From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Mutations of p53 Gene and Their Relation to Disease Progression in B-Cell
Lymphoma
By Atsushi Ichikawa, Tomomitsu Hotta, Norio Takagi, Keitaro Tsushita, Tomohiro Kinoshita, Hirokazu Nagai,
Yoshinori Murakami, Kenshi Hayashi, and Hidehiko Saito
The alteration of p53 tumor suppressor gene was studied in
48 patients with 8-cell lymphoma. A sequential combined
technique of polymerase chain reaction-mediated singlestrand conformational polymorphism (PCR-SSCP) or reverse
transcription (RT)-PCR-SSCP and direct sequencing were
used as a simple and sensitive approach to analyze nucleotide changes. By these methods, we identified 8 missense
point mutations and 2 codon deletions in 9 of the 48 patients.
These mutations were located in or close to the evolutionally
highly conserved regions of the p53 gene. Eight of nine
patients having p53 gene alterations were in advanced
clinical stage (IV). It is the first report of p53 gene mutations
in follicular and diffuse lymphoma. These obsenrations suggest that the p53 gene alteration may play an important role
in lymphomagenesis and/or disease progression in some
types of B-cell lymphoma.
0 7992 by The American Society of Hematology.
I
1990. DNA samples were extracted from lymph nodes or extranodal tumors at biopsy performed for diagnosis once informed
consent had been obtained. The characteristics of these patients
appear in Table 1. Portions of the tissue used for DNA analysis
were also used for histologic and surface marker studies using an
immunohistochemical technique. The Modified Working Formulation Classification was applied for histologic classification of the
lymphomas.30
DNA samples. DNA samples of the following cell lines or
primary hepatocellular carcinoma were used as positive controls
during PCR-SSCP analysis; CEM (mutation at codons 175 and
248),6 HUT78 (mutation at codon 196); and 32C (mutated at
codon 276)’O were kindly provided from Drs Yoshinori Murakami
and Kenshi Hayashi (National Cancer Center Research Institute,
Tokyo, Japan). Molt-4 was used as the negative control (mutations
not detected at codons 135 to 296).6
Preparation of DNA and RNA. Lymph nodes or tumor tissues
were placed in lysis buffer (1% sodium dodecyl sulfate [SDS], 2
mmol/L EDTA, 20 mmol/L Tris pH 7.4, and 100 pg/mL of
proteinase K) and incubated at 37°C overnight. After performing
phenol and chloroform extractions, DNA was precipitated in
ethanol and resuspended in sterile TE buffer (10 mmol/L Tris pH
8.0, 1 mmol/L EDTA) for storage. Total cellular RNA was
extracted by an acid guanidium thiocyanate phenol chloroform
method.31 RNA was precipitated in ethanol for storage and then
was resuspended in sterile double-distilled water for analysis. DNA
and RNA stocks were kept physically separated from the areas in
which the PCR reaction products were handled.
PCR-SSCP analysis. Analysis of PCR-SSCP was performed
essentially as described p r e v i ~ u s l y The
. ~ ~ 5’-end
~ ~ ~ of the primer
(100 pmol) was labeled with [ Y ~ ~ P ] A and
T P polynucleotide kinase
(Takara, Kyoto, Japan)32 in 4 pL of 50 mmol/L Tris-HCI, pH 8.3,
10 mmol/L MgC12, and 5 mmol/L dithiothreitol (DTT) at 37°C for
T IS WELL KNOWN that the p53 gene is one of tumor
suppressor genes and the p53 gene alterations occur in
several types of human cancers.’-14 Recent evidences suggest that a wild-type p53 gene is a negative regulator of cell
pr01iferation~~J~
and that inactivation of p53 gene caused by
mutations in exons 5 through 9 is critical for neoplastic
tran~formation.~-~
Several lines of evidence support the contribution of the
loss or alteration of the p53 gene to the tumor development
and/or progression. First, the allelic loss of chromosome
17p, the location of the p53 gene,17,18is common in several
types of human malignancie~.’~-~~
Second, the loss of
17~13.1is associated with mutations of the remaining p53
allele, which is thought to inactivate the p53
Finally, functional evidence for a tumor suppressor action
of p53 was shown by the finding that normal p53 inhibited
the malignant transformation of rodent cells and reversed
the neoplastic character of human carcinoma cell lines in
vitro.15J6 Chromosomal abnormalities have been found in
84.6% of patients with untreated non-Hodgkin’s lymphoma
(NHL), and abnormalities of chromosome 17 were shown
in 16.3% of these patients.23Abnormalities on chromosome
17 were shown to correlate with a diffuse histology and a
shorter survival in NHL.23,24A recent report showed point
mutations in 5 of 10 leukemic T-cell lines.6 Thus, it is
important to elucidate the incidence of the p53 gene
alteration in primary samples of B-cell lymphoma.
