Molecular Human Reproduction vol.2 no.1 pp.63-71, 1996
Nuclear structural conditions and PCR amplification in human
preimplantation diagnosis*
Ke-Hui Cui1 and Colin D.Matthews
Department of Obstetrics and Gynaecology, The Queen Elizabeth Hospital, The University of Adelaide, Woodville,
Adelaide, SA 5011, Australia
^o whom correspondence should be addressed
An understanding of the relationship between nuclear morphology and DNA function is important in cytology
and preimplantation diagnosis. In this study, direct polymerase chain reaction (PCR) amplification was used
to diagnose the common AF508 mutation of cystic fibrosis in 62 biopsied human embryo cells. The nuclei
were photographed and classified into three categories depending on their microscopic appearance; these
were further correlated with the results of PCR amplification. The normal nucleus group (42 embryo cells,
with clear and regular nuclear membrane, transparent nucleoplasm and prominent nucleoli) showed 100%
PCR amplification, with normal amplification results, i.e. bright DNA bands. These were considered to be the
living cells. Only half of the cells (10 embryo cells) which contained abnormal nuclei (with abnormal nuclear
membranes or nucleoplasm) showed PCR amplification, often with abnormal amplification results, i.e. weak
DNA bands. These cells were considered to be either degenerate or to be undergoing degeneration. The
anuclear cells (10 embryo cells) were composed of living (metaphase) and degenerated cells and showed
about 30% PCR amplification. These results demonstrated that one of the important signs of early visible cell
degeneration is the partial or total degeneration of the nucleus. Abnormal morphological changes of the
nuclear membrane and nucleoplasm are usually accompanied with functional and structural DNA alteration.
It is suggested that base degradation occurs earlier than the breakage of base-sugar bonds and phosphodiester
bonds during the course of DNA degradation. The selection of optimal cells with a normal nucleus for single
cell embryo biopsy is important for the precision and safety of preimplantation diagnosis.
Key words: cell/DNA degradation/genetic diseases/PCR amplification/preimplantation diagnosis
Introduction
The biology of nuclear structure and cellular organization has
been the subject of much study (Darnell et ai, 1986; Alberts
et ai, 1989), especially with regard to cell proliferation. In
human clinical practice, cell biology is important in pathology
and the diagnosis of disease (Bibbo, 1991). In defoliative
cytology, the nuclear.xytoplasmic ratio and the conditions of
the nucleus are two crucial diagnostic criteria for the diagnosis
of hyperplasia and carcinoma changes (Cardozo, 1976). The
nucleus is therefore an important index for differentiation
between normal and abnormal cells. Together with cell proliferation and pathology, research into cell degeneration has also
been of considerable interest in recent years. Many theories
have been proposed as to how DNA degrades (Lockshin and
Zakeri, 1992), but little is known of the exact intracellular
mechanisms which occur, particularly with regard to DNA
cleavage. For the investigation of the mechanism(s) of cell
death, the techniques of DNA, RNA and protein analysis are
very important. Together with these, nuclear morphology is
also helpful in the understanding of DNA degradation.
Preimplantation diagnosis is an important option for the
•Presented at the Xlllth Annual Scientific Meeting of the
Fertility Society of Australia, Brisbane, Australia,
October 3-7,1994.
© European Society for Human Reproduction and Embryology
prenatal diagnosis of genetic diseases (Miedzybrodzka et ai,
1993). Since the first attempt in the rabbit (Edwards and
Gardner, 1967) and the human (Fowler and Edwards, 1973;
personal correspondence, 1994), much experience has been
accumulated. Three major factors are crucial in human preimplantation diagnosis before routine clinical work, namely,
precision, safety and a higher pregnancy rate. With respect to
safety, some analyses have been reported (Wilton and Trounson,
1989; Krzyminska et ai, 1990; Hardy et ai, 1990; Cui et ai,
1991; Takeuchi et ai, 1992) and an optimal safety indicator
for the technique of single cell embryo biopsy has been
proposed (Cui et ai, 1993a). Acceptable pregnancy rates
have been achieved by many centres experienced in in-vitro
fertilization (IVF) techniques.
However, the most difficult factor in preimplantation diagnosis is the precision of the diagnosis. There are two basic
diagnosis techniques: fluorescent in-situ hybridization (FISH)
is currently used for sex determination but is vulnerable to the
problem of mosaicism (Cui, 1995) and may influence adversely
the precision of diagnosis using single cells; since 1990, some
experience has accumulated to achieve precise diagnosis in
single biopsied cells using polymerase chain reaction (PCR)
amplification. For this to be optimal, the following points are
important: firstly, the selection of an optimal cell for biopsy;
63
K.-H.Cui and C.D.Matthews
Figure 1. The biopsied embryo cells with normal nuclei and polymerase chainreaction(PCR) amplification results. In all, 42 embryos with
normal nuclei were tested, but only 11 cell results are shown; + = positive PCR amplification. All the nuclear membranes are clear and
regular. The nucleoplasms are transparent and are sharply contrasting with the cloudiness of the cytoplasm. The nucleoli are prominent. The
cell membranes of cells A-G are intact. Although the cell membranes were broken during embryo biopsy, clear nuclei can still be seen in
cell H (upper side of cell) and in cell I (right side of cell). PCR amplification was also positive while some vacuoles were present in cell J.
