Transforming Growth Factor-A1 Is a Negative Modulator of Adult

J Neuropathol Exp Neurol
Copyright Ó 2006 by the American Association of Neuropathologists, Inc.
Vol. 65, No. 4
April 2006
pp. 358Y370
ORIGINAL ARTICLE
Transforming Growth Factor-A1 Is a Negative Modulator of
Adult Neurogenesis
Frank-Peter Wachs, PhD, Beate Winner, MD, Sebastien Couillard-Despres, PhD, Thorsten Schiller,
Robert Aigner, Jürgen Winkler, MD, Ulrich Bogdahn, MD, and Ludwig Aigner, PhD
Abstract
Transforming growth factor (TGF)-A1 has multiple functions in
the adult central nervous system (CNS). It modulates inflammatory
responses in the CNS and controls proliferation of microglia and
astrocytes. In the diseased brain, TGF-A1 expression is upregulated
and, depending on the cellular context, its activity can be beneficial
or detrimental regarding regeneration. We focus on the role of TGFA1 in adult neural stem cell biology and neurogenesis. In adult neural
stem and progenitor cell cultures and after intracerebroventricular
infusion, TGF-A1 induced a long-lasting inhibition of neural stem
and progenitor cell proliferation and a reduction in neurogenesis. In
vitro, although TGF-A1 specifically arrested neural stem and
progenitor cells in the G0/1 phase of the cell cycle, it did not affect
the self-renewal capacity and the differentiation fate of these cells.
Also, in vivo, TGF-A1 did not influence the differentiation fate of
newly generated cells as shown by bromo-deoxyuridine incorporation experiments. Based on these data, we suggest that TGF-A1 is an
important signaling molecule involved in the control of neural stem
and progenitor cell proliferation in the CNS. This might have
potential implications for neurogenesis in a variety of TGF-A1associated CNS diseases and pathologic conditions.
Key Words: Brain repair, Cell fate, Differentiation, Doublecortin,
Neurodegenerative diseases.
INTRODUCTION
Transforming growth factor (TGF)-A superfamily
members are pleiotropic cytokines and fulfill key functions
during development and in maintenance of adult tissue
homeostasis. In particular, TGF-A1 plays a central role in
tissue repair (1). It regulates cellular proliferation, survival,
and differentiation as well as matrix formation; moreover, it
From the Department of Neurology, University of Regensburg, Regensburg,
Germany; and the Volkswagen Foundation Research Group (F-PW,
SC-D, TS, RA, JW, LA), Hannover, Germany.
Send correspondence and reprint requests to: Ludwig Aigner, PhD, Department of Neurology, University of Regensburg, Franz-Josef-StraussAllee 11, D-93053 Regensburg, Germany; E-mail: ludwig.aigner@
klinik.uni-regensburg.de
Funding provided by the Volkswagen Foundation, Hannover, Germany, and
the German Federal Ministry of Education and Research (BMBF
#01GA0510). Support provided by the ReForM program, Medical
Faculty, University of Regensburg (F-PW, BW, RA), and the FritzThyssen Foundation, Köln, Germany (S-CD).
358
modulates the immune response depending on the cellular
and environmental context. TGF-A1 signaling involves binding of the ligand to the constitutive active serine/threonine
kinase receptor type 2 (R2) and subsequent recruitment
of the receptor type 1 (R1) into a signaling complex (2).
Downstream signaling is mediated through members of the
Smad family of proteins (3).
In the adult brain, TGF-A1 is predominantly expressed
in the choroid plexus and meninges, but also by astroglia and
microglia (4Y7). In many different central nervous system
(CNS) disease conditions, TGF-A1 expression is rapidly
upregulated by activated microglia (8Y17). In the lesioned
CNS, TGF-A1 plays a complex role in coordinating cellular
responses and has been associated with beneficial as well as
detrimental activities regarding regeneration. For example,
TGF-A1 overexpression by astrocytes in transgenic mice
promotes Alzheimer disease-like amyloid formation and
microvascular degeneration (18, 19). In contrast, different in
vitro and in vivo models using mice with targeted deletions of
the TGF-A1 gene or infusions of TGF-A1 have attributed to a
neuroprotective role to TGF-A1, for example, in cerebral
ischemia (4, 8, 20, 21). At the cellular level, TGF-A1
modulates cell proliferation (22). It either promotes or inhibits
proliferation of brain tumor-derived cells depending on the
specific cell line and on the malignant phenotype (23Y26); it
blocks proliferation of dissociated fetal cortical, cerebellar,
and retinal neuroblasts (27Y29); and inhibits the proliferation
of astroglia and oligodendroglia (30, 31). Moreover, it blocks
the proliferation of microglia (32). The role of TGF-A1 on the
regulation of proliferation of neural stem and precursor cells
in the adult brain has not yet been explored.
The adult CNS is not immutable; new neurons are
generated in the dentate gyrus and in the lateral ventricle
wall throughout life by proliferating and differentiating
neural stem cells (33Y35). Neurogenesis underlies dynamic
changes and is modulated by a number of different factors at
the level of cell proliferation, fate determination, differentiation, and survival (36). Among those factors, lesions
and pathologic conditions affect neurogenesis. For example,
acute lesions of stroke induce a transient upregulation of
neurogenesis (37), whereas in animal models of chronic
degenerative diseases such as Alzheimer and Parkinson
disease, neurogenesis is reduced (38Y40). The precise
molecular mechanisms underlying the regulation of neurogenesis under pathologic conditions are barely understood,
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
Wachs et al
but among others, factors associated with inflammatory
responses are involved. For example, activated microgliaassociated interleukin (IL)-6 impairs neuronal and favors
glial differentiation during adult neurogenesis (41).
The mechanisms of immune response-associated modulation of neurogenesis at the level of neural stem and
progenitor cell proliferation are not known. Because 1) TGFA1 controls the proliferation of many different cell types, 2)
TGF-A1 expression is associated with neurologic diseases,
and 3) pathologic conditions in the CNS modulate neurogenesis, we tested the hypothesis that TGF-A1 is involved in
the regulation of adult neural stem and progenitor cell
biology, in particular cell proliferation, self-renewal, and
differentiation fate.
MATERIALS AND METHODS
Adult Neural Progenitor Cultures
and Growth Factors
Adult neural stem and progenitor cells (ANPs) of
the ventricle wall and hippocampus from 3- to 4-monthold female Fischer 344 rats (Charles River, Sulzfeld,
Germany) were isolated and grown as described (42). The
tissue was dissociated mechanically using a scalpel, resuspended in PPD solution containing 0.01% Papain (Worthington Biochemicals, Lakewood, NJ), 0.1% dispase II
(Boehringer, Mannheim, Germany), 0.01% DNase I (Worthington Biochemicals), and 12.4 mM MgSO4 in HBSS
(PAN, Aidenbach, Germany) without Mg++/Ca++ (PAA,
Pasching, Austria) and digested for 30 to 40 minutes at room
temperature. The cell suspension was triturated every
10 minutes. The single cell suspension was resuspended in
NB medium (Gibco BRL, Karlsruhe, Germany) supplemented with B27 (Gibco BRL) (NB/B27), 2 mM Lglutamine (PAN), 100 U/mL penicillin and 100 Kg/mL
streptomycin (PAN), 2 Kg/mL heparin (Sigma, Munich,
Germany), 20 ng/mL bFGF-2 (R and D Systems, Abingdon,
U.K.), and 20 ng/mL EGF (R and D Systems). This medium
composition is defined as proliferation conditions (PC) in the
present study. Cells were seeded in T-25 culture flasks and
cultures were maintained at 37-C in an incubator with 5%
CO2. Single cells began to form spheres within 5 to 7 days of
suspension culture and continued to grow in mass and
number over the next weeks. Half of the medium was
changed every 7 days. Cells from passage number 3 to 6
were used for the experiments. For passaging of cells, the
culture medium containing floating neurospheres was collected in a 15-mL centrifuge tube and centrifuged at 120 g
for 5 minutes. The pellet was resuspended in 200 KL of
Accutase (Innovative Cell Technologies Inc., San Diego,
CA) and triturated approximately 10 times using a pipette.