To our knowledge, except Burkitt’s lymphoma and chronic
lymphocytic leukemia,13no positive evidence for alterations
of the p53 gene has been reported so far in the common
subtypes of B-cell NHL. A simple and rapid method for
detecting changes in DNA sequence, including single nucleotide substitutions, namely, polymerase chain reaction
(PCR)25-mediated single-strand conformational polymorphism analysis (PCR-SSCP a n a l y s i ~ )has
~ ~ recently
,~~
been
developed. In this study, we analyzed DNA or RNA
extracted from the lymph nodes or tumor tissues of patients
with B-cell lymphoma using the PCR-SSCP or PCR-SSCP
method in combination with the reverse transcriptase
(RT-PCR-SSCP) method,28 and studied any abnormal
sequences by the direct sequencing t e c h n i q ~ e . ~ ~
MATERIALS AND METHODS
Patient characteristics. We analyzed 48 consecutive patients
with untreated B-cell lymphoma who were admitted to our hospital
for first-line chemotherapy between September 1988 and October
Blood, Vol79, No 10 (May 15), 1992: pp 2701-2707
From the First Department of Internal Medicine, Nagoya University
School of Medicine Showa-ku, Nagoya; and the National Cancer
Center Research Institute, Tokyo, Japan.
Submitted July 25,1991; accepted January 17,1992.
Supported in part by Grants-in-Aidfor Cancer Research (1-I)from
the Ministry of Health and Welfare of Japan.
Address reprint requests to Atsushi Ichikawa, MD, First Department
of Internal Medicine, Nagoya University School of Medicine, 65
Tsuruma-cho,Showa-ku, Nagoya 466, Japan.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section I734 solely to
indicate this fact.
0 1992 by TheAmerican Society of Hematology.
0006-4971I921 7910-0002$3.00/0
2701
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
2702
ICHIKAWA ET AL
Table 2. Primers Used for PCR
Table 1. Patients' Characteristics
No. of patients
Median age (range) (yr)
Sex (M/F)
Clinical stage
II
Ill
Primers
48
55 (15-74)
Amplified Fragment
34/14
Genomic DNA
EX5
10
13
EX6
IV
25
Histopathology (Modified Working F~rmulation)*~
Diffuse large cleaved
12
Diffuse large noncleaved
9
Diffuse mixed
7
Diffuse small cleaved
5
Small lymphocytic
7
Follicular mixed
3
Follicular large noncleaved
1
Follicular small cleaved
1
3
Unclassifiable
EX7
EX8,9
30 minutes. The PCR mixture contained 10 pmol of each labeled
primer, 2 nmol of each of the four deoxynucleotides, 50 ng of
genomic DNA, and 0.125 U of Tuq polymerase in 10 pL of the
buffer specified in the GeneAmp kit (Perkin-Elmer Cetus, Norwalk, CT). Thirty cycles of the PCR reaction at 94,55, and 72°C for
0.5, 0.5, and 1 minute, respectively, were run in a Thermocycler
(Perkin-Elmer Cetus). The product was diluted 100 times with
98% formamide, 20 mmol/L EDTA, 0.05% bromophenol blue,
and 0.05% xylene cyanol, heated at 80°C for 3 minutes, and quickly
chilled on ice. A volume of 2 pL was promptly applied to 6%
acrylamide gel (acrylamide:N,N'-bisacrylamide= 49:l) containing
90 mmol/L Tris-borate, pH 8.3, 4 mmol/L EDTA, and with and
without 5% glycerol. After electrophoresis at room temperature
for the appropriate times at a constant power of 30 W with vigorous
air cooling, the gel was dried on Whatman 3MM paper (Whatman
International Ltd, Maidstone, UK) and exposed to Kodak XAR
film (Eastman Kodak Company, Rochester, NY)for 12 hours at
room temperature.
