of the leaf shape defect in transgenic plants expressing
chimeric phototropins. Photographs of 3-week-old plants. Arrows indicate
curled leaves. WT, wild type; p1p2, phot1phot2 double mutant. Bar = 1 cm.
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd, The Plant Journal, (2008), 56, 364–375
366 Yusuke Aihara et al.
double mutant curls downward (Sakamoto and Briggs,
2002). This phenotype was complemented in all the lines.
In contrast to plants expressing phot2 derivatives under the
control of the 35S promoter (Kong et al., 2007; Onodera
et al., 2005), the present lines grew normally without any
growth defect such as reduction in the size of the rosette leaf
or male sterility.
(a)
(b)
Expression levels of the P1G, P2G, P1n/2cG, and P2n/1cG
proteins
The expression levels of the introduced proteins were
examined by immunoblotting of rosette leaves (Figure 2a).
First, a P2-P2G line that expressed approximately endogenous levels of the introduced proteins was selected as a
control line (P2-P2G 44). The expression levels in other lines
were then examined with reference to P2-P2G 44. Consequently, P2-P1G 3, P2-P1n/2cG 7, and P1-P2n/1cG 35 were
selected as representative lines. A few additional lines were
selected for each construct and used in some experiments
for confirmation of the results. We then observed GFP fluorescence in those lines. As expected, the intensity of fluorescence was comparable between those lines, both in the
mesophyll (Figure 2b) and epidermis (data not shown).
The expression levels in dark-grown seedlings were
examined by immunoblotting (Figure 2c). For an unknown
reason, the levels of P2G in P2-P2G 44 and 49 were more
than twice as high as the endogenous phot2 level. Similar
over-accumulation was observed in P2-P2n/1cG but not in
P2-P1G or P2-P1n/2cG. In consistent with the immunoblotting result, P2-P2G 44 and P2-P2n/1cG 35 exhibited
higher GFP fluorescence than P2-P1G 3 or P2-P1n/2cG7 in
cotyledon mesophyll cells, although the fluorescence in
hypocotyl epidermis was comparable (Figure 2d). Hence,
the lower expressers (P2-P2G 52 and P2-P2n/1cG 46) were
additionally chosen for phototropic experiments (Figure 2c).
We confirmed that the GFP fluorescence was weaker in these
lines (data not shown).
Phototropins are autophosphorylated both in vitro
(Palmer et al., 1993; Sakai et al., 2001; Short et al., 1992)
and in vivo (Knieb et al., 2005; Salomon et al., 2003; Sullivan
et al., 2008) in a light-dependent manner. The autophosphorylation is accompanied by a mobility shift that is observable
by SDS-PAGE (Knieb et al., 2005; Salomon et al., 2003).
Hence, we examined the BL-induced electrophoretic mobility shift in vivo (Figure 3). The mature plants were adapted to
continuous red light (RL) for 24 h and then treated with BL.
The immunoblot analysis of the extracts indicated that all of
the recombinant phototropins were autophosphorylated in
response to BL. In addition, the levels of the introduced
proteins were not significantly changed by irradiation with
BL at 48 lmol m)2 sec)1 for 1 h in rosette leaves, although
light-dependent degradation of phot1 has been reported in
etiolated seedlings (Sakamoto and Briggs, 2002).
(c)
(d)
Figure 2. Detection of chimeric phototropins by immunoblotting and confocal microscopy.
(a) Immunoblot detection of chimeric phototropins in rosette leaves with an
anti-phot2 polyclonal (left) or an anti-GFP monoclonal (right) antibody.
Twenty (left) or 40 (right) lg of total protein were separated by 7.5% SDSPAGE.
(b) Confocal laser scanning microscopic observation of mature rosette leaves.
Green fluorescence from GFP and red fluorescence from chlorophyll were
overlaid electronically. Bar = 20 lm.
(c) Immunoblot detection of chimeric phototropins in etiolated seedlings with
an anti-phot2 polyclonal (upper) or an anti-GFP monoclonal (lower) antibody.
Forty (upper) or 80 (lower) lg of total protein from 3-day-old etiolated
seedlings were separated by 7.5% SDS-PAGE. *The endogenous phot1 crossreacted with the antibody in the upper panel. Circles and an arrow in the upper
panel indicate the endogenous phot2 and P2G, respectively.
(d) Confocal microscopic observation of etiolated seedlings. Hypocotyl
epidermal cells (top) and cotyledon mesophyll cells (bottom) of 3-day-old
etiolated seedlings were observed. Green fluorescence from GFP and red
fluorescence from chlorophyll were overlaid electronically. Bar = 50 lm (top)
or 16.7 lm (bottom).
WT, wild-type; p1p2, phot1phot2 double mutant.
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd, The Plant Journal, (2008), 56, 364–375
Domain-swap analysis of phot1 and phot2 367
(a)
Figure 3. Blue light-induced autophosphorylation in chimeric phototropins.
Twenty micrograms of total protein from 24-day-old rosette leaves were
subjected to immunoblot analyses with an anti-phot1 (left) or an anti-phot2
(right) polyclonal antibody. The plants were adapted to red light (RL) for 24 h
and then treated further with RL (16 lmol m)2 sec)1) (R) or blue light (BL;
48 lmol m)2 sec)1) (B) for 1 h before the extraction. Dashed lines indicate the
lowest mobility edges of the bands. WT, wild type.
(b)
Intracellular localization
Phot1 and phot2 are mainly localized in the plasma membrane region (Kong et al., 2006; Sakamoto and Briggs, 2002).
Interestingly, a fraction of P1G is released into the cytoplasm
in response to BL (Sakamoto and Briggs, 2002). More
recently, relocalization of P1G into the cytoplasm was
observed at higher resolution (Wan et al., 2008). In contrast
to P1G, a fraction of P2G is associated with the Golgi apparatus in a light-dependent manner (Kong et al., 2006).