The nuclear membrane of cell K has been broken during biopsy, however PCRresultsstill showed a strong band.
secondly, achievement of near 100% or 100% amplification and
diagnosis by the PCR amplification; thirdly, the achievement of
co-amplification of two different gene fragments using different
sets of primers in the initial amplification with a single cell
and a single gene copy in sex determination; fourthly, correct
design of PCR amplification techniques including amplification
conditions, quality control of reagents and thermal cycler etc.;
fifthly, the correct analyses of occasional contamination of
single cell PCR amplification (Cui et ai, 1994a, 1995). The
last four aspects have been solved in our basic studies. Selection
of unspecified nucleated cells for diagnosis has been proposed
and practised (Handyside et ai, 1990; Grifo et ai, 1992; Liu
et ai, 1993; Cui et ai, 1994a); however, it is still not optimal
for precise diagnosis. This study is to address further the
selection of an optimal nucleus for single cell embryo biopsy.
64
In this study, we have used PCR techniques for the investigation of cystic fibrosis (CF). A Direct PCR Amplification of
Mutation (DIPCRAM) method can confidently (100%) diagnose this mutation with single lymphocyte and embryo cells
(Cui et al, 1993b). Using similar CF techniques to correlate
the results of PCR amplification with the morphology of single
biopsied cells, the other aim of the study was to understand
better the relationship between different nuclear morphology
and degradation changes in the DNA.
Materials and methods
Embryos and embryo biopsy
Single cell embryo biopsy was performed on 62 early (4-10 cell)
human polyspermic embryos which had been cryopreserved and
Nucleus and PCR amplification
SINGLE BLASTOMERES
M
2
3
4
5
7
§
9
B
B
B_ B
N F N F N F N F N F N F N F H F N F N F N F N F N
P
Tubes with primers
_/Bands from first
round of PCR
"Aimed N or P bands
Results
N N N N N N N N N N N N N N N N N N
Figure 3. Polymerase chain reaction (PCR) amplification results from the embryo cells with only normal nuclei. They all show bright bands
(of AF508 homozygous normal condition in cystic fibrosis diagnosis). M is the marker pUC19. N represents the normal gene. F represents
the mutant gene. NN denotes a homozygous normal result.
EMBRYOS
M
2
3
4
5
6
7
8
9
1
0
12 13
N F N F N F N F N F N F N F N F N F N F N F N F N F
Tube3 with primers
I
/Self-control bands
""Aimed N or F bands
NNNNNN
NNNNNNNN
NNNNNN
2H 1C 2C 2K 2M 1J
2B 2F 21
—Results
—Figure reference
Figure 4. Polymerase chain reaction (PCR) amplification results from the embryo cells with different nuclear conditions. They show
different PCR amplification results: strong bands (tubes 1,2,6,7,8,11,12), weak bands (tubes 3,9,13) and failure of amplification
(tubes 4,5,10). Notation is as in Figure 3. Tube 2 (i.e. 1C) and tube 6 (i.e. U) are the results of cells C and J in Figure 1 which contained
normal nuclei. Tube 2B, 2C and 2F are results of cells B, C and F in figure 2 which contained abnormal nuclei. Tube 2H, 21, 2K and 2M
are results of cells H, I ,K and M in Figure 2 which did not contain nuclear membranes.
thawed. Some of the embryos retained the same cell numbers as
before freezing, however most embryos contained a fewer number of
cells after thawing. The embryos were kept in human tubal fluid
medium (HTFM) (Quinn et ai, 1985) in a 37.3°C incubator with 5%
CO2 for 3-10 h for recovery. Before biopsy, the embryos were
incubated in Ca2+-free and Mg2+-free HTFM for 15-30 min before
being transferred to Ca2+-free and Mg2+-free HEPES HTFM in a
plastic dish for biopsy using an inverted microscope (Nikon). The
embryos were stabilized with a holding pipette. A targeted embryo
cell was determined and located in the biopsied position. The zona
pellucida was drilled using acid medium (with 10% fetal bovine
serum (FBS, Gibco BRL, Glen Waverley, Victoria, Australia), pH2.3).
A single cell embryo biopsy was performed using a biopsy pipette
through the drilled hole in the zona. All of the aspirated embryo cells
were expelled from the biopsy pipette into the medium. Their nuclear
conditions were studied and recorded prior to photography.
followed by 30 cycle 94°C (1 min), 65°C (1 min) and 72°C (2 min),
and a final extension at 72°C (10 min). Another batch of PCR
mixtures was prepared, which was used to amplify the specific normal
or abnormal CF gene sequences. These mixtures contained 20 |il
sterile distilled water, 4 [i\ of 10X reaction buffer, 1.5 |J.l of each
dNTP (10 mM), 6 ul of 25 mM MgCl2 with either 1.6 ul of each of
the normal gene primers (5'- GGCACCATTAAAGAAAATATCATCTTTG -3'; 5'- AGCTTCTTAAAG CATAGGTCATGTG -3') (designated as N tubes with the addition of lul of Phenol Red 1 mg/lOml
H2O), or 1.6 \i\ of each of the AF508 mutation gene primers
(5'-CTGGCACCATTAAAGAA AATATCATTG-3'; 5'-AGCTTCTTAAAGCATAGGTCATGTG -3') (designated as F tubes), and 0.2 ul
of ampli Taq DNA polymerase. The first amplification products (1 ul)
were put into the second PCR mixtures for another 30 cycle
amplification.