Genomic DNA obtained from the lymph nodes or tumor tissues
of patients were amplified by the PCR to double-stranded DNA
fragments using the oligonucleotide primers. The regions amplified, designated as E X , EX6, EX7, and EX8-9, with nucleotide
lengths of 139 bp to 330 bp, are shown in Fig 1.These regions cover
exons 5 through 9, which contain domains of p53 highly conserved
among species and the sites of frequent mutations in various cancer
cells. The primers used in this study (Table 2) were synthesized by
the 391 DNA synthesizer (Applied Biosystems, Foster City, CA)
and purified on OPC columns (Applied Biosystems).
Designation
EXSU
EX5D
EXGU
EX6D
EX7U
EX7D
EXBU
EX9D
Sequence
5' TTCCTCUCCTGCAGTACTC3'
5' GCAAATTTCCUCCACTCGG3'
5' ACCATGAGCGCTGCTCAGAT 3'
5' AGTTGCAAACCAGACCTCAG 3'
5' GTGUGCCTCCTAGGTTGGC 3'
5' CAAGTGGCTCCTGACCTGGA 3'
S'CCTATCCTGAGTAGTGGTAA 3'
5' CCAAGACTTAGTACCTGAAG 3'
RT-PCR-SSCP analysis. One microgram of total cellular RNA
was annealed with a synthetic oligomer of 20 nucleotide residues to
the appropriate region of p53 messenger RNA (mRNA) and then
transcribed with Moloney murine leukemia virus RT (Bethesda
Research Laboratories, Gaithersburg, MD) in the presence of
ribonuclease inhibitor (Takara) in 14 pLof the reaction mixture, as
described previously." A portion (1 pL) of the reaction mixture
was subjected directly to the PCR in place of genomic DNA in the
PCR-SSCP method described above using two appropriate primers, one of which was the same as used in the RT reaction. The
5'-end of these primers was labeled with [ Y ~ ~ P ] A TbyP the
polynucleotide kinase reaction, as described previously?2 Three
pairs of primers were used to amplify the cDNA fragments C, D,
and E, as described previ0usly.3~
Direct DNA sequencing. A small area (approximately 1 mm2) of
the gel corresponding to the position of bands with or without a
mobility shift was cut out, and single-strand DNA was eluted from
the dried gel. Five microliters of the eluted solution was subjected
to asymmetric amplification by PCR (55 cycles) in a mixture (40
pL) containing the primers in a ratio of 10 to 1,as des~ribed.3~
The
amplified reaction mixture was purified in a micro-concentrator
Centricon 30 (Amicon, W.R. Grace and Co, Beverly, MA) and the
single-strand DNAs were annealed to a 5'4abeled primer. Chain
elongation and termination were performed using a Sequenase kit
(Sequenase Ver.2.0; US Biochemical Corporation, Cleveland, OH)
and the products were run in 6% polyacrylamide gel containing 7
mol/L urea.