Dissociated cells were centrifuged at 120 g for 5 minutes,
resuspended, and seeded in PC. ANPs were differentiated
on poly-ornithine (250 Kg/mL) (Sigma, Germany) and laminin
(5 Kg/mL) (Sigma, Germany)-coated glass coverslips (Menzel)
by EGF/FGF removal and addition of 5% fetal calf serum
(PAN), termed here differentiation condition (DC) (42).
Growth factors tested were human recombinant TGF-A1 and
TGF-A2 (R and D Systems), 10 ng/mL each if not specified
Ó 2006 American Association of Neuropathologists, Inc.
otherwise. NTera-2 cells (DSMZ, Braunschweig, Germany;
#ACC 527) were grown in DMEM (Gibco BRL), 10% (v/v)
fetal bovine serum (PAN), 4 mM L-glutamin (PAN), 4.5 g/L
glucose (Merck VWR, Darmstadt, Germany), 100 U/mL
penicillin (PAN), and 0.1 mg/mL streptomycin (PAN).
Expansion and Proliferation Assays
Expansion
A total of 104 ANPs were seeded in 12-well plates in
PC. Cells were exposed to TGF-A1or TGF-A2 at days 1, 3,
and 6. At day 7, neurospheres were dissociated and viable
cells were counted by trypan blue exclusion assay.
Proliferation
A total of 104 ANP cells/mL were seeded in T25 flasks
for 7 days in PC in the presence or absence of TGF-A1. Cells
were labeled for 48 hours with 5 KM bromo-deoxyuridine
(BrdU) (Sigma) and DNA was analyzed for the presence of
BrdU by enzyme-linked immunosorbent assay (ELISA) as
described (43).
Apoptosis and TUNEL Assays
Apoptosis Assay for Cell Cultures
A total of 104 ANPs/mL were seeded in T25 flasks for
7 days in PC in the presence or absence of TGF-A1.
Apoptosis was detected by measuring cytoplasmic histoneassociated DNA fragments (mono- and oligonucleosomes)
using a photometric enzyme immunoassay (Cell Death
Detection ELISA; Roche Diagnostics, Mannheim, Germany).
TUNEL Assay for Detection of Apoptosis In Vivo
The TUNEL (terminal deoxynucleotidyl transferase
dUTP nick end labeling) assay was performed using the
Apoptag Fluorescein In situ Apoptosis Detection Kit (Chemicon, Hants, U.K.) modified for free-floating sections (44).
Clonal and Self-Renewal Analysis
ANP cultures were treated with or without TGF-A1 for
7 days, dissociated, and single cells were transferred to 96well plates by limited dilution at a density of 0.5 cells/well
in PC with or without TGF-A1. Media was changed after
2 weeks and subsequently on a weekly basis. TGF-A1 or
PBS as control was added twice a week. The presence and
size of spheres was followed over 3 months after seeding.
Individual clones were expanded (for additional 10 weeks or
10 passages) and analyzed for their differentiation potential.
Western Blotting
Cells were lysed in a buffer containing 4 mM HEPES
(Merck VWR), 320 mM sucrose (Merck VWR), 1 mM EDTA
(Merck VWR), 0.1 mM DTT (Sigma), 1 mM phenylmethylsulfonyl fluoride (Sigma), 1.5 mM pepstatin (Sigma), 2 mM
leupeptin (Sigma, Munich, Germany), 0.7 mM aprotinin
(Sigma), and 0.1% CHAPS (Sigma) on ice for 20 minutes.
After sonication for 10 seconds, protein extracts were
centrifuged for 20 minutes at 20800 g at 4-C. The protein
concentration in the supernatant (cytosolic proteins) and the
resuspended pellet (membrane proteins) was determined using
the BCA test (Sigma). Fifty micrograms of extracts were
359
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
loaded and run on 7.5% SDS-PAGE gels under reducing
conditions. After electrophoresis, protein was transferred onto
a nitrocellulose membrane (Schleicher and Schuell, Dassel,
Germany). Membranes were placed into blocking buffer
(20 mM Tris-HCl, pH 7.3, 0.9% NaCl, 1% Teleostean gelatin
[Sigma], and 0.1% Tween-20) for 1 hour at room temperature.
The same buffer composition served for antibody dilutions as
well as for washes. Goat anti human recombinant TGF-AR2 (R
and D Systems) was used in a concentration of 0.2 Kg/mL.
Immunoblots were incubated with 1:5000 diluted horseradish
peroxidase-conjugated antigoat IgG (Dianova, Hamburg,
Germany) using the Enhanced Chemiluminescence Plus
(ECL-Plus) Western blotting detection system kit (Amersham
Pharmacia, Freiburg, Germany) and exposed to Hyperfilm
(Amersham Pharmacia).
Immunostaining of Cell Cultures
and Quantification
Five 104 ANPs/well were seeded in 12-well plates in
PC or DC for 1 or 7 days with or without TGF-A1 on coated
glass coverslips. Cells were fixed with phosphate-buffered 4%
paraformaldehyde pH 7.4 and processed for immunocytochemistry as described (42). The following primary antibodies were used: rabbit anti-GFAP 1:1000 (Dako, Hamburg,
Germany); mouse antirat-nestin 1:500 (Pharmingen International, Heidelberg, Germany); mouse antitubulin-AIII 1:500
(Promega, Mannheim, Germany), goat antihuman recombinant TGF-AR2 1:25 (R and D Systems), rabbit anti-NG2
1:250 (Chemicon), and rabbit anti-GalC 1:250 (Chemicon).
The secondary fluorochrome-conjugated antibodies were
diluted 1:500 (donkey antimouse, antirabbit, or antigoat
[Dianova]). Nuclear counterstaining was performed with
4_,6_-diamidino-2-phenylindole dihydrochloride hydrate at
0.25 Kg/KL (DAPI; Sigma) or ToPro3 1:1000 (Molecular
Probes, Karlsruhe, Germany). Controls included omission of
primary antibodies. Coverslips were mounted onto glass
slides using Prolong-Antifade (Molecular Probes). For analysis, 8-bit monochrome pictures were taken at 200
magnification on a fluorescent microscope (Leica DMR;
Leica, Bensheim, Germany) equipped with a Spot CCD
camera model 2.2.1 (Diagnostic Instruments, Sterling
Heights, IL). Three independently performed immunocytochemical stains were analyzed. Immunoreactive cells were
determined in 5 random fields in relation to all cells present
within the field (number of DAPI counterstained nuclei, total
number of cells between 250 and 300).
Reverse TranscriptaseYPolymerase Chain
Reaction Analysis
Total RNA isolation, reverse transcription and reverse
transcriptaseYpolymerase chain reaction were performed as
described (43). Forward and reverse primers used were (5¶-3¶):
TCCGATCCTGGTGATGTCC (sense) and CGAA
CACGCTCCCAGACGT (antisense) for p21, CTGAAATC
GACCTAATTCC (sense) and CCATGCTCATGATAATCC
(antisense) for TGF-AR1, CAACAACAT(AGC)AACCA
CAATACG (sense) and ATCTTTCACTTCTCCCACAGC
(antisense) for TGF-AR2, TTCTACAGCTCCAAGA
GAGTGC (sense) and GGAGTAGATGTACCACAAGGCC
360
TGF-A1 Impairs Adult Neurogenesis
(antisense) for TGF-AR3, and GGTCGGTGTGAACG
GATTTG (sense) and GTGAGCCCCAGCCTTCTCCAT
(antisense) for GAPDH. The lengths of the amplified fragments were 200 bp (p21), 633 bp (TGF-AR1), 659 bp (TGFAR2), 432 bp (TGF-AR3), and 350 bp (GAPDH), respectively.
FACS Analysis
Propidium-iodide staining: 10 6 cells from ANP
cultures were dissociated into single cells, washed once
with phosphate-buffered saline (PBS), and resuspended in
5 mL of ice-cold 70% ethanol and kept overnight at j20-C.
