From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
The Stability of Human P-Globin mRNA Is Dependent on Structural
Determinants Positioned Within Its 3' Untranslated Region
By J. Eric Russell and Stephen A. Liebhaber
Controls that act at bothtranscriptional and posttranscriptional levels assure that globin genes are highly expressed
in developing erythroid cells. The extraordinary stabilities of
a- and P-globin mRNAs permit globin proteinst o accumulate t o substantial levels in these cells, even in the face of
physiologic transcriptionalsilencing. Structural features that
determine a-globin mRNA stability have recently been identified within its B'UTR; in contrast, the structural features
that determine P-globin mRNA stability remainobscure. The
current stJdy begins t o define the structural basis for pglobin mRNA stability. Two tandem antitermination mutations are introduced into the wild-type human P-globin
gene
that permitribosomes t o read into the3'UTR of the encoded
P-globin mRNA. The readthrough P-globin mRNA is destabilized in cultured erythroid cells, indicating that, as in human
a-globin mRNA, an unperturbed B'UTR is crucial t o maintaining mRNA stability. Additional experiments show
that the P-globin and a-globin
mRNA 3'UTRs provide equivalent levels of stability t o a linked P-globin mRNA coding
region, suggesting a parallel in their function(s). However,
destabilization ofthe antiterminated P-globin
mRNA is independent ofactive translation into theB'UTR, whereas translation into the a-globin
mRNA 3'UTRdestabilizes a linked Pglobin coding region in a translationally dependent manner.
This indicates that thea- and P-globin 3'UTRs may stabilize
linked mRNAs through distinct mechanisms. Finally, it is
shown that neither of the two mutations that, in combination, destabilize the P-globin mRNA have any effect on
P-globin mRNA stability when present singly, suggesting
potential redundancy of stabilizing elements. In sum, the
current study shows that a functionally intactP-globin
mRNA B'UTR is crucial t o maintaining P-globinmRNA stability and
provides a level ofstability that functionally
is
equivalent to, although potentially mechanistically distinct from,
the previously characterized a-globin mRNA B'UTR stability
element.
Q 1996 by The American Society of Hematology.
T
regulated. Whereas most mRNAs havedegradationhalflives (t1,2s) rangingfrom several minutes to several h o ~ r s , ' ~ . ' '
globin mRNA t 1 , 2have
~
been estimated between 16 and 48
hours in a variety of ~ettings.~"'~
Their remarkable stability
permits globin mRNAs to accumulate to greater than 95%
of the total cellular mRNAin terminally differentiated erythrocyte precursors.2' An understanding of the structural basis
for the extraordinary stability of a-globin mRNA in developing erythroid cells has been facilitated by the study of the
The a'' gene, which is the
a-globin gene variant aCS.2h-2y
most frequent cause of nondeletional a-thalassemia worldwide, contains a UAA-CAA antitermination mutation that
permits translating ribosomes to read past the normal translation termination codon and into the 3' untranslated region
(UTR).28.2'The readthrough ribosomes appear to disrupt sequences or structures in the 3'UTR of the a-globin mRNA
that determine its stability.28 The positions and functions of
three putative stability-determining sequences in this region
havebeenidentified by mutational analysis.'" Boththein
vivo stability of the a-globin mRNA and the invitro assembly of a sequence-specific mRNP complex are disrupted by
mutationspositionedatany
one of these threeThese
observations suggest that the three
sequences cooperate to
assembleanmRNPcomplex
that determinesa-globin
mRNA stability.
Althoughthehuman p-globin mRNA is also extraordinarily stable in erythroid cells, the molecular basis for its
stability has not been defined. Three naturally occurring pglobin mRNAs havebeen described thatcontain antitermina,BSaveme, and peranst""
.32-34 An
tion (frameshift) mutations: pTak,
in-frame UAA within the P-globin 3'UTR limits ribosomes
to readinganadditional
10 codonsinto thisregion. The
stabilities of the mRNAs encoded by these P-globin gene
variants have never been directly investigated. An attractive
hypothesisis that antiterminationmutationsdestabilize
pglobinmRNA viathe samemechanism described for aglobin mRNA; ie, by permitting readthrough ribosomes to
disrupt a stability-determining element positioned within its
3'UTR. However, the markedly decreased levels of acspro-
HE EXPRESSION OF human globin genes is a highly
regulated process that requires both transcriptional and
posttranscriptional controls. These controls dictate the highlevel, erythroid cell-specific, and developmental stage-specific expression of the a-like and P-likeglobin genes: 6-and
a- and y-globin during
€-globin during early embryogenesis,
fetal development, and a- and P-globin in adults.' The restriction of globin gene transcription to erythroid cells appears to be mediated by the combined activities of lineagerestrictedtranscription
factorssuch as GATA-I, NF-E2,
EKLF, Nrf-l, Nrf-2, and LCR-F1 and ubiquitous transcripFull levels of develoption factorssuchasAP-1and
mentalstage-appropriateglobin
gene transcriptionrequire
the interaction of globin genepromoters with upstream
DNase1 hypersensitive regulatory sequences.
The latter set
of determinants are encompassedwithin the p-locus control
region and the a-positiveregulatory element, positioned upstream of the p- and a-globin gene clusters, respectively.'""'
Developmental silencers (eg,upstream of the t-globin gene)
andenhancers(eg,downstream
of the P- and Ayglobin
genes) further refine transcriptional control.'2~'5
Posttranscriptional control of globin mRNA stability provides a secondlevelatwhichglobin
gene expression is
From the Howard Hughes Medical Institute and Departments
of Medicine (Hematology-Oncology) and Genetics, University of
Pennsylvania, Philadelphia, PA.
Submitted October 12, 1995; accepted February 12, 1996.
Supported by National Institutes of Health Grant No. K1 1HL02623. S.A.L. is an Investigator of the Howard Hughes Medical
Institute.
Address reprint requests to J. Eric Russell, MD, Departnzent of
Genetics, University of Pennsylvania, Clinical Research Building,
Room 435, 415 Curie Blvd, Philadelphia, PA 19104.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. ,section 1734 solely to
indicate this fact.
0 1996 by The American Society of Hematology.
0006-497//96/8712-0027$3.00/0
5314
Blood, Vol 87, No 12 (June 15), 1996: pp 5314-5323
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
&GLOBINMRNASTABILITY
5315
globin gene(s) and mutations that they carry, eg, plasmid pPSm,B.Af
tein observed in affected a' heterozygotes (typically <2%
contains a P-globin gene with Sm, B, and Af mutations. Parental
of normal a-globin expression) contrasts sharply with the
p158.2K13 is designated p@"'.
approximately 40% level of expression of readthrough
pCell culture. Murine erythroleukemia (MEL) cells, which priglobin proteins in individuals heterozygous for p'", pSaVeme,
marily express adult a- and P-globins, were cultured in minimum
or pCranston.
This observation implies normal or near-normal
essential medium (MEM) supplemented with 8% fetal bovine serum
stability of the mutant (antiterminated) &globin ~ R N A s . ~ ' " ~ (FBS), 100 U/mL penicillin, 100 pg/mL streptomycin, and 2
This distinction between the
a- and 0-globin mRNA3'UTRs
mmol/L glutamine in a 37"C/5% CO2 incubator. Cells in log phase
is further supported by the observation that the a-globin
were washed twice in excess cold phosphate-buffered saline (PBS)
mRNA is fully destabilized when ribosomes read as few as
and resuspended in cold PBS to a density of 5 X IO' cells/mL.