PCR amplification
Categories of nuclear condition
All aspirated cells were transferred to separate PCR tubes which
contained 10 ul PCR buffer. The transfer pipette was checked for the
possible presence of any embryo cells adherent to the pipette. After
DNA denaturation, 30 cycles of PCR preamplification were performed
after the addition of freshly made PCR mixture (30 |il). This mixture
contained 12|j.l of sterile distilled water, 4 ja.1 of I OX PCR buffer
(500 mM KCI, 100 mM Tris-HCI, pH8.3), 1.5 ul of each dNTP
(10 mM), 6 ul of 25 mM MgCI2, 0.2 u.1 of ampli Tag DNA
polymerase (5 lU/ul) and 1.6 |xl of each of the CF gene primers (5'GCATAGC AGAGTACCTG A A AC AGG A-3'; 5 '-G ACGTTTGTCTCACTAATGAGTGAAC-3') which amplified the common sequences
covering the mutation points. DNA was denatured for 6 min at 94°C,
All the positive and negative PCR results were correlated with the
corresponding photos of each of the biopsied embryo cells. The
existence of the nucleus, the clearness and regularity of the nuclear
membrane, the transparency of the nucleoplasm, the condition of the
nucleoli and the chromatin distribution were especially analysed. The
nuclei of these human embryo cells after biopsy were classified into
three categories: normal nuclei, abnormal nuclei and anuclear. The
normal nuclei were bound by a clear and regular nuclear membrane,
with transparent nucleoplasm and prominent and bright nucleoli. The
abnormal nuclei had a vague and irregular nuclear membrane, cloudy
and dark nucleoplasm and unclear nucleoli. If the nuclear membrane
did not exist or had partly dissolved, or there was no obvious
65
K.-H.Cui and C.D.Matthews
Table I. Nuclear condition and polymerase chain reaction (PCR)
amplification. Figures in parentheses are percentages
Biopsied embryo cell
PCR positive
PCR negative
Normal
nucleus
Abnormal
nucleus
Anuclear
condition
Tocal
42(68)
42 (100)
0(0)
10(16)
5 (50)
5(50)
10(16)
3 (30)
7(70)
62(100)
50 (81)
12(19)
nucleoplasm present, (with dark or faint chromatin distributing within
the cytoplasm), the cell was designated anuclear.
Prospective experiments
In prospective experiments, three different groups of embryo biopsy
were performed: group 1, embryo biopsy without nuclear selection
(i.e. including anuclear and nucleated cells); group 2, selection of
nucleated cells for embryo biopsy (i.e. including cells with normal
and abnormal nuclei); and group 3, selection of only those cells with
normal nuclei. The PCR amplification results were correlated with
the three groupings.
Retrospective analyses
In retrospective analyses, the PCR amplification results were correlated with different nuclear structural conditions - normal nuclei,
abnormal nuclei and anuclear from all of the biopsied cells of the
above three groups of embryo biopsy.
Results
Prospective experiments
In group 1, where 'random' embryo biopsy was performed
without nuclear selection, 11 out of 20 biopsied embryo cells
(55.0%) showed PCR amplification, which included some cells
with normal nuclei (Figure 1), abnormal nuclei (Figure 2) and
some cells without nuclei (Figure 2).
In group 2, where embryo biopsy was performed with
selection of nucleated cells (which included cells with normal
and abnormal nuclei), 24 out of 27 biopsied embryo cells
(88.9%) showed PCR amplification. In group 3, with selection
of cells with only normal nuclei (Figure 1), 15 out of 15
biopsied embryo cells (100%) showed PCR amplification. The
improvement of PCR amplification rate (55% -> 88.9% -»
100%) confirmed the close relationship between the different
selections of nuclear morphology (no selection of cells —»
selection of nucleated cells —> selection of cells with only
normal nuclei) during embryo biopsy. All N tube solutions
used to detect the normal CF gene fragments were red in
colour due to the addition of Phenol Red for differentiation.
The colourless F tube solutions were used to detect the AF508
mutation. In the positive PCR amplification results of the
above three groups, all showed normal gene fragments only
(N tubes or N bands positive), and mutation gene fragments
(F tubes or F bands) negative (Figures 3 and 4), and were
therefore homozygous normal.
Retrospective analyses
Of the 62 biopsied embryo cells, 42 of them contained normal
nuclei (Table I; Figure 1), all of which (100%) showed PCR
amplification (homozygous normal) with bright bands (Figure
3). Although some embryo cells had larger (Figures 1A and
ID) or smaller nuclei (Figure 1G) and one showed a vacuole
in the cytoplasm (Figure U), these cells also showed perfect
PCR amplification (Figure 3). Occasionally the cell membrane
was broken, and the intact nucleus was located outside the
cell (Figures 1H and II), and these cells also showed positive
PCR amplification. Similarly, if a clear nucleus existed before
biopsy but was broken during aspiration, PCR amplification
was also positive (Figure 1K).
Of the 62 biopsied embryo cells, ten contained abnormal
nuclei (Table I; Figure 2), in which 5 (50%) showed PCR
amplification (homozygous normal) and 5 (50%) failed to
amplify. Some of the PCR amplification results from the
abnormal nuclei (Figures 2B and 2C) showed weaker bands
(Figure 4) different to those bands from the normal nuclei
(Figure 3). Some embryo cells contained embryo fragments
and some 'multinuclei'(Figure 2F) or a nuclear vacuole (Figure
2E), and they failed to amplify with PCR (Figure 4). Some
nuclei were characterized by an indistinct membrane (Figures
2A and 2B) or irregular membrane (Figures 2D and 2G), while
others had an unclear or darker nucleoplasm (Figures 2A, 2B,
2C and 2G).