The following day, cells were washed twice with PBS and
resuspended into 470 KL of PBS, and then 5 KL of RNase
A (Roche Diagnostics) (stock 1 mg/mL) was added. After a
30-minute incubation at 37-C, 25 KL of propidium iodide
(stock 1 mg/mL) (Sigma) were added and samples were
analyzed on a FACSCalibur flow cytometer (Becton Dickinson, Heidelberg, Germany). Data were processed using
WinMDI 2.8 software.
TGF-AR2 FACS Analysis
Immediately after dissociation, cells were transferred
on ice, washed twice with PBS, and kept at 0-C. Immunofluorescent staining was done with a 2-step labeling
technique with immunoglobulins against TGF-AR2. Cells
were incubated with unconjugated goat anti-TGF-AR2 1:25
(R and D Systems) at room temperature for 60 minutes.
Cells were washed twice with PBS and second-step reagent
rhodamine X donkeyYantigoat (1:1000; Dianova) was added
to the cells for 60 minutes. Cells were washed twice with
PBS and subsequently analyzed by FACS analysis.
Growth Factor Infusion
Animal experiments were carried out in accordance
with the European Communities Council Directive of
November 24, 1986 (86/609/EEC) and were approved by
the local governmental commission for animal health. Twoto 3-month-old (180 g) female Fischer-344 rats (n = 24)
received intracerebroventricular infusions through stainless
steel cannulas connected to osmotic minipumps (model
2002, ALZET; Durect Corp., Cupertino, CA) as described
(43). Animals received either recombinant TGF-A1 dissolved in artificial cerebrospinal fluid (CSF) (500 ng/mL
present in the pump) or artificial CSF as control (n = 16
each) at a flow rate of 0.5 KL/hour. Starting at day 1 of the
pump period, animals received daily intraperitoneal injections of 50 mg/kg BrdU for 7 days. After 7 days of infusion,
6 animals per group were intracardially perfused with 4%
paraformaldehyde. The remaining animals had the pumps
removed and were perfused 4 weeks later.
Tissue Processing and Histology
Tissue was processed for chromogenic or epifluorescence immunodetection in 40-Km sagittal sections and
analyzed as described (43). Primary antibodies were as
above and: rat anti-BrdU 1:250 (Oxford Biotechnology,
Kidlington, U.K.), goat antihuman recombinant TGF-AR2
1:25 (R and D Systems), goat anti-doublecortin (DCX)
1:500 (Santa Cruz Biotechnology, Santa Cruz, CA); mouse
antirat nestin 1:500 (Pharmingen International, San Diego,
Ó 2006 American Association of Neuropathologists, Inc.
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
Wachs et al
CA); mouse anti-NeuN 1:500 (Chemicon), mouse antiproliferating cell nuclear antigen (PCNA) 1:500 (Santa Cruz
Biotechnology); and rabbit anti-S100A 1:500 (Swant,
Bellinzona, Switzerland). Secondary antibodies were
donkey antigoat, mouse, rabbit, or rat conjugated with
fluorescein, rhodamine X, CY5, or biotin 1:500 (Dianova).
Counting Procedures and Statistical Analysis
To determine the number of PCNA- and TUNELpositive cells, every sixth section (240-Km intervals) of one
cerebral hemisphere was selected from each animal and
processed for immunohistochemistry. In the hippocampus,
the volume of the granule cell layer of the hippocampal
dentate gyrus was determined by tracing the area using a
semiautomatic stereology system (Stereoinvestigator; MicroBrightField, Colchester, VT).
Subventricular Zone
For the lateral ventricle wall, labeled cells were very
numerous. Therefore, fields of 50 50 Km located at the
bottom, middle, and uppermost region of the ventricle wall
were counted.
Positive cells were counted on each section by a
systematic procedure. Positive cells that intersected the
uppermost focal plane (exclusion plane) or the lateral
exclusion boundaries of the counting frame were not
counted. The total counts of positive cells were multiplied
by the ratio of reference volume to sampling volume in order
to obtain the estimated number of PCNA- or TUNELpositive cells (45, 46). All extrapolations were calculated for
one cerebral hemisphere and have to be doubled to represent
the total brain values.
To determine the differentiation pattern of newborn
cells, a series of every sixth section (240-Km interval) was
examined using a confocal laser microscope equipped with a
40 PL APO oil objective (1.25 numeric aperture) and a
pinhole setting that corresponded to a focal plane of 2 Km or
less. An average of 50 BrdU-labeled cells per animal and
structure (n = 4 per group) was analyzed for differentiation.
Statistical analysis was performed using the unpaired, 2-sided
t-test comparison between the TGF-A1-treated and control
groups (GraphPad Prism 4 software). The significance level
was assumed at p G 0.05.
RESULTS
TGF-A1 Inhibits Proliferation of Adult Neural
Stem and Progenitor Cells In Vitro
To target the role of TGF-A1 in the regulation of
neural stem cell biology, we used neural stem and progenitor
cell cultures derived from adult rat subventricular zone
(SVZ) (42). These cultures, referred to as adult neural
progenitor (ANP) cultures, grow in spheres consisting of
undifferentiated neural stem and progenitor cells and, to a
lesser extent, of already differentiated neuronal and glial
cells (42). We first investigated ANPs for expression of the
TGF-A receptors with the focus on receptor R2, the binding
receptor for TGF-A1 (2). Under proliferation conditions
(PC), TGF-AR1, R2, and R3 mRNAs were expressed by
Ó 2006 American Association of Neuropathologists, Inc.
ANPs as determined by RT-PCR (Fig. 1A). In a screen for
TGF-AR2 antibodies compatible and appropriate for immunostaining, an antihuman recombinant TGF-AR2 antibody
gave the most reliable and consistent results. This antibody
detected specifically a band of the correct size in the
membrane fraction of rat ANPs and of the human neural
NTera cells, but not in the corresponding cytosolic fraction
(Fig. 1B). FACS analysis using this antibody indicated the
presence of the receptor R2 protein on the cell surface of
ANPs (Fig. 1C). Cell type analysis of TGF-AR2-expressing
cells was performed by immunocytochemistry using specific
antibodies for nestin (uncommitted neural stem cells [47]),
tubulin-AIII (young neurons [48]), GFAP (astroglia and
neural stem cells [49, 50]), and NG2 (glial progenitors [51]).
TGF-AR2 was localized predominantly on nestin expressing
neural stem and progenitor cells (Fig. 1D). Weak or no
colocalization was observed with tubulin-AIII-, GFAP-, or
NG2-expressing cells (Fig. 1D).
Adding TGF-A1 for 1 week diminished the expansion
rate of ANP cultures to 25% of that observed under control
conditions in a dose-dependent manner with an ED50 of
approximately 4 ng/mL and plateau effect at 100 ng/mL
(Fig. 2A). The growth inhibition was specific for TGF-A1,
because TGF-A2, another TGF-A family member, did not
affect ANP proliferation (Fig. 2A). This suggests that
although ANPs express TGF-AR3, signaling of TGF-A2
through TGF-AR3 either did not occur or did not result in a
cell proliferation response. Concomitant to the reduced proliferation rate, sphere size and volume (but not the number
of spheres) were decreased after exposure to TGF-A1,
suggesting that the number of neural stem cells present in
the cultures was not affected by TGF-A1 (Fig. 2B). To
determine whether the effect of TGF-A1 on adult ANPs was
caused by reduced proliferation and/or enhanced apoptosis,
we performed BrdU incorporation-based ELISA, cell death
detection ELISA, and DNA content FACS analysis. Stimulation of ANPs with TGF-A1 for 7 days resulted in reduced
BrdU incorporation (20% of the PBS control) (Fig. 2C). In
addition, the level of apoptosis was also reduced in the
TGF-A1-treated cultures compared with the PBS control
(Fig. 2C), suggesting that the TGF-A1-induced decrease in
cell number was caused by reduced proliferation and not by
enhanced apoptosis. The effect of TGF-A1 on ANPs was
reversible but long-lasting, because TGF-A1-treated cells
needed 8 weeks to recover and to regain normal growth
rates (Fig. 2D). In summary, these data indicate a TGF-A1induced reduction in cell proliferation and protracted
growth arrest in ANP cultures.
