Research Article
KCl Cotransporter-3 Down-regulates E-Cadherin/B-Catenin Complex
to Promote Epithelial-Mesenchymal Transition
1,2
1,2
3
4
Yueh-Mei Hsu, Yih-Fung Chen, Cheng-Yang Chou, Ming-Jer Tang, Ji Hshiung Chen,
7
7
2,3,5
Robert J. Wilkins, J. Clive Ellory, and Meng-Ru Shen
6
1
Institute of Basic Medical Sciences, and Departments of 2Pharmacology, 3Obstetrics and Gynecology, and 4Physiology, College of Medicine
and 5Center for Gene Regulation and Signal Transduction Research, National Cheng Kung University, Tainan, Taiwan;
6
Graduate Institute of Molecular and Cell Biology, College of Life Sciences, Tzu Chi University, Hualien, Taiwan; and
7
Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford, United Kingdom
Abstract
The potassium chloride cotransporter (KCC) is a major
determinant of osmotic homeostasis and plays an emerging
role in tumor biology. Here, we investigate if KCC is involved
in the regulation of epithelial-mesenchymal transition
(EMT), a critical cellular event of malignancy. E-cadherin
and B-catenin colocalize in the cell-cell junctions, which
becomes more obvious in a time-dependent manner by
blockade of KCC activity in cervical cancer SiHa and CaSki
cells. Real-time reverse transcription-PCR on the samples
collected from the laser microdissection indicates that KCC3
is the most abundant KCC isoform in cervical carcinoma.
The characteristics of EMT appear in KCC3-overexpressed,
but not in KCC1- or KCC4-overexpressed cervical cancer cells,
including the elongated cell shape, increased scattering,
down-regulated epithelial markers (E-cadherin and B-catenin), and up-regulated mesenchymal marker (vimentin). Some
cellular functions are enhanced by KCC3 overexpression, such
as increased invasiveness and proliferation, and weakened
cell-cell association. KCC3 overexpression decreases mRNA
level of E-cadherin. The promoter activity assays of various
regulatory sequences confirm that KCC3 expression is a potent
negative regulator for human E-cadherin gene expression. The
proteosome inhibitor restores the decreased protein abundance of B-catenin by KCC3 overexpression. In the surgical
specimens of cervical carcinoma, the decreased E-cadherin
amount was accompanied by the increased KCC3 abundance.
Vimentin begins to appear at the invasive front and becomes
significantly expressed in the tumor nest. In conclusion, KCC3
down-regulates E-cadherin/B-catenin complex formation by
inhibiting transcription of E-cadherin gene and accelerating
proteosome-dependent degradation of B-catenin protein. The
disruption of E-cadherin/B-catenin complex formation promotes EMT, thereby stimulating tumor progression. [Cancer
Res 2007;67(22):11064–73]
Introduction
The activity of potassium chloride cotransporter (KCC) plays an
important role in several cellular functions, such as cell volume
Note: Supplementary data for this article are available at Cancer Research Online
(http://cancerres.aacrjournals.org/).
Requests for reprints: Meng-Ru Shen, Department of Obstetrics and Gynecology,
College of Medicine, National Cheng Kung University, 138 Sheng-Li Road, Tainan 704,
Taiwan. Phone: 886-6-2353535, ext. 5505; Fax: 886-6-2766185; E-mail: mrshen@
mail.ncku.edu.tw.
I2007 American Association for Cancer Research.
doi:10.1158/0008-5472.CAN-07-2443
Cancer Res 2007; 67: (22). November 15, 2007
regulation, epithelial ion transport, and osmotic homeostasis (1).
Functionally, KCC is defined as the Cl -dependent bidirectional K+
transport measured in the presence of ouabain and bumetanide to
inhibit Na+-K+ pump and Na+K+2Cl cotransporter, respectively (2).
The KCC family includes four isoforms (KCC1-KCC4), which differ
at amino acid residues within key transmembrane domains and in
the distribution of putative phosphorylation sites within the
amino- and carboxyl-terminal cytoplasmic domains. The activities
of KCC1, KCC3, and KCC4 are osmotically sensitive and involved in
cell volume regulation (3). The neuron-specific KCC2 is critical for
the maturation of inhibitory g-aminobutyric acid responses in the
central nervous system by the control of intracellular Cl
concentration (4, 5). KCC activity in RBC was undiminished in
KCC1 knockout mice, decreased in KCC3 knockout mice, and
almost completely abolished in mice lacking both isoforms,
indicating that KCC activity of mouse RBC is mediated largely by
KCC3 (6). Loss of KCC3 caused deafness, neurodegeneration, and
reduced seizure threshold (7). KCC3 also plays an important role in
the regulation of cell proliferation (8). Deafness and renal tubular
acidosis were noted in mice lacking KCC4 (9).
The important role of KCC in tumor behaviors emerged from
our previous studies. The malignant transformation of cervical
epithelial cells is associated with the differential expression of
volume-sensitive KCC activities (10). Cervical carcinogenesis is also
accompanied by the up-regulation of mRNA transcripts in KCC1,
KCC3, and KCC4 (11). The loss-of-function KCC mutant cervical
cancer cells exhibit inhibited cell growth accompanied by
decreased activity of the cell cycle gene products retinoblastoma
and cdc2 kinase. Reduced cellular invasiveness in loss-of-function
KCC mutant cervical cancer cells is in parallel, by reduced
expression of avh3 and a6h4 integrins, accompanied by decreased
activity of matrix metalloproteinase 2 and 9. Inhibition of tumor
growth in severe combined immunodeficient mice confirms the
crucial role of KCC in promoting cervical cancer growth and
invasion (10). In addition, KCC activation by insulin-like growth
factor-I (IGF-I) stimulation plays an important role in IGF-I
signaling to promote the growth and spread of gynecologic cancers
(12). Furthermore, IGF-I up-regulates KCl cotransporter KCC3 and
KCC4, which are differentially required for breast cancer cell
proliferation and invasiveness (13). Hence, KCC may aid the
invasive biology of cancer cells, a feature that poses a serious
problem to the successful treatment of neoplastic disease.
Studying on the conversion of epithelial cells to mesenchymal
cells [epithelial-mesenchymal transition (EMT)] in different
developmental and pathologic stages provides a better understanding of tumor biology. Some cellular functions of tumor would
be enhanced by EMT, such as increased invasive migration and
resistance to anoikis (14, 15). EMT has been characterized as a
11064
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2007 American Association for Cancer
Research.
Role of KCC3 in EMT Regulation
hallmark for cancer metastasis in several types of cancer, including
colorectal cancer (16), breast cancer (17), and lung cancer (18, 19).