Aliquots of 0.4 mL were transferred to prechilled electroporation
4 codonsintothe3'UTR.28Stability
control elements, if
chambers (BRL, Grand Island, NY) with 10 to 20 pg of a 1:l mix
present in the p-globin mRNA 3'UTR, must therefore be
of supercoiled pp"' and pOVana"' in 20 pL of H20. Electroporations
positioned further 3' relative to the termination codon than
were performed in a Cell-Porator (BRL) at the following settings:
they are situated within the a-globin mRNA
3'UTR. In paralhigh ohms, 400 V, and 800 pF. Cells were placedon ice for 10
lel with this apparent difference in positioning, the sequenceminutes and then transferred to a 100-cmZdish containing 10 mL
specific mRNP complex that assembles in vitro
on the asupplemented MEM media for an additional 2 to 4 hours. The cells
globin mRNA 3'UTR does not assemble on the 3'UTR of
were then layered over 1.S mL of a 35:20:45 Hypaque:Percoll:H,O
P-globin mRNA.3' These contrasting features of the human
gradient and centrifuged for 15 minutes at 5OOg to remove cell
a- and p-globin mRNA 3'UTRs suggest that their stabilities debris. Surviving cells were resuspended in supplemented MEM
may be determined by distinct structures and/or mechanisms. media and incubated for 24 hours. When required, actinomycin D
In the current study, we beginto define the mechanism(s)
(Act D; Cal Biochem, La Jolla, CA) or 5,6-Dichloro-l-~-D-ribofuranosylbenzimidazole (DRB; Sigma, St Louis, MO) were added to
throughwhichhuman&globinmRNAisstabilized.
The
results show that the native structure of the p-globin mRNA final concentrations of I O pg/mL or 40 pmol/L, respectively. Cell
viability in transcriptionally arrested cells was monitored by trypan
3'UTR is crucial to the stability of p-globin mRNA andhas
blue exclusion.
a stabilizing effect equivalent to thatof the a-globin mRNA
RNA isolation. Cytoplasmic RNA from cells was prepared using
3'UTR. Additional data are presented that support the
hyan adaptation of the method described by Laski et al.3" Cells were
pothesisthatthefunctionalsimilaritiesofthe
a- and pwashed twice in ice-cold PBS, resuspended in 100 pL lysis buffer
globin mRNA stability elements may arise through distinct
(0.65% NP-40, 10 mmol/L Tris, pH 7.5, 150 mmol/L NaC1, 15
structures and/or independent mechanisms.
mmol/L MgCI2) and incubated on ice for 2 minutes. Cell debris
was pelleted by a full-speed 2-minute spin in a desktop centrifuge
MATERIALS ANDMETHODS
(Eppendorf 5415C; Brinkmann Instruments, Westbury, NY), and the
supernatant was mixed with an equal volume of urea buffer (7 mol/
Plasmids. Plasmids containing the human P-globin gene were
L urea, 10 mmol/L Tris, pH 7.5, 10 mmol/L EDTA, 750 mmol/L
derived from p158.2 (kind gift of S. Orkin, Boston, MA),which
NaCI) and incubated for 2 minutes on ice. Samples were extracted
contains the 4. I-kb Hpa VXba I genomic fragment encoding the
once with phenol and once with 25:24:1 pheno1:cbloroform:isoamyl
entire 1.6-kb gene along with 0.8 kb of 3' flanking region and 1.7
alcohol, precipitated with 2.5 v01 EtOH, and washed twice with 70%
kb of S' flanking sequence, adjacent to a 1.9-kb Kpn YPvu I1 DNA
EtOH. Pellets were resuspended in 20 to 40 pL sterile deionized
fragment containing the human 8-globin locus control region DNase
H 2 0 and stored at -80°C.
hypersensitive site 2. Plasmid pSV2Aneoa2 contains the 1.5-kbPst I
Northern analysis. Samples containing approximately 5 pg of
human a2-globin gene fragment previously de~cribed.~'
To facilitate
purified cytoplasmic RNAwererun
on an agarose/formaldehyde
construction of P-globin gene variants, the polylinker EcoRI site in
gel, transferred to Gene Screen Plus (New England Nuclear, Boston,
p158.2 was eliminated by partial EcoRI digestion and religation of
MA), probed, andwashedas
previously de~cribed.~'
32P-labeled
the Klenow-blunted ends, leaving a unique EcoRI site within Pprobe was prepared by random primer labeling (Boehringer Mannglobin exon 111 (p158.2K13). Variant P-globin genes were syntheheim, Indianapolis, IN) using as template the 1.4-kb Xho I fragment
sized by creating point mutations within the 904-bp EcoFU-EcoNI
of murine c-myc cDNA (kind gift of W.M.F. Lee, Philadelphia, PA).
fragment by splice-overlap-extension (SOE; see below) and ligating
Synthesis of P-globin gene variants. Oligomers were synthethe mutant sequences into the prepared EcoRUEcuNI site of
sized by the Howard Hughes Oligomer Synthesis Service atthe
p158.2K13, or by creating a mutation within the 547-bp Dra 111
University of Pennsylvania (Table 1). Mutations Sm, B, Af, and P
fragment by the same technique and substituting it for the native
were introduced by a similar SOE strategy that will be described
Dra 111sequence. Variant ,&globin genes were created that contained
for mutation B in detail. Reaction 1 included primers P1355/1374
one, two, or three mutations. Mutation Sm is an AU-CG substitution
and P1490/1459/Bcl I in a 50 pL mix containing 20 ng template
at mRNA positions +51/52 (numbered from the cap site) that deDNA, 100 pmol each oligomer, 200 mmol/L each dNTP, 1 X Vent
stroys the translation initiation codon; mutation B is a UG insertion
buffer, and 1 U Vent polymerase (New England Biolabs, Beverly,
following position 486; and mutation Af is a U< and A-W substiMA). Reaction 2 comprised the same reaction mix but with primers
tution at positions 522 and 524, respectively. By design, each of
these mutations creates a restriction site (Sm, Sma I; B, Bcl I; Af,
P147111490 and P2334/2315. Amplifications were performed in a
A$ 11) that facilitates subsequent mRNA analysis (see below). A Pa
Thermal Cycler (Perkin-Elmer Cetus model 480; Perkin-Elmer
chimeric gene, in which the a-globin 3'UTR is substituted for the
Cetus, Norwalk, CT) at the following settings: 95°C for 3 minutes,
equivalent 8-globin sequence, was also constructed by SOE/poly50°C for 1 minute, and 73°C for 1.S minutes (1 cycle); 95°C for 1
merase chain reaction (PCR). Three variants of the Pa chimeric
minute, 50°C for 1 minute, and73°C for 1.5 minutes (4 cycles);
gene were constructed, one containing a mutation of the initiation
95°C for 1 minute, 56°C for 1 minute, and 73°C for 1 .S minutes (20
codon (mutation Sm), the second containing a mutation of the transcycles); and73°C for 5 minutes ( 1 cycle). One microliter each of
lation termination codon (mutation P [Pvu 111, TAA-TCA), and a
reactions 1 and 2 was combined with 48 pL ofPCR reaction mix
third containing both the Sm and P mutations. For convenience,
containing oligomers PI 355/1374 and P2334/2315 and amplified
plasmids are designated by the prefix "p" followed by the parental
using95°C for 3 minutes, 42°C for 1 minute, and73°C for 1.5
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
5316
A N D LIEBHABER
Table 1. DNA Oligomers Used in the Current Study
Primer*
Length
SOE synthesis
p611431Sma I
p43/61/Sma I
p5311512
4-1931-174
0135511374
p233412315
p149011459/Bc/ I
fl147111490
~1478115111Af/
II
p149711478
pcode-a3'UTR
a3'UTR-pcode
pcode-a3'UTR/Pvu II
a3'UTR-BcodelPvu I I
a3'UTR-p3'flank
pB'flank-u3'UTR
19
19
20
20
20
Orientation
~
+
~
+
+
20
34
20
34
-
20
-
-
+
+
Seauence (5' + 3'lt
Position