Using confocal microscopy, we observed GFP fluorescence in cotyledon epidermal cells (Figure 4). As in the
hypocotyl epidermis (Figure 2d), GFP fluorescence in the
cotyledon epidermis was comparable between the representative lines. In all the lines, GFP fluorescence was
observed mainly in the plasma membrane region, regardless of the light conditions (Figure 4a). As with P2G (Kong
et al., 2006), a punctate pattern appeared after irradiation
with BL in P2-P1n/2cG. Irradiation with BL from lightemitting diodes (LEDs) (48 lmol m)2 sec)1) effectively
induced the punctate staining as well (data not shown). By
contrast, the punctate structure was observed in neither
P2-P1G nor P2-P2n/1cG. Instead, cytoplasmic fluorescence
was observed following the light treatment in these lines as
previously reported for P1-P1G (Sakamoto and Briggs, 2002;
Wan et al., 2008). Hence, the C-terminal moiety was confirmed to be responsible for the distribution patterns specific
to phot1 and phot2 in the light.
The appearance of punctate staining under a lower
intensity of BL was also examined in P2-P2G and P2-P1n/
2cG (Figure 4d). Under medium BL at 2 lmol m)2 sec)1, the
punctate staining of P1n/2cG was detected within 10 min of
onset of BL exposure. By contrast, punctate staining of P2G
remained undetectable even after 20 min of exposure.
Hence, P1n/2cG responded to BL with a higher sensitivity
than P2G for the association with the punctate structures. As
previously reported (Kong et al., 2006), cytoplasmic fluores-
(c)
(d)
Figure 4. Intracellular localization patterns of chimeric phototropins.
Green fluorescent protein fluorescence was observed in cotyledon epidermal
cells of 3-day-old dark-grown seedlings under a confocal laser scanning
microscope.
(a) Samples were prepared in the dark and the images of the first scan are
shown as the dark state (S 0 min). The samples were further scanned with
laser blue light (BL) five times at 1-min intervals and the images from the last
scan were recorded (S 5 min). Bar = 16.7 lm.
(b) Higher-magnification images of the dark state. Bar = 5 lm.
(c) A higher-magnification image of GFP localization in 35-GFP. Bar = 5 lm.
(d) Formation of punctate staining in response to medium BL at 2 lmol m)2
sec)1 from a light-emitting diode (LED). Samples were treated with BL for the
indicated period before observation. Bar = 16.7 lm.
cence of P2G was detected in the dark (Figure 4a,b). Interestingly, similar fluorescence was observed in P2-P2n/1cG
but not in P1n/2cG.
Stomatal opening
In guard cells, phot1 and phot2 redundantly mediate BLinduced stomatal opening with similar sensitivity (Kinoshita
et al., 2001). We examined whether the chimeric phototropins retain this activity (Figure 5). Leaf strips were prepared
from the rosette leaves and treated with or without high BL
(10 lmol m)2 sec)1). Consequently, we confirmed that stomata opened in response to BL in all of the lines, including
wild type, P2-P1G, P2-P2G, P2-P1n/2cG, and P2-P2n/1cG.
Hence, both P1n/2cG and P2n/1cG retain the ability to
mediate stomatal opening.
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd, The Plant Journal, (2008), 56, 364–375
368 Yusuke Aihara et al.
(a)
(b)
Figure 5. Stomatal apertures in transgenic plants expressing chimeric phototropins.
Stomatal apertures were measured microscopically in the mature leaves. The
epidermal strips of leaves were irradiated with blue light (BL; 10 lmol m)2 sec)1) superimposed on background red light (RL; 50 lmol m)2 sec)1) (blue
bar) or incubated in darkness (gray bar) for 2–3 h before the measurement.
Values are mean SD (n = 45). WT, wild type; p1p2, phot1phot2 double
mutant.
(c)
Hypocotyl phototropism
Phot1 mediates the phototropic response in the hypocotyl at
a broad range of fluence rates (0.01–100 lmol m)2 sec)1),
whereas the response of phot2 is elicited only by higher
fluence rates (>10 lmol m)2 sec)1) (Sakai et al., 2001). To
determine which of the N- and C-terminal moieties is
responsible for this difference in sensitivity, we examined
the responses mediated by chimeric phototropins (Figure 6).
The hypocotyl curvature was measured after 12-h exposure
to various intensities of unilateral BL in two independent
lines for each construct. In addition, we analyzed one of each
of the additional lines for P2-P2G and P2-P2n/1cG in which
the introduced protein was underexpressed (Figure 2c).
All the lines except the phot1-5 phot2-1 double mutant
efficiently responded to a higher intensity of BL
(40 lmol m)2 sec)1) (Figure 6). Hence, both P1n/2cG and
P2n/1cG retained the basic ability to mediate the phototropic
response. However, the response to lower intensities of BL
varied between the lines. The fluence response curves for
P2-P1G and P2-P1n/2cG were almost identical to those for
the wild type and the phot2-1 mutant, although the response
was a little weaker in P2-P1n/2cG than in P2-P1G at
0.02 lmol m)2 sec)1. Hence, P1G and P1n/2cG were almost
as sensitive as the endogenous phot1. By contrast, the
response mediated by the endogenous phot2, P2G or P2n/
1cG was much less sensitive. These lines failed to respond to
BL at 0.1 lmol m)2 sec)1. It should be noted here that the
C-terminal moiety affected sensitivity to some extent.
Namely, a small but significant difference was observed
between the P2-P2G and P2-P2n/1cG lines. The latter
Figure 6. Hypocotyl phototropism in transgenic seedlings expressing chimeric phototropins.
Hypocotyl curvatures were measured in 3-day-old dark-grown seedlings
treated with various intensities of unilateral blue light (BL; 0.02–40 lmol m)2 sec)1) for 12 h. Values are mean sd for at least 25 seedlings.
(a) Curvatures in wild-type (WT), phot1, phot2 and phot1 phot2 mutants.
(b) Curvatures in P2-P1G and P2-P2G lines.
(c) Curvatures in P2-P1n/2cG and P2-P2n/1cG lines.
showed stronger curvature than the former at 2 lmol m)2
sec)1. This could not be due to the difference in expression
levels because the level was higher in P2-P2G 44 or 49 than
in P2-P2n/1cG 46, as judged by immunoblot analysis (Figure 2c).
Chloroplast accumulation responses
The chloroplast accumulation response is redundantly
mediated by phot1 and phot2. However, the response
mediated by phot1 is more sensitive than that mediated by
phot2 (Sakai et al., 2001). Hence, we examined the chloroplast accumulation response under different intensities of
BL (Figure 7). As expected from the previous report
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd, The Plant Journal, (2008), 56, 364–375
Domain-swap analysis of phot1 and phot2 369
with a higher sensitivity. In summary, all the derivatives
except P1G were capable of mediating the avoidance
response.