The alterations in the abundance of several molecules are used to
detect the events of EMT, for example, the decreased abundances
of epithelial markers such as E-cadherin and h-catenin, and the
increased abundances of mesenchymal markers such as vimentin
and fibronectin (20, 21).
Little information is available on the roles of cellular ion
transport systems in the regulation of EMT to promote tumor
progression. The literature on the important role of EMT in cervical
carcinogenesis is scarce. Because EMT has been characterized as a
hallmark of cellular event for cancer invasion and metastasis, we
investigate if KCC activity is involved in the regulation of EMT by
the model of cervical carcinoma. The data indicate that KCC3
down-regulates E-cadherin/h-catenin complex formation by inhibiting transcription of E-cadherin gene and accelerating degradation
of h-catenin protein.
Materials and Methods
Cell culture and transfection. Cultures of cervical cancer SiHa and
CaSki cell lines were prepared as previously described (11). The full-length
cDNA of human KCC1 (22), human KCC3 (8), and mouse KCC4 (22)
construct were subcloned into the eukaryotic expression vector pCDNA3.1
(Invitrogen). Plasmids were transfected into SiHa cells by LipofectAMINE
(Invitrogen) and stable clones were selected.
Reverse transcription-PCR. Total RNAs were isolated by RNeasy Mini
Kit (Qiagen) and cDNA was prepared with Superscript II (Invitrogen). For
E-cadherin, forward (5¶-GGGTGACTACAAAATCAATC-3¶) and reverse (5¶GGGGGCAGTAAGGGCTCTTT-3¶) primers were used to amplify a 251-bp
fragment from human E-cadherin. For b-catenin, forward (5¶-ACTCTAGGAATGAAGGTGTGGC-3¶) and reverse (5¶-AGTGTGTCAGGCACTTTCTGAG-3¶) primers were used to amplify a 822-bp fragment from human
h-catenin. For KCC1, forward (5¶-TGGGACCATTTTCCTGACC-3¶) and
reverse (5¶-CATGCTTCTCCAC GATGTCAC-3¶) primers were used to
amplify a 421-bp fragment from human KCC1. For KCC3, forward (5¶CTATCCTTGCCATCCTGACC-3¶) and reverse (5¶-GCAGCAGTTGTCACTCGAAC-3¶) primers were used to amplify a 1,099-bp fragment from human
KCC3. For KCC4, forward (5¶-GACTCGTTTCCGC AAAACC-3¶) and reverse
(5¶-AGAGTGCCGTGATGCTGTTGG-3¶) primers were used to amplify a
783-bp fragment from human KCC4. PCR was carried out as described in
detail elsewhere (11).
Surgical specimens, laser microdissection, and real-time reverse
transcription-PCR. From January 2006 to April 2006, 36 consecutive
patients with cervical carcinoma of stage Ib to IIa were scheduled for
radical hysterectomy and pelvic lymphadenectomy at National Cheng Kung
University Hospital, Taiwan. Patients who had undergone the loop
electrosurgical excision for the transformation zone of uterine cervix before
radical hysterectomy and who had unusual histopathology such as clear cell
adenocarcinoma, adenosquamous carcinoma, and small-cell carcinoma
were excluded from this study. The tumor volume of cervical carcinoma
was measured as previously described (23). The tumor and normal tissues
were collected from patients immediately after surgical removal. The frozen
tissue specimens were serially cut into pieces of 8 Am. The sections were
stained with H&E according to NIH laser capture microdissection
protocols,8 and was subjected to laser microdissection by Leica AS LMD
system (Leica Microsystems). Five thousand laser pulses per specimen were
used to collect f10,000 morphologically normal epithelial cells and
primary carcinoma cells from each case. Total RNA of these cells was
extracted by the PicoPure RNA Isolation Kit (Arcturus) according to the
manufacturer’s instructions, and cDNA was prepared with Superscript II
(Invitrogen). The RNA levels of individual KCC isoforms in the surgical
8
http://dir.nichd.nih.gov/lcm/sin_cell_collection.htm
www.aacrjournals.org
specimens were examined by real-time quantitative reverse transcriptionPCR (RT-PCR) with the use of ABI Prism 7900 Analyzer and TaqMan probes
(Applied Biosystems). cDNA was normalized against glyceraldehyde3-phosphate dehydrogenase (GAPDH). Amplification primers and probes
for real-time RT-PCR are listed as follows. For KCC1, forward GTGATCATCTCCATCCTCTCCATCT; reverse GTTGCC CAGCATGCATACC; probe
CCCTCCCGTGTTTCC. For KCC3, forward ACATTGACGTTTGCTCTAAGACCAA; reverse ACTCGAGTTACAG AAGAATCCCCATA; probe
CTGTCATGTTGTTAATTTC. For KCC4, forward TGCGCCTGACGTGGAT;
reverse GGCCACGATGAGGAAGGA; probe CCAGGACACCAGCCACC.
Functional K+ (86Rb+) efflux assays. By using 86Rb+ as a congener of K+,
unidirectional K+ efflux was carried out at 37jC as described in detail
elsewhere (8). KCC activity is defined as the Cl -dependent K+ transport
measured in the presence of 0.1 mmol/L ouabain and 0.01 mmol/L
bumetanide to inhibit Na+-K+ pump and Na+K+2Cl cotransporter,
respectively (2). Release of 86Rb+ from preloaded cells was measured in
the efflux medium at indicated time intervals within a 15-min duration.
86
Rb+ efflux rate constants were estimated from the negative slope of the
graph of ln[Xi (t)/Xi (t = 0)] versus time (t), where Xi (t = 0) denotes the total
amount of 86Rb+ inside the cells at the beginning of the efflux time course
and Xi (t) denotes the amount of 86Rb+ inside the cells at the time point of t.
The isotonic efflux medium contained (in mmol/L) NaCl 110, KCl 5, MgCl2
1, CaCl2 1.5, glucose 10, HEPES 10 and mannitol 60, titrated to pH 7.4
with NaOH (300 F 3 mOsm/L). The components of the hypotonic medium
(240 F 2 mOsm/L) are the same as those of the isotonic medium except
that mannitol was omitted. To study the KCC activity, the Cl dependence
of K+ (86Rb+) efflux was examined by substituting NO3 for Cl in the efflux
medium. The Cl -dependent K+ (86Rb+) flux was defined as the efflux
difference between Cl and NO3 media.
Measurements of cell volume. Cell volume was measured as described
in detail elsewhere (24). The relative volume change (V/V o) was calculated
from the cross-sectional surface area at the beginning (S o) of experiment
and during (S) the experiments from the relation V/V o = (S/S o)3/2 (10, 24).