p Exon I
p Exon 1
p IVS-2
p 5' flanking
p Exon 111
p 3' flanking
p Exon 111
p Exon 111
p Exon 111
p Exon Ill
AGGTGCACCCGGGTGTCTG
CAGACACCCGGGTGCACCT
AGGGGAAA~WCATCAAG
TTAGAGGGAGGGCTGAGGGT
AACGTGCTGGTCTGTGTGCT
AGAATGGGACTTCCATTTGG
CAGCAAGAAAGCGAGCTTAGTGATCAACTTGTGG
-
CTAAGCTCGCTCTTGCTG
CGCTCTTGCTGTCCAATCTACTTAAGGTTC
"
AATTGGACAGCAAGAAAGCG
30
31
30
31
30
31
+
-
Compound pia
Compound pla
Compound pla
CCGAGGCTCCAGCTGAGTGATACTTGTGGGC
Compound pla
GTCTGAGTGGGCGGCCAATGATGTATAA Compound pia
TTAAATACATCATGGCCGCCCACTCAGACT
Compound pla
47
25
+
TACACATACGATAGGTGACACTATAACATTTGCTTCTGACACAAC p Exon 1
-
I I G C A A T G A A A A
21
25
+
20
20
20
-
GGCAATAGCAATATCTGCA
ATTCAGAAATAATAAATACATCA
GGCCATCACTAAAGGCACCG
AGGGGAAAGAAAACATCAAG
GAGCCTTCACCTTAGGGTTG
ACACAACTGTGTTCACTAGC
TTGCCACACTGAGTGAGCTG
GCACTGTGACAAGCTGCACG
CAGTAGTAGTGGACTTAGG
GCCGCCCACTCAGACTTTATT
-
-t
-
+
GCCCACAAGTATCACTAAGCTGGAGCCTCG
CCGAGGCTCCAGCTAGTGATACTTGTGGGC
GCCCACAAGTATCACTCAGCTGGAGCCTCG
Transcription/translation assay
SP685'NTR
pTl5NlO
RT-PCR assay
p114711167
8163311 609
p406/387
p5311512
83701351
p1 4/33
p4371456
04561475
p154111520
a8341814
20
20
20
22
21
-
-
+
+
+
~
-
tail
Illlpoly-A p Exon
p
p
p
p
p
IVS-2
3' flanking
Exon II
IVS-2
Exon II
0 5'
UTR
p Exon II
p Exon II
p Exon 111
a Exon 111
* Primer designations reflect positions and orientations relative to the native a- or p-globin gene sequence. For example, primer L?1541/1520
is the antisense 8-globin gene sequence from position 1541 (5') to 1520 (3'). Compound oligomers are designated along similar lines, using
component origin (coding region, S'UTR, or 3' flanking region) to indicate sequence origin. Oligomers that contain mutations that encode
restriction sites are indicated with an appropriate suffix (eg, @l4781151l/Af/ 11). The transcriptional start site is designated position + l .
t Nucleotide insertions or mutations of the wild-type a-or p-globin gene sequence are underlined for clarity.
minutes (1 cycle); 95°C for 1 minute, 45°C for 1 minute, and 73°C
for 1.5 minutes (4 cycles); 95°C for 1 minute, 56°C for 1 minute,
and73°C for 1.5 minutes (20 cycles); and73°C for 5 minutes (1
cycle). The amplified product was digested with EcoRI and EcoN1,
gel-purified, and ligated into the EcoRYEcoNI site of pp"'using T4
DNA ligase according to the manufacturer's recommended protocol.
Transfection-competent dam- Escherichia coli cells (kind gift of D.
Portnoy, Philadelphia, PA) were electroporated with the ligation mix
using a Bio-Rad Gene Pulser (Bio-Rad, Hercules, CA) according to
manufacturer's instructions. Desired mutant plasmids were identified
by Bcl I digestion and confirmed by restriction mapping and sequencing between the EcoRI site and the 3' flanking region. Other variant
plasmids were constructed in a similar manner from the pp"' template using different primers to introduce desired mutations (Table
l): ppA'(p1355/1374
p1497/1478, pI478/1511/A$ I1 + p23341
2315) and ppB,"'(pl355/1374 + p1490/1459/BcI I, p1478/1511/Aj
11 + 82334/2315). pp''" was constructed by introducing an SOEgenerated fragment (p-193/-174
p61143/Sma I, fl43/61/Sma I
+ p531/5 12) into Dra I11 sites bracketing exon I and pPSm,B,Af
p/3as", and ppaSm.Pconstructed by introducing the Sm-containing
SOE fragment into pp"."', p&, or ppap, respectively. ppa was
constructed by combining in an SOE reaction P-globin gene fragments amplified using (p135511374 + a3'UTWpcode) and
+
+
(a3'UTWp3'flank + p2334/2315) with an a-globin gene fragment
amplified using (pcodela3'UTR + P3'flanMa3'UTR). pp"'was
similarly constructed, substituting oligomers a3'UTW~codelPvu I1
and pcodela3'UTRIPvu I1 where appropriate.
Reverse transcription-PCR (RT-PCR) assay. A IO-pL reaction
mixture containing 50 pmol oligomer p154111520 and 4 pL of sample RNA was heated to 95°C for 3 minutes and then chilled on ice.
Ten microliters of RT reaction master mix was then added (2 pL
1OX PCR salts, 18 U avian myeloblastosis virus (AMV) reverse
transcriptase, and 500 pmol of each dNTP), and tubes were incubated
for 45 minutes at 45°C. A 30-pLPCR reaction master mix containing
100 pmol oligo p437/456 was then added to a final 50-pL reaction
volume (0.12% P-mercaptoethanol, 5% dimethyl sulfoxide [DMSO],
0.5 pL Taq polymerase, 50 mmoVL KCl, 20 mmoVL Tris [pH 8.41,
1.5 mmoVL MgCI2, and 100 pg/mL BSA). The samples were amplified for 25 cycles using 92°C for 3 minutes, 58°C for 15 seconds, and
72°C for 30 seconds (1 cycle); 92°C for 1 minute, 58°C for 15seconds,
and 72°C for 30 seconds (30 cycles); and 72°C for I minute (1 cycle).
Samples were then spiked with 10 pL of a mix containing 0.25 pL
Taq, 50 pm01 'zP-labeled oligo p456/475, 500 pmol each dNTP, and
1X in PCR salts and amplifiedfor a single cycle of 95°C for 3 minutes,
58°C for 15seconds,and72°C
for 30 seconds. This approach of
selectively adding the '*P-labeled primer for the final extension reac-
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
0-GLOBIN MRNA STABILITY
5317
two highly similar ,&globin *As
transiently expressed
tioninsuredthatall"P-labeledproductswerehomoduplexesthat
would be fully sensitive to restriction enzyme digestion analysis. Chi-in MEL cells, an RT-PCR assay was developed. This assay
meric pa mRNAs were assayed using a834/814 as the 3' oligomer.
permits the relative quantitation of the two *As
when
psmmRNA was assayed in a similar manner using unlabeled oligopresent at low concentrations in the same sample
(Fig 1A
mers p14/33 and p406/387 for the initial PCR amplification and "Pand Materials andMethods). The wild-type (Pw')and variant
labeled p370/351 for the final cycle. RT-PCR reactions were extracted
(P""') /?-globin mRNAs present in a typical sample are rewithanequalvolume25:24:1
pheno1:chloroform:isoamyl alcohol,
verse-transcribed and PCR-amplified. A finalextension reacEtOH precipitated, and then taken up inpL
30H20.An approximately
so that
tion is performed with a nested 32P-labeled primer,
equal number of counts from each sample was taken up in
a 15 pL
allend-labeled cDNAs are perfect duplexes that are fully
volume and digested with an appropriate restriction endonuclease, ie,
susceptible to restriction enzyme analysis. The cDNA prodSma I, Bcl I, Afi 11, or Pvu I1 for samples containing mutations Sm,
B, Af, or P, respectively. Samples were digested for
2 hours using
ucts are then digested with a restriction enzyme that recogrecommended buffers and conditions (New England Biolabs), and an
nizes the mutation that defines each specific Pva. The uncut
aliquot of each reaction was resolved on an 8 m o m urea/6% acryl(f?'"") and cut (p""') fragments are resolved on a denaturing
amide gel. Band density was determined
by PhosphoImager densitomare deteracrylamide gel and theirrelativeconcentrations
etry. p" mRNA corresponds to an undigested band (236
bp), whereas
mined. The capacity of this assay to linearly amplify input
variant P-globin mRNA cut at Bcl I or Aj? I1 corresponds to bands
of161 or 197 bp, respectively. Undigested (pa) and digested (PaP) DNAs was confirmed using mixtures containing known ratios (ranging from 1:8 to 8:l) of wild-type human P-globin
bandsofpredictedsize278and168bp
are observed, respectively.