Reduced proliferation of ANPs should be reflected
by changes in the cell cycle and its regulators. Therefore,
we performed a FACS-based cell-cycle analysis that indicated a TGF-A1-induced shift in the cell cycle from G2/Mand S-phase toward the G0/1 phase (Fig. 2E). In addition,
we analyzed the expression of p21, a key molecule known to
mediate the effects of TGF-A1 on cell proliferation (52).
TGF-A1 induced an increase in expression of mRNA for p21
within 1 hour (Fig. 2F). Moreover, gene expression profiling
revealed changes in the expression levels of a number of cell
cycle-associated molecules such as PCNA, Cdc2a, cyclin
361
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
TGF-A1 Impairs Adult Neurogenesis
FIGURE 1. Expression of TGF-AR2 in
adult neural stem and progenitor cell
cultures (ANPs). ANPs (passage 4)
derived from adult rat ventricle wall
were seeded at 1 104 cells/mL and
grown for 4 days in culture (AYC). (A)
reverse transcriptaseYpolymerase chain
reaction detection of TGF-A1 R1, R2,
and R3; GAPDH as control. (B) Western
blot analysis of ANPs and of NTera cells
using antihuman recombinant TGF-AR2
antibodies demonstrating that this antibody also recognizes rat TGF-AR2. (C)
FACS analysis of ANPs stained with
antibodies against TGF-AR2 (black line)
or isotype control antibodies (red). (D)
ANPs (passage 4) were plated on a polyornithine/laminin matrix, grown for 4
days, and analyzed by immunofluorescence for the presence of TGF-AR2.
Predominant immunoreactivity for
TGF-AR2 is present on nestin-positive
cells. Neuronal, astroglial, or glial progenitor markers do not or only weakly
colocalize with TGF-AR2 (blue = nuclear
counterstain DAPI, red = TGF-AR2,
green = cell type specific marker). m,
membrane fraction; c, cytosolic fraction.
Scale bar = 20 Km.
B1, p53, cyclin G1, and CDK 105 (data not shown). Taken
together, these data indicate that the TGF-A1-induced
decrease in ANP proliferation correlates with an exit from
the cell cycle.
TGF-A1 Does Not Interfere With Self-Renewal
or Multipotency of Neural Stem Cells In Vitro
In further experiments, we analyzed the effect of
TGF-A1 on the differentiation and self-renewal potential of
362
ANPs. Immunocytologic analysis of ANPs revealed that
under PC, the presence of TGF-A1 for 7 days did not
significantly change the percentages of cells expressing
nestin, TGF-AR2, tubulin-AIII, GFAP, NG2, or GalC
(Fig. 3A). Under conditions that promote differentiation
(see BMaterial and Methods[), the shift toward expression
of differentiation markers was not affected by TGF-A1
(Fig. 3B). Coinciding with the differentiation of the cells, a
lower intensity of TGF-AR2 immunoreactivity was noticed,
Ó 2006 American Association of Neuropathologists, Inc.
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
Wachs et al
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
FIGURE 2. TGF-A1decreases ANP proliferation. (A) TGF-A1 and TGF-A2 doseYresponse. ANPs (passage 4) derived from adult rat
ventricle wall were seeded at 1 104 cells/mL and grown for 7 days in culture. On days 1, 3, and 6, cells received different
concentrations of either TGF-A1 or TGF-A2. On day 7, cell number was analyzed. TGF-A1 inhibited expansion of cultures, TGF-A2
had no effect. Experiments were done in triplicate. (B) Phase contrast micrographs of neurospheres without and with TGF-A1
treatment. TGF-A1-treated spheres were smaller in size and volume, but sphere number remained unchanged. Scale bar = 100 Km.
(C) TGF-A1 reduces cell proliferation and DNA synthesis. Cells were incubated under the same conditions as in (B). Proliferation
was measured by BrdU-ELISA, decrease of apoptosis was detected by ELISA for histone-associated DNA fragmentation and
compared with phosphate-buffered saline-stimulated conditions. Experiments were done in triplicate. Data are presented as mean T
standard deviation percentage of optical density of phosphate-buffered saline-stimulated control. (D) The TGF-A1-induced growth
arrest is reversible but long-lasting. Cells were incubated under the same conditions as in (B). TGF-A1-stimulated cells were
reseeded and restimulated with TGF-A1 (days 1, 3, and 6) or remained untreated for 7 days. This procedure was repeated every
7 days for up to 8 weeks and cell number was analyzed at 1, 4, and 8 weeks. Experiments were done in triplicate. After 8 weeks,
growth rates of previously TGF-A1-treated cells paralleled those of untreated cells. (E) Cell-cycle analysis. Cells were incubated
under the same conditions as in (B). Propidium iodide-stained DNA from proliferating cells showed an increase in the number
of cells within the G0/1 phase of the cell cycle after TGF-A1 treatment. (F) Induction of p21. Cells were seeded as in (B) and
stimulated with TGF-A1. Within 60 minutes after stimulation, upregulation of p21 mRNA could be detected using reverse
transcriptaseYpolymerase chain reaction (GAPDH as control).
thus supporting the findings that TGF-AR2 expression is
strongest on neural stem and progenitor cells. When TGFA1 was present during proliferation and differentiation, or
only during the 7-day differentiation period, the percentages of cells expressing nestin, TGF-AR2, tubulin-AIII,
GFAP, NG2, or GalC did not change compared with the
control condition (data not shown). Therefore, TGF-A1 did
not induce a shift in cell identity or fate of ANPs, at least
during the time period analyzed.
Ó 2006 American Association of Neuropathologists, Inc.
The self-renewal capacity of ANPs was tested by
clonal analysis of neurosphere-derived single cells in the
presence or absence of TGF-A1. Although under control
conditions, individual cells formed spheres within 3 to
4 weeks, cells in the presence of TGF-A1 took 2- to 3-fold
more time (2Y3 months) to generate spheres of a similar size.
However, the cloning rate was similar under the 2 conditions
(18.0% for control, 17.8% for TGF-A1, n [wells] = 480).
Spheres grown under clonal conditions in the presence of
363
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
TGF-A1 Impairs Adult Neurogenesis
FIGURE 3. TGF-A1does not change the differentiation potential of ANPs. Cell type analysis of ANPs under proliferation (A) and
differentiation (B) conditions. Five 104 cells/well were grown on a poly-ornithine/laminin matrix in growth medium for 7 days
with or without TGF-A1 and immunostained using antibodies specific for nestin, TGF-AR2, tubulin-AIII, GFAP, NG2, and GalC.
The percentage of cells expressing a specific marker was analyzed. Data are presented as mean T standard deviation. TGF-A1 did
not change the cell type distribution. Note that similar percentages of cells expressed the neural stem cell marker nestin and the
TGF-AR2.
TGF-A1 retained their multipotency because cells derived
from individual spheres generated tubulin-AIII-, GFAP- and
GalC-positive cells, and the percentages of cells expressing
specific markers with or without TGF-A1 stimulation did not
significantly differ and were comparable to the numbers
derived from bulk cultures (PC: 80.1% nestin-, 13.2%
tubulin-AIII-, 21.3% GFAP-, 0.5% GalC-positive cells; DC:
6.3% nestin-, 31.5% tubulin-AIII-, 20.5% GFAP-, 1.7%
GalC-positive cells) (Fig. 3A, B). Clonally derived spheres
that were grown in the presence of TGF-A1 were able to
generate secondary spheres with an efficacy similar to
primary spheres (18.1%, N [wells] = 480), and secondary
spheres consisted of nestin-positive cells giving rise to
tubulin-AIII-, GFAP- and GalC-expressing cells (PC:
77.0% nestin-, 12.7% tubulin-AIII-, 18.4% GFAP-, 0.4%
GalC-positive cells; DC: 7.1% nestin-, 31.1% tubulin-AIII-,
17.7% GFAP-, 1.6% GalC-positive cells).
In the next experiment, we asked the question whether
TGF-A1 prestimulation of ANPs might change their selfrenewal capacity. Therefore, neurospheres were stimulated
for 7 days with TGF-A1, dissociated and seeded under
clonal conditions by limited dilution, and kept in culture for
2 more months either with or without TGF-A1. In both
conditions, the cloning rate of 17.9% (n [wells] = 480) was
comparable to the results obtained as previously mentioned.