RESULTS
Analysis of pS3 gene by the PCR-SSCP method. To
determine whether p53 gene alterations were present in
B-cell lymphomas, we examined the genomic DNA of the
p53 gene by the PCR-SSCP method. In this method, the
H
EX5EX6
EX7
EX8.9
Fig 1. Rggionsof p53 gene amplified and subjected to SSCP analysis. The four regions of p53 gene (fragments EX5 to EX8.91 correspondingto
exon 5 to 9 are indicated by bars. Coding exons are shown by open boxes with amino acid positions. The conserved domains IIto V are indicated
in correspondencewith coding exons.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
MUTATIONS OF ~ 5 GENE
3
IN B-CELL LYMPHOMA
2703
Table 3. p53 Gene Alterations in Nine Patients With E-Cell Lymphoma
Patient
1
2
3
4
5
6
7
8
9
Lymphoma
Type
DLC
DLC
DLC
DLC
DM
DSC
DSC
FSC
FLN
Mutation
Codon
Exon
Nucleotide
Amino Acid
257
248
148
254
216-218
244
216-218
250
187
254
7
7
5
7
6
7
6
7
5
7
CTG + CCG
CGG + TGG
GAT + GAA
ATC + AAC
GTG deletion
GGC -t GCC
GTG deletion
ccc + AAC
GGT + AGT
ATC -+ AGC
Leu -,Pro
Arg + Trp
Asn + Glu
Ile + Asn
Val deletion
Gly + Ala
Val deletion
Pro + Asn
Gly + Ser
Ile -+ Ser
Clinical
Stage
IV
IV
IV
IV
IV
IV
IV
IV
111
Abbreviations: DLC. diffuse large cleaved; DSC, diffuse small cleaved; DM, diffuse mixed; FSC, follicular small cleaved; FLN, follicular large
noncleaved.
I
Fig 2. PCR-SSCP analysis of p53 gene mutations
in E-cell lymphoma. Amplified genomic DNA fragments corresponding t o exons 5 through 9 were
denatured by heating, and electrophoresis was performed in 6% polyacrylamide gel containing 5%
glycerol at constant 30 w at room temperature. (A)
Mobility pattern (1.5 hours) of amplified DNA fragments corresponding t o exon 6. The lane at left end
(P) indicates positive control (HUl78, CGAlW + TGA,
Arg -t Stop). The next lane (N) shows negative control (Molt-4). In patient 7 (lane 9). a fragment with
mobility shift in addition t o a wild-type band is
observed. (B) Mobility pattern (1 hour) of amplified
DNA fragments corresponding to exon 7. Positive
control (CEM, CGGzQ CAG, Arg + Gln) is indicated at left end lane (P). The next lane (N) shows
negative control (Molt-4). Patients 1.4.6, and 9 (lanes
8,1,11, and 5, respectively) have aberrantly migrated
bands.
+
PN
B
1
n
pN
1
1 2 3 4 5 6 7 8910111213
t
1 2 3 4 5 6 7 8 9 101 1 12 13 1415
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
2704
ICHIKAWA ET AL
Fig 3. RT-PCR-SSCPanalysis. Amplified cDNAfragments correspondingto exons 6 and 7 were denatured and run for 1 hour (A) or 45 minutes
(E). Negative control obtained from normal peripheral blood mononuclear cells is shown in lane N. (A) Patients' samples were run on lanes 1
through 8. Patients 1, 2, and 7 (lanes 8, 4, and 7, respectively) show aberrantly migrating fragments in addition to two bands corresponding
wild-type fragments. ( 6 )Patient 5 (lane 3) indicates four bands of wild-type and aberrantlymigratingfragments.
amplified DNA fragments were separated into single strands
by denaturing. Each strand has a folded conformation that
is stabilized by intrastrand interactions and is moved with a
sequence-dependent three-dimensional conformation during electrophoresis under nondenaturing conditions. A
single nucleotide change can be readily detected as electrophoretic mobility shift, because of a conformational change
of a single-stranded DNA fragment.'".27
Using PCR-SSCP analysis, 10 p53 gene alterations were
shown in nine patients. These included two in exon 5, two in
exon 6, and six in exon 7, as shown in Table 3. Figure 2
shows the results of PCR-SSCP analysis for exons 6 and 7.