Chloroplast dark positioning
Figure 7. Chloroplast accumulation responses in transgenic plants expressing chimeric phototropins.
Mesophyll cells adapted to red light (RL) (Start) were treated with a blue light
(BL) beam at low intensity (0.05 lmol m)2 sec)1) for 60–80 min (LB). The
irradiated areas (20 lm width) are indicated with dotted rectangles. WT, wild
type. Bar = 20 lm.
(Sakai et al., 2001), a microbeam of low BL at
0.05 lmol m)2 sec)1 led to accumulation of chloroplasts in
the wild type but not in the phot1 mutant. The accumulation
response was also observed in P2-P1G and P2-P1n/2cG lines,
whereas neither P2-P2G nor P2-P2n/1cG exhibited the
response. Hence, high sensitivity in the accumulation
response was conferred by the N-terminal moiety, as is the
case with phototropism.
We then examined whether chloroplasts accumulated at a
medium intensity of BL (3.4 lmol m)2 sec)1), to which both
phot1 and phot2 are responsive (Sakai et al., 2001). As
expected, all the lines except P2-P1n/2cG exhibited the
response (Figure 8). In the P2-P1n/2cG line, a medium
intensity of BL elicited avoidance rather than the
accumulation response (see below).
Chloroplasts accumulate at the bottom of the cell in
darkness. Phot2, but not phot1, is required for this specific
positioning (Suetsugu et al., 2005). Therefore, we examined this phenomenon in the present lines (Figure 9). As
expected from the previous report, this accumulation was
observed in the wild type and P2-P2G lines, but not in the
P2-P1G line, the phot2 mutant, or the phot1 phot2 double
mutant. Interestingly, dark positioning was restored in the
P2-P2n/1cG line but not in the P2-P1n/2cG line. Hence, the
N-terminal moiety was responsible for chloroplast dark
positioning.
We then examined whether the N-terminal fragment of
phot2 alone could position chloroplasts at the bottom of the
cell in darkness (Figure 9). For this purpose we used a
transgenic Arabidopsis expressing the fragment fused to
GFP under the control of 35S promoter in the phot1 phot2
double mutant background (35-P2NG/p1p2 line) (Kong et al.,
2007). Observation revealed that the N-terminal fragment of
phot2 could not position chloroplasts at the bottom of the
cell even though the fragment was accumulated at a high
level in this line (Kong et al., 2007). Hence, the C-terminal
moiety, irrespective of its source, was required for dark
positioning.
We further examined whether the C-terminal fragment of
phot2 could induce dark positioning using the 35-P2CG/p1p2
line, in which the fragment was expressed under the control
of 35S promoter (Kong et al., 2007). However, chloroplasts
were not positioned at the bottom of the cell (Figure 9).
Discussion
Expression of chimeric phototropins
Chloroplast avoidance responses
While both phot1 and phot2 mediate the accumulation
response, only phot2 mediates the avoidance response to
higher intensities of BL (Sakai et al., 2001). To examine the
avoidance response, mesophyll cells were first irradiated
with a BL beam at a medium intensity (3.4 lmol m)2 sec)1)
to accumulate chloroplasts, and then the intensity was
increased to 57 lmol m)2 sec)1 to elicit the avoidance
response (Figure 8). Consequently, the avoidance response
was observed in the wild type, the phot1 mutant, P2-P2G,
and P2-P2-P2n/1cG. In the case of P2-P1n/2cG, chloroplasts
accumulated with the low-BL treatment (see above). The
intensity was then increased to the medium level
(3.4 lmol m)2 sec)1), which elicited the avoidance
response. Hence, P1n/2cG mediated the avoidance response
The present study attempted to elucidate the structural basis
for the functional specificities of phot1 and phot2. To this
end, we expressed phot1 and phot2 chimeric proteins in the
Arabidopsis phot1 phot2 double mutant background under
the control of the PHOT2 authentic promoter (Figure 1a).
Consequently, both chimeric phototropin proteins, P1n/2cG
and P2n/1cG, were successfully expressed (Figure 2). Furthermore, we established lines in which the introduced
protein was expressed at approximately endogenous phot2
levels. It was noteworthy that none of the lines exhibited
growth defects, which are often observed in plants
expressing phot2 derivatives under the control of the 35S
promoter (Kong et al., 2007; Onodera et al., 2005). Aberrant
expression of phot2 in inappropriate tissues might lead to
such defects.
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd, The Plant Journal, (2008), 56, 364–375
370 Yusuke Aihara et al.
Figure 8. Chloroplast avoidance responses in transgenic plants expressing chimeric phototropins.
Mesophyll cells adapted to red light (RL) (Start) were treated with a blue light (BL) beam at a medium intensity (3.4 lmol m)2 sec)1) to accumulate chloroplasts (MB).
The cells were then treated with a high intensity of BL (57 lmol m)2 sec)1) for 30 min (HB). For P2-P1n/2cG, mesophyll cells were treated with a BL beam at low
intensity (0.05 lmol m)2 sec)1) for 80 min to accumulate chloroplasts (LB), then treated with BL at the medium intensity for 50 min (MB) and treated finally with BL
at the high intensity for 30 min (HB). The irradiated areas (20 lm width) are indicated with dotted rectangles. WT, wild type. Bar = 20 lm.
Figure 9. Chloroplast dark-positioning in transgenic plants expressing chimeric phototropins.
Plants were dark adapted for about 24 h before
observation. Transverse sections of a leaf were
prepared and observed under a confocal scanning microscope. The chlorophyll autofluorescence was detected in the topmost layer of
mesophyll cells. White lines trace the edges of
the mesophyll cells. WT, wild–type; p1p2, phot1phot2 double mutant. Bar = 20 lm.
While phot1-5 is a null allele (Huala et al., 1997), leaky
expression of phot2 has been reported in phot2-1 (Cho et al.,
2007). Hence, residual phot2 could have influenced the
functions of introduced phototropin derivatives in the present lines. However, the expression of the full-length phot2 in
the phot1-5 phot2-1 double mutant appeared to be very low
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd, The Plant Journal, (2008), 56, 364–375
Domain-swap analysis of phot1 and phot2 371
as we could not detect the signal by immunoblotting
(Figures 2a,c). Furthermore, physiological responses in P2P2G, in which P2G was expressed in the phot1-5 phot2-1
background, were indistinguishable from those in the phot15 mutant (Figures 6 and 7). Hence, the effect of the residual
phot2, if any, should be limited.