Individual spheres generated tubulin-AIII-, GFAP-,
and GalC-expressing cells with similar percentages as in
Figure 3A, B (data not shown). In summary, these data
exclude that TGF-A1 affects self-renewal and multipotency
of adult neural stem and progenitor cells in vitro.
TGF-AR2 in Adult Neurogenic Regions Is
Predominantly Expressed by Neural Stem
and Progenitor Cells
TGF-A1 is predominantly expressed in the choroid
plexus and meninges in the CNS (8). The TGF-AR2 shows
364
widespread expression in the brain on a variety of cells
including neurons, astroglia, microglia, endothelial cells, and
other nonneuronal cells such as choroid plexus cells (53Y55).
To obtain more specific information on the expression of
TGF-AR2 in neurogenic regions, we analyzed the expression
of TGF-AR2 in the hippocampal dentate gyrus and in the
ventricle wall of adult rats. In the hippocampus, TGF-AR2immunoreactive cells are present in the subgranular layer of
the dentate gyrus and rarely in the granular layer (data not
shown). In the lateral ventricle wall, strongest immunoreactivity was found in the subventricular zone (Fig. 4). Here,
TGF-AR2 colocalized often with cells expressing the neural
stem cell marker nestin, but rarely with cells expressing the
astroglial/neural stem cell marker GFAP and almost never
with the ependymal/glial marker S100A (Fig. 4). Taken
together, these data indicate the presence of TGF-AR2 in
vivo in neurogenic regions with high expression of the TGFAR2 on neural stem or progenitor cells.
TGF-A1 Impairs Neural Stem and Progenitor
Cell Proliferation In Vivo, But Does Not Change
Differentiation Fate of Newly Born Cells
To investigate the effects of TGF-A1 on neurogenesis
in vivo, TGF-A1 (500 ng/mL in the pump) or artificial CSF
as a control was infused into the right lateral ventricle of
adult rats for 7 days using osmotic minipumps (Fig. 5A).
During the infusion period, animals received daily intraperitoneal injections of BrdU starting at day one after pump
implantation to be able to subsequently analyze the cell fate.
Animals were perfused transcardially at the last day of
infusion (group 1) or 4 weeks later (group 2). Cell
proliferation was analyzed by quantification of PCNApositive cells. Neurogenesis was determined by immunohistological stainings for the neuronal precursor marker DCX
(56) and by cell fate analysis of BrdU-labeled newly born
cells (Fig. 5B).
Ó 2006 American Association of Neuropathologists, Inc.
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
Wachs et al
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
FIGURE 4. TGF-AR2 expression in neurogenic regions of the adult rat. Cell
type analysis of TGF-AR2-expressing
cells in the subventricular zone of a
sagittal brain section of a 3-month-old
rat visualized using epifluorescence.
TGF-AR2 immunoreactivity (red) is
present in most but not all nestinexpressing cells (green, top panel);
arrowhead points to cell positive for
both markers, arrow points to a cell
expressing nestin but not TGF-AR2.
TGF-AR2 immunoreactivity is rarely
detected in GFAP (green, middle panel)
and not in S100A-positive (green, lower
panel) cells. Scale bar = 10 Km.
After one week of infusion, a marked reduction in the
number of PCNA-positive cells was observed in the dentate
gyrus (29% compared with controls) and in the ventricle
wall (64% compared with controls) in the TGF-A1-treated
group (Fig. 5C, D). In addition to the reduced number of
PCNA-positive cells, fewer cells expressed the neurogenesis
marker DCX in the dentate gyrus and in the SVZ, indicating
a reduced level of neurogenesis (Fig. 5C). At 4 weeks
postinfusion, the number of PCNA-positive cells was still
significantly reduced in the TGF-A1-treated group in the
dentate gyrus (32% of control) and in the SVZ (48% of
control), suggesting a longlasting effect of TGF-A1 on cell
proliferation (Fig. 5C, D). Similarly, less cells in the dentate
gyrus and in the SVZ expressed DCX as an indication for
reduced neurogenesis (Fig. 5C).
Cell fate and differentiation was analyzed in the 4-week
postinfusion group by confocal double immunofluorescence
and quantitative analysis of newborn cells (BrdU-positive)
coexpressing the markers nestin (neural stem cells), S100A
(glia), DCX (neuronal precursors and immature neurons),
Ó 2006 American Association of Neuropathologists, Inc.
and NeuN (mature neurons) in the dentate gyrus and in the
olfactory bulb (Fig. 6A, B). Except for a low but significant
increase in the percentage of BrdU/NeuN double-positive
cells in the olfactory bulb, no significant differences between
TGF-A1 and control groups were observed. This strongly
indicates that the differentiation fate of the newly generated
cells was not affected by TGF-A1 treatment.
Because neurogenesis is controlled by programmed cell
death (57), we quantitatively analyzed apoptosis in the dentate
gyrus in the 4-week postinfusion groups by TUNEL staining.
The level of apoptosis in the TGF-A1 group was significantly
reduced compared with the control group (57% of control)
(Fig. 6C). Because the reduction in the number of TUNELpositive cells correlates with the lower number of PNCApositive cells in the TGF-A1 group (Fig. 5D), it can be
assumed that the cell fate of newly generated cells in terms of
apoptosis is not influenced by TGF-A1. In summary, considering the reduced cell proliferation in the neurogenic regions
in combination with the unchanged cell fate, the net result of
TGF-A1 infusion is a diminished neurogenesis.
365
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
DISCUSSION
TGF-A1 Modulates Adult Neurogenesis at the
Level of Cell Proliferation
Neurogenesis is a tightly regulated process that
involves control of neural stem cell number and regulation
TGF-A1 Impairs Adult Neurogenesis
of proliferation, symmetric and/or asymmetric cell division,
determination, migration and differentiation, and cell death.
Moreover, it is associated with the sequential changes in cell
identity from a slowly proliferating neural stem cell with
unlimited self-renewal capacity to the mature neuron.
Intermediate steps are fast-cycling progenitors and dividing
FIGURE 5. TGF-A1-infusion impairs
cell proliferation and neurogenesis in
neurogenic regions. (A) Schematic
representation of pump localization
in the adult rat brain. (B) Infusion
and BrdU application paradigm. (C)
Analysis of cell proliferation and neurogenesis. Mitotic cells and neurogenesis were visualized by proliferating
cell nuclear antigen and anti-doublecortin immunohistochemistry, respectively, on the last day of infusion (day
7) and 4 weeks later (day 35) in the
hippocampus (upper 2 rows) and the
subventricular zone (lower 2 rows).
Arrows point toward labeled cells. In
TGF-A1-infused animals, proliferation
and neurogenesis are reduced compared with cerebrospinal fluid-infused
animals. Scale bars = 100 Km. (D)
Quantitative and stereologic analysis
of cell proliferation in the hippocampus and subventricular zone. Data are
presented as total estimated numbers
of cells per structure (mean T standard
error of mean) determined by stereologic counting procedures.
366
Ó 2006 American Association of Neuropathologists, Inc.
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
Wachs et al
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
FIGURE 6. TGF-A1infusion does not change fate of newly generated cells. Experiments were as described in Figure 5. (A, B)
Brain sections of perfusion group 2 were double-stained using antibodies for BrdU and for the cell type-specific markers nestin,
S100A, anti-doublecortin, and NeuN. The dentate gyrus and the olfactory bulb were analyzed for the percentage of cells doublelabeled for a specific marker and BrdU. Data are presented as mean T standard deviation. Except for a low but significant increase
in the percentage of BrdU/NeuN double-positive cells in the olfactory bulb, no significant differences between TGF-A1 and
control groups were observed. (C) Brain sections of perfusion group 2 were TUNEL-stained. The dentate gyrus was analyzed for
the number of TUNEL-positive cells. Data are presented as mean T standard deviation.
precursors with limited self-renewal and limited differentiation potential. The present study demonstrates that
neural stem and progenitor cell proliferation can be
modulated by TGF-A1 by arresting these cells in the cell
cycle. TGF-A1 limits the proliferation potential of adult
neural stem and progenitor cells without changing the selfrenewal capacity or the differentiation fate. Here, TGF-A1
acts differently compared with the embryonic situation. For
example, in the developing CNS, TGF-A1 promotes oligodendroglial differentiation (30, 31). Moreover, TGF-A1 acts
differently from other members of the TGF-A family. For
example, the bone morphogenetic protein BMP2 suppresses
neurogenesis by inducing a change in developmental cell
fate from neuronal to astroglial lineage in cultures of fetal
mouse brain cells (58). Interestingly, the effect of TGF-A1
on cell proliferation was dominant over the mitogenic effects
of EGF and FGF-2 in culture, suggesting an inhibition of the
EGF/FGF-2 signaling by the Smad pathway. This seems to
be a more general mechanism, because TGF-A1 inhibits also
the EGF and FGF-2 induced proliferation of astrocytes (59).
the number of stem cells but selectively increased the
number of the transit-amplifying progenitors (61).