Data were presented as the percentage of starting volume (V/V o), as a
function of time. Fluorescence-activated cell sorting was also used to
measure cell size. Cells were suspended in the isotonic solution containing
20 Ag/mL propidium iodide. A flow cytometer (Becton Dickinson FACSCalibur System) was used to measure the light-scattering properties of the
cells. An argon laser (488 nm) was used as the probing beam, with red light
emission being used to exclude the dead, propidium iodide–stained cells
during later analysis. Because forward-angle light scatter originates in
particles with diameters that are larger than the wavelength of the probing
light, the forward-angle light scatter serves as an indirect measure of overall
cell size. Forward-angle light scatter distribution histograms for viable cells
were analyzed using Cell Quest software.
Proliferation, migration, and invasion assay. To assess proliferation,
cells were plated at the density of 1 105 per dish on 60-mm dishes and the
medium was changed every 2 days. Cell counts were done with the aid of a
hemocytometer by using trypan blue exclusion (0.08%) to monitor cell
viability. Invasive migration was done in the BD Matrigel invasion chamber
(BD Biosciences) for 6 h in serum-free culture medium at 37jC, as an index
of invasive activity of tumor cells (25). Cells were then fixed with
paraformaldehyde, stained with crystal violet, and counted immediately
after staining. For the migration assays (26), cells were allowed to migrate
across a membrane (with 8-Am pore) toward the medium containing
10 Ag/mL fibronectin or vitronectin for 6 h at 37jC. Cells that migrated
through the membrane were then fixed with methanol, stained with
GIEMSA stain, and counted immediately.
Cell dissociation assay. Cell dissociation assay was done following a
previously published method (27). Briefly, cells were detached from culture
plates with a rubber policeman and passed through glass Pasteur pipettes
10 times. The cells were then fixed in 1% glutaraldehyde and pictures were
taken under an Olympus IX70 inverted microscope equipped with a
CoolSnap-Pro color digital camera (Roper Scientific). The extent of cell
dissociation was represented by the ratio of the number of particles (N p)
over the number of cells (N c; N p/N c). The values of N p/N c were calculated
by analyzing at least 150 cells from each sample.
11065
Cancer Res 2007; 67: (22). November 15, 2007
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2007 American Association for Cancer
Research.
Cancer Research
E-cadherin promoter reporter assay. Serial deletions of the regulatory
sequences of the human E-cadherin gene were constructed and attached
with pGL3 luciferase reporter plasmid (28). These constructs or control
vector were transfected into wild-type or KCC3-overexpressed SiHa cells.
The cells were transfected in six-well plastic dishes using LipofectAMINE
2000 (Invitrogen). Reporter assays were determined using the DualLuciferase Reporter Assay System (Promega). At 48 h after transfection,
the cells were lysed and the soluble fraction was used for luciferase assays
following the manufacturer’s instructions. The luciferase activities were
expressed as folds over that of the control vector.
Immunoblotting, immunofluorescence, and immunoprecipitation.
For Western immunoblotting, cells were harvested with ice-cold protein
lysis solution containing a protease inhibitor mixture (Roche Diagnostics),
100 mmol/L KCl, 80 mmol/L NaF, 10 mmol/L EGTA, 50 mmol/L
h-glycerophosphate, 10 mmol/L p-nitrophenyl phosphate, 1 mmol/L
vanadate, 0.5% sodium deoxycholate, and 1% NP40. Protein concentrations
were determined with the use of a Bio-Rad protein assay. Equal protein
loads (50 Ag in each column) were separated by 7.5% SDS-PAGE, and then
transferred to polyvinylidene difluoride membranes (Stratagene). The
primary antibodies used were monoclonal anti–E-cadherin (BD Transduction Laboratories, 1:3,000 for immunoblotting; 1:150 for immunofluorescence), monoclonal anti-tubulin (BD Transduction Laboratories, 1:5,000 for
immunoblotting), polyclonal anti–h-catenin (Cell Signaling Technology,
1:3,000 for immunoblotting; 1:150 for immunofluorescence), polyclonal
anti–a-catenin (Santa Cruz Biotechnology, 1:5,000 for immunoblotting),
polyclonal anti–g-catenin (Santa Cruz Biotechnology, 1:5,000 for immunoblotting), monoclonal anti-vimentin (BD Transduction Laboratories, 1:150
for immunofluorescence), and monoclonal anti–a-actin (BD Transduction
Laboratories, 1:5,000 for immunoblotting). KCC3 antibody was kindly
provided by Dr. David B. Mount (Harvard Medical School, Boston, MA).
The horseradish peroxidase–conjugated secondary antibody against mouse
source (BD Transduction Laboratories, 1:5,000 for immunoblotting), rabbit
source (BD Transduction Laboratories, 1:5,000 for immunoblotting), or
goat source (Santa Cruz Biotechnology, 1:2,000 for immunoblotting) was
purchased. The antibodies against KCC1 (1:1,000 for immunoblotting) and
KCC4 (1:1000 for immunoblotting) were purchased from Santa Cruz
Biotechnology and Chemicon, respectively. For immunofluorescent staining,
the fixed cells were permeabilized with 0.05% Triton X-100 in PBS at room
temperature for 20 min. These cells were blocked with commercial blocking
serum (Vector Laboratories) and incubated with primary antibody at 4jC
overnight, washed, and then incubated with fluorescence-conjugated
secondary antibody for 1 h at room temperature. After that, cells were
washed and mounted, and examined by a scanning confocal microscope
(FV-1000, Olympus). For immunoprecipitation, agarose-conjugated antibody
was prepared by adding 50 AL of protein G-agarose bead (Amersham
Biosciences) slurry to 3 Ag of antibody. Immunoprecipitation was done by
adding cell lysates (1 mg/sample) to the agarose-conjugated antibody
complex and incubating at 4jC for 1 h to overnight on a rotator. After
extensive washing with radioimmunoprecipitation assay lysis buffer,
samples were resuspended in reducing sample buffer, boiled for 3 min,
centrifuged to pellet the agarose beads, and subjected to immunoblotting.
Statistics. All values were reported as mean F SE. Student’s paired or
unpaired t test was used for statistical analyses. Differences between values
were considered significant when P < 0.05.
Results
KCC activity regulates E-cadherin/B-catenin complex formation in cell-cell junctions. First, we investigated whether KCC
activity is involved in the regulation of EMT. In cervical cancer
SiHa cells, KCC activity was quiescent in the isotonic solution
and significantly increased under hypotonic conditions (Fig. 1A).
The hypotonicity-activated KCC activity was almost abolished by
50 Amol/L [(dihydroindenyl)oxy]alkanoic acid (DIOA). N-ethylmaleimide potently activated KCC activity, which was also inhibited by 50 Amol/L DIOA. These data indicate that DIOA is a
Cancer Res 2007; 67: (22). November 15, 2007
potent KCC inhibitor. Blockade of KCC activity by 50 Amol/L DIOA
increased both E-cadherin and h-catenin abundances in a timedependent manner (Fig. 1B). The immunofluorescent images of
two different cervical cancer cell lines show that E-cadherin and
h-catenin colocalized in the cell-cell junctions, which became more
obvious upon the inhibition of KCC activity (Fig. 1C and D).