Basic phototropin activities of chimeric phototropins
Both phot1 and phot2 exhibit light-dependent autophosphorylation in vivo (Knieb et al., 2005; Salomon et al., 2003).
They are mainly localized to the plasma membrane (Harada
et al., 2003; Kong et al., 2006; Sakamoto and Briggs, 2002).
These features were retained in the chimeric phototropins
(Figures 2d, 3 and 4). Furthermore, they were capable of
mediating all the basic physiological responses, namely leaf
flattening (Figure 1b), stomatal opening (Figure 5), phototropism (Figure 6), and chloroplast accumulation (Figures 7
and 8). Hence, P1n/2c and P2n/1c retained all the basic
activities of phototropins, indicating that the similarity
between phot1 and phot2 is high enough to tolerate the
moiety swap.
Specific subcellular localization patterns
Besides the plasma membrane, specific localization patterns
are known for phot1 and phot2 in response to BL irradiation.
P1G fluorescence appears in the cytoplasm of cotyledon
epidermal cells following illumination with BL (Sakamoto
and Briggs, 2002; Wan et al., 2008), whereas a fraction of
P2G associates with the Golgi apparatus (Kong et al., 2006).
In this regard, P2n/1cG and P1n/2cG resembled P1G and
P2G, respectively (Figure 4a). Hence, the C-terminal moiety,
but not the N-terminal moiety, determined the specific
localization patterns in the light.
The cytoplasmic pattern is observed not only for P1G in
the light (Sakamoto and Briggs, 2002; Wan et al., 2008;
Figure 4) but also for P2G in the dark (Kong et al., 2006;
Figure 4). A similar dark pattern was observed in P2-P2n/1cG
but not in P2-P1n/2cG (Figure 4). Hence, the N-terminal
moiety determined whether a fraction of phototropin is
released from the plasma membrane in the dark. It should be
noted here that the cytoplasmic fluorescence could be due to
free GFP released by degradation of the introduced protein.
Hence, we attempted to detect the fusion protein and
possible degradation products in the soluble fraction. However, the proteins were undetectable because of lower
accumulation levels compared with P1-P1G (data not
shown). Further investigation should be needed to fully
exclude this possibility.
The biological significance of the formation of punctate
staining is not clear. For one thing, P1n/2cG, but not P1G,
exhibited the punctate distribution (Figure 4). Nevertheless,
both P1n/2cG and P1G exhibit high-sensitivity responses in
phototropism (Figure 6) and chloroplast relocation
(Figures 7 and 8). In addition, both P2G and P2n/1cG elicit
the chloroplast avoidance response, although only P2G
exhibits the punctuate distribution. Hence, the Golgi association does not correlate with any specific function of
phototropins. This fact implies that the Golgi association per
se is not important for the protein’s physiological function. It
should be noted here that punctate distribution of P1G has
been observed in root cells (Wan et al., 2008). Hence, the
subcellular distribution patterns of phototropins might be
altered depending on the tissue.
The N-terminal moiety mainly determines
the photosensitivity
Although phot1 and phot2 both mediate most of the
phototropin responses, the sensitivity is higher in the phot1
response in some cases (Harada and Shimazaki, 2007). On
the basis of the fluence rate response curves (Figure 6), we
estimate that the phototropic response by P1G is about 250
times more sensitive than that by P2G. The present results
demonstrate that the N-terminal moiety mainly determines
the sensitivity of the response. Namely, P1G and P1n/2cG
are much more sensitive than P2G and P2n/1cG in all of the
responses examined. This includes phototropism (Figure 6),
chloroplast accumulation (Figure 7), avoidance (Figure 8)
responses, and light-induced association with the punctate
structures (Figure 4). It should be noted that smaller but
significant effects on sensitivity of the C-terminal moiety
were observed, at least in the phototropic response
(Figure 6). According to the fluence rate response curves,
P1G and P2n/1cG were estimated to be about two and six
times more sensitive than P1n/2cG and P2G, respectively.
Hence, the N- and C-terminal moieties of phot1 were calculated to increase the sensitivity by the factors of 40–130 and
2–6, respectively.
These results are consistent with the current model of
the intramolecular mechanism of phototropin action
(Matsuoka and Tokutomi, 2005; Tokutomi et al., 2008).
According to this model, the N-terminal photosensory
moiety perceives the light stimulus and this regulates
kinase activity in the C-terminal moiety via a direct physical
interaction between the LOV2 and the kinase domains.
Indeed, LOV2 has been shown to be more important than
LOV1 for the biological function of phototropins (Cho et al.,
2007; Christie et al., 2002). Hence, the sensitivity may differ
because the phot1 LOV2 domain might be more easily
light-activated and/or remain in the activated state for
longer than the phot2 LOV2 domain. In accordance with
this view, the LOV2 domains of phot1 and phot2 are
spectrally different (Kasahara et al., 2002). Furthermore, the
half-life of the cysteinyl adduct state, determined by smallangle x-ray scattering, is much longer in phot1 LOV2 than
phot2 LOV2 (Nakasako et al., 2004).
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd, The Plant Journal, (2008), 56, 364–375
372 Yusuke Aihara et al.
The above facts indicate that the spectral properties of
LOV2 primarily determine the sensitivity of phototropins.
However, regions outside LOV2 could also influence the
sensitivity to some extent. A phot1 derivative lacking the
entire N-terminal LOV1 region has been reported to be much
less sensitive than the full-length phot1 (Sullivan et al.,
2008). Hence, the sensitivity appears to be affected by the
domains within the N-terminal moiety other than LOV2.
The expression patterns and photosensitivity
Phot1 and phot2 are expressed differently in etiolated
seedlings. Plants expressing P1G under the control of the
PHOT1 promoter, referred to as P1-P1G hereafter, exhibit
intense GFP fluorescence in whole seedlings (Sakamoto and
Briggs, 2002; Wan et al., 2008). By contrast, P2G is mainly
expressed at weaker levels in the P2-P2G seedling in cotyledons and the hook (Kong et al., 2006). We confirmed that
the expression level was more than 10 times higher in
P1-P1G than in P2-P2G by immunoblotting (data not shown).