Does TGF-A1 Affect Neural Stem, Progenitor, or
Precursor Cells?
At present, we cannot discriminate between a stem,
progenitor, or a precursor cell effect of TGF-A1 activity,
but our in vitro data on the self renewal capacity of multipotent cells over several passages strongly suggests that
TGF-A1 affects the neural stem cell population. Moreover,
the longlasting effect on cell proliferation in vitro and in
vivo favors the model of a TGF-A1 effect on stem cells
rather on progenitor or precursor cells. In addition, the cellcycle arrest of TGF-A1 on neural stem cells is in accordance with work on the hematopoietic system in which
TGF-A1 affects hematopoietic stem cells by restraining
them in a quiescent stage that involves the cell-cycle regulators p57 and p21 (62Y64).
Does TGF-A1 Regulate the Stem Cell Pool?
Is TGF-A1 Signaling a Negative Feedback Loop
Controlling the Neural Stem Cell Pool?
The data presented on the TGF-A1-regulated expression of cell-cycle molecules such as p21 together with the
cell-cycle FACS analysis indicate the downstream effects of
TGF-A1 on cell-cycle regulation and provide a molecular
mechanism for the growth arrest and for the limited
neurogenesis. The physiological relevance of this control
mechanism requires further analysis and validation, but
experiments using animals with targeted deletion of the
cell-cycle regulator p21 suggested that such mechanisms are
required for maintenance of the stem cell pool (60). In these
experiments, the increased proliferation rates of adult neural
stem cells derived from p21-/- mice were associated with a
reduction in neural stem cell number relative to p21+/+ mice
(60). In contrast to p21, which regulates cell cycle of neural
stem cells, the cell-cycle molecule p27 is involved in
controlling proliferation of the transit-amplifying population
of progenitor cells, because the lack of p27 had no effect on
The maintenance of hematopoietic stem cell quiescence depends on TGF-A1 signaling, because the use of
blocking antibodies against TGF-A1 or against TGF-AR2
releases hematopoietic stem cells from the cell-cycle arrest
(65). A similar role of TGF-A1 on controlling neural stem
cell proliferation was recently demonstrated in cultures of
postnatal retina. Here, TGF-A1 derived from mature neurons
limited retinal progenitor proliferation by an endogenous
feedback loop (66). Progenitor proliferation was restored by
the inhibition of TGF-A1 signaling with soluble TGF-AR2
proteins (66). Negative feedback regulation controlling the
proliferation rate of stem cells might be a very general
mechanism applicable in adult stem and progenitor cell
biology. For example, in the olfactory epithelium GDF11,
another member of the TGF superfamily, acts as an
inhibitory feedback loop that reversibly arrests progenitors
in the cell cycle (67).
Ó 2006 American Association of Neuropathologists, Inc.
367
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
A Potential Role of TGF-A1 Signaling in
Modulating Neurogenesis Under Disease
Conditions?
The identification of a pathway that negatively
regulates the proliferation of adult neural stem cells reveals
a novel control mechanism for neurogenesis in the adult
brain. The relevance of the TGF-A1/TGF-AR2 system being
involved in the regulation of adult neurogenesis under
physiological or pathophysiological conditions requires
further exploration. Unfortunately, experiments using animals with deletions in the TGF-A1 or the TGF-AR2 gene do
not provide data on adult neural stem cells or adult
neurogenesis. Mice engineered to lack TGF-A1 do not
survive into adulthood; therefore, studies on adult neurogenesis cannot be performed (21). In these mice, however,
lack of TGF-A1 resulted in a loss of neurons indicating a
neuroprotective role of TGF-1 (21). This view was supported
by transgenic mice, in which overexpression of TGF-A1 was
neuroprotective in acute excitotoxic and chronic injury (21).
Mice with an inducible and cell-type-specific deletion of the
TGF-AR2 have recently been described (68). A conditional
deletion of TGF-AR2 resulted in mammary epithelium
hyperplasia, confirming the role of TGF-A signaling in
growth control (69). In addition, loss of TGF-A signaling by
mice expressing a dominant negative TGF-AR2 mutant
resulted in prostate cancer metastasis and in skin hyperplasia, further strengthening the role of TGF-A signaling in
regulation of cell proliferation (70).
It is intriguing to speculate that TGF-A1 might play a
key role in the modulation of neurogenesis under disease
conditions. TGF-A1 expression is low in the healthy CNS,
but rapidly upregulated after injury (71). In the diseased
brain, TGF-A1 is expressed by activated microglia (8, 17).
Expression of TGF-A1 is elevated in diseases such as
Alzheimer and Parkinson disease, amyotrophic lateral
sclerosis, Creutzfeldt-Jacob disease, acute insults such as
stroke and traumatic brain injury, and autoimmune disorders
such as multiple sclerosis (9Y17). Elevated levels of TGF-A1
are also found in the aged brain (72). The impact of CNS
diseases on neurogenesis is presently an issue of current
research activities. Interestingly, adult neurogenesis is
modulated in human brains of neurodegenerative diseases,
in animal models of CNS diseases, or during aging. For
example, cell proliferation and/or neurogenesis is downregulated in the transgenic R6/1 and R6/2 mouse models of
Huntington disease, but increased after acute quinolinic acid
lesions or in human Huntington disease brains (73Y76).
Similarly, the presenilin-1 knockout model of Alzheimer
disease or overexpression of mutant forms of presenilin or
APP (both causing familial Alzheimer disease in humans)
reduce the level of neurogenesis (38, 39, 77). Moreover, in
the >-synuclein-overexpressing mouse model of Parkinson
disease, adult neurogenesis is reduced (40). The specific
involvement of TGF-A1 in controlling neural stem cell
proliferation and neurogenesis in such animal models needs
to be determined in detail, but a TGF-A1-induced decrease
in neurogenesis might contribute to structural and cognitive
deficits associated with neurodegenerative diseases. This
368
TGF-A1 Impairs Adult Neurogenesis
hypothesis is supported by the finding that TGF-A1 infusion
into the lateral ventricle induces spatial learning deficits in
rats (78). In summary, the present data open the possibility
that TGF-A1 is involved in the modulation of neurogenesis
under these conditions.
REFERENCES
1. Massague J, Blain SW, Lo RS. TGFbeta signaling in growth control,
cancer, and heritable disorders. Cell 2000;103:295Y309
2. Wrana JL, Attisano L, Wieser R, Ventura F, Massague J. Mechanism of
activation of the TGF-beta receptor. Nature 1994;370:341Y47
3. Massague J. The TGF-beta family of growth and differentiation factors.
Cell 1987;49:437Y38
4. Unsicker K, Krieglstein K. TGF-betas and their roles in the regulation
of neuron survival. Adv Exp Med Biol 2002;513:353Y74
5. Bottner M, Krieglstein K, Unsicker K. The transforming growth
factor-betas: structure, signaling, and roles in nervous system development and functions. J Neurochem 2000;75:2227Y40
6. Constam DB, Philipp J, Malipiero UV, ten Dijke P, Schachner M,
Fontana A. Differential expression of transforming growth factor-beta
1,-beta 2, and-beta 3 by glioblastoma cells, astrocytes, and microglia. J
Immunol 1992;148:1404Y10
7. Unsicker K, Flanders KC, Cissel DS, Lafyatis R, Sporn MB. Transforming growth factor beta isoforms in the adult rat central and
peripheral nervous system. Neuroscience 1991;44:613Y25
8. Krieglstein K, Strelau J, Schober A, Sullivan A, Unsicker K. TGF-beta
and the regulation of neuron survival and death. J Physiol Paris 2002;
96:25Y30
9. Flanders KC, Lippa CF, Smith TW, Pollen DA, Sporn MB. Altered
expression of transforming growth factor-beta in Alzheimer’s disease.