In this abnormal nucleus group, the results of PCR amplification were closely related to the degree of abnormalities of
the nuclei. When the nuclei showed mild abnormalities (i.e.
mild change of the nuclear membrane and nucleoplasm; Figure
2D), the bands of PCR amplification of the cellular DNA were
still bright. However, when the nuclei were more abnormal
(i.e. more indistinction of the nuclear membranes and more
cloudiness of the nucleoplasm; Figures 2B, 2C and 2G), the
bands of PCR amplification were weak (Figure 4). When the
nuclei were severely abnormal (i.e. the nuclear membranes
could almost not be seen, and the nucleoplasm was almost as
cloudy as the cytoplasm; Figure 2A), PCR amplification failed.
Figure 2. The (biopsied embryo) cells with abnormal nuclei and anuclear condition and polymerase chain reaction (PCR) amplification
results. A total of 10 cells with abnormal nuclei and another 10 anuclear cells were tested, but only the results of 7 cells with abnormal
nuclei (cells A-G) and 6 anuclear cells (cells H-M) are shown; + = positive PCR amplification; — = negative PCR amplification. (A)
Nuclear degeneration is severe. The nuclear membrane has almost disappeared but can be recognized with difficulty. The nucleus-cytoplasm
contrast has also almost disappeared. (B and C) Nuclear degradation is moderate. The nuclear membranes are thicker. The nucleuscytoplasm contrast is significantly lower than the normal one. Some vacuoles are present in the cytoplasm. (D) The nuclear membrane is
irregular. The nucleus-cytoplasm contrast is low but with prominent nucleoli. (E and F) The nuclei are broken into polynuclei with low
nucleus-cytoplasm contrast. In Cell E, some obvious vacuoles are present in the polynuclei, especially in the lower nucleus. (G) The nuclear
membrane is mildly irregular, and the nucleus-cytoplasm contrast is low. (H and I) The chromatin in these anuclear cells are prominent and
scattered evenly within the cytoplasm. (J) Only two prominent chromatin in the upper part of the cytoplasm with other faint chromatin
which are almost unrecognizable. (K) The prominent chromatin are unevenly concentrated in the centre of the cell. (L) Some faint
chromatin concentrate in the lower part of the cell. (M) Only some prominent chromatin are seen on the right side of the cell, with some
cell fragments around the cell.
66
Nucleus and PCR amplification
Figure 2.
A further 10 embryo cells were anuclear, and three (30%)
showed PCR amplification with bright bands (Figures 2H and
21, and Figure 4), but seven (70%) failed to amplify (Figures
2K and 2M, and Figure 4). Some embryo cells which had
larger chromatin granules scattered evenly in the cytoplasm
showed a positive PCR amplification with strong bands (Figure
2H); while other cells with the chromatin concentrated, scattered unevenly (Figure 2M), or where the chromatin granules
were smaller and faint (Figures 2J and 2L), failed to respond
to PCR amplification.
m
K.-H.Cui and C.D.Matthews
Discussion
In nuclear studies, the human embryo cell is specific. The size
of nuclei differs from nuclei in other human tissue cells.
Human embryo cells (especially in the 2-8 cell stage) contain
larger nuclei which allows nuclear morphology to be investigated more easily by microscope. Some mice (such as CBA/
C57) embryo cells show congruity of the live condition (Cui
et ai, 1993c) but human embryo cells show considerable
variability some living cells and some dead cells (Cui et ai,
1994a). At present, human embryos can only be cultured in a
living condition for several days in vitro, so the human embryo
cells in this study will show more real biological variation and
will contain less results of methodological differences than
those in long culture. In villi tissue culture, the longer culture
time is associated with more artefacts (such as triploidy and
tetraploidy, Hassold et ai, 1980). In this experiment the single
human embryo cells also showed a more natural nucleus
condition, as no strong chemical treatment has been used to
specially dissolve the surrounding cell membranes for obtaining
the naked nuclei.
Analysis of normal nuclei
In this study, the nucleus has been shown to be an important
sign of life of human embryo cells. In the normal nuclei group,
the morphological structure of the nuclear membrane was
normal, i.e. clear and regular. It allows specific proteins and
ions to pass through the nuclear pore complex from the
cytoplasm into the nucleus (Bonner, 1978; Hille, 1984) for
DNA replication and transcription (Huang et ai, 1994), and
allows the RNA from the nucleus to the cytoplasm to synthesize
protein (Stewart, 1992). This normal function of the nuclear
membrane keeps the nucleoplasm transparent or clear with
prominent bright nucleoli. In these normal nuclei the chromatin
was very fine and scattered evenly; these signs indicated that
the cell was alive. Human embryo cells with these life signs
showed 100% PCR amplification with bright bands (Figure
3). This further identified that the integrity of the DNA
structure in these cells was normal. Since the embryos were
derived from different developing stages of embryos with
polyspermic fertilization, some embryo cells contained variable
sized nuclei. These features did not influence amplification,
nor did the presence of vacuoles in the cytoplasm or a disrupted
nuclear membrane (during embryo biopsy). It is therefore
crucial to select a nucleus with good characteristics (i.e. normal
nuclear membrane, nucleoplasm, chromatin and nucleoli) to
obtain positive DNA amplification by PCR in single cell
experiments.
Analysis of abnormal nuclei
The embryo cells with abnormal nuclei were degenerating
or degenerated cells with different degrees of DNA degradation. They showed a range of PCR results: normal PCR
amplification (bright bands, two samples) to less optimal
PCR amplification (weak bands, three samples) to failure of
PCR amplification (absence of bands, five samples). The
state of DNA degradation was closely related to the nuclear
morphological changes in these dying and dead cells. The first
signs of cell degeneration were mild changes in the nuclear
68
membrane and nucleoplasm (i.e. mild abnormality of the
nuclear membrane and a little cloudiness of the nucleoplasm).