KCC3 is the most abundant KCC isoform in tumor tissues.
To address the roles of individual KCC isoforms in tumor biology,
we analyzed the expression levels of KCC isoforms in the surgical
specimens of cervical carcinoma. The laser microdissection with
microscopic observation was used to precisely sample the targeted
tissues (Fig. 2A). Compared with normal or noncancerous
squamous epithelia, mRNA levels of KCC3 and KCC4 were
significantly increased 25-fold and 14-fold in the primary cervical
carcinoma (n = 12), respectively (Fig. 2A). In addition, the
expression level of KCC3 mRNA in tumor tissues was closely
correlated with tumor size (Supplementary Fig. S1; R 2 = 0.86), an
important indicator of human cervical carcinoma progression
in vivo (23). This is consistent with our previous study showing that
KCC3 may play an important role in cell growth regulation (8).
Increased KCC3 abundance induces EMT. To study KCCmediated tumor behavior, we established various clones of cervical
cancer SiHa cell lines with KCC1, KCC3, or KCC4 overexpression.
The parental SiHa cells exhibited well-organized cell-cell association and islet-like structure, which are the characteristics of
squamous cell carcinoma (Fig. 2B). Overexpression of KCC1 or
KCC4 did not change cell morphology or induce cell scattering. In
striking contrast, KCC3 overexpression was accompanied by the
elongation of cell shape and increased scattering, similar to the
morphology of mesenchymal cells (Fig. 2B). To detect if EMT
occurs in KCC3-overexpressed cells, we studied the possible
alterations of molecular markers. As shown in Fig. 2C, KCC3
overexpression decreased the abundance of epithelial markers such
as E-cadherin and h-catenin in a cell density–independent manner.
The abundance of vimentin, a mesenchymal marker, was
simultaneously increased (Fig. 2D). These results indicate that
KCC3 overexpression is accompanied by the loss of epithelial
markers and the gain of mesenchymal marker.
Increased KCC3 abundance enhances cellular functions. We
then tested if the cellular functions of cancer cells benefit from
KCC3 overexpression. The immunoblots showed that KCC3
overexpression did not change the protein levels of other KCC
isoforms in cervical cancer SiHa cells (Supplementary Fig. S2A).
There is no significant difference in cell size between parental wildtype and KCC3-overexpressed cells (Supplementary Fig. S2B). As
expected, KCC3-overexpressed cells exhibited a better capability of
regulatory volume decrease than did parental wild-type cells
(Supplementary Fig. S2C). In addition, the proliferation (Supplementary Fig. S2D), migration (Fig. 3A), and invasiveness (Fig. 3B) of
cervical cancer SiHa cells were markedly enhanced by KCC3
overexpression.
E-cadherin and h-catenin could form a complex in cell-cell
junctional area, which provides the strength for cell-cell association
(29). The abundances of E-cadherin and h-catenin were decreased
by KCC3 overexpression (Fig. 2C and D). We then tested whether
the physiologic functions of both proteins are affected by
KCC3 overexpression. The cell lysate was immunoprecipitated by
E-cadherin antibody and then immunoblotted by E-cadherin or
h-catenin antibody, respectively, to analyze E-cadherin/h-catenin
complex formation. The protein amount of E-cadherin in KCC3overexpressed SiHa cells was significantly decreased (Fig. 3C, right).
11066
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2007 American Association for Cancer
Research.
Role of KCC3 in EMT Regulation
Figure 1. KCC activity regulates E-cadherin/h-catenin complex formation in the cell-cell junctions. A, DIOA is a potent inhibitor of KCC activity. KCC activity is activated
by hypotonic solution and 0.5 mmol/L N -ethylmaleimide (NEM ) stimulation in cervical cancer SiHa cell line. The hypotonicity- or N -ethylmaleimide–activated
KCC activity is almost abolished by 50 Amol/L DIOA. Columns, mean (n = 6); bars, SE. B, blockade of KCC activity by DIOA increases the protein abundances of
E-cadherin and h-catenin. Cervical cancer SiHa cell line was incubated in the absence (control group) or presence of KCC inhibitor DIOA (50 Amol/L). Top, a
representative immunoblot of three independent experiments. Bottom, the quantitative analysis of the protein levels of E-cadherin and h-catenin in various conditions.
The protein expression level in cells without drug treatment is used as the control and others are expressed as the relative of control. Columns, mean (n = 3); bars, SE.
*, P < 0.05; **, P < 0.01. C and D, blockade of KCC activity increases E-cadherin/h-catenin complex formation in the cell-cell junctions. Cervical cancer SiHa and
CaSki cell lines were incubated in the absence (control group) or presence of 50 Amol/L DIOA for 2 d. Cells were then triple-stained with E-cadherin (green ),
h-catenin (red), and nucleus (Hoechst33258, blue ). The image is a representative of four different experiments. Bar , 20 Am.
The abundance of E-cadherin–associated h-catenin was remarkably decreased in KCC3-overexpressed SiHa cells (Fig. 3C, left),
indicating that E-cadherin/h-catenin complex formation was
reduced. Consistent with the disorganization of h-catenin and
E-cadherin, KCC3 overexpression weakened the cell-cell association (Fig. 3D).
Mechanisms controlling E-cadherin and B-catenin expression in KCC3-overexpressed cells. As shown in Fig. 4A, KCC3
overexpression decreased mRNA expression level of E-cadherin but
did not affect that of h-catenin, compared with wild-type cells. The
promoter activity of E-cadherin gene was further examined. We
have previously studied the structure and functions of human
E-cadherin gene regulatory sequences (28). Serial deletions of the
regulatory sequences of human E-cadherin gene were constructed
and attached with pGL3 luciferase reporter plasmid (Fig. 4B, left).
These constructs and control vector were transfected into wildtype or KCC3-overexpressed SiHa cells. The luciferase activities
were measured and expressed as folds over that of the control
www.aacrjournals.org
vector. These different constructs displayed differential reporter
activities in wild-type SiHa cells, which were similar to our previous
study in breast cancer cell lines (28). The reporter activities of these
constructs were all significantly decreased in KCC3-overexpressed
cells (Fig. 4B, right). This implies that KCC3 expression is likely a
potent negative regulation for human E-cadherin gene expression.
