© 2001 Oxford University Press
Nucleic Acids Research, 2001, Vol. 29, No. 17 e89
Linear 2′ O-Methyl RNA probes for the visualization of
RNA in living cells
C. Molenaar*, S. A. Marras1, J. C. M. Slats, J.-C. Truffert2, M. Lemaître2, A. K. Raap,
R. W. Dirks and H. J. Tanke
Department of Molecular Cell Biology, Wassenaarseweg 72, 2333 AL Leiden, The Netherlands, 1Department of
Molecular Genetics, Public Health Research Institute, 455 First Avenue, New York, NY 10016, USA and
2Eurogentec s.a. Parc Scientifique du Sart Tilman, 4102 Seraing, Belgium
Received May 16, 2001; Revised and Accepted July 16, 2001
ABSTRACT
U1snRNA, U3snRNA, 28 S ribosomal RNA, poly(A)
RNA and a specific messenger RNA were visualized
in living cells with microinjected fluorochromelabeled 2′ O-Methyl oligoribonucleotides (2′ OMe RNA).
Antisense 2′ OMe RNA probes showed fast hybridization kinetics, whereas conventional oligodeoxyribonucleotide (DNA) probes did not. The nuclear
distributions of the signals in living cells were similar
to those found in fixed cells, indicating specific
hybridization. Cytoplasmic ribosomal RNA, poly(A)
RNA and mRNA could hardly be visualized, mainly
due to a rapid entrapment of the injected probes in
the nucleus. The performance of linear probes was
compared with that of molecular beacons, which due
to their structure should theoretically fluoresce only
upon hybridization. No improvements were achieved
however with the molecular beacons used in this
study, suggesting opening of the beacons by mechanisms other than hybridization. The results show that
linear 2′ OMe RNA probes are well suited for RNA
detection in living cells, and that these probes can be
applied for dynamic studies of highly abundant
nuclear RNA. Furthermore, it proved feasible to
combine RNA detection with that of green fluorescent protein-labeled proteins in living cells. This was
applied to show co-localization of RNA with proteins
and should enable RNA–protein interaction studies.
INTRODUCTION
The eukaryotic cell nucleus is highly organized to tightly
control and coordinate gene expression. This picture has
emerged from fluorescence in situ hybridization and immunocytochemical studies, showing that chromosomes occupy
distinct territories within the nucleus and that many of the
nuclear factors that play a role in transcription and RNA
processing are compartmentalized in nuclear bodies, as
reviewed by Lamond and Earnshaw (1). The chromosome
territories contain regions in which the degree of chromatin
condensation varies. Transcriptionally active genes have been
shown to be located at the borders of the condensed chromatin
regions to have access to the transcription, RNA processing
and transport machinery (2,3). Nuclear bodies, like coiled
bodies, PML bodies and speckles may then serve as preassembly sites of the components of this machinery or as
storage sites from which factors are recruited to active genes
(4,5). Alternatively, or additionally, transcription and RNA
processing complexes may be functional at these sites (6).
To relate the spatial organization of nuclear components to
functional activities the dynamic behaviors of DNA, RNA and
proteins need to be studied in living cells. Various strategies
for in vivo labeling of DNA, RNA and proteins have been
proposed. DNA can be labeled by the transient incorporation
of fluorescent nucleotides during replication, which results in a
partial labeling of chromatin in successive cell generations (7).
Proteins can be tagged with the spectral variants of the green
fluorescent protein (GFP) and their dynamic behavior can be
analyzed by time-lapse experiments and by fluorescence redistribution after photo bleaching (FRAP) (8,9). More recently,
Tsukamoto et al. (6) described a system to visualize a gene and
its protein product in living cells. To detect the various RNA
classes in living cells, several approaches have been developed
(reviewed in 10–13). Ainger et al. (14) injected in vitro transcribed fluorescent RNAs, which act as duplicates of endogenous RNAs, and studied their localization upon delivery into
cells. As an alternative, mRNA was visualized using GFP as a
fluorescent tag on the RNA-loop binding protein MS2 (15–17).
In addition to these two methods, in vivo hybridization
methods were used that are based on the annealing of short
antisense fluorescent probes to specific cellular RNAs. In most
studies, short linear DNA oligonucleotides (20–40 bases) were
used (18–21). As an alternative, Carmo-Fonseca et al. (22)
described the use of 2′ O-Methyl (2′ OMe) RNA and 2′ O-allyl
RNA probes for the detection of small nuclear RNAs. 2′ OMe
RNA probes were considered to perform better then DNA
oligonucleotides because they are not only nuclease resistant,
but also possess a higher affinity, increased specificity, faster
hybridization kinetics and a superior ability to bind to structured targets compared to DNA oligonucleotides (23,24).