Neurology 1995;45:1561Y69
10. Mogi M, Harada M, Kondo T, Narabayashi H, Riederer P, Nagatsu T.
Transforming growth factor-beta 1 levels are elevated in the striatum
and in ventricular cerebrospinal fluid in Parkinson’s disease. Neurosci
Lett 1995;193:129Y32
11. Ilzecka J, Stelmasiak Z, Dobosz B. Transforming growth factor-Beta 1
(TGF-Beta 1) in patients with amyotrophic lateral sclerosis. Cytokine
2002;20:239Y43
12. Baker CA, Lu ZY, Zaitsev I, Manuelidis L. Microglial activation varies
in different models of Creutzfeldt-Jakob disease. J Virol 1999;73:
5089Y97
13. Krupinski J, Kumar P, Kumar S, Kaluza J. Increased expression of
TGF-beta 1 in brain tissue after ischemic stroke in humans. Stroke
1996;27:852Y57
14. Rimaniol AC, Lekieffre D, Serrano A, Masson A, Benavides J, Zavala F.
Biphasic transforming growth factor-beta production flanking the
pro-inflammatory cytokine response in cerebral trauma. Neuroreport
1995;7:133Y36
15. Lindholm D, Castren E, Kiefer R, Zafra F, Thoenen H. Transforming
growth factor-beta 1 in the rat brain: Increase after injury and inhibition
of astrocyte proliferation. J Cell Biol 1992;117:395Y400
16. Issazadeh S, Mustafa M, Ljungdahl A, et al. Interferon gamma,
interleukin 4 and transforming growth factor beta in experimental
autoimmune encephalomyelitis in Lewis rats: Dynamics of cellular
mRNA expression in the central nervous system and lymphoid cells. J
Neurosci Res 1995;40:579Y90
17. Lehrmann E, Kiefer R, Christensen T, et al. Microglia and macrophages
are major sources of locally produced transforming growth factor-beta1
after transient middle cerebral artery occlusion in rats. Glia 1998;24:
437Y48
18. Wyss-Coray T, Lin C, Sanan DA, Mucke L, Masliah E. Chronic
overproduction of transforming growth factor-beta1 by astrocytes
promotes Alzheimer’s disease-like microvascular degeneration in transgenic mice. Am J Pathol 2000;156:139Y50
19. Wyss-Coray T, Masliah E, Mallory M, et al. Amyloidogenic role of
cytokine TGF-beta1 in transgenic mice and in Alzheimer’s disease.
Nature 1997;389:603Y6
Ó 2006 American Association of Neuropathologists, Inc.
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
Wachs et al
20. Dhandapani KM, Brann DW. Transforming growth factor-beta: a
neuroprotective factor in cerebral ischemia. Cell Biochem Biophys
2003;39:13Y22
21. Brionne TC, Tesseur I, Masliah E, Wyss-Coray T. Loss of TGF-beta 1
leads to increased neuronal cell death and microgliosis in mouse brain.
Neuron 2003;40:1133Y45
22. Flanders KC, Ren RF, Lippa CF. Transforming growth factor-betas in
neurodegenerative disease. Prog Neurobiol 1998;54:71Y85
23. Rogers SL, Cutts JL, Gegick PJ, McGuire PG, Rosenberger C,
Krisinski S. Transforming growth factor-beta 1 differentially regulates proliferation, morphology, and extracellular matrix expression
by three neural crest-derived neuroblastoma cell lines. Exp Cell Res
1994;211:252Y62
24. Robe PA, Rogister B, Merville MP, Bours V. Growth regulation of
astrocytes and C6 cells by TGFbeta1: Correlation with gap junctions.
Neuroreport 2000;11:2837Y41
25. Jachimczak P, Hessdorfer B, Fabel-Schulte K, et al. Transforming
growth factor-beta-mediated autocrine growth regulation of gliomas as
detected with phosphorothioate antisense oligonucleotides. Int J Cancer
1996;65:332Y37
26. Jennings MT, Kaariainen IT, Gold L, Maciunas RJ, Commers PA. TGF
beta 1 and TGF beta 2 are potential growth regulators for medulloblastomas, primitive neuroectodermal tumors, and ependymomas:
Evidence in support of an autocrine hypothesis. Hum Pathol 1994;25:
464Y75
27. Miller MW, Luo J. Effects of ethanol and transforming growth factor
beta (TGF beta) on neuronal proliferation and nCAM expression.
Alcohol Clin Exp Res 2002;26:1281Y85
28. Constam DB, Schmid P, Aguzzi A, Schachner M, Fontana A. Transient
production of TGF-beta 2 by postnatal cerebellar neurons and its effect
on neuroblast proliferation. Eur J Neurosci 1994;6:766Y78
29. Close JL, Gumuscu B, Reh TA. Retinal neurons regulate proliferation
of postnatal progenitors and Muller glia in the rat retina via TGFb
signaling. Development 2005;132:3015Y26
30. Hunter KE, Sporn MB, Davies AM. Transforming growth factor-betas
inhibit mitogen-stimulated proliferation of astrocytes. Glia 1993;7:
203Y11
31. McKinnon RD, Piras G, Ida JA Jr, Dubois-Dalcq M. A role for
TGF-beta in oligodendrocyte differentiation. J Cell Biol 1993;121:
1397Y407
32. Suzumura AA, Sawada M, Yamamoto H, Marunouchi T. Transforming
growth factor-beta suppresses activation and proliferation of microglia
in vitro. J Immunol 1993;151:2150Y58
33. Gage FH. Mammalian neural stem cells. Science 2000;287:1433Y38
34. Doetsch F. A niche for adult neural stem cells. Curr Opin Genet Dev
2003;13:543Y50
35. Alvarez-Buylla A, Lim DA. For the long run: Maintaining germinal
niches in the adult brain. Neuron 2004;41:683Y86
36. Lie DC, Song H, Colamarino SA, Ming GL, Gage FH. Neurogenesis in
the adult brain: New strategies for central nervous system diseases.
Annu Rev Pharmacol Toxicol 2004;44:399Y421
37. Arvidsson A, Kokaia Z, Lindvall O. N-methyl-D-aspartate receptormediated increase of neurogenesis in adult rat dentate gyrus following stroke. Eur J Neurosci 2001;14:10Y18
38. Feng R, Rampon C, Tang YP, et al. Deficient neurogenesis in
forebrain-specific presenilin-1 knockout mice is associated with reduced
clearance of hippocampal memory traces. Neuron 2001;32:911Y26
39. Haughey NJ, Nath A, Chan SL, Borchard AC, Rao MS, Mattson MP.
Disruption of neurogenesis by amyloid beta-peptide, and perturbed neural
progenitor cell homeostasis, in models of Alzheimer’s disease. J Neurochem 2002;83:1509Y24
40. Winner B, Lie DC, Rockenstein E, et al. Human wild-type
alpha-synuclein impairs neurogenesis. J Neuropathol Exp Neurol
2004;63:1155Y66
41. Monje ML, Toda H, Palmer TD. Inflammatory blockade restores adult
hippocampal neurogenesis. Science 2003; 302:1760Y65
42. Wachs FP, Couillard-Despres S, Engelhardt M, et al. High efficacy of
clonal growth and expansion of adult neural stem cells. Lab Invest
2003;83:949Y62
43. Schänzer A, Wachs FP, Wilhelm D, et al. Direct stimulation of adult
neuralstem cells in vitro and neurogenesis in vivo by vascular
endothelial growth factor. Brain Pathol 2004;14:237Y48
Ó 2006 American Association of Neuropathologists, Inc.