Recent studies have shown that h-catenin was translocated into
nucleus or degraded through proteosome-mediated pathway while
EMT happened (29). Because there was no obvious nuclear
translocation of h-catenin in KCC3-overexpressed SiHa cells
(Fig. 2D), we studied if KCC3 affects the proteosome-dependent
degradation pathway. The wild-type and KCC3-overexpressed cells
displayed the similar protein abundances of h-catenin after
the treatment of 26S-proteosome–specific inhibitor MG132 for
12 h (Fig. 4C). On the other hand, the decreased abundance of
E-cadherin in KCC3-overexpressed SiHa cells was not affected
by treatment of MG132. The protein levels of h-catenin and
E-cadherin were not affected by the treatment of NH4Cl, an
11067
Cancer Res 2007; 67: (22). November 15, 2007
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2007 American Association for Cancer
Research.
Cancer Research
inhibitor of lysosome-dependent protein degradation pathway
either in wild-type or KCC3-overexpressed SiHa cells (Fig. 4D).
These data indicate that KCC3 down-regulates E-cadherin/
h-catenin complex formation by inhibiting transcription of
E-cadherin gene and accelerating h-catenin protein degradation
through the proteosome-dependent pathway.
Association between KCC3 abundance and E-cadherin/
B-catenin complex in vivo. Studies in cell culture system have
revealed that KCC3 plays an important role in the regulation of
EMT. To evaluate the in vivo condition, we examined the
association of KCC3 expression and EMT in the surgical specimens
of cervical carcinoma by immunofluorescent staining of
E-cadherin, vimentin, and KCC3. In the normal or noncancerous
cervix, vimentin was only present in stromal tissues (Fig. 5A, top).
KCC3 expression was weak in both stromal and normal/
noncancerous squamous epithelial tissues. In striking contrast,
KCC3 protein was abundant in cervical carcinoma. Vimentin
appeared at the invasive front of cervical carcinoma, an area where
squamous cell carcinoma just broke through the basal layers of
squamous epithelia (Fig. 5A, middle). Tumor nest was formed when
cervical carcinoma invaded deeply into stromal tissues, where
KCC3 protein was abundant and vimentin was significantly
expressed at the periphery of tumor nest (Fig. 5A, bottom).
E-cadherin protein was obvious in the normal or noncancerous
cervical squamous epithelial tissues but was absent in the
underlying stromal tissues (Fig. 5B, top). The loss of cell integrity
was noted in the adjacent cervical carcinoma tissues, where the
decreased abundance of E-cadherin was accompanied by the
increased expression of KCC3 protein (Fig. 5B, bottom). To confirm
if there is a cause and effect, KCC3-overexpressed SiHa cells were
treated with KCC inhibitor DIOA and then assayed the expression
of E-cadherin and h-catenin. As shown in Fig. 5C, the decrease in
Figure 2. KCC3 expression is associated with EMT. A, KCC3 is the most abundant KCC isoform in cervical carcinoma. The laser microdissection with microscopic
observation was used to precisely sample the targeted tissues (dashed line ). The mRNA levels of individual KCC isoforms in the surgical specimens were examined by
real-time quantitative RT-PCR and were normalized against GAPDH. The expression level of KCC isoform in normal/noncancerous squamous epithelia was used as the
control. Columns, mean (n = 12); bars, SE. Bar, 10 Am. B, representative morphologies of wild-type, KCC1-, KCC3- or KCC4-overexpressed cervical cancer SiHa
cells. Many fields similar to those in B were observed under four conditions. Bar, 50 Am. C, KCC3 overexpression down-regulates the abundances of h-catenin and
E-cadherin protein. The immunoblot is a representative of three independent experiments. WT, wild-type SiHa cells. KCC3, KCC3-overexpressed SiHa cells. D, KCC3
overexpression induces the morphologic change, down-regulates the protein abundance of h-catenin, and up-regulates the protein abundance of vimentin. Bar, 20 Am.
Cancer Res 2007; 67: (22). November 15, 2007
11068
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2007 American Association for Cancer
Research.
Role of KCC3 in EMT Regulation
Figure 3. Increased KCC3 abundance enhances the invasive migration and cell dissociation. Migration assay (A) and invasion assay (B), compared between wild-type
and KCC3-overexpressed SiHa cells. In the migration assay, 10 Ag/mL fibronectin or vitronectin were used as the chemoattractor. Column, mean from at least
three different experiments; bars, SE. C, E-cadherin/h-catenin complex formation in wild-type and KCC3-overexpressed SiHa cells. IP, immunoprecipitation.
IB, immunoblotting. Positive control, whole-cell lysate from wild-type SiHa cells. MW, molecular weight. The immunoblot is a representative of three independent
experiments. D, cell dissociation in wild-type and KCC3-overexpressed SiHa cells. The degree of cell dissociation (the number of particles/the number of total cells) was
calculated by analyzing at least 150 cells from each sample. Columns, mean (n = 3); bars, SE.
both E-cadherin and h-catenin in KCC3-overexpressed cells was
rescued by DIOA treatment. These results suggested that the
association between KCC3 abundance and E-cadherin/h-catenin
complex exists both in vitro and in vivo.
Discussion
EMT is a key event occurring in the normal development and
pathologic processes during which epithelial cells assume a
mesenchymal phenotype. EMT may play a gatekeeper role and
regulate the frequency of cancer invasiveness and metastasis (30).
Although multiple extracellular stimuli and transcriptional regulators can trigger EMT, this study is the first report to show that a
cellular ion transport system, KCC3, regulates EMT to promote
tumor progression. Here, we show the following findings: (a) The
characteristics of EMT appear in the KCC3-overexpressed tumor
www.aacrjournals.org
cells, including the elongation of cell shape, increased scattering,
down-regulation of epithelial markers (E-cadherin and h-catenin),
and up-regulation of a mesenchymal marker (vimentin). (b)
Blockade of KCC activity in wild-type and KCC3-overexpressed
tumor cells is accompanied by the increased abundances of
E-cadherin and h-catenin in cell-cell junctions. The cellular KCC
activity is mediated largely from KCC3 (3, 6, 31). Therefore, we
suggest that there is a tight link between the expression and
activity of KCC3 and EMT in cervical cancer cells.
E-cadherin plays a critical role in establishing cell polarity and in
maintaining normal tissue morphology (32, 33). Down-regulation
or loss of E-cadherin has been implicated in the gain of invasive
potential by carcinomas (34–37). h-Catenin also functions as a
component of adherent cell-cell junctions that promote cell
adhesion by binding to the intracellular domain of E-cadherin
and linking E-cadherin to the cytoskeleton through the adaptor
11069
Cancer Res 2007; 67: (22). November 15, 2007
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2007 American Association for Cancer
Research.