gene (pp"') and a P-globin gene variant containing a mutaTo showcompletedigestionofeachsample,themastermixwas
spiked with a 32P-labeled 487-bp fragment
of ppB,*'ora 435-bp fragtion that encodes a Bcl I restriction site immediately 5' of
ment of p&~' that were amplified from the cloned genes in separate
the termination codon (pp"; Fig 1B).Additional experiments
PCR reactions using oligomers p1147/1167 and p1633/1609 for 25
(data not shown) confirm that the ratio of the coamplified
cycles and 3'P-labeled p1147/1167 for the final cycle. Full digestion
products is not influenced by the number of PCR cycles,
was indicated in each sample by the disappearance of the 487-bp 32Peven when an amplification plateau is reached.
labeled control cDNA with replacementby a 319- or 354-bp fragment
Using theRT-PCRassay,the
relativestability of two
(Bcl I or Aj? I1 digests,respectively) or 326-bpfragment (fiu I1
mRNAs
can
be
determined
by
measuring
thetime-dependent
digest). Control ppSrnsequences, when required, were amplified from
change in their relative levels in transcriptionally
silenced
the pps template using oligomers p-193/-174, p531/512, and 32Pcells. To determine thestability of a variant P-globin mRNA
labeled p531/5 12.
In vitro transcri~tion/rranslation. Thelowexpressionof p-glo(Pvu)relative to a parental wild-type P-globin mRNA (P""),
bin proteins from MEL cells transiently transfected with 8-globin
equal amounts of the corresponding genes are
mixed and
gene variants precluded their direct assay. The translational activity
cotransfected into MEL cells (Fig 2A). After a 24-hour reof the expressed globin mRNAs was determined instead by a linked
coveryperiod, thecells are treatedwithatranscriptional
RT-PClUtranscriptiodtranslationassay. mRNAs fromtransiently
inhibitor (Act D or DRB) and purified cytoplasmic RNA
transfected cells were isolated and amplified for 30 cyclesaninRTprepared
from aliquots harvested after an additional 0, 3, 6,
PCR reaction using oligomersPTlSNlO and SP685'NTR. Amplified
and 9 hours. The level of pVar
mRNA is determined relative
cDNAs were purified from a 5% polyacrylamide gel and an aliquot
to parental , P t mRNA in each aliquot by the RT-PCR assay
transcribedin vitro, as previously de~cribed.~'Thetranscription
products were purified over a G50 sephadex mini-spin column pre(see above), and the normalized ratio was plotted as a funcequilibratedwith deionized H 2 0 , and 1 pL of product was translated
tion of the duration of time posttranscriptionalinhibition.
in rabbit reticulocyte lysate supplemented with [3H]-lysine.38 Trans- Transcriptional arrest of the Act D-treated MEL cells is conlation products were analyzed in parallel on a Triton-acid-ureagel3'
firmed by Northern analysis of aliquots for short-lived (TLIZ
and by sodium dodecyl sulfate-polyacrylamide gelelectrophoresis
= 15 minutes) c-myc mRNA (Fig 2B):"
As expected, the
(SDS-PAGE).
T
=
0
is
lost
at subsequent
high-intensity
signal
observed
at
Data analysis. Resultsfromindependent Sma I, Bcl I, A j 11,
time points,indicatingrapid
andcomplete transcriptional
and/or Pvu I1 digests from samples with more than one candidate
inhibition.
restriction site (such asp","') were averaged and counted asa single
determination.To eliminate interexperimental variation due to differ- The 3'UTR of human P-globin mRNA is involved in mRNA
ences in the ratio of input DNA and the efficiency of transformation,
stabilization. Structuralfeatures of the a-globinmRNA
eachdatapointwasexpressedas
a ratio of digestedxndigested
3'UTR that determine itsstability have recentlybeen de(mutant:wt)product and normalized to the average value of all time
scribed.Similar
stability elements might be positioned
points from a single transformation. The ratios were then renormalwithin the 3'UTR of the wild-typeP-globin mRNA,in which
ized to the average T = 0 value from all transformations to center
event they would be protected from disruption by translating
T = 0 values near unity. Linear regression analysis was performed
ribosomes. To testthishypothesis,
two tandem mutations
by standard techniques. The half-life tl/zca,An
of p"."' was estimated
wereintroduced into the wild-type P-globin gene that, in
fromtheequation:
tl,2iB,An= ln(2)/[(1n(2)/t,,,,,,) - (ln(R)/t)], in
which the variable R is the ratioof PB.*':pw'aftert hours of transcripcombination,permitribosomesto
read intotheP-globin
tional arrest and tl12(wf)is the half-life of p"' &A. The equation
mRNA 3'UTR for a total of 37 codons, until the next inderives from the general formula for exponential decay of a subframeUAA translation stopcodon isencountered (22 nt
strate: n = n"e-", in whichn, and n represent the initial concentration
upstream of the poly-adenylation site). P"."'mRNA is a fulland concentration remaining aftert hours of decay,respectively, and
length human P-globin mRNAwith two setsof substitutions:
A = ln(2)/tl,2.
a 2-nt insertion 5 nt upstream from the native termination
RESULTS
codon (mutation B; directs ashift to the -1 translational
Assay of P-globin mRNA stability in transiently transreading frame) and an in-frame antitermination mutation 10
relativestabilitiesof
fected MEL cells. Tocomparethe
codons into the 3'UTR
(mutation Af). The mRNA containing
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
RUSSELL AND LIEBHABER
5318
RTPCR
Restriction Digest
4
4
-
"
-
B
&"8
24
Input DNAs
1 1
1
P"
BC!I
restriction
products
p":pB
1.0
1
P"
m
Input DNA
m
0 . .
o PCR Products
Fig 1. The relative concentrations of wild-type and variant p-globin mRNAs quantitated by RT-PCR. (A) Assay. Cytoplasmic RNA is
isolated from transfected MEL cells. In this example, two mRNAs,
wild-type (pw)and variant(p'"), are expressed from the transfected
genes (depictedas gray and dark lines, respectively). The two mRNAs
are identical except for the presence of a mutation ("1 in p'". The
mixture of mRNAs is reverse-transcribed and PCR-amplified with a
set of unlabeled primers (+ and -1 that bracket the divergentsite. A
final elongation cycle is then performed with a nested 32P-labeled
cycle
oligomer ( +.The 32P-labeledcDNAs generated during this final
are obligate cDNA homodimers that contain the wt or mutant sequence. The two cDNAs are distinguished by digestion
with a restriction endonuclease specific for the p"" mutant site, yielding uncut
and cut 32P-labeledfragments corresponding t o p" and p'"' amplified
product, respectively. The two different-sized fragments are resolved
on a denaturing acrylamidelurea gel and their relative intensities
determined. (B) Quantitation control for theRT-PCR assay. Mixtures
containing known ratiosof supercoiled wild-type (pp"") and variant
DNA (the example [pp'] contains a BC/ 1 sitel were PCR-amplified,
extended a final cycle with a 32P-labelednested primer, digested with
BC/1, and resolved on a denaturing acrylamidelurea gelas described
in (A). The positions ofp" and p' restriction fragmentsare identified
t o the rightof the autoradiograph. The ratio of p":pB PCR products
(0)
was determined byPhospholmager and plotted beloweach lane
along with theoriginal ratioof input pp" :pp8 DNAs (0)
t o show the
accuracy of the PCR assay.
these two mutations, p".^' mRNA (Fig 3A. left), is the pglobin mRNA analog of the antiterminated acsmRNA. The
stability of the DR..^'
mRNA relative to the P"' mRNA was
determined in Act D-treated MEL cells using the RT-PCR
assay (Fig 3B, left) and was confirmed in parallelexperiments using DRB, a mechanistically distinct transcriptional
inhibitor'" (Fig 3C). Both studies indicateanapproximate
35% decrease in the level of
mRNA relative to p"'
mRNA during a 9-hour transcriptional chase. These results
suggest that a structurally intact 3'UTR is critical to maintaining full &globin mRNA stability.