PCR product EX 6 from patient 7 (lane 9) showed a
mobility shift on SSCP analysis (Fig 2A). Similarly, PCR
product EX 7 from patients 1,4,6, and 9 (lanes 8, 1, 1 1 , and
5, respectively) showed shifts in their mobilities on SSCP
analysis. No wild-type band was detected in patient 4 (lane
1) (Fig 2B). PCR products EX5 and EX7 from the normal
tissues of patients 3 and 2, ie, the liver of patient 3 and the
bone marrow cells of patient 2, evaluated histologically as
no involvement, showed no mobility shift (data not shown).
Analysisofp53mRNA by the RT-PCR-SSCP analysis. To
examine the expression of altered p53 gene, RNA from 13
patients was analyzed by the RT-PCR-SSCP method. As
shown in Fig 3A, mobility shifts were detected in patient 1
(lane 8), patient 2 (lane 4), and patient 7 (lane 7). Similarly,
mobility changes were found in patient 5 (lane 3) (Fig 3B).
Nucleotide sequence analysis of p53 gene. Nucleotide
sequences of p53 genes in cases showing a mobility shift on
PCR-SSCP analysis were determined as described in Materials and Methods. Furthermore, asymmetric PCR was
performed with two different primer combinations (5'
dominant to 3' and 3' dominant to 5'). DNA demonstrating
mobility shifts on PCR-SSCP analysis had sequence mutations responsible for amino acid substitutions or deletions.
-
Figure 4 shows examples of the nucleotide sequencing.
Patient 1 had a point mutation at codon 257 (CTG +. CCG,
Leu Pro) as shown in Fig 4A. In patient 2, a point
mutation was detected at codon 248 (CGG +. TGG,
Arg-Trp) (Fig 4B). In patient 7, one codon (Val)
deletion (216 to 218) was identified (Fig 4C). In eight of the
nine patients who showed a mobility shift on PCR-SSCP
analysis, residual bands with normal mobility were sequenced and showed a wild-type nucleotide sequence. In
Fig 2B, there is a minor band between the two major bands
in most patient lanes, including patients 6 and 9. These
minor bands were confirmed to be wild-type by sequencing
(data not shown). Genomic DNA from the non-neoplastic
tissues of patients 2 and 3 showed no mobility shift by
PCR-SSCP analysis and a wild-type sequence. The mutations of p53 gene in these patients are summarized in Table
3.
p53 gene alterations in relation to advanced clinical stage.
We examined the relationship between p53 gene alterations and the clinical stage. The p53 gene alteration was
found significantly more frequently in patients with clinical
stage IV than those with clinical stages I1 and Ill (P < .05),
as shown in Table 4.
To confirm that our experiments are free from contamination or some other artifacts, we repeated some experiments
using the same samples, other portions of tumors when
available, and cell line DNA samples identified previously,
and obtained the same results. Furthermore, we did not
detect any bands in PCR-SSCP analyses when DNA was
not included in the amplification reactions (data not shown).
DISCUSSION
Exons 5 through 8 of the p53 gene, which contain 98% of
the mutations previously identified in diverse t ~ m o r s , ' ~
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Fig 4. Examples of nucleotide sequencing showing p53 gene mutations. Nucleotide sequences of
each patient (Pt) are indicated in correspondence
with it of wild-type (WT). The nucleotide sites of
mutation are shown by outline letters. (A) Nucleotide
sequence of patient 1 shows point mutation
(CTGx7 + CCG, Leu + Pro). (B) Patient 2 has a point
mutation (CGGzw+ TGG, Arg
Trp). (C) Nucleotide
sequencing of the amplified DNA fragments corresponding exon 6 of patient 7 shows that one codon
(Val) is deleted in 216 t o 218.