Recently, so-called molecular beacons were introduced for
RNA detection in living cells (19,25). Molecular beacons are
hairpin-shaped oligonucleotide probes that fluoresce only
upon hybridization (26,27). The rationale for using molecular
beacons to detect RNAs in living cells was to improve
*To whom correspondence should be addressed. Tel: +31 71 527 6278; Fax: +31 71 527 6180; Email: [email protected]
e89 Nucleic Acids Research, 2001, Vol. 29, No. 17
PAGE 2 OF 9
Table 1. Probe sequences
RNA target
Design
Sequence
GenBank ID
Nucleotide
positions
U1 snRNA
linear probea
(c)cugccagguaaguau(g)
340085
1–17
MB probe
gcgac cugccagguaaguau gucgc
U3 snRNA
Linear probea
(c)ggcuucacgcucagg(a)
2736114
205–221
MB probe
(c/g)cgacggcuucacgcucagggucg(c/g)
337381
2321–2337
28S rRNA
Linear probe 17 bp
Linear probe 35
Poly(U)
Poly(A)
CMV1
CMV2
CMV3
CMV4
CMV5
bpb
uaccaccaagaucugca
gaatatttgctactaccaccaagatctgcacctgc
MB probe
gcgacuaccaccaagaucugcagucgc
Linear probes
(u)18(u)22(t)40b
MB probes
gucgac(u)18gucgac;cgucgac(u)22gucgacg
2316–2350
Linear probe
(a)18
MB probe
gucgac(a)18gucgac
Linear probe
aaacauccucccauca
330617
MB probe
cgcacaaacauccucccaucagucag
(exon 4)
Linear probe
caucuccucgaaaggcu
MB probe
cgcacaucuccucgaaaggcugugcg
119–134
169–186
Linear probe
acaucaugcagcuccuu
MB probe
ccagacaucaugcagcuccuucugg
271–287
Linear probe
gagcacugaggcaaguuc
MB probe
ccagggagcacugaggcaaguucccugg
465–482
Linear probe
ugugaucaaugugcguga
MB probe
ccagugugaucaaugugcgugcugg
551–568
aAdditional
bases in longer probes for the same target are indicated within brackets.
linear probes.
All sequences were synthesized as DNA and as 2′ OMe RNA oligonucleotides, except for the longer linear probes that were only used as
DNA probes.
All probes were labeled with TAMRA; molecular beacons were labeled additionally with DABCYL as quencher.
bLonger
signal-to-noise ratios by eliminating fluorescence signals
derived from non-hybridized probe sequences. In order to come
to a generally applicable technique for the detection of RNAs in
living cells, we systematically evaluated the performance of
linear probes and molecular beacons synthesized both from
DNA and 2′ OMe RNA monomers. The RNA targets detected
were two small nuclear RNAs, U1 snRNA and U3 snRNA,
ribosomal RNA of the 28S ribosomal subunit, poly(A) RNA
and a specific mRNA, the mRNA encoding the human cytomegalovirus immediate early antigen (HCMV IE) in transformed
rat fibroblasts. We demonstrate that of the four probe types
tested, linear 2′ OMe RNA probes are the most suitable for
specific detection of these RNAs, representing different
classes of RNA, in the nuclei of living cells. Under the conditions used, molecular beacons did not result in images with
improved signal to noise ratios, thereby leading to better detection sensitivity.
MATERIALS AND METHODS
Probes
For the various RNA targets described, probes were selected
on the basis of sequences in the NCBI genome database.
Single-stranded regions or partly single-stranded regions in the
secondary RNA structure for U1 snRNA and U3 snRNA (28)
were targeted. They were varied in length, structure and
nucleotide modification. Sequences and GenBank IDs are
listed in Table 1. DNA oligonucleotides were synthesized
using standard phosphoramidite chemistry and purified by
HPLC. 2′ OMe RNA probes were synthesized using standard
2′ OMe phosphoramidite monomers. For linear probes fluorescent dyes were covalently linked to the 5′-end via a succinimidyl
ester derivative (Molecular Probes, Eugene, OR). Molecular
beacons were synthesized automatically with the 3′-4dimethylaminoazobenzene-4′-sulfonyl
(dabcyl)-quencher
linked to the solid phase support (DABCYL-CPG, Glen
Research, Sterling, VA). Oligonucleotide chain elongation was
performed via standard cyanoethyl-phosphoramidite chemistry and fluorophores were covalently linked to the 5′-end via
iodoacetamide (Molecular Probes) or phosphoramidite derivatives (Glen Research) following release from the solid support.