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
44. Winner BB, Cooper-Kuhn CM, Aigner R, Winkler J, Kuhn HG.
Long-term survival and cell death of newly generated neurons in the
adult rat olfactory bulb. Eur J Neurosci 2002;16:1681Y89
45. Gundersen HJ, Bagger P, Bendtsen TF, et al. The new stereological
tools: Dissector, fractionator, nucleator and point sampled intercepts
and their use in pathological research and diagnosis. APMIS 1988;96:
857Y81
46. Williams RW, Rakic P. Three-dimensional counting: an accurate and
direct method to estimate numbers of cells in sectioned material. J
Comp Neurol 1988;278:344Y52
47. Lendahl U, Zimmerman LB, McKay RD. CNS stem cells express a new
class of intermediate filament protein. Cell 1990;60:585Y95
48. Laferriere NB, Brown DL. Expression and posttranslational modification of class III beta-tubulin during neuronal differentiation of
P19 embryonal carcinoma cells. Cell Motil Cytoskeleton 1996;35:
188Y99
49. Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A.
Subventricular zone astrocytes are neural stem cells in the adult
mammalian brain. Cell 1999;97:703Y16
50. Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A. Cellular composition and three-dimensional organization of the subventricular germinal
zone in the adult mammalian brain. J Neurosci 1997;17:5046Y61
51. Levine JM, Nishiyama A. The NG2 chondroitin sulfate proteoglycan: A
multifunctional proteoglycan associated with immature cells. Perspect
Dev Neurobiol 1996;3:245Y59
52. Bachman KE, Blair G, Brenner K, et al. p21(WAF1/CIP1) mediates the
growth response to TGF-beta in human epithelial cells. Cancer Biol
Ther 2004;3:221Y25
53. Morita N, Takumi T, Kiyama H. Distinct localization of two
serine-threonine kinase receptors for activin and TGF-beta in the rat
brain and down-regulation of type I activin receptor during peripheral
nerve regeneration. Brain Res Mol Brain Res 1996;42:263Y71
54. Ata KA, Lennmyr F, Funa K, Olsson Y, Terent A. Expression of
transforming growth factor-beta 1, 2, 3 isoforms and type I and II
receptors in acute focal cerebral ischemia: An immunohistochemical
study in rat after transient and permanent occlusion of middle cerebral
artery. Acta Neuropathol (Berl) 1999;97:447Y55
55. De Groot CJ, Montagne L, Barten AD, Sminia P, Van Der Valk P.
Expression of transforming growth factor (TGF)-beta1,-beta2, and
-beta3 isoforms and TGF-beta type I and type II receptors in multiple
sclerosis lesions and human adult astrocyte cultures. J Neuropathol Exp
Neurol 1999;58:174Y87
56. Couillard-Despres S, Winner B, Schaubeck S, et al. Doublecortin
expression levels in adult brain reflect neurogenesis. Eur J Neurosci
2005;21:1Y14
57. Biebl M, Cooper CM, Winkler J, Kuhn HG. Analysis of neurogenesis
and programmed cell death reveals a self-renewing capacity in the adult
rat brain. Neurosci Lett 2000;291:17Y20
58. Nakashima K, Takizawa T, Ochiai W, et al. BMP2-mediated alteration in
the developmental pathway of fetal mouse brain cells from neurogenesis
to astrocytogenesis. Proc Natl Acad Sci U S A 2001;98:5868Y73
59. Vergeli M, Mazzanti B, Ballerini C, Gran B, Amaducci L, Massacesi L.
Transforming growth factor-beta 1 inhibits the proliferation of rat
astrocytes induced by serum and growth factors. J Neurosci Res 1995;
40:127Y33
60. Kippin TE, Martens J, van der Kooy D. p21 loss compromises the
relative quiescence of forebrain stem cell proliferation leading to
exhaustion of their proliferation capacity. Genes Dev 2005;19:756Y67
61. Doetsch F, Verdugo JM, Caille I, Alvarez-Buylla A, Chao MV,
Casaccia-Bonnefil P. Lack of the cell-cycle inhibitor p27Kip1 results
in selective increase of transit-amplifying cells for adult neurogenesis.
J Neurosci 2002;22:2255Y64
62. Batard P, Monier MN, Fortunel N, et al. TGF-(beta)1 maintains
hematopoietic immaturity by a reversible negative control of cell
cycle and induces CD34 antigen up-modulation. J Cell Sci 2000;113:
383Y90
63. Scandura JM, Boccuni P, Massague J, Nimer SD. Transforming growth
factor beta-induced cell cycle arrest of human hematopoietic cells
requires p57KIP2 up-regulation. Proc Natl Acad Sci U S A 2004;101:
15231Y36
64. Ducos K, Panterne B, Fortunel N, Hatzfeld A, Monier MN, Hatzfeld J.
p21(cip1) mRNA is controlled by endogenous transforming growth
369
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.
J Neuropathol Exp Neurol Volume 65, Number 4, April 2006
65.
66.
67.
68.
69.
70.
71.
factor-beta1 in quiescent human hematopoietic stem/progenitor cells.
J Cell Physiol 2000;184:80Y85
Fortunel N, Hatzfeld J, Kisselev S, et al. Release from quiescence of
primitive human hematopoietic stem/progenitor cells by blocking their
cell-surface TGF-beta type II receptor in a short-term in vitro assay.
Stem Cells 2000;18:102Y11
Close JL, Gumuscu B, Reh TA. Retinal neurons regulate proliferation
of postnatal progenitors and Muller glia in the rat retina via TGF(beta)
signaling. Development 2005;132:3015Y26
Wu HH, Ivkovic S, Murray RC, et al. Autoregulation of neurogenesis
by GDF11. Neuron 2003;37:197Y207
Frugier T, Koishi K, Matthaei KI, McLennan IS. Transgenic mice
carrying a tetracycline-inducible, truncated transforming growth factor
beta receptor (TbetaRII). Genesis 2005;42:1Y5
Forrester E, Chytil A, Bierie B, et al. Effect of conditional knockout of
the type II TGF-beta receptor gene in mammary epithelia on
mammary gland development and polyomavirus middle T antigen
induced tumor formation and metastasis. Cancer Res 2005;65:
2296Y3302
Tu WH, Thomas TZ, Masumori N, et al. The loss of TGF-beta signaling
promotes prostate cancer metastasis. Neoplasia 2003;5:267Y77
Finch CE, Laping NJ, Morgan TE, Nichols NR, Pasinetti GM.
370
TGF-A1 Impairs Adult Neurogenesis
72.
73.
74.
75.
76.
77.
78.
TGF-beta 1 is an organizer of responses to neurodegeneration. J Cell
Biochem 1993;53:277Y79
Finch CE. Neuron atrophy during aging: Programmed or sporadic?
Trends Neurosci 1993;16:104Y10
Lazic SE, Grote H, Armstrong RJ, et al. Decreased hippocampal
cell proliferation in R6/1 Huntington’s mice. Neuroreport 2004;15:
811Y13
Tattersfield AS, Croon RJ, Liu YW, Kells AP, Faull RL, Connor B.
Neurogenesis in the striatum of the quinolinic acid lesion model of
Huntington’s disease. Neuroscience 2004;127:319Y32
Curtis MA, Penney EB, Pearson AG, et al. Increased cell proliferation
and neurogenesis in the adult human Huntington’s disease brain. Proc
Natl Acad Sci U S A 2003;100:9023Y27
Gil JM, Mohapel P, Araujo IM, et al. Reduced hippocampal neurogenesis in R6/2 transgenic Huntington’s disease mice. Neurobiol Dis
2005;20:744Y51
Wen PH, Hof PR, Chen X, et al. The presenilin-1 familial Alzheimer
disease mutant P117L impairs neurogenesis in the hippocampus of adult
mice. Exp Neurol 2004;188:224Y37
Nakazato F, Tada T, Sekiguchi Y, et al. Disturbed spatial learning of
rats after intraventricular administration of transforming growth
factor-beta 1. Neurol Med Chir (Tokyo) 2002;42:151Y56
Ó 2006 American Association of Neuropathologists, Inc.
Copyright @ 2006 by the American Association of Neuropathologists, Inc. Unauthorized reproduction of this article is prohibited.