In addition, P1G accumulates to a high level in the cortical
cells (Sakamoto and Briggs, 2002; Wan et al., 2008), whereas
little P2G was detected there in P2-P2G seedlings (data not
shown).
The above observations lead to the view that the higher
sensitivity of phot1 might be attributed to its higher expression, particularly in the cortical cells. However, this is not
likely. Since the authentic PHOT2 promoter was used, the
introduced proteins were expressed at the endogenous
phot2 levels in different tissues (Figure 2). Although minor
discrepancies were observed between different constructs
(see above), the difference was much smaller than that
observed between P1-P1G and P2-P2G. Nevertheless,
P2-P1G was as sensitive as P1-P1G in the phototropic
response (Figure 6). By contrast, the response of P2-P2G
was much less sensitive. Hence, we conclude that the
intrinsic signaling activity of the phototropin molecule rather
than its expression level determines the sensitivity of the
phototropic response.
In the light, the difference in the expression levels
between phot1 and phot2 becomes much smaller. PHOT2
gene expression is light-induced (Jarillo et al., 2001;
Kagawa et al., 2001). Furthermore, the level of phot1
protein is reduced substantially whereas that of phot2 is
increased to some extent in the light (Kong et al., 2006;
Sakamoto and Briggs, 2002). The intensity of GFP fluorescence was comparable between P1-P1G and P2-P2G in
mature rosette leaves (data not shown). This was further
confirmed by immunoblotting with an anti-GFP antibody
(data not shown). Accordingly, all the constructs exhibited
comparable GFP fluorescence in mesophyll cells
(Figure 2b). Hence, the difference in the photosensitivity
observed for the chloroplast accumulation and avoidance
responses (Figures 7 and 8) should be attributed to the
difference in intrinsic phototropin activity rather than
expression levels.
Chloroplast avoidance response
The chloroplast avoidance response is mediated solely by
phot2 (Sakai et al., 2001). Since the C-terminal fragment of
phot2 constitutively triggers this response (Kong et al.,
2007), we speculated that the C-terminal moiety of phot2,
but not that of phot1, had this activity. However, both P1n/
2cG and P2n/1cG were capable of mediating this response
(Figure 8). In other words, the avoidance response was
observed in cases other than when the N-terminal and
C-terminal moieties were both derived from phot1.
It is noteworthy that phototropin from the green alga
Chlamydomonas mediates both the accumulation and
avoidance responses when it is over-expressed in Arabidopsis (Onodera et al., 2005). Hence, the avoidance response
might be a basic function of phototropin that is conserved
even in distantly related phototropins. Such an activity
appeared to be suppressed by an unknown mechanism in
phot1. Since P1n/2cG and P2n/1cG could trigger the
response (Figure 8), both the N- and C-terminal moieties of
phot1 should retain the potential to participate in the
response. One simple explanation for the loss of activity in
phot1 is that the N- and C-terminal moieties of phot1 are less
‘active’ than those of phot2 with respect to the avoidance
response. The combination of two less active moieties might
lead to the apparent loss of the function. Alternatively, these
two moieties may interact in a specific way to hinder phot1
from triggering the avoidance response.
Whatever the mechanism, it is reasonable that plants
suppress the avoidance activity with phot1 because an
improper response at lower light intensities would reduce
the efficiency of photosynthesis. The present lines should be
useful for estimating the contribution of the chloroplast
relocation responses to increases in photosynthetic productivity under ambient light conditions.
Chloroplast dark positioning
In the dark, chloroplasts accumulate at the bottom of the cell
in the wild type but not in the phot2 mutant (Suetsugu et al.,
2005). This is an unusual function of phot2 because the
positioning is observed in darkness. In other words, phot2
appears to have activity even in the inactive state. Interestingly, the dark positioning is restored by P2G and P2n/1cG
but not by P1G or P1n/2cG (Figure 9). Hence, the N-terminal
moiety should be derived from phot2 to exhibit the modulatory activity to position chloroplasts at the cell bottom in
darkness. By contrast, the C-terminal moiety of phot2 could
be replaced with the respective phot1 moiety without
affecting the dark positioning activity. Nevertheless, both
the N- and C-terminal moieties were required for the
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd, The Plant Journal, (2008), 56, 364–375
Domain-swap analysis of phot1 and phot2 373
response because neither the N-terminal nor the C-terminal
fragment of phot2 failed to position chloroplasts at the
bottom of the cell (Figure 9).
It is intriguing that both P2G and P2n/1cG, but neither P1G
nor P1n/2cG, exhibit the cytoplasmic distribution in darkness
(Figure 4). It might be necessary for phototropin to be
dissolved in the cytoplasm for positioning chloroplasts at
the bottom of the cell. Alternatively, the cytoplasmic pattern
might represent an as yet unknown cytoplasmic structure.
Chloroplasts might be positioned at the bottom of the cell for
the function of such a structure with the aid of phot2.
Experimental procedures
Plant materials and growth conditions
The wild-type (gl-1, Columbia) and phototropin mutants, phot1-5
(Huala et al., 1997), phot2-1 (cav1-1, Kagawa et al., 2001), phot1-5
phot2-1 (Kinoshita et al., 2001), were used. Plants expressing GFP
(35-GFP) (Kong et al., 2006) and the N- and C-terminal fragment of
phot2 fused to GFP (35-P2NG/p1p2 6-2 and 35-P2CG/p1p2 9,
respectively) (Kong et al., 2007) under the control of the 35S promoter in the phot1-5 phot2-2 mutant background have been
described elsewhere. Seeds were planted on 0.6% agar plates
containing Murashige and Skoog (MS) medium with 1% w/v
sucrose at pH 5.8. Plants were grown at 22C in all experiments. For
immunoblot analysis, plants were grown for 3 weeks on agar plates
under continuous white light (cWL) at 34 lmol m)2 sec)1. Etiolated
seedlings were grown for 3 days in the dark for hypocotyl phototropic responses. For chloroplast relocation experiments, plants
grown on agar plates for 14 days under cWL at 34 lmol m)2 sec)1
were transplanted onto pots of soil and additionally grown for
10 days under 16-h day/8-h night cycles of white light at about
42 lmol m)2 sec)1. For stomatal opening experiments, plants were
grown on pots of soil for 4–5 weeks under the same day/night
cycles.