The a-and 0-globin mRNA 3'UTRs provide an equivalent
degree qf stability 10 a linked P-globin mRNA coding region.
The long half-lives of human a- and &globin mRNAs and
the balanced synthesis of theirencodedglobin
chains in
differentiating erythroid cells suggests that the two mRNAs
may be stabilized by related mechanisms. To investigate the
possibility that the a- and P-globin 3'UTRs provide functionally equivalent degrees of stability, the &globin 3'UTR
was substituted by the a-globin 3'UTR to createthe chimeric
gene p& (Fig 3A, right). A readthrough variant of this pachimeric gene (ppa') was also constructed by mutating the
termination codon TAA-TCA (creating a Pvu I1 site at this
position). This antitermination mutation permits ribosomes
to rcad into the a-globin 3'UTR for an additional 3 1 codons
until the next in-frame codon is encountered 19 nt upstream
of the polyadenylation site, exactly as occurs in acsmRNA.
Relative to pa mRNA, the level of readthrough paPmRNA
decreased by approximately 35% over 9 hours in Act Dtreated MEL cells (Fig 3B, right). This result, when compared with the effect of translational readthrough into the pglobinmRNA3'UTR
in theprevious experiment (-35%
decrease per 9 hours: Fig 3B, left), suggests that the 0-and
a-globin mRNA 3'UTRs provideanequivalent degree of
stability to a linked &globin mRNA.
The a-and fl-globin mRNA 3'UTRs may stabilize a linked
P-globin mRNA coding region rkrough distinct mechanisms.
Although the a- and&globin mRNA 3'UTRs stabilizea
linked @globin mRNA coding region to the same degree,
computer-assisted comparison of the a-and B-globin mRNA
3'UTRs fails to showsignificant primary or secondary structural similarities that might constitute a shared stability-determiningelement(data
not shown).Additionalindirect
evidence indicates that the two regions may act in mechanistically distinct fashions (see Introduction and Discussion).
We therefore tested whether conditions known to affect the
function of the a-globin mRNA stability element also affect
the function of the &globin mRNA stability element. Instability of aCSmRNA is known to be translationally dependent.'x We asked whether destabilization caused by readthrough mutations within the P"."'and &'
mRNAs wasalso
dependent on active translation. To do this,the initiation
codons of the P"."' and pa' mRNAs were destroyed by an
AUCrrCCG mutation (Fig 4A). This initiation codon mutation (mutation Sm) has no demonstrable effect on the stability of p"' or Pa mRNA when present alone (pq'"
and Pasm;
Fig 4A and B).When the Sm mutation is introduced into the
antiterminated Da-chimeric mRNA (Fig 4A,fla".P),normal
stability is restored (Fig 4B, right). This is consistent with
the restoration of stability to a(" mRNA by any of several
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
O-GLOBIN MRNA STABILITY
5319
B
A
c
3
-
Elactmporate
mixture
DNA
into cells
H w post-Act
~
D
0 3 6 9
FP"
c-myc
mRNA
MEL cells
24
hours
-n
Add Transcriptional
inhibitor
0
+
3
RNA
Recover
RNA
Recover RNA
6
9
Recover
RNA
RBcover
Fig 2. Stability of a variant P-globin mRNA relative to wild-type @globin mRNA in transcriptionally arrested MEL cells. (A) Assay. Equal
quantities of pp" and ppv" plasmids are coelectroporated into MEL cells followed by 24 hours of recovery. A transcriptional inhibitor (Act D
or DRB) is then added (T = 0) and cytoplasmic RNA harvested from cell aliquots at T = 0, 3, 6, and 9 hours. The ratio of p'" mRNA relative
to p" mRNA is determined in each aliquot by the RT-PCR assay illustrated in Fig 1A. (B) Transcriptional inhibition in MEL cells is rapid and
complete. (Upper panel) Transiently transfected MEL cells were exposed to Act D and total cytoplasmic mRNA was isolated at the times
indicated. mRNAs were analyzed on a Northern blot hybridized with a murine c-myc cDNA probe. (Lower panel) EtBr fluorescence ofthe sama
gel under UV illumination. Positions of the 18s and 28s rRNAs are indicated.
methods that arrest its translation.2nSurprisingly, when the
same translation-arresting Sm mutation was substituted into
the g"."' mRNA (Fig 4A, /?sm.s.nr), themRNAremained
unstable (Fig 4B, left). This observation was confirmed using
DRB as transcriptional inhibitor (data not shown). These
results suggest that, although the 3'UTRs of the a- and 0globin mRNAs provide similar levels of stability to a linked
globin coding region, the mechanisms through which they
work may in fact be distinct.
The inability of the translation initiation (Sm) mutation to
stabilize p"."' mRNA might reflect ongoing translation via
initiation at a cryptic translation initiation site. This formal
possibility was unlikely, because the same sites wouldbe
available for cryptic translation initiation and subsequent
destabilization of
which does not appear to occur.
However, to confirm that the introduced Sm mutation effectively blocks translation in the ps'"~"~"'
mRNA, a linked RTPCWtranscriptiodtranslationassay was used (see Materials
and Methods). The D"."' mRNA translated an elongated globin chain, as predicted, whereas the pSrn.'."'
mRNA failed to
express a protein product (Fig 4C). pw'mRNA present in
the B"."' and ~ S m ~ B ~samples
A '
functions as an internal control
for each step, yielding pw'protein in both cases. The predicted sizes of the p..1 and g"."' proteins were verified by
SDS-PAGE (data not shown). These data confirm that the
Sm mutation effectively blocks translation of the /?"".B.A'
mRNA. Thus, the tandem B + Af mutations destabilize 0globin mRNA by a translationally independent mechanism.
Mutations that destabilize the P-globin mRNA in tandem
have no efSectwhen introduced singly. The translational
independence of p"."' instability suggests that mutation B or
mutation Af may destabilize P-globin mRNA directly rather
than via their permissive effects on ribosomal entry into the
3'UTR. This direct destabilization mechanism wouldparallel
the direct destabilizing effect that results from introduction
of site-specific mutations into any one of three segments
of the a-globin mRNA 3'UTR stability determinant." The
destabilizing effects of mutations B and Af were therefore
tested individually (Fig 5A; p" and PA'). Surprisingly, both
the ~ " : P " and
' ~ " ' : f l W ' mRNA ratios remained constant during a 9-hour transcriptional chase, indicating that the p" and
p"' mRNAs are both equally stable to pw'mRNA (Fig 5B).
To confirm that mutation B had the anticipated permissive
effect on ribosomal entry into the 3'UTR. RNA from the
transfected cells was assayed by the linked RT-PCWtranscriptiodtranslation assay as described above (Fig K ) . The
observed elongated &globin chain indicates that mutation
B permits ribosomal translation intothe3'UTRas
far as
codon 10, where an in-frame TAA terminates chain elongation. These results suggest that neither the B northeAf
mutation alone is responsible for
instability. Instead,
mRNA sequences that are interrupted by the two mutations
must both be altered for the mRNA to be destabilized.