All 2′ OMe RNA probes were purified twice by reverse phase
HPLC with a Waters 600E instrument, equipped with a Waters
996 Photodiode Array Detector for simultaneous detection at
three different wavelengths. Ion-molecular weights of purified
probes were determined by mass spectrometry using a
Nucleic Acids Research, 2001, Vol. 29, No. 17 e89
PAGE 3 OF 9
Dynamo time-of-flight instrument. The initial molecular
beacon probes were designed following the guidelines
described by Tyagi and Kramer (26) (http:\\www.molecularbeacons.org). The intramolecular configuration of molecular
beacons and their target sequences was modeled using the
DNA mfold program (www.ibc.wustl.edu/~zuker/dna/
form1.shtml), which uses thermodynamic parameters established by SantaLucia (26). The molecular beacons did not
contain self-complementary sequences in the loop. Beacons
were equipped with stem sequences of varying length.
Cell culture and microinjection
For microinjection experiments and life cell observation,
U2OS (human osteosarcoma) cells and R9G cells were
cultured on coverslips in 3.5 cm Petri dishes (Mattek, Ashland,
MA) in RPMI 1640, without phenol red supplemented with 5%
fetal calf serum and buffered with 25 mM HEPES buffer to pH 7.2
(Life Technologies, Breda, The Netherlands). R9G is a rat
fibroblast cell line harboring a tandem repeat of 50 copies of
the HCMV IE gene in one of the rat chromosomes (29–31). To
induce the S-phase dependent HCMV IE gene expression,
50 µg/ml cycloheximide (Sigma, St Louis, MO) was added to
the culture medium, 3–4 h prior to injection. The temperature
of the culture medium was kept at 37°C using a heated ring
surrounding the culture chamber and a microscope objective
heater (Bioptechs, Butler, PA). For microinjection, a Narishige
IM 300 microinjector (Narishige, Tokyo, Japan) was used.
Needles with a tip inner diameter of ∼0.5 µm were pulled from
glass capillaries (no. MTW100F-3 WPI, Aston, UK) on a
Sutter micropipette puller (p97, Sutter instrument company,
Novato, CA). Probes were dissolved in a buffer containing 80 mM
KCl, 10 mM K2PO4, 4 mM NaCl pH 7.2 to a final concentration of 5 µM and microinjected in the cytoplasm of cells. The
optimal concentration and the amount of probe molecules
injected was determined on the basis of a series of initial
experiments taking the intensity of the hybridization signals
and cell viability into account. Typically, for each probe about
50 cells were injected and monitored over time. Representative
cells were selected and analyzed by digital fluorescence microscopy.
RNA-FISH on fixed cells
To detect the various RNAs in fixed cells, in situ hybridization
was performed essentially as described previously (32). In
brief, U2OS cells were fixed in 3.7% formaldehyde, 5% acetic
acid in PBS for 15 min at room temperature. The cells were
pretreated for 1 min with 0.1% pepsin pH 2.0 at 37°C before
hybridization. The 2′ OMe RNA probes were dissolved in 40%
deionized formamide/2× SSC pH 7.4 and the DNA probes
were dissolved in 10% deionized formamide/2× SSC. Hybridization mixture (10 µl) containing 50 nM probe was applied on
cells grown on glass slides and covered with an 18 × 18 mm
coverslip. Slides were put on an 80°C hot plate for 2 min to
denature nucleic acids and then incubated for 2 h at 37°C for
hybridization. To remove excess of probe, slides were rinsed in
2× SSC for 5 min, 2× SSC/10% formamide for 10 min, 2× SSC
for 5 min. Cells were then mounted in VectaShield (Vector
Laboratories, Burlingame, CA).
Construction and expression of GFP-fusion proteins
The cDNAs encoding ASF/SF2 and fibrillarin were generated
by RT–PCR and cloned into the pEGFP-C1 vector (Clontech,
Palo Alto, CA) as described previously (9). The resulting
plasmid constructs were microinjected into cells (50 ng/µl
H2O), and cells showing GFP-expression were injected 24 h
after transfection with antisense probes.
Life cell imaging
Microinjection and life cell imaging was performed on a Zeiss
Axiovert 135 TV microscope (Zeiss, Jena, Germany),
equipped with a 100 W mercury arc lamp. The objectives used
were a 40×/NA 1.30 Plan Neofluar phase and a 100×/NA 1.30
Plan Neofluar phase. Tetramethylrhodamine (TAMRA)
labeled probes were detected using a filter set consisting of a
546/10 nm BP filter, a 580 nm DM and a 590 LP barrier filter.