Plasmid constructions and production of transgenic plants
The PHOT1 cDNA with a BamHI tail at its 3¢ end was fused to the GFP
gene with a BamHI tail at its 5¢ end to produce P1G. The 35S promoter in the binary vector 35S-nosT/pPZP211 (Hajdukiewicz et al.,
1994) was replaced with a genomic fragment corresponding to the
PHOT1 authentic promoter (position )3918 to 594) (PP1-nosT/
pPZP211). The P1G fragment was then inserted into PP1-nosT/
pPZP211 (Pp1:P1G-nosT/pPZP211). Pp2:P2G-nosT/pPZP211, which
contains the fusion gene between PP2()3047 to )1 of the PHOT2
gene) and P2G (1–2745 of the PHOT2 cDNA fused to the GFP gene),
was previously described (Kong et al., 2006).
The PP2()3047 to )1 of the PHOT2 gene):P1n(1–782 of the
PHOT1 gene) fusion fragment was engineered by a combination
of PCR reactions as described here (Figure S1). The Pp2 and P1n
fragments, with additional small overlapping sequences, were
amplified by PCR. These overlapping fragments served as
templates to produce the PP2:P1n fragment by the polymerase
reaction. The resulting fusion fragment was then amplified in a
second PCR reaction. In the actual experiments, the latter two
steps were carried out consecutively in the same tube. The P1n/
2cG fragment, in which the P1n (1–1857 of P1G) and P2cG (1600–
2745 of P2G) were fused, and the P2n/1cG fragment, in which
P2n (1–1599 of P2G) and P1cG (1858–2988 of P1G) were fused,
were prepared in similar ways (Figure S1). The sequences of the
primers are listed below.
For P1G:
AAAGAATTCATGGAACCAACAGAAAAACC (PHOT1/1-EcoRI/fw)
AAAGGATCCAAAAACATTTGTTTGCAGATC (PHOT1/2988-BamHI/
rv)
AAAGGATCCATGGTGAGCAAGGGCGAGGAGCTG (GFP/1-BamHI/
fw)
AAAGCGGCCGCTTACTTGTACAGCTCGTCCATG (GFP/720-NotI/rv)
For PP2:P1n:
GAGAATAAAGAAACGTTATGGAACCAACAGAAAAAC
(P2proC::P1N-fw)
GTTTTTCTGTTGGTTCCATAACGTTTCTTTATTCTC (P2proC::P1Nrv)
AAAAAGCTTCAACGTATCTCCTTTTTATTTG (PHOT2pro-HindIIIfw)
CAATAATTGTTACCAGCAGCTAATGTC (PHOT1-782rv)
For P1n/2cG:
GAACTTCCTGATGCCAACACGCGGCCCGAAGACCTG
(P1L1857::2K-1600fw)
CAGGTCTTCGGGCCGCGTGTTGGCATCAGGAAGTTC
(P1L1857::2K-1600rv)
ATGGAACCAACAGAAAAACCATCGACC (PHOT1-1fw)
GTGAGCGGATAACAATTTCACACAGG (Rv-M)
For P2n/1cG:
GCTTCCAGATGCTAATATGACACCAGAGGATTTATG
(P2L1599::1L-1858fw)
CATAAATCCTCTGGTGTCATATTAGCATCTGGAAGC (P2L-1599::1L1858rv)
ATGGAGAGGCCAAGAGCCCCTCCATC (PHOT2-1fw)
GTGAGCGGATAACAATTTCACACAGG (Rv-M)
The Pp2:P1n, P2n/1cG and P1n/2cG fragments replaced corresponding regions in Pp1:P1G-nosT/pPZP211, Pp2:P2G-nosT/pPZP211
and Pp2:P2G-nosT/pPZP211 to prepare Pp2:P1G-nosT/pPZP211,
Pp2:P2n/1cG-nosT/pPZP211 and Pp2:P1n/2cG-nosT/pPZP211, respectively. The resulted constructs, Pp2:P2G, Pp2:P1G, Pp2:P1n/2cG, and
Pp2:P2n/1cG, were transformed into the phot1-5 phot2-1 double
mutant by the floral dip method (Clough and Bent, 1998). The
resulting transgenic lines were designated as P2-P2G, P2-P1G, P2P1n/2cG, and P2-P2n/1cG, respectively (Figure 1a). Kanamycinresistant T1 plants were selected on MS agar. Based on segregation
of kanamycin resistance, homozygous T3 lines with a single
transgene locus were selected.
Production of anti-phot1 polyclonal antibody
and immunoblot analysis
The anti-phot1 polyclonal antibody was produced as follows. The
phot1 N-terminal fragment (Met1–Thr619):His-tag fusion protein
was expressed in Escherichia coli, and purified with a Ni2+-column.
The purified protein was injected into a rabbit with Freund’s complete adjuvant. Three booster injections with incomplete adjuvant
were given at 2-week intervals. Seven days after the last booster
injection, blood was drawn and the serum containing anti-phot1
polyclonal antibody was prepared. The titer and specificity of the
antibody was examined by immunoblotting.
Immunoblot analysis was performed essentially as described
previously (Kong et al., 2006). Crude protein extracts were prepared
from mature rosette leaves or 3-day-old etiolated seedlings. The
proteins were separated by 7.5% SDS-PAGE and blotted onto
nitrocellulose membrane. The antibodies used were the anti-GFP
monoclonal antibody (Nacalai, http://www.nacalai.co.jp/en/), the
anti-phot1 polyclonal antibody (see above), and the anti-phot2
polyclonal antibody (Kong et al., 2006).
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd, The Plant Journal, (2008), 56, 364–375
374 Yusuke Aihara et al.
Confocal laser scanning microscopy and image analysis
Confocal laser scanning microscopy was carried out in a dark-room
with the aid of a green safe light. Specimens were prepared on a
glass slide and observed under a confocal laser scanning microscope (FV300 + BX60; Olympus, http://www.olympus.co.jp/en/). A
band-pass filter (510–530 nm) and a long-pass filter (>610 nm) were
used for GFP and chlorophyll fluorescence observation, respectively. The confocal images were processed using Adobe Photoshop 7.0 software (Adobe Systems, http://www.adobe.com/).