Cancer Research
protein a-catenin (38, 39). Several studies have shown that
posttranscriptional regulations, including nuclear translocalization
and protein degradation, are mainly responsible for regulation of
h-catenin while EMT happens (29, 37, 40). The E-cadherin/
h-catenin complex therefore provides the major strength for cellcell association (29). It has been reported that loss of this complex
formation would promote the invasive ability of breast cancer cells
due to the decreased cell-cell association (16). Here, we show how
KCC3 orchestrates the E-cadherin/h-catenin complex that facilitates EMT. KCC3 overexpression decreases mRNA expression level
of E-cadherin, compared with that of wild-type tumor cells. We
have previously cloned a 1.2-kb DNA fragment upstream from the
transcription initiation site of the human E-cadherin gene to
understand how human E-cadherin gene expression is regulated
(28). Several transcription factor–binding sites were identified, for
example, three AML1-binding sites, four HNF3-binding sites, and
four snail-binding sites. By using this system of serial deletions of
the regulatory sequences of E-cadherin gene, KCC3 expression
down-regulates the reporter activities of these constructs. Because
KCC3 expression does not change the cell size and control vector
Figure 4. Mechanisms controlling E-cadherin and h-catenin expression in KCC3-overexpressed cells. A, effect of KCC3 overexpression on mRNA levels of E-cadherin
and h-catenin. The mRNA expression level of h-actin is used as the internal control. Representative of five independent experiments. WT, parental wild-type
cervical cancer SiHa cell line. B, the promoter activities of E-cadherin gene in wild-type and KCC3 overexpressed SiHa cells. Left, serial deletions of the regulatory
sequences of human E-cadherin gene were constructed and attached with pGL3 luciferase reporter plasmid. There are several interacting transcription factors in
the human E-cadherin promoter, for example, three AML1-binding sites, four HNF3-binding sites, and four snail-binding sites. Right, the luciferase activities were
measured and expressed as folds over that of the control vector. Columns, mean (n = 4); bars, SE. C, effect of a 26S-proteosome inhibitor on the protein abundances
of E-cadherin and h-catenin. Wild-type and KCC3-overexpressed SiHa cells were treated with or without the 26S-proteosome inhibitor (20 Amol/L MG132) for
12 h. Top, a representative immunoblot. Bottom, the quantitative analysis of the protein levels of E-cadherin and h-catenin in various conditions. The protein expression
level in wild-type SiHa cells without drug treatment is used as the control and others are expressed as the relative of control. Columns, mean (n = 3); bars, SE.
N.S., nonsignificance. D, effect of a lysosome inhibitor on the protein abundances of E-cadherin and h-catenin. Wild-type and KCC3-overexpressed SiHa cells
were treated with or without the lysosome inhibitor (20 or 40 Amol/L NH4Cl) for 12 h. Top, a representative immunoblot. Bottom, quantitative analysis of the protein
levels of E-cadherin and h-catenin in various conditions. The protein expression level in wild-type SiHa cells without drug treatment is used as the control and others
are expressed as the relative of control. Columns, mean (n = 3); bars, SE.
Cancer Res 2007; 67: (22). November 15, 2007
11070
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2007 American Association for Cancer
Research.
Role of KCC3 in EMT Regulation
has been used as a negative control, the results of luciferase assays
are the promoter-specific effects rather than artifacts of cell
shrinkage. We therefore conclude that KCC3 expression is likely a
potent negative regulation for human E-cadherin gene expression.
However, neither proteosome inhibitor nor lysosome inhibitor
change the protein abundance of E-cadherin in wild-type and
KCC3-overexpressed tumor cells. On the other hand, KCC3 overexpression decreases h-catenin abundance by posttranslational
modification. The proteosome inhibitor, but not the lysosome
inhibitor, restores the decreased protein abundance of h-catenin by
KCC3 overexpression. Thus, KCC3 down-regulates E-cadherin/
h-catenin complex formation by inhibiting transcription of
E-cadherin gene and accelerating proteosome-dependent degradation of h-catenin protein.
KCC3 is the most abundant KCC isoform in tumor tissues,
detected by laser microdissection. KCC3 overexpression enhances
cervical cancer cell proliferation in vitro. In the surgical specimens,
the tumor size of cervical carcinoma, an indicator of tumor growth
in vivo, correlates well with KCC3 expression level in tumor tissues.
This is consistent with our previous work demonstrating a close
link between the expression and activity of KCC3 and cell growth
by a NIH/3T3 fibroblast expression system (8). In the NIH/3T3
Figure 5. The association between KCC3
expression and EMT in cervical carcinoma.
A, the association of vimentin and KCC
abundance in vivo . The surgical specimens
of cervical carcinoma (n = 12) were
triple-stained with vimentin (green ), KCC3
(red), and nucleus (Hoechst33258, blue ).
Top, normal or noncancerous cervix.
Dashed line, the basal layer of squamous
epithelia. Middle, invasive front of cervical
carcinoma. Arrow, invasive front. Bottom,
tumor nest in the deeper stromal tissue.
The images are taken from the same
patient. Bar, 40 Am. B, the association
of E-cadherin and KCC abundance in vivo .
The surgical specimens of cervical
carcinoma (n = 12) were triple-stained with
E-cadherin (green ), KCC3 (red), and
nucleus (Hoechst33258, blue ). Top, normal
or noncancerous cervix. Bottom, cervical
carcinoma tissues. The images were taken
from the same patient. Dashed line, the
basal layer of squamous epithelia. Bar,
40 Am. C, blockade of KCC activity
increases the abundances of E-cadherin
and h-catenin. Different clones of
KCC3-overexpressed cervical cancer SiHa
cells were cultured in the absence
(control group) or in the presence of KCC
inhibitor DIOA (50 Amol/L). The immunoblot
is a representative of three independent
experiments. C, control group.
www.aacrjournals.org
11071
Cancer Res 2007; 67: (22). November 15, 2007
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2007 American Association for Cancer
Research.
Cancer Research
Figure 6. KCl cotransporter KCC3 down-regulates E-cadherin/h-catenin
complex formation to promote EMT that is important for cervical cancer cell
invasiveness. The KCC3 activity and expression are sensitive to the stimulation
of oncogenic growth factors such as IGF-I and VEGF in cervical cancer cells,
ovarian cancer cells, and breast cancer cells. The expression and activity of
KCC3 affect E-cadherin and h-catenin abundances by inhibiting transcription
of E-cadherin gene and accelerating proteosome-dependent degradation of
h-catenin protein. The disruption of E-cadherin/h-catenin complex formation
causes the dysfunction of cell-cell junction system, thereby triggering cancer
invasive migration and proliferation.
fibroblast expression system, KCC3 activity is important for cell
cycle progression, thereby regulating cell growth. Our study also
shows that KCC3 overexpression is accompanied by the enhanced
capability of regulatory volume decrease, increased cellular
invasive migration, and decreased cell-cell association. We
previously showed that the invasive migration and proliferation
of cancer cells require shape and/or volume changes (10). KCC3
plays a dominant role in cell volume regulation (7) and may
contribute to such shape-volume changes by mediating net salt
fluxes across cell membranes (11). These data suggest that up-
Cancer Res 2007; 67: (22). November 15, 2007
regulation of KCC3 expression in the tumor tissues enhances the
malignant behaviors of tumor tissues.