-
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
2706
ICHIKAWA ET AL
Table 4. p53 Gene Alterations and Clinical Stage
ferent molecular lesions of p53 gene in NHL between
Japanese and Western patients. This seems to be similar to
the case for the frequency of bcl-2 involvement in follicular
p53 Gene Alteration
II
Ill
IV
NHL.36
Altered
0
1
0
Of nine patients whose lymphomas showed p53 gene
Not altered
13
14
12
alterations, eight (88.9%) were in clinical stage IV. p53
gene alterations were detected more frequently in patients
with an advanced clinical stage of the disease (clinical stage
were analyzed by PCR-SSCP or RT-PCR-SSCP method
IV). Our data are consistent with previous reports of others
and sequenced in B-cell lymphomas. Of 48 patients with
that p53 gene alterations are significantly involved in late
B-cell lymphoma, nine patients (18.8%) showed mobility
events associated with the transition from an adenomatous
shifts by the PCR-SSCP method, suggesting the presence of
to the carcinomatous state in, eg, colon cancer,1JJ8 and
sequence changes such as mutations. In this study, we
strongly suggest that the p53 gene alterations also play an
incorporated the direct sequencing method because the
important role, especially in disease progression during the
possibility of the error by artifacts of sequencing procedure
late process of lymphomagenesis.
is unlikely. By direct sequencing, all of the 10 bands with
In the RT-PCR-SSCP analysis, patients 1, 2, 5, and 7
abnormal mobility had unique sequence changes (missense
showed normally migrating bands as well as shifted bands.
point mutations or deletion). Moreover, all of the amplified
By direct sequencing, it was shown that the normally
DNA fragments from genomic DNA prepared from nonmigrating bands had the wild-type sequence and the shifted
neoplastic tissues of these patients had only the wild-type
bands were mutated. Therefore, it was confirmed that
sequence shown by direct sequencing, as consistent with the
mutated p53 genes were really expressed in lymphoma. On
results of previous studies on other human malignancies.14
the other hand, regarding normally migrating bands, there
It is, therefore, conceivable that the p53 gene alteration
are possibilities that normally migrating bands originate
occurs in tumor cells as a result of somatic mutations. Eight
from the normal allele of non-neoplastic cells in lymphoma
missense point mutations and one codon deletion (two
tissue and/or residual normal allele of lymphoma cells. In
patients) were identified in the present study. All nucleour study, all patients whose RNA was available showed
otide changes were clustered in or close to the evolutionally
p53 gene expression irrespective of mutations. Concerning
highly conserved domains ( 2 mutations in domain I11 and 6
the gene expression and gene structural alteration, there
mutations in domain IV) of the p53 gene. These observastill exist some possibilities that mutations occur in the
tions are consistent with previous data of p53 gene alterpromoter region. Although we cannot entirely exclude this
ations reported in several types of human ma1ignan~ies.l-l~ possibility, it is less likely because there have not been any
investigations suggesting such a possibility.
Gaidano et all3 have reported that 43 patients with lowor intermediate-grade NHL were negative for p53 gene
The present study disclosed the incidence and signifialterations. However, in our study, p53 gene alterations
cance of p53 gene alterations in B-cell lymphoma using a
sufficient number of patients. The results of the study on
were detected in 18.8% of patients with B-cell lymphoma,
especially those in the advanced clinical stage.
the expression of altered p53 gene suggest that mutant p53
Because the clinical characteristics of those patients were
represents a “loss of function” mutation by a recessive or
not given in their report,13we cannot compare our data with
dominant negative process.37 Further studies are required
their results. It may be possible that the discrepancy is
to elucidate the precise molecular mechanism of the p53
gene and its alterations in the disease progression of B-cell
explained by a difference in clinical status. Furthermore,
ethnic and/or geographic factors might account for diflymphoma.
Clinical Stage
REFERENCES
1. Baker SJ, Fearon ER, Nigro JM, Hamilton SR, Preisinger
AC, Jessup JM, vanTuinen P, Ledbetter DH, Barker DF, Nakamura Y, White R, Vogelstein B: Chromosome 17 deletions and p53
gene mutations in colorectal carcinomas. Science 244:217,1989
2. Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R,
Clealy K, Bigner SH, Davidson N, Baylin S, Devilee P, Glover T,
Collins FS, Weston A, Modali R, Harris CC, Vogelstein B:
Mutations in the p53 gene occur in diverse human tumor types.