Images were acquired using a cooled charged coupled device
camera (type PXL, Photometrix, Tucson, AZ). At various time
points after microinjection, images were acquired and fluorescence distribution patterns were analyzed. Typical exposure
times were 1–2 s.
RESULTS
U1 snRNA and U3 snRNA, 28 S rRNA and poly(A) are
present in high amounts in a cell, and specific nuclear compartments, such as nucleoli, speckles and Cajal bodies are enriched
for some of these RNA species. U1 snRNA is a component of
‘spliceosomes’, structures that are responsible for mRNA
splicing (33); U3 snRNA has a function in rRNA processing,
and is mainly localized in nucleoli (34). Poly(A) RNA,
representing mRNA or pre-mRNA, is present throughout the
nucleoplasm and concentrated in speckles and also in the
cytoplasm (35,36), and 28S rRNA is localized in nucleoli and
cytoplasm. The high expression from the HCMV IE gene integration sites generates a local nuclear track consisting of transcript (31). For each of these targets four different types of
probes were synthesized: linear 2′ OMe RNA probes, molecular
beacon 2′ OMe RNA probes, linear DNA probes and molecular
beacon DNA probes, and used for hybridization in fixed and
living cells. Probe sequences and the fluorescent labels that
were used are listed in Table 1.
Linear 2′ OMe RNA probes
Probes were injected in the cytoplasm of U2OS cells, causing
less damage to the cells compared to nuclear injections. Within
60 s of injection, all probes accumulated in the nucleus, an
observation that is in agreement with earlier studies (37,38).
Microinjected fluorescent linear 2′ OMe RNA probes to
U1 snRNA were visible in speckles, Cajal bodies and
throughout the nucleoplasm (Fig. 1C), excluding nucleoli, in
agreement with earlier studies (22,39,40). The U3 snRNA
2′ OMe RNA probe was found to localize in nucleoli and in the
nucleoplasm (Fig. 1G). Nucleoli were identified in phase
contrast images (Fig. 1B, D, F and H). Similar staining patterns
were observed when these probes were hybridized on fixed
cells (Fig. 1A and E), indicating that they specifically hybridized to their respective RNA targets in living cells. In general
the signal intensity of hybridized probe was higher in fixed
cells compared to that in living cells. The pepsine-treatment
e89 Nucleic Acids Research, 2001, Vol. 29, No. 17
PAGE 4 OF 9
prior to injection of fluorescent probes, the specific hybridization pattern was not obtained (data not shown), indicating
blocking of the hybridization sites.
Following microinjection in U2OS cells, fluorescent linear
2′ OMe RNA probes designed to hybridize to 28S rRNA or
poly(A) RNA localized at the expected nuclear sites. Ribosomal
RNA was detected in nucleoli (Fig. 2C) and poly(A) RNA was
detected in speckles and throughout the nucleoplasm (Fig. 2G).
Similar nuclear hybridization patterns were obtained when
these probes were hybridized to fixed cells (Fig. 2A).
However, in fixed cells, the nucleoplasmic staining was less
pronounced and the contrast between speckles and nucleoplasm was more apparent (Fig. 2E). The cytoplasmic staining
of 28S rRNA and poly(A) RNA observed in fixed cells
(Fig. 2A and E) was not observed in living cells (Fig. 2C and
G), due to a rapid accumulation of the probes in the nucleus.
Only a very low concentration of all injected probes could be
observed in the cytoplasm.
To further prove the specificity of hybridization in live cells,
cells were microinjected with control probes without a specific
target sequence. Microinjection of the poly(A)18 2′ OMe RNA
probe resulted in a diffuse staining throughout the nucleoplasm
without revealing any specific hybridization pattern (Fig. 2K).
A similar diffuse staining was observed when non-induced rat
9G cells or U2OS cells were microinjected with a 2′ OMe
RNA probe specific for HCMV IE RNA (not shown).
Detection of the transcription site of CMV RNA in living
R9G cells
Figure 1. Similar localization patterns of 2′ OMe RNA oligonucleotides
hybridized to U1 snRNA and U3 snRNA in fixed and living U2OS cells
(A, C, E and G). The distinct localization patterns observed for U1 snRNA
(C) and U3 snRNA (G) detected in living cells after microinjection of the antisense oligonucleotides are similar to those observed in fixed cells (A and E),
indicating a specific hybridization to RNA in living cells. Corresponding phase
contrast images (B, D, F and H). The intense spots in (C) and (E), indicated by
arrows, are Cajal bodies, the faint structures in the nucleoplasm in (C) are
speckles.
and the denaturation step that are applied in FISH on fixed