Under these conditions, the nuclear DNA was not changed,
and gave normal PCR amplification results (bright bands).
Whether these kind of cells can return to normal conditions
and further develop or cleave or not is unknown.
A further sign of the embryonic cell degeneration was that
the nuclear membrane became thicker or unclear (Figures 2B,
2C). If the structures of the nuclear membrane and nuclear
lamina have changed (Franke et ai, 1981), they will influence
the transportation of proteins and ions into the nucleus. This
abnormal transportation will further harm the normal structure
and functions of the nuclear DNA (Hameed et ai, 1989).
Neither will the RNA be smoothly transported to the cytoplasm.
The cleavage of transcriptionally active ribosomal genes
(rDNA) within the dense fibrillar components (Goessens and
Lepoint, 1979) forms multiple, various sized particles of the
osmiophilic dense fibrillar component (DFC) along with groups
of preribosomal ribonucleoprotein (RNP) granules (Arends
et ai, 1990). All these substantial changes in the nucleoplasm
can explain why the nucleoplasm inevitably turned out to be
more cloudy in this study. The environment of the nucleoplasm
could not maintain the normal structure of DNA (Newport
and Forbes, 1987), thus it produced less optimal PCR results,
i.e. weak bands, in this study.
An advanced sign of cell degeneration was that the structure
of the nuclear membrane had almost disappeared (Figure 2A).
Under these conditions, the function of the nuclear membrane
was almost destroyed. The density of the nucleoplasm was
observed under the microscope to be almost the same as that
of the cytoplasm. The microenvironment of the nucleoplasm
has fundamentally changed and the DNA is largely destroyed
by endogenous deoxyribonuclease (Peitsch et al., 1993). In
these circumstances, PCR amplification failed, i.e. no band in
our study.
Analysis of anuclear cells
When the cell membranes did not exist, the cell might have
been degenerated or in metaphase. In the latter the chromatin
is apparent and is scattered evenly in this study, because the
chromosomes are coiling up to form much more visible
condensed structures (Georgiev et al., 1978) and the individual
chromosomes occupy discrete precise territories in the nucleus
before metaphase (Comings, 1980). Under these conditions,
PCR amplification in this study was effective and normal
(bright band), because the cell was alive and could further
cleave into new cells. In the degenerated cells, the cells could
die during interphase or metaphase. Whether there is any
morphological difference between the degenerated cells that
die in these two phases is unknown in this study. It is known
that chromatin fibres of the normal nucleus are anchored to
the nuclear matrix or scaffold (Long et al, 1979). When the
embryo cell is degenerating, multiple cleavage events occur
between anchorage sites (Rest et ai, 1986). The partial
and asynchronous loss of chromatin fibres of the anchor
surrounding the nuclear structure (Murti and Goorha, 1983)
produce the phenomenon that some chromatin fibres condensed
in different shapes and scattered unevenly in the early degener-
Nucleus and PCR amplification
I.
o
o
o— p=o .'
o
*//
DNA Degradation and PCR Amplifications
o
'poiyn»raie\
II
NH
>FM1
^ T T T T V T T T T T T T T T T T T T T T
3.
I
HO-C
C-NHj
Stow
M
T f T I^T T f T T T t H
T T I T ) ? T
,
CH 2
T
O
I
•o—P=O
1 T T 1
T
1 T
1 1 T T
XO^
Jl
Hydrolytic
Domination
Figure 6. Analysis of therelationshipbetween the different
courses of DNA degradation and the results of polymerase chain
reaction (PCR) amplification. T bars mean normal bases. The circle
bars mean early degradation of bases which still retain their coding
signals. Short bars = severe degradation of bases (which lose their
coding signals) or the breakage of the base-sugar bonds. Broken
line = breakage of the phosphodiester bond. A. Taq polymerase
works fast to give a strong PCR amplification band. B. Taq
polymerase works slowly to give a weak PCR amplification band.
C, D and E PCR amplification fails.
Mathylitlon
Normal
Bases
Abnormal
Bases
Figure 5. Some possibilities of base degradation during DNA
decay. In the abnormal bases, only one site of oxidation, hydrolytic
deamination and methylation is shown.
ated cells in our previous study (Cui et al., 1994a) and in this
study. As the cell degenerated further, the chromatin turned
faint due to further DNA degradation (Figure 2L) in this study;
this has also been reported by Umanskii et al. (1981). All
PCR amplification failed in this study during the early and
late degenerated stages of the cells.
DNA degradation and PCR amplification
This study could not have been perfomed without achieving
100% PCR amplification (Cui et al., 1993b). Without this
confidence, when PCR amplification fails it would be difficult
to differentiate whether the failure is from the imperfect PCR
amplification techniques or from the degenerated cells and
nuclei (Pickering et al., 1992), and further analysis of the
different physiological conditions of the biopsied cells would
not be possible. In our basic experiment, the PCR conditions
have been set up to allow the PCR amplification to plateau.
Thus the brightness of the resulting bands will not change too
much when one copy (in a single heterozygous cell) to two
or more copies (in one or more homozygous cells) of the gene
were amplified (Cui et al., 1995). This eliminated the possibility
that the much weaker signal in this study was from a single
copy of the gene rather than from a DNA degradation. Our
further 2 year clinical practice also proves this point. The
fresh embryos (two-pronucleus embryos rather than polyspermic frozen-thawed embryos) also contain some cells
undergoing apoptosis. These cells also showed the same DNA
degradation results (unpublished data).