Nature 342:705,1989
3. Takahashi T, Nau MM, Chiba I, Birrer MJ, Rosenberg RK,
Vinocour M, Levitt M, Pass H, Gazdar AF, Minna JD: p53: A
frequent target for genetic abnormalities in lung cancer. Science
246:491,1989
4. Hollstein MC, Metcalf RA, Welsh JA, Montesano R, Harris
CC: Frequent mutation of the p53 gene in human esophageal
cancer. Proc Natl Acad Sci USA 87:9985,1990
5. Iggo R, Gatter K, Bartek J, Lane D, Harris A: Increased
expression of mutant forms of p53 oncogene in primary lung
cancer. Lancet 335:675,1990
6. Chen J, Haas M: Frequent mutations in the p53 tumor
suppressor gene in human leukemia T-cell lines. Mol Cell Biol
10:5502, 1990
7. Marshal R, Shtalrid M, Talpaz M, Kantarjian H, Smith L,
Beran M, Coek A, Trujillo J, Gutterman J, Deisseroth A: Rearrangement and expression of p53 in the chronic phase and blastic
crisis of chronic myelogeneous leukemia. Blood 75:180, 1990
8. Hsu IC, Metcalf RA, Sun T, Welsh JA, Wang NJ, Harris CC:
Mutational hotspot in the p53 gene in human hepatocellular
carcinomas. Nature 350:427,1991
9. Bressac B, Kew M, Wands J, Ozturk M: Selective G to T
mutations of p53 gene in hepatocellular carcinoma from southern
Africa. Nature 350:429,1991
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
MUTATIONS
OF
P53 GENE IN 6-CELL LYMPHOMA
10. Murakami Y, Hayashi K, Hirohashi S, Sekiya T: Aberrations
of the tumor suppressor p53 and retinoblastoma genes in human
hepatocellular carcinomas. Cancer Res 51:5520,1991
11. Mashiyama S, Murakami Y, Yoshimoto T, Sekiya T, Hayashi
K: Detection of p53 gene mutations in human brain tumors by
single-strand conformational polymorphism analysis of polymerase
chain products. Oncogene 6:1313,1991
12. Sugimoto K, Toyoshima H, Sakai R, Miyagawa K, Hagiwara
K, Hirai H, Ishikawa F, Takakau F: Mutations of the p53 gene in
lymphoid leukemia. Blood 77:1153,1991
13. Gaidano G, Ballerini P, Gong JZ, Inghirami G, Neri A,
Newcomb EW, Magrath IT, Knowles DM, Dalla-Favera R: p53
mutations in human lymphoid malignancies: Association with
Burkitt’s lymphoma and chronic lymphocytic leukemia. Proc Natl
Acad Sci USA 88:5413,1991
14. Hollstein M, Sidransky D, Vogelstein B, Harris C C p53
mutations in human cancers. Science 253:49, 1991
15. Eliyahu DD, Michalovitz S, Eliyahu 0, Pinhasi K, Oren M:
Wild-type p53 can inhibit oncogene-mediated focus formation.
Proc Natl Acad Sci USA 86:8763,1989
16. Finlay CA, Hinds PW, Levine AJ: The p53 proto-oncogene
can act as a suppressor of transformation. Cell 57:1083,1989
17. McBride OW, Merry D, Givol D: The gene for human p53
cellular tumor antigen is located on chromosome 17 short arm
(17~13).Proc Natl Acad Sci USA 83:130,1986
18. Isobe M, Emanuel BS, Givol D, Oren M, Croce C Localization of gene for p53 tumor antigen to band 17~13.Nature 320:84,
1986
19. Yokota J, Wada M, Shimosato Y, Terada M, Sugimura T:
Loss of heterozygosity of chromosome 3, 13 and 17 in small-cell
carcinoma and on chromosome 3 in adenocarcinoma of the lung.