Phototropic response
The hypocotyl curvature assay was performed as described (Onodera et al., 2005). In brief, the growth angle of the hypocotyl in
3-day-old etiolated seedlings treated with unilateral BL at various
intensities for 12 h was measured. Blue light-emitting diodes (LEDs;
peak at 470 nm, half-bandwidth = 30 nm; LSD-mB, EYELA, http://
www.eyelaworld.com/) were used as the light source. The light was
attenuated with dark acryl plates (S802 and S909; Takiron, http://
www.takiron.co.jp/english/) when necessary.
Chloroplast relocation response
Twenty-four-day-old plants were placed under red light (RL) at
16 lmol m)2 sec)1 from LED arrays (LED-R; EYELA) for 12–14 h
before the observation. Chloroplast movement was examined using
a microbeam irradiation system based on a epifluorescent microscope (BX51; Olympus) essentially as described (Kagawa and
Wada, 2000; Kasahara et al., 2004). The evacuated rosette leaves
were irradiated on a glass slide with a BL beam from an illumination
unit equipped with a halogen lamp (TH4-100; Olympus). The
monochromatic BL passing through a band-pass filter (peak at
450 nm, half-bandwidth = 30 nm; S450/30 m; Chroma Technology
Corp., http://www.chroma.com/) was attenuated with a combination of a dichroic mirror and neutral density filters (ND50 and ND6;
Olympus). A rectangular field diaphragm was placed to narrow the
irradiated area to 20 · 226 lm on the specimen surface. The visible
light from a halogen lamp for observation with a CCD camera was
filtered through a red acrylic filter (Shinkolite A102; Mitsubishi
Rayon, http://www.mrc.co.jp/english/).
For the dark-positioning experiments, 24-day-old plants were
placed in the dark for 1 day before the observation. Transverse
sections of evacuated rosette leaves were prepared on a vibratome
(DSK, Kyoto, http://www.kyoto.zap.ne.jp/dkaih504/) and subjected
to confocal microscopic observation. A few optical sections at 2-lm
intervals were electronically overlaid to obtain hemispherical
projections of mesophyll cells.
Stomatal opening
Measurements of stomatal aperture were performed according to a
previously described method (Kong et al., 2007) with modifications.
Leaves from 4-week-old plants were blended in distilled water
in a Waring Commercial blender (Waring Commercial, http://
www.waringproducts.com) for 15 sec. The blended material was
filtered in 2 ml of basal reaction mixture [5 mM MES-BTP (MES,
2-[N-morpholino]ethanesulfonic acid; BTP, 1,3-bis[tris(hydroxymethyl)-methylamino]-propane)], pH 6.5, 5 mM KCl, 0.1 mM CaCl2) in
a Petri dish (35 mm diameter). Strips were then illuminated with BL
superimposed on background RL for 2–3 h. After treatment, the
strips were collected on a 48-lm nylon mesh and plated onto a
microscope slide with a cover glass. Stomatal apertures in the
abaxial epidermis were measured microscopically at ·400 magnification. Blue light (peak at 475 nm, half-bandwidth = 23.7 nm) and
RL (peak at 660 nm, half-bandwidth = 24.0 nm) were from LED
arrays (IS-mini; CCS, http://www.ccs-inc.co.jp/eng/).
Acknowledgements
We thank BioMed Proofreading for English proofreading. We are
grateful to Sam-Guen Kong for providing the Pp1:P1G-nosT/
pPZP211. This work was partially supported by a Grant-in-Aid for
Scientific Research (B) 17370018 (to AN), a Grant-in-Aid for Scientific Research on Priority Areas 17084002 (to AN) and a Grant-in-Aid
for 21st Century COE Research, Kyoto University (A14) (to AN).
Supporting Information
Additional Supporting Information may be found in the online
version of this article:
Figure S1. Diagram of strategy used to construct the PP2-P1G, P2n/
1cG and P1n/2cG fragments.
Please note: Wiley-Blackwell are not responsible for the content or
functionality of any supporting materials supplied by the authors.
Any queries (other than missing material) should be directed to the
corresponding author for the article.
References
Banerjee, R. and Batschauer, A. (2005) Plant blue-light receptors.
Planta, 220, 498–502.
Briggs, W.R. and Christie, J.M. (2002) Phototropins 1 and 2: versatile
plant blue-light receptors. Trends Plant Sci. 7, 204–210.
Briggs, W.R., Beck, C.F., Cashmore, A.R. et al. (2001a) The phototropin family of photoreceptors. Plant cell, 13, 993–997.
Briggs, W.R., Christie, J.M. and Salomon, M. (2001b) Phototropins:
a new family of flavin-binding blue light receptors in plants.
Antioxid. Redox Signal. 3, 775–788.
Cho, H.Y., Tseng, T.S., Kaiserli, E., Sullivan, S., Christie, J.M. and
Briggs, W.R. (2007) Physiological roles of the light, oxygen, or
voltage domains of phototropin 1 and phototropin 2 in
Arabidopsis. Plant Physiol. 143, 517–529.
Christie, J.M., Swartz, T.E., Bogomolni, R.A. and Briggs, W.R. (2002)
Phototropin LOV domains exhibit distinct roles in regulating
photoreceptor function. Plant J. 32, 205–219.
Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J. 16, 735–743.
Hajdukiewicz, P., Svab, Z. and Maliga, P. (1994) The small, versatile
pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol. Biol. 25, 989–994.
Harada, A. and Shimazaki, K. (2007) Phototropins and blue lightdependent calcium signaling in higher plants. Photochem. Photobiol. 83, 102–111.
Harada, A., Sakai, T. and Okada, K. (2003) Phot1 and phot2 mediate
blue light-induced transient increases in cytosolic Ca2+ differently in Arabidopsis leaves. Proc. Natl Acad. Sci. USA, 100, 8583–
8588.
Harper, S.M., Neil, L.C. and Gardner, K.H. (2003) Structural basis of a
phototropin light switch. Science, 301, 1541–1544.
Harper, S.M., Christie, J.M. and Gardner, K.H. (2004) Disruption of
the LOV-Jalpha helix interaction activates phototropin kinase
activity. Biochemistry, 43, 16184–16192.
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd, The Plant Journal, (2008), 56, 364–375
Domain-swap analysis of phot1 and phot2 375
Huala, E., Oeller, P.W., Liscum, E., Han, I.S., Larsen, E. and Briggs,
W.R. (1997) Arabidopsis NPH1: a protein kinase with a putative
redox-sensing domain. Science (New York, NY), 278, 2120–2123.