Although DNA is the carrier of genetic information, it has
limited chemical stability. Hydrolysis, oxidation and nonenzymatic methylation of DNA occur at significant rates in vivo,
and are counteracted by specific DNA repair processes. The
spontaneous degradation of DNA is a major factor in the
ageing of cells (Lindahl, 1993), in which DNA repair processes
fail. In DNA degradation, hydrolysis can occur at the nucleic
acid phosphodiester bond, base-sugar bonds and the deamination of bases. Oxidation usually occurs at the unsaturated
bonds of nitrogenous bases, and oxidation of guanine residues
to 8-hydroxyguanine is the major type of spontaneous event
in living cells (Kasai and Nishimura, 1984; Figure 5). DNA
base residues are also susceptible to hydrolytic deamination
(Shapiro, 1970); 7-methylguanine and 3-methyladenine are
also major DNA lesions (Becker et al., 1981), in which the
latter is a cytotoxic DNA lesion that blocks replication. It has
been estimated that about 600 3-methyladenine residues per
day are generated in DNA of a human cell in this reaction
(Rydberg and Lindahl, 1982).
In this study, the PCR results showed a DNA degradation
course in the dying human embryo cells. If DNA degradation
does not involve phosphodiester bonds, base-sugar bonds and
nitrogenous bases, Taq polymerase incorporates easily onto
the DNA and synthesizes smoothly along the intact DNA
sequences (Figure 6A). This allowed the formation of normal
PCR results (bright bands), which were seen in the normal
nuclei group and in the nuclei with mild abnormalities. If the
DNA degradation process involves only small parts of the
nitrogenous bases (i.e. the base-coding signals still remained),
the ability of Taq polymerase to incorporate the DNA will be
reduced (Figure 6B). This resulted in poorer PCR amplification
with weak bands, which occurred in the nuclei with more
abnormalities (obvious changes in the nuclear membrane and
69
K.-H.Cui and C.D.Matthews
nucleoplasm). If the DNA degradation severely damages the
nitrogenous bases, the Taq polymerase will not recognize the
coding signals and will not incorporate the degraded DNA
(Figure 6C); also if the base-sugar bonds and phosphodiester
bonds are eventually broken, the Taq polymerase will not
extend along the broken DNA strands (Figures 6C, 6D and
6E) resulting in failure of PCR amplification. This occurred
in the nuclei with severe abnormalities and in the dead anuclear
cells. Thus from this study, a course of embryonic cell
degeneration in a nuclear cell is clear early morphological
change of the nuclear membrane accompanied with early
changes in the nucleoplasm (normal PCR amplification) —>
mild change on the small part of nitrogenous bases (- coding
signals remaining with weak PCR amplification) -4 further
degradation of nitrogenous bases (- coding signals lost), basesugar bonds or phosphodiester bonds (with PCR amplification
failure) —> disappearance of the nuclear membrane —> disappearance of chromatin.
Preimplantation diagnosis and selection of normal
cells
The optimal selection of single cells of the early human
embryo for biopsy is closely related to four factors in human
preimplantation diagnosis: the efficiency of biopsy, the PCR
amplification rate, the analysis of contamination and the
precision of diagnosis. The efficiency of the biopsy process is
mainly dependent on optimal PCR amplification techniques
and the condition of the DNA of the biopsied cell. If the PCR
amplification technique is not perfect for diagnosis and there
is a high frequency of degenerated DNA (or cells), many cells
will be needed to achieve a correct diagnosis and even routine
2-cell embryo biopsy will not be reliable. If PCR amplification
techniques are perfect for diagnosis (Cui et al, 1993b, 1994a),
a routine 2-cell embryo biopsy is likely to permit a precise
diagnosis. However, the safety of routine 2-cell embryo biopsy
in human is uncertain (especially for embryos at the 5-7 cell
stage), and so has been questioned for clinical use (Cui et al,
1994b). If both PCR amplification techniques and the selection
of cells are perfect, then single cell embryo biopsy will be
successful with confidence for the aim of precise preimplantation diagnosis with safer results. It is therefore important to
select a nucleus with good characteristics (i.e. good nuclear
membrane, nucleoplasm and nucleoli) for confident DNA
analysis. In most cases, cells with normal nuclei can be selected
before biopsy by appropriate focusing under the microscope
if the embryo does not contain too many fragments (Figures
1 and 2). This should lower the necessity for a second cell to
be biopsied.
A detailed method for analysis of contamination from
PCR amplification is also very important in preimplantation
diagnosis. In some conditions, if the selection of the cells for
PCR amplification is correct and the transfer of the cells to
the PCR tubes is perfect, contamination will not change our
confidence in a correct diagnosis. For example, in X-linked
diseases, contamination will not have a clinical consequence
if only diagnosed female embryos are to be transferred to the
mother's uterus when the PCR specimen did include the
embryo cell or its DNA, the reason for which has been
70
previously described (Cui et al, 1994a). In cystic fibrosis,
only if homozygous normal embryos were chosen for transfer
would all contamination risks be eliminated when a biopsied
cell (or its DNA) is present (Cui et al, 1995). So the selection
of good embryo cells with normal DNA for biopsy, and a
detailed record of each nuclear condition during biopsy are
very crucial for the analysis of precision of preimplantation
diagnosis.