Proc Natl Acad Sci USA 84:9252,1987
20. Vogelstein B, Fearon ER, Hamilton SR, Kern SE, Preisinger AC, Leppert M, Nakamura Y, White R, Smits AMM, Bos
J L Genetic alteration during colorectal tumor development. N
Engl J Med 319525,1988
21. Mackay J, Steel CM, Elder PA, Forrest APM: Allelic loss on
short arm of chromosome 17 in breast cancers. Lancet 2:1384,1988
22. James CD, Carlbom E, Nordenskjold M, Collins VP, Cavanee W K Mitotic recombination of chromosome 17 in astrocytomas. Proc Natl Acad Sci USA 86:2858,1989
23. Schouten HC, Sanger WG, Weisenburger DD, Anderson J,
Armitage JO: Chromosomal abnormalities in untreated patients
with non-Hodgkin’s lymphoma: Associations with histology, clinical characteristics, and treatment outcome. Blood 75:1841, 1990
24. Levine EG, Arthur DC, Frizzera G, Peterson BA, Hurd DD,
Bloomfield CD: Cytogenetic abnormalities predict clinical outcome in non-Hodgkin’s lymphoma. Ann Intern Med 108:14,1988
2707
25. Saiki RK, Gelfand DH, Stoffel S, Scarf SJ, Higuchi R, Horn
GT, Mullis IU3, Erlich HA. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science
239:487,1988
26. Orita M, Suzuki Y, Sekiya T, Hayashi K Rapid and sensitive
detection of point mutations and DNA polymorphisms using the
polymerase chain reaction. Genomics 5:874,1989
27. Hayashi K PCR-SSCP: A simple and sensitive method for
detection of mutations in the genomic DNA. PCR Method and
Applications 1:34,1991
28. Makino R, Sekiya T, Hayashi K Evaluation of quantitative
detection of mRNA by the reverse transcription-polymerase chain
reaction. Technique 2:295,1990
29. Gyllensten UB, Erlich HA. Generation of single-stranded
DNA by the polymerase chain reaction and its application to direct
sequencing of the HLA-DQA locus Proc Natl Acad Sci USA
85:7652,1988
30. Nathwani BN, Winberg CD: Non-Hodgkin’s lymphomas: An
appraisal of the “Working Formulation” of non-Hodgkin’s lymphomas for clinical usage, in Sommers SC, Rosen PP (eds): in
Malignant Lymphomas: A Pathology Annual Monograph. Norwalk, CT,Appleton-Century-Crofts, 1983, p 1
31. Chomczynski P, Sacchi N: Single-step method of RNA
isolation by acid guanidium thiocyanate phenol chloroform extraction. Anal Biochem 162156,1987
32. Hayashi K, Orita M, Sozuki Y, Sekiya T: Use of labeled
primers in polymerase chain reaction (LP-PCR) for a rapid
detection of the product. Nucleic Acids Res 17:3605,1989
33. Kawasaki ES, Clark SS, Coyne MY, Smith SD, Champlin R,
Witte ON, McCormick FP: Diagnosis of chronic myeloid and acute
lymphocytic leukemias by detection of leukemia-specific mRNA
sequences amplified in vitro. Proc Natl Acad Sci USA 85:5698,1988
34. Murakami Y, Hayashi K, Sekiya T Detection of aberrations
of the p53 alleles and the gene transcript in human tumor cell lines
by single-strand conformational polymorphism analysis. Cancer
Res 51:3356,1991
35. Suzuki Y, Sekiya T, Hayashi K Alle-specific PCR: A method
for amplification and sequence determination of a single component among a mixture of sequence variants. Anal Biochem 192232,
1990
36. Amakawa R, Fukuhara S, Ohono H, Doi S, Oguma S,
Tanabe S, Yamabe H, Edanuma S, Tomono N, Nasu K Involvement of bcl-2 gene in Japanese follicular lymphoma. Blood 73:787,
1989
37. Herskowitz I: Functional inactivation of genes by dominant
negative mutations. Nature 329:219,1987
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
1992 79: 2701-2707
Mutations of p53 gene and their relation to disease progression in Bcell lymphoma
A Ichikawa, T Hotta, N Takagi, K Tsushita, T Kinoshita, H Nagai, Y Murakami, K Hayashi and H
Saito
Updated information and services can be found at:
http://www.bloodjournal.org/content/79/10/2701.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.