DISCUSSION
The overall expression of a gene reflects the level of its
encoded mRNA. Consequently, profound differences in gene
expression can result from moderate changes in mRNA synthesis andor decay rates. The impact of mRNA stability on
overall gene expression is most pronounced in mRNAs with
exceptionally long or short t,ns. For example, the cytoplasmic levels of highly unstable mRNAs such as c-myc, cfos, interleukin-2 (IL-2). and granulocyte-macrophage colony-stimulating factor (GM-CSF) rapidly reflect even small
changes in gene transcription, providing the cell with rapidly
responsive and precise control over their expression? In
contrast, the stable nature of globin mRNAs permit them to
accumulate to high levels in maturing erythroid cells.25Their
long tlns also insure that globin mRNAsremain translationally active for several days after extrusion of the erythroid nucleus. Using an estimate of 24 to 48 hours for the
t l n of ow'mRNA, the unstable P-globin mRNAs assayed in
the current study would be expected to have tins of 8 to 12
hours (see Materials and Methods). The consequences of
such a decrease in the tln of a globin mRNA is quite dramatic
when the physiologic transcriptional silencing of maturing
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
5320
RUSSELL AND LIEBHABER
erythroid cells is considered. These transcriptionally silent
cells remain translationally active for up to 3 days in the bone
marrow and for an additional 1 to 2 days (as reticulocytes) in
the peripheral
Relative to a stable (P“‘) mRNA,
the concentration of an unstable P-globin mRNA decreases
exponentially during this period. Consequently, the 3.1 or
4:l ratio of their tIl2ssignificantly underestimates the ratio
of globin protein expressed by the stable and unstable Pglobin mRNAs, respectively. Hence, even a modest change
in the tlt2of a globin mRNA can have a major impact on
the accumulation of its encoded protein in maturing erythroid
cells, showing the critical importance of globin mRNA stability to normal erythroid development and function.
The present work begins to identify structural features that
contribute to the stability of the human P-globin mRNA. A
transient transfection system and assay was developed that
accurately and reproducibly determines the relative stabili-
B
1.4
1.2
ties of variant P-globin mRNAs (Figs 1 and 2). This approach was then applied to the specific question of whether
the 3’UTR of the pa-globin mRNA enhances its stability by
determining whether antitermination mutations that permit
ribosomal readthrough into the 3’UTR disrupt /?-globin
mRNA stability. To establish a P-globin mRNA comparable
to aCsmRNA, two tandem mutations were introduced into
the wild-type human P-globin gene that permit ribosomes
to readthrough 109 nt of the 132 nt P-globin mRNA 3’UTR
Fig 3A). Destabilization mRNA
of
relative to
parental P,’ mRNA suggests that one ormore structures
withinthe3’UTR are crucial to P-globin mRNA stability
(Fig 3B, left, and C). In a parallel set of experiments, we
determined that the P-globin mRNA coding region can be
stabilized to a similar degree by the a-globin mRNA 3’UTR
(Pa; Fig 3A, right, and B, right). These observations confirm
the importance of globin mRNA 3’UTRs to globin mRNA
1
0.4
Q 0.2
0.0
J
l
.
. , . . ,
3
0
.
,
.
6
Time p-t-Act
9
0
.
.
, . . , . .
i
3
9
6
T i m Wt-Act D
(Hours)
D
(Hours)
C
,. .,
0 . 0 J l . .
0
3
6
.9 . , 1.
.
I
2
Time ost-DRB
(tlburs)
Fig 3. The p-globin mRNA coding region is dependent on 3’UTR elements for full stability. (A) Structures of p“- and pa-globin mRNAs
and their reapecthre readthrough veriants. Fully processedp”, p”, BP, and pap mRNAs are illuatrated. &globin mRNA is shown as a bold
line and a-globin mRNA 3’UTR is shown as a cross-hatched rectangle.
The cep (0)and native Initidon start and termination sites are indlwted
(tick marks); astariskaindicate positions of introducd mutations. Tha open readingframe and translation termination site for each mRNA is
illustreted by a horizontal line with a vertical errowhead. (B)The p-globin and ugbbin mRNA 3‘UTRs provide comparable levels of stability
to the linked &globin mRNA coding region. (Left) MEL cells weretrandently cotransfected with pp“ and ppu and treated with the tranrcriptional Inhibitor Act D, and cytoplasmic RNA was recovered from cell aliquot8 harvested at 0,3,6, and 9 hours. The pBY:p“ mRNA ratio in
each eliquot, determined by the RT-PCR assay shown in Fig 1A. is displayed as a function of hours port-Act D (abaci8d. On this graph, a
horizontal line at unit value would indicate equal stability of the variant end parental mRNAs. Each point represents the mean k SE from
seven independent experiments; the best-fit curve determined by linear regression analysisdiffers from unit s
t
a
b
i
l
t
y at the P < .W level.
(Right) Determinationof the stability of readthroughpa‘ mRNA relative to pa mRNA in MEL cells transcriptionally erreated with Act D. Each
point represents the mean k SE from four independent experiments. The
beat-fitcurve differs from unitvalue at a P c .005 level of significance.
(C) Determination of relatlve BB” stability udng DRB for tranrcrlptional inhibition. The tranrcriptlonsl inhlbltor DRB was subaihlted for Act
D in an experiment otherwise identical to that described in (B).Eech point represents the mean f SE from two independent experiments.
Destabilization of p’” relative to p“ mRNA is significant at P < .005.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
0-GLOBIN MRNASTABILITY
5321
A
B
C
&
Fig 4. Translational arrest restores baseline stability t o pap mRNA but fails t o stabilize psa'mRNA. (A) Structures of p"- and pa-globin
mRNA variants. (Left) mRNAs encoded by pp",pp'",
and pp'm~s~A'.
(Right) mRNAs encoded by ppa, ppa'", and ppasm,P.Features of the
mRNAs are as described in Fig 3.An X below specific mRNAs emphasizes that translation isblocked at the initiationcodon by mutationSm.
(B) Relative stabilities of translationally silentmRNA variants in transiently transfected MEL cells. Variant ~p'".~.~'
was coelectroporated into
MEL cells with an equal amount of parental pp" as an internal control. Similarly, variant ppaSm,Pwas coelectroporated into MEL cells, with
parental p p a as an internal control. The cells were subsequently treated with Act D, and mRNAs were recovered from aliquots atT = 0, 3,6,
and 9 hours. Relative mRNA levels were determined in each aliquot by theRT-PCR assay illustrated in Fig 1A. The stability of psm.sw
relative
mRNA relative t o pa mRNA is graphed t o the right ( P = not significant).
t o p" is graphed to the left ( P < .005), and the stability of
The isolated effect of mutation Sm on the parentalp" and pa mRNAs (p'", left, and pa'", right, respectively) does not differ significantly
from unit value (dashed line). Each point represents the mean? SE from betweentwo and fourindependent experiments. (C) Initiation codon
mutations mediate complete translational
arrest. (Left) Linked RT-PCRltranscriptionltransIation assay. RNAfrom MEL cells cotransfected with
two human p-globin genes is reverse-transcribed and PCR-amplified using sequence-specific primers (+ and
The 5' primer (SP665'NTR;
see Table 1) contains an SP6 promoter sequence'* at its 5' terminal that is consequently integrated into the amplified cDNAs (gray). The
cDNAs are transcribed in vitro, and the resulting mRNAs are translated in rabbit reticulocyte lysate supplemented with ['HI-lysine. (Right)
Assay of mRNAs from MEL cells cotransfected with pp" and either
or
Control mRNAs fromnormalhuman
reticulocytes and
from in vitro transcribed cloned human p" and a-globin cDNAs were translated in parallel. Translation products were resolved on a Tritonacid-urea gel?' The p'."'-, p"-, and a-globin bands are identified to the rightof the autoradiograph (theupper a-globin band is an a-globin
oxidation product). Globinsizes were confirmed bySDS-PAGE (data not shown). See Materials and Methods for details.