The literature on the important role of EMT in human cervical
carcinogenesis is scarce. Here, we show the association between
KCC3 abundance and EMT in cervical carcinoma. Studies in
cervical cancer cell lines indicate that KCC3 plays an important
role in the regulation of EMT. To evaluate the in vivo condition,
we examined the association of KCC3 expression and EMT
molecular markers in the surgical specimens of cervical carcinoma.
E-cadherin protein was abundant in the normal or noncancerous
squamous epithelia of the portio of the cervix, where KCC3 protein
level is scanty. The loss of cell integrity was noted in the adjacent
cervical carcinoma tissues, where the decreased abundance of
E-cadherin was accompanied by the increased expression of KCC3
protein. Vimentin, the mesenchymal marker, was only present in
stromal tissues. Interestingly, it appeared at the invasive front of
cervical carcinoma, an area where squamous cell carcinoma just
invaded the basal layers of squamous epithelia. The abundance of
vimentin became better visible at the periphery of tumor nest, an
area where cervical carcinoma invaded deeply into stromal tissues
of tumor nest. Moreover, the decrease in both E-cadherin and
h-catenin in KCC3-overexpressed cells was rescued by KCC3
inhibitor, DIOA. This suggests that there is a cause and effect
between KCC3 expression and EMT.
The KCC3 activity and expression are sensitive to the
stimulation of oncogenic growth factors such IGF-I and vascular
endothelial growth factor (VEGF) in cervical cancer cells, ovarian
cancer cells, breast cancer cells, and endothelial cells (12, 13, 41).
This and our previous study (8) suggest that KCC3 may play an
important role in the regulation of cell growth. In addition, KCC3
expression enhances the cell capability of regulatory volume
decrease. KCC3 also down-regulates E-cadherin/h-catenin complex
formation in the cell-cell junction. More importantly, KCC3
expression stimulates cell invasive migration. The close linkage of
KCC3 abundance, cell proliferation, invasiveness, and EMT suggests
the possibility that expression and activity of KCC 3 may serve as a
selective advantage for cancer cells in malignant behaviors. Further
work will be required to determine whether these changes reflect
KCC3-associated changes in intracellular Cl concentration or
intracellular K+ concentration or other yet-to-be determined
functions of KCC3 perhaps not directly related to ion transport.
Taken together, the results of cell culture systems and surgical
specimens, and the regulatory mechanisms of KCC3 on EMT, can
be summarized as follows (Fig. 6). The expression and activity of
KCC3 affect E-cadherin and h-catenin abundances by inhibiting
transcription of E-cadherin gene and accelerating proteosomedependent degradation of h-catenin protein. The disruption of
E-cadherin/h-catenin complex formation causes the dysfunction of
cell-cell junction system, thereby triggering cancer invasion and
metastasis. Therefore, blockade of KCC3 activity or expression may
provide a potential target for the treatment of tumor progression.
Acknowledgments
Received 6/29/2007; revised 8/20/2007; accepted 9/12/2007.
Grant support: Center of Excellence for Clinical Trial and Research (DOH-TDB-111-004), Department of Health, Executive Yuan, Taiwan; National Science Council,
Taiwan (NSC 96-2314-B-006-001; M-R. Shen); National Health Research Institutes
grants NHRI-EX94-9311BS (M-R. Shen) and NHRI-EX94-9422BI (C.Y. Chen); and Center
for Gene Regulation and Signal Transduction Research, National Cheng Kung
University, Taiwan.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
11072
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2007 American Association for Cancer
Research.
Role of KCC3 in EMT Regulation
References
1. Adragna NC, Fulvio MD, Lauf PK. Regulation of K-Cl
cotransport: from function to genes. J Membr Biol 2004;
201:109–37.
2. Ellory JC, Gibson JS, Stewart GW. Pathophysiology of
abnormal cell volume in human red cells. Contrib
Nephrol 1998;123:220–39.
3. Mercado A, Song L, Vazquez N, Mount DB, Gamba G.
Functional comparison of the K+-Cl cotransporters
KCC1 and KCC4. J Biol Chem 2000;275:30326–34.
4. Hubner CA, Stein V, Hermans-Borgmeyer I, Meyer T,
Ballanyi K, Jentsch TJ. Disruption of KCC2 reveals an
essential role of K-Cl cotransport already in early
synaptic inhibition. Neuron 2001;30:515–24.
5. Song L, Mercado A, Vazquez N, et al. Molecular,
functional, and genomic characterization of human
KCC2, the neuronal K-Cl cotransporter. Brain Res Mol
Brain Res 2002;103:91–105.
6. Rust MB, Alper SL, Rudhard Y, et al. Disruption of
erythroid K-Cl cotransporters alters erythrocyte volume
and partially rescues erythrocyte dehydration in SAD
mice. J Clin Invest 2007;117:1708–17.
7. Boettger T, Rust MB, Maier H, et al. Loss of K-Cl cotransporter KCC3 causes deafness, neurodegeneration
and reduced seizure threshold. EMBO J 2003;22:5422–34.
8. Shen MR, Chou CY, Hsu KF, et al. The KCl
cotransporter isoform KCC3 can play an important role
in cell growth regulation. Proc Natl Acad Sci U S A 2001;
98:14714–9.
9. Boettger T, Hubner CA, Maier H, Rust MB, Beck FX,
Jentsch TJ. Deafness and renal tubular acidosis in mice
lacking the K-Cl co-transporter KCC4. Nature 2002;416:
874–8.
10. Shen MR, Chou CY, Hsu KF, et al. KCl cotransport is
an important modulator of human cervical cancer
growth and invasion. J Biol Chem 2003;278:39941–50.
11. Shen MR, Chou CY, Ellory JC. Volume-sensitive KCl
cotransport associated with human cervical carcinogenesis. Pflugers Archiv 2000;440:751–60.
12. Shen MR, Lin AC, Hsu YM, et al. Insulin-like growth
factor 1 stimulates KCl cotransport, which is necessary
for invasion and proliferation of cervical cancer and
ovarian cancer cells. J Biol Chem 2004;279:40017–25.
13. Hsu YM, Chou CY, Chen HH, et al. IGF-1 upregulates
electroneutral K-Cl cotransporter KCC3 and KCC4
which are differentially required for breast cancer cell
proliferation and invasiveness. J Cell Physiol 2007;210:
626–36.