This study has shown that the selection of optimal cells
with normal nuclei for single cell embryo biopsy is quite easy,
but extremely important. The simple practice of nuclear
selection with the perfect PCR amplification techniques will
achieve a precise and safe diagnosis. A record of the nuclear
condition during single cell embryo biopsy should be kept for
further analysis of contamination and for the precision of
diagnosis. Further studies on the techniques of single cell
embryo biopsy will be helpful for the progress of preimplantation diagnosis.
Acknowledgements
We thank Mrs Monica Briffa, Regan Jeffrey and Mr Michael F.Barry
for preparing cryopreserved embryos, and Miss Louise Wamest and
Mrs Helen Holmes for the preparation of this manuscript.
References
Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K. and Watson, J.D. (1989)
Molecular Biology of the Cell. 2nd edn. Garland Publishing Inc., New York.
Arends, M.J., Morris, R.G. and Wyllie, A.H. (1990) Apoptosis. The role of
the endonuclease. Am. J. Pathol., 136, 593-608.
Becker, R.A., Barrows, L.R. and Shank, R.C. (1981) Methylation of liver
DNA guanine in hydrazine hepatotoxicity: dose-response and kinetic
characteristics of 7-methylguanine and O6-methylguanine formation and
persistence in rats. Carctnogenesis, 2, 1181-1188.
Bibbo, M. (1991) Comprehensive Cytopathology. W.B. Saunders Company,
Harcourt Brace Jovanovich, Inc., Philadelphia.
Bonner, W.M. (1978) Protein migration and accumulation in nuclei. In Busch,
C. (ed.), The Cell Nucleus. Vol. 6, Part C. Academic Press, New York. p. 97.
Cardozo, PL. (1976) Atlas of Clinical Cytology. Targa b.v. 's-Hertogenbosch,
The Netherlands.
Comings, D.E. (1980) Arrangement of chromatin in the nucleus. Hum. Genet.,
53, 131-143.
Cui, K.-H., Dobrovic, A., Putland, R.A., Verma, PJ., Seamark, R.F. and
Matthews, CD. (1991) Sex selected births of mice following single
blastomere biopsy and gene analysis. In Proceedings of the Xth Annual
Scientific Meeting, Fertility Society of Australia. Lome, Victoria, Australia,
p. 43.
Cui, K.-H., Verma, PJ. and Matthews, CD. (1993a) Hatching rate: an optimal
discriminator for the assessment of single blastomere biopsy. J. Assist.
Reprod. Genet., 10, 157-162.
Cui, K.-H., Haan, E.A., Warnes, G.M., Wang, LJ. and Matthews, C D .
(1993b) Confident diagnosis of preimplantation human embryos by PCR
amplification of a cystic fibrosis mutant gene (AF508) In Proceedings of
the Xllth Annual Scientific Meeting, Fertility Society of Australia, Sydney,
Australia. Abstract No. PO40.
Cui, K.-H., Putland, R.A., Seamark, R.F. and Matthews, CD. (1993c) Precise
sex selected births of mice following single cell embryo biopsy and Ylinked testis specific gene analysis. Hum. Reprod., 8, 621-626.
Cui, K.-H., Wames, G.M., Jeffrey, R. and Matthews, CD. (1994a) Sex
determination of preimplantation embryos by human testis-determining
gene amplification. Lancet, 343, 79-82.
Cui, K.-H., Barua, R. and Matthews, CD. (1994b) Histopathological analysis
of mice bom following single cell embryo biopsy. Hum. Reprod., 9,
1146-1152.
Cui, K.-H. (1995) Genome project and human reproduction. Mol. Hum.
Reprod., 1; see Hum. Reprod., 10, 1275-1279.
Cui, K.-H., Haan, E.A., Wang, LJ. and Matthews. CD. (1995) Optimal
Nucleus and PCR amplification
polymerase chain reaction amplification for preimplantation diagnosis in
cystic fibrosis (AF508). Br. Med. J., 311, 536-540.
Darnell, J.E., Lodish, H.F. and Baltimore, D. (1986) Molecular Cell Biology.
Scientific American Books Inc., New York.
Edwards, R.G. and Gardner, R.L. (1967) Sexing of live rabbit blastocysts.
Nature, 214, 576-577.
Fowler, R.E. and Edwards, R.G. (1973) The genetics of early human
development. In Emery, A.E.H. (ed.), Progress in Medical Genetics. Vol.
IX. Butterworths, London, UK, pp. 49-112.
Franke, W.W., Scheer, U., Krohne, G. and Jarasch, E.D. (1981) The nuclear
envelope and architecture of the nuclear periphery. J. Cell Biol., 91,39s-50s.
Georgiev, G.P., Nedospasov, S.A. and Bakayev, V.V. (1978) Supranucleosomal
levels of chromatin organization. In Busch, H. (ed.), 77ie Cell Nucleus. Vol.
6. Academic Press, New York, p. 3.
Goessens, G. and Lepoint, A. (1979) The nucleolus-organizing regions
(NOR's): recent data and hypotheses. Biol. Cellulaire, 35, 211-220.
Grifo, J.A., Tang, Y.X., Cohen, J., Gilbert, F, Sanyal, M.K. and Rosenwaks,
Z. (1992) Pregnancy after embryo biopsy and coamplification of DNA
from X and Y chromosomes. J. Am. Med. Assoc., 268, 727-729.
Hameed, A., Olsen, K.J., Lee, M.K., Lichtenheld, M.G. and Podack, E.R.
(1989) Cytolysis by Ca-permeable transmembrane channels. Pore formation
causes extensive DNA degradation and cell lysis. J. Exp. Med., 169,
765-777.