4.
stability and show functional similarity between the a- and
@-globinmRNA 3'UTR stability elements.
Several key characteristics appear to distinguish the mechanisms through which human a- and P-globin mRNAs are
stabilized. These differences are especially surprising considering that the two mRNAs are evolutionarily related and
appear to be equally stable in adult erythroid cells.'.JhPrevious studies from this lab show that, under in vitro conditions
that favor assembly of a ribonucleoprotein complex within
the 3'UTR of a-globin mRNAs, no equivalent complex is
assembled on the &globin 3'UTR.3' The current study supports this apparent difference by showing that the a- and
P-globin mRNAs are stabilized through potentially distinct
mechanisms. Although translational arrest restores baseline
stability to antiterminated a-globin mRNA2R and
to chimeric
Pa-globin mRNA (Fig 4B, right), the instability of translationally arrested readthrough &globin mRNA is unaffected
(Fig 4B, left). These results were duplicated using a second,
mechanistically distinct transcriptional inhibitor (DRB; data
not shown) and were further supported by direct verification
of translational arrest (Fig 4C). The hypothesis that a- and
P-globin mRNAs may have evolved distinct stabilizing components is supported by other experimental observations.
Whereas the a-globin mRNA is destabilized by ribosomes
that read as few as 4 codons into the 3'UTR;' the P-globin
mRNA retains full stability despite readthrough as far as
10 codons into the 3'UTR (Fig 5),32" suggesting different
positioning of the respective stability elements. Furthermore,
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
RUSSELL AND LIEBHABER
5322
Fig 5. Two mutations that destabilize the human
p-globin mRNA in tandem have no effectwhen introduced singly. (A) Structures of variant mRNAs. p*'
and p"mRNAs are illustrated as detailed in Fig 3.
Asterisks indicate the sites of mutations B and Af.
(B) The single B and Af mutations have no effect on
human p-globin mRNA stability. Cultured MEL cells
were cotransfected with pp" and either ppAfor pp"
and mRNAs isolatedat defined times after transcriptional inhibition. Thelevels of p" and p*' mRNAs
relative to p" mRNA were determined using the RTPCR assay shown in Fig 1A.Neither p" nor p*' mRNA
stability differs from unit value (dashed line;P = not
significant for each). Values (mean ? SE) for p" ( W
and p"' ( 0 )were determined from four andt w o independent experiments,respectively. (C) Mutation B
permits ribosomes to read through the first part of
the p-globin mRNA B'UTR.p" mRNA was translated
in vitro with control P"" mRNA as described in Fig
4C. The positionof wild-type p-globin mRNAs is indicated to the right of the autoradiograph. Globinprotein sizes ware confirmed by SDS-PAGE (data not
shown).
C
PA' r*
t.0
0.0 J
,
0
. . , . . , .
3
&
.
,
9
Time post-Act D
(Hours)
a-globin mRNA can be destabilized by single-site mutations
at any of several disparate positions within its 3'UTR, indicating that a-globin mRNA stability is maintained by interacting, nonredundant elements.3",3'In contrast, the ,&globin
mRNAmaybe stabilized by multiple elements positioned
within the terminal coding regionand3'UTR.Neither
of
two mutations present in the unstable readthrough
mRNA can individually destabilize &globin mRNA (Fig 5 ) ;
destabilization requires presence of the two mutations in
tandem. The need for both mutations to be in place for this
destabilization does notreflect their permissive effect on
ribosomal entry into the 3'UTR. because specific inhibition
ofmRNA translation does not relieve this destabilization.
Thus, the two mutations appear to act directly on a determinant or determinants in the mRNA sequence. This observationwould account for thefact that, among the several
hundred distinct nondeletional &thalassemic mutations described, no naturally occurring unstable readthrough b-globinmRNA has been observed.' To destabilize &globin
mRNA, simple antitermination is not sufficient, and a highly
unlikely double mutation would be required.
Different stability mechanisms for a- and &globin
mRNAs may be necessary to insure developmental stagespecific expression of different globin genes. For example,
separate systems may permit P-globin mRNA to be stabilized exclusively in adult erythroid cells, whereas a-globin
mRNA is stabilized in both fetal and adult erythroid cells.
Despite these potential mechanistic differences, the a-globin
mRNA stability element is capable of stabilizing the p-globin coding region, suggesting that functional similarity of
the two stability elements is preserved to insure balanced
a- and &globin protein synthesis that is crucial to normal
erythrocyte function.
The positioning of stability-determining elements in the
3'UTR appears to be a common molecular strategy; unique
positive stability-determining elements havebeenmapped
to the 3'UTRs of histone and transferrin receptor (TW)
mRNAs, as well as the human a-globin mRNA.2X.3".'7.'8The
stability elements in a-globin, TW, and histone mRNAs are
single (perhaps multicomponent) determinants thatcanbe
disrupted by appropriately positioned mutations. By comparison, the linear separation of mutations B and Af in the 0globin mRNA 3'UTR and the requirement thatbothbe
present to destabilize the mRNA suggest that the stability
determinant present in this region may comprise a complex
and potentially redundant structure. Studies that show distinct high-order RNA structures or identify interaction with
discrete rmns-acting factors at the B and Af sites would be
of value in both validating and refining the proposed model.
ACKNOWLEDGMENT
Wethank S. Orkin for p158.2, W.M.F. Lee for cloned c-myc
sequences, D. Portnoy for dm- E coli cells, and R. Spielman for
statistical assistance.
REFERENCES
1. Russell JE, Liebhaber SA: Molecular genetics of thalassemia,
in Verma RS (ed): Advances in Genome Biology. v012. Greenwich.
JAI, 1993, p 283
2. Mignotte V, Wall L, deBoer E, Grosveld F. Romeo PH: Two
tissue-specific factors bindthe erythroid promoter ofthehuman
porphobilinogen deaminase gene. Nucleic Acids Res 17:37, 1989
3. Ney PA, Sorrentino BP, McDonagh KT, Nienhuis AW: Tandem AP-I binding sites withinthehuman
beta-globin dominant
control region function as an inducible enhancer in erythroid cells.
Genes Dev 4:993, 1990
4. Yu CY, Chen J, Lin LI, Tam M. Shen CK: Cell type-specific
protein-DNA interactions in thehuman zeta-globin upstreampromoterregion: Displacement of Spl by the erythroid cell-specific
factor NF-E2. Mol Cell Biol 10:282,
1990
5. Zon LI, Tsai S-F, Burgess S, Matsudaira P, Bums GP, Orkin
SH: The major human erythroid DNA binding protein (GF-I): Primary sequence and localization of the gene to the X-chromosome.