14. Lee JM, Dedhar S, Kalluri R, Thompson EW. The
epithelial-mesenchymal transition: new insights in
www.aacrjournals.org
signaling, development, and disease. J Cell Biol 2006;
172:973–81.
15. Thiery JP, Sleeman JP. Complex networks orchestrate
epithelial-mesenchymal transitions. Nat Rev Mol Cell
Biol 2006;7:131–42.
16. Spaderna S, Schmalhofer O, Hlubek F, et al. A
transient, EMT-linked loss of basement membranes
indicates metastasis and poor survival in colorectal
cancer. Gastroenterology 2006;131:830–40.
17. Yang J, Mani SA, Donaher JL, et al. Twist, a master
regulator of morphogenesis, plays an essential role in
tumor metastasis. Cell 2004;117:927–39.
18. Keshamouni VG, Michailidis G, Grasso CS, et al.
Differential protein expression profiling by iTRAQ2DLC-MS/MS of lung cancer cells undergoing epithelial-mesenchymal transition reveals a migratory/invasive
phenotype. J Proteome Res 2006;5:1143–54.
19. Thomson S, Buck E, Petti F, et al. Epithelial to
mesenchymal transition is a determinant of sensitivity
of non-small-cell lung carcinoma cell lines and xenografts to epidermal growth factor receptor inhibition.
Cancer Res 2005;65:9455–62.
20. Li Y, Yang J, Dai C, Wu C, Liu Y. Role for integrinlinked kinase in mediating tubular epithelial to mesenchymal transition and renal interstitial fibrogenesis.
J Clin Invest 2003;112:503–16.
21. Kim KK, Kugler MC, Wolters PJ, et al. Alveolar
epithelial cell mesenchymal transition develops in vivo
during pulmonary fibrosis and is regulated by the
extracellular matrix. Proc Natl Acad Sci U S A 2006;103:
13180–5.
22. Casula S, Shmukler BE, Wilhelm S, et al. A dominant
negative mutant of the KCC1 K-Cl cotransporter: both
N- and C-terminal cytoplasmic domains are required for
K-Cl cotransport activity. J Biol Chem 2001;276:41870–8.
23. Chou CY, Hsu KF, Wang ST, Huang SC, Tzeng CC,
Huang KE. Accuracy of three-dimensional ultrasonography in volume estimation of cervical carcinoma.
Gynecol Oncol 1997;66:89–93.
24. Shen MR, Chou CY, Hsu KF, Ellory JC. Osmotic
shrinkage of human cervical cancer cells induces an
extracellular Cl- dependent nonselective cation channel, which requires p38 MAPK. J Biol Chem 2002;277:
45776–84.
25. Albini A, Allavena G, Melchiori A, et al. Chemotaxis of
3T3 and SV3T3 cells to fibronectin is mediated through
the cell-attachment site in fibronectin and a fibronectin
cell surface receptor. J Cell Biol 1987;105:1867–72.
26. Chen HC. Boyden chamber migration assay. Methods
Mol Biol 2005;294:15–22.
11073
27. Gkretsi V, Zhang Y, Tu Y, et al. Physical and
functional association of migfilin with cell-cell adhesions. J Cell Sci 2005;118:697–710.
28. Liu YN, Lee WW, Wang CY, Chao TH, Chen Y, Chen
JH. Regulatory mechanisms controlling human Ecadherin gene expression. Oncogene 2005;24:8277–90.
29. Behrens J. Cadherins and catenins: role in signal
transduction and tumor progression. Cancer Metastasis
Rev 1999;18:15–30.
30. Xue C, Plieth D, Venkov C, Xu C, Neilson EG. The
gatekeeper effect of epithelial-mesenchymal transition
regulates the frequency of breast cancer metastasis.
Cancer Res 2003;63:3386–94.
31. Mercado A, Vazquez N, Song L, et al. NH2-terminal
heterogeneity in the KCC3 K+-Cl cotransporter. Am J
Physiol Renal Physiol 2005;289:1246–61.
32. Birchmeier W, Behrens J. Cadherin expression in
carcinomas: role in the formation of cell junctions and
the prevention of invasiveness. Biochim Biophys Acta
1994;1198:11–26.
33. Berx G, Cleton-Jansen AM, Nollet F, et al. E-cadherin
is a tumour/invasion suppressor gene mutated in
human lobular breast cancers. EMBO J 1995;14:6107–15.
34. Wu W, Walker AM. Human chorionic gonadotropin h
(HCGh) down-regulates E-cadherin and promotes
human prostate carcinoma cell migration and invasion.
Cancer 2006;106:68–78.
35. Comijn J, Berx G, Vermassen P, et al. The two-handed
E box binding zinc finger protein SIP1 downregulates Ecadherin and induces invasion. Mol Cell 2001;7:1267–78.
36. Takao S, Che X, Fukudome T, Natsugoe S, Ozawa M,
Aikou T. Down-regulation of E-cadherin by antisense
oligonucleotide enhances basement membrane invasion
of pancreatic carcinoma cells. Hum Cell 2000;13:15–21.
37. Zheng Z, Pan J, Chu B, Wong YC, Cheung AL, Tsao
SW. Downregulation and abnormal expression of
E-cadherin and h-catenin in nasopharyngeal carcinoma:
close association with advanced disease stage and
lymph node metastasis. Hum Pathol 1999;30:458–66.
38. Jamora C, Fuchs E. Intercellular adhesion, signalling
and the cytoskeleton. Nat Cell Biol 2002;4:101–8.
39. Gumbiner BM. Regulation of cadherin adhesive
activity. J Cell Biol 2000;148:399–404.
40. Savagner P. Leaving the neighborhood: molecular
mechanisms involved during epithelial-mesenchymal
transition. Bioessays 2001;23:912–23.
41. Hiki K, D’A ndrea RJ, Furze J, et al. Cloning,
characterization, and chromosomal location of a novel
human K+-Cl cotransporter. J Biol Chem 1999;274:
10661–7.
Cancer Res 2007; 67: (22). November 15, 2007
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2007 American Association for Cancer
Research.
KCl Cotransporter-3 Down-regulates E-Cadherin/β-Catenin
Complex to Promote Epithelial-Mesenchymal Transition
Yueh-Mei Hsu, Yih-Fung Chen, Cheng-Yang Chou, et al.
Cancer Res 2007;67:11064-11073.
Updated version
Supplementary
Material
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/67/22/11064
Access the most recent supplemental material at:
http://cancerres.aacrjournals.org/content/suppl/2007/11/12/67.22.11064.DC1
This article cites 41 articles, 15 of which you can access for free at:
http://cancerres.aacrjournals.org/content/67/22/11064.full.html#ref-list-1
This article has been cited by 10 HighWire-hosted articles. Access the articles at:
/content/67/22/11064.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2007 American Association for Cancer
Research.