Handyside, A.H., Kontogianni, E.H., Hardy, K. and Winston, R.M.L. (1990)
Pregnancies from biopsied human preimplantation embryos sexed by Yspecific DNA amplification. Nature, 344, 768-770.
Hardy, K., Martin, K.L., Leese, HJ., Winston, R.M.L. and Handyside, A.H.
(1990) Human preimplantation development in vitro is not adversely
affected by biopsy at the 8-cell stage. Hum. Reprod., 5, 708-714.
Hassold, T, Chen, N., Funkhouser, J., Jooss, T, Manuel, B., Matsuura, J.,
Matsuyama, A., Wilson, C , Yamane, J.A. and Jacobs, P.A. (1980) A
cytogenic study of 1000 spontaneous abortions. Ann. Hum. Genet. Lond.,
44, 151-178.
Hille, B. (1984) Ionic Channels of Excitable Membranes. Sinauer Associates
Inc., Sunderland, MA., USA.
Huang, S., Deerinck, TJ., Ellisman, M.H. and Spector, D.L. (1994) In vivo
analysis of the stability and transport of nuclear poly(A)+RNA. J. Cell
Biol., 126, 877-899.
Kasai, H. and Nishimura, S. (1984) Hydroxylation of deoxyguanosine at the
C-8 position by ascorbic acid and other reducing agents. Nucleic Acids
Res., 12,2137-2145.
Krzyminska, U.B., Lutjen, J. and O'Neill, C. (1990) Assessment of viability and
pregnancy potential of mouse embryos biopsied at different preimplantation
stages of development Hum. Reprod., 5, 203-208.
Lindahl, T. (1993) Instability and decay of the primary structure of DNA.
Nature, 362,709-715.
Liu, J., Lissens, W., Devroey, P., Liebaers, I. and Van Steirteghem, A.C.
(1993) Efficiency of polymerase chain reaction assay for cystic fibrosis in
single human blastomeres according to the presence or absence of nuclei.
Fertil. Steril., 59, 815-819.
Lockshin, R.A., and Zakeri, Z.F. (1992) Physiology and protein synthesis in
programmed cell death. Early synthesis and DNA degradation. Ann. N.Y.
Acad. Sci., 663, 234-249.
Long, B.H., Huang, C-Y. and Pogo, A.O. (1979) Isolation and characterization
of the nuclear matrix in Fnend erythroleukaemic cells: chromatin and
hnRNA interaction with the nuclear matrix. Cell, 18, 1079-1090.
Miedzybrodzka, Z., Templeton, A., Dean, J., Haites, N., Mollison, J. and
Smith, N. (1993) Preimplantation diagnosis or chorionic villus biopsy?
Women's attitudes and preferences. Hum. Reprod., 8, 2192-2196.
Murti, K. G. and Goorha, R. (1983) Interaction of frog virus-3 with the
cytoskeleton. I. Altered organization of microtubules, intermediate filaments
and microfilaments. J. Cell Biol., 96, 1248-1257.
Newport, J.W. and Forbes, DJ. (1987) The nucleus: structure, function, and
dynamics. Ann. Rev. Biochem., 56, 535-565.
Peitsch, M.C., Polzar, B., Stephan, H., Crompton, T, MacDonald, H.R., el at,
(1993) Characterization of the endogenous deoxyribonuclease involved in
nuclear DNA degradation during apoptosis (programmed cell death). EMBO
J., 12, 371-377.
Pickering, SJ., McConnell, J.M., Johnson, M.H. and Braude, P.R. (1992)
Reliability of detection by polymerase chain reaction of the sickle cellcontaining region of the fi-globin gene in single human blastomeres. Hum.
Reprod. 7, 630-636.
Quinn, P., Wames, G.M., Kerin, J.F. and Kirby, C. (1985) Culture factors
affecting the success rate of in vitro fertilization and embryo transfer. Ann.
N.Y. Acad. Sci., 442, 195-204.
Rest, R., Meller, M. and Werner, D. (1986) Disintegration of nucleoskeletal
elements by metrizamide/2 M salt isopyknic centrifugation. Exp. Cell Res.,
167, 144-156.
Rydberg, B., and Lindahl, T. (1982) Nonenzymatic methylation of DNA by the
intracellular methyl group donor S-adenosyl-L-methionine is a potentially
mutagenic reaction. EMBO J., 1, 211-216.
Shapiro, R., Cohen, B.I and Servis, R.E. (1970) Specific deamination of RNA
by sodium bisulphite. Nature, 227, 1047-1048.
Stewart, M. (1992) Nuclear pore structure and function. Semin. Cell Biol., 3,
267-277.
Takeuchi, K., Sandow, B.A., Morsy, M., Kaufmann, R.A., Beebe, SJ. and
Hodgen, G.D. (1992) Preclinical models for human pre-embryo biopsy
and genetic diagnosis. I. Efficiency and normalcy of mouse pre-embryo
development after different biopsy techniques. Fertil. Steril., 57, 425—430.
Umanskii, S.R., Korol, B.A. and Nelipovich, P.A. (1981) DNA degradation
in vivo in dying thymocytes, model for the study of chromatin structure.
Mol. BioL Mask., 15, 1028-1039.
Wilton, LJ. and Trounson, A.O. (1989) Biopsy of preimplantation mouse
embryos: development of micromanipulated embryos and proliferation of
single blastomeres in vitro. Biol. Reprod., 40, 145-152.
Received on June 23, 1995; accepted on September 18, 1995
71