Proc Natl Acad Sci USA 87:668, 1990
6. Chan JY, Han XL, KanYW: Cloning of Nrfl, an NF-E2related transcription factor, by genetic selection in yeast. Proc Natl
Acad Sci USA 90: I 1371, I993
7. Miller IJ, Bieker JJ: A novel, erythroid cell-specific murine
C T ,
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
0-GLOBIN MRNASTABILITY
transcription factor that binds to the CACCC element and is related
to the Kruppel family of nuclear proteins. Mol Cell Biol 13:2776,
1993
8. Moi P, Chan K, Asunis I, Cao A, Kan YW: Isolation of NFE2-related factor 2 (Nrf;?), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2lAPl repeat of
the beta-globin locus control region. Proc Natl Acad Sci USA
9 1:9926, 1994
9. Sun C-W, Donze D, Farmer S, Ciavatta DJ, Townes TJ: Cloning and functional characterization of LCR-Fl: A bzip transcription
factor that activates erythroid-specific, human globin gene expression. Blood 84:218a, 1994 (abstr, suppl I )
10. Tuan D, Solomon D, Li Q, London M: The p-like globin
gene domain in human erythroid cells. Proc NatlAcad Sci USA
825384, 1985
1 1. Forrester WC, Thompson C, Elder JT, Groudine M: A developmentally stable chromatin structure in the human p-globin gene
cluster. Proc Natl Acad Sci USA 83:1359, 1986
12. Higgs DR. Wood WG, Jarman AP, Sharpe J, Lida J, Pretorius
I-M, Ayyub H:A major positive regulatory region located
far upstream
of the human alpha-globin gene locus. Genes Dev 4:1588, 1990
13. Bodine DM, Ley TJ: An enhancer lies 3' to the human Ayglobin gene. EMBO J 6:2997, 1987
14. Trudel M, Constantini F: A 3' enhancer contributes to the
stage-specific expression of the human &globin gene. Genes Dev
I :954, 1987
15. Cao SX, Gutman PD, Dave HPG, Schechter AN: Identification of a transcriptional silencer inthe 5' flanking region of the
human +globin gene. Proc Natl Acad Sci USA 865306, 1989
16. Ross J: Messenger RNA turnover in eucaryotic cells. Mol
Biol Med 5:1, 1988
17. Hargrove JL, Schmidt FH: The role ofmRNAand protein
stability in gene expression. FASEB J 3:2360, 1989
18. Aviv H, Volloch Z, Bastos R, Levy S: Biosynthesis and stability of globin mRNA in erythroleukemia Friend cells. Cell 8:495,
1976
19. Lodish HF, Small B: Different lifetimes of reticulocyte messenger RNA. Cell 7:59, 1976
20. Bastos RN, Aviv H:Theoretical analysis of a model for globin
messenger RNA accumulation during erythropoiesis. J MolBiol
110:204, 1977
2 I . Ross J, Pizarro A: Human beta and delta globin messenger
RNAs turn over at different rates. J Mol Biol 167:607, 1983
22. Krowczynska A, Yanofsky R, Braweman G: Regulation of
messenger RNA stability in mouse erythroleukemia cells. J Mol Biol
181:231, 1985
23. Ross J, Sullivan TD: Half-lives ofbetaand gamma globin
messenger RNAs and of proteinsynthetic capacity in cultured human
reticulocytes. Blood 66:1 149, 1985
24. Kabnick KS, Housman D: Determinants that contribute to
cytoplasmic stability of human c-fos and P-globin &As
are located at several sites in each mRNA. Mol Cell Biol 8:3244, 1988
25. Bastos RN, Volloch Z, Aviv H: Messenger RNA population
analysis during erythroid differentiation: A kinetic approach. J Mol
Biol l10:191, 1977
26. Liebhaber SA, Kan YW: Differentiation of the mRNA transcripts originating from the a l - and a2-globin loci in normals and
a-thalassemics. J Clin Invest 68:439, 1981
27. Hunt DM, Higgs DR. Winichagoon P, Clegg JB, Weatherall
DJ: Haemaglobin Constant Spring has an unstable a chain messenger
RNA. Br J Haematol 51:405, 1982
28. Weiss IM, Liebhaber SA: Erythroid cell-specific determinants
of a-globin mRNA stability. Mol Cell Biol 14:8123, 1994
5323
29. Milner PF, Clegg JB, Weatherall DJ: Unique haemoglobin
variant with an elongated a-chain. Lancet 1:729, 1971
30. Weiss IW, Liebhaber SA: Erythroid cell specific mRNA stability elements in the a2-globin 3' nontranslating region. Mol Cell
Biol 15:2457, 1995
31. Wang X, Kiledjian M, Weiss IM, Liebhaber SA: Detection
and characterization of a 3' untranslated region ribonucleoprotein
complex associated with human a-globin mRNA stability. Mol Cell
Biol 15:1769, 1995
32. Flatz G, Kinderlerer JL, Kilmantin JV, Lehmann H: Hemoglobin Tak: A variant with additional residues at the end of the pchains. Lancet 1:732, 1971
33. Bunn HF, Schmidt GJ, Haney DN, Dluhy RG: Hemoglobin
Cranston, an unstable variant having an elongated p-chain due to
nonhomologous crossover between two normal p-chain genes. Proc
Natl Acad Sci USA 72:3609, 1975
34. Delanoe-Garin J, Blouquit Y, Arous N, Kister J, Poyart C,
North AL. Bardakjian J, Lacombe C, Rosa J, Galacteras F:Hb
Saverne: A new variant with an elongated beta-chain: Structural and
functional properties. Hemoglobin 12:337, 1988
35. Weiss I, Cash FE, Coleman MB, Pressley A, Adams JG,
Sanguansermsri T, Liebhaber SA, Steinberg MH: Molecular basis
for a thalassemia associated with the structural mutant Suan Dok
). Blood 76:2630, 1990
(a2'09LEU-ARG
36. Laski FA, Alzner-DeWeerd B, RajBhandary UL, Sharp PA:
Expression of a X. laevis tRNATy'gene in mammalian cells. Nucleic
Acids Res 10:4609, 1983
37. Liebhaber SA, Emery JG, Urbanek M, Wang X, Cooke NE:
Characterization of a human cDNA encoding a widely expressed
and highly conserved cysteine-rich proteinwithan unusual zincfinger motif. Nucleic Acids Res 18:3871, 1990
38. Liebhaber SA, Cash FE, Shakin SH: Translationally associated helix-destabilizing activity in rabbit reticulocyte lysate. J Biol
Chem 259:15597, 1984
39. Rovera G, Magarian C, Borun TW: Resolution of hemaglobin
subunits by electrophoresis in acid urea polyacrylamide gels containing Triton X-100. Anal Biochem 85:506, 1978
40. Wisdom R, Lee W: The protein coding region of c-myc
mRNA contains a sequence that specifies rapid mRNA turnover and
induction by protein synthesis inhibitors. Genes Dev 5:232, 1991
41. Zandomini R, Weinmann R: Inhibitory effect of 5,6-dichlorol-beta-D-ribofuranosylbenzimidazoleon a protein kinase. J Biol
Chem 259:14804, 1984
42. Butler ET, Chamberlin MJ: Bacteriophage SP6-specific RNA
polymerase. I. Isolation and characterization of the enzyme. J Biol
Chem 257:5772, 1982
43. Carter BZ, Malter JS: Regulation of mRNA stability and its
relevance to disease. Lab Invest 65:610, 1991
44. Papayannopoulou T, Abkowitz J: Biology of erythropoiesis,
erythroid differentiation, and maturation, in Hoffman R, Benz H,
Shattil SJ, Furie B, Cohen HJ (eds): Hematology: Basic Principles
and Practice. New York, NY, Churchill Livingstone, 1991, p 252
45. Erslev AJ: Production of erythrocytes, in Williams WJ, Beutler E, Erslev AJ, Lichtman MA (eds): Hematology. New York, NY,
McGraw-Hill, 1990, p 389
46. Goodman M, Weiss ML, Czelusniak J: Molecular evolution
above the species level: Branching pattern, rates, and mechanisms.
Systematic Zoo1 31:376, 1982
47. Pandy NB, Marzluff WF: The stem-loop structure at the end
of histone mRNA is necessary and sufficient for regulation of histone
mRNA stability. Mol Cell Biol 7:4557, 1987
48. Mullner EW, Kuhn LC: A stem-loop in the 3' untranslated
region mediates iron-dependent regulation of transfenin receptor
mRNA stability in the cytoplasm. Cell 53:815, 1988
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
1996 87: 5314-5323
The stability of human beta-globin mRNA is dependent on structural
determinants positioned within its 3' untranslated region
JE Russell and SA Liebhaber
Updated information and services can be found at:
http://www.bloodjournal.org/content/87/12/5314.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.