Huang, K. and Beck, C.F. (2003) Phototropin is the blue-light
receptor that controls multiple steps in the sexual life cycle of the
green alga Chlamydomonas reinhardtii. Proc. Natl Acad. Sci.
USA, 100, 6269–6274.
Jarillo, J.A., Gabrys, H., Capel, J., Alonso, J.M., Ecker, J.R. and
Cashmore, A.R. (2001) Phototropin-related NPL1 controls chloroplast relocation induced by blue light. Nature, 410, 952–954.
Kagawa, T. and Wada, M. (2000) Blue light-induced chloroplast
relocation in Arabidopsis thaliana as analyzed by microbeam
irradiation. Plant Cell Physiol. 41, 84–93.
Kagawa, T., Sakai, T., Suetsugu, N., Oikawa, K., Ishiguro, S., Kato,
T., Tabata, S., Okada, K. and Wada, M. (2001) Arabidopsis NPL1: a
phototropin homolog controlling the chloroplast high-light
avoidance response. Science (New York, NY), 291, 2138–2141.
Kasahara, M., Swartz, T.E., Olney, M.A., Onodera, A., Mochizuki, N.,
Fukuzawa, H., Asamizu, E., Tabata, S., Kanegae, H., Takano, M.,
Christie, J.M., Nagatani, A. and Briggs, W.R. (2002) Photochemical properties of the flavin mononucleotide-binding
domains of the phototropins from Arabidopsis, rice, and
Chlamydomonas reinhardtii. Plant Physiol. 129, 762–773.
Kasahara, M., Kagawa, T., Sato, Y., Kiyosue, T. and Wada, M. (2004)
Phototropins mediate blue and red light-induced chloroplast
movements in Physcomitrella patens. Plant Physiol. 135, 1388–
1397.
Kinoshita, T., Doi, M., Suetsugu, N., Kagawa, T., Wada, M. and
Shimazaki, K. (2001) Phot1 and phot2 mediate blue light regulation of stomatal opening. Nature, 414, 656–660.
Knieb, E., Salomon, M. and Rudiger, W. (2005) Autophosphorylation, electrophoretic mobility and immunoreaction of oat
phototropin 1 under UV and blue Light. Photochem. Photobiol.
81, 177–182.
Kong, S.G., Suzuki, T., Tamura, K., Mochizuki, N., Hara-Nishimura, I.
and Nagatani, A. (2006) Blue light-induced association of phototropin 2 with the Golgi apparatus. Plant J. 45, 994–1005.
Kong, S.G., Kinoshita, T., Shimazaki, K., Mochizuki, N., Suzuki, T.
and Nagatani, A. (2007) The C-terminal kinase fragment of Arabidopsis phototropin 2 triggers constitutive phototropin
responses. Plant J. 51, 862–873.
Lariguet, P. and Dunand, C. (2005) Plant photoreceptors: phylogenetic overview. J. Mol. Evol. 61, 559–569.
Mathews, S. (2006) Phytochrome-mediated development in land
plants: red light sensing evolves to meet the challenges of
changing light environments. Mol. Ecol. 15, 3483–3503.
Matsuoka, D. and Tokutomi, S. (2005) Blue light-regulated molecular switch of Ser/Thr kinase in phototropin. Proc. Natl Acad. Sci.
USA, 102, 13337–13342.
Nakasako, M., Iwata, T., Matsuoka, D. and Tokutomi, S. (2004)
Light-induced structural changes of LOV domain-containing
polypeptides from Arabidopsis phototropin 1 and 2 studied by
small-angle X-ray scattering. Biochemistry, 43, 14881–14890.
Onodera, A., Kong, S.G., Doi, M., Shimazaki, K., Christie, J., Mochizuki, N. and Nagatani, A. (2005) Phototropin from Chlamydomonas reinhardtii is functional in Arabidopsis thaliana. Plant Cell
Physiol. 46, 367–374.
Palmer, J.M., Short, T.W., Gallagher, S. and Briggs, W.R. (1993) Blue
light-induced phosphorylation of a plasma membrane-associated
protein in Zea mays L. Plant Physiol. 102, 1211–1218.
Sakai, T., Kagawa, T., Kasahara, M., Swartz, T.E., Christie, J.M.,
Briggs, W.R., Wada, M. and Okada, K. (2001) Arabidopsis nph1 and
npl1: blue light receptors that mediate both phototropism and
chloroplast relocation. Proc. Natl Acad. Sci. USA, 98, 6969–6974.
Sakamoto, K. and Briggs, W.R. (2002) Cellular and subcellular
localization of phototropin 1. Plant cell, 14, 1723–1735.
Salomon, M., Knieb, E., von Zeppelin, T. and Rudiger, W. (2003)
Mapping of low- and high-fluence autophosphorylation sites in
phototropin 1. Biochemistry, 42, 4217–4225.
Short, T.W., Porst, M. and Briggs, W.R. (1992) A Photoreceptor
system regulating in vivo and in vitro phosphorylation of a pea
plasma membrane protein. Photochem. Photobiol. 55, 773–781.
Suetsugu, N., Kagawa, T. and Wada, M. (2005) An auxilin-like
J-domain protein, JAC1, regulates phototropin-mediated chloroplast movement in Arabidopsis. Plant Physiol. 139, 151–162.
Sullivan, S., Thomson, C.E., Lamont, D.J., Jones, M. and Christie,
J.M. (2008) In vivo phosphorylation site mapping and functional
characterization of arabidopsis phototropin 1. Mol. Plant, 1, 178–
194.
Tokutomi, S., Matsuoka, D. and Zikihara, K. (2008) Molecular
structure and regulation of phototropin kinase by blue light.
Biochim. Biophys. Acta, 1784, 133–142.
Wan, Y.-L., Eisinger, W., Ehrhardt, D., Kubitschek, U., Baluska, F.
and Briggs, W.R. (2008) The subcellular localization and blue-light
induced movement of phototropin 1-GFP in etiolated seedlings of
Arabidopsis thaliana. Mol. Plant, 1, 103–117.
ª 2008 The Authors
Journal compilation ª 2008 Blackwell Publishing Ltd, The Plant Journal, (2008), 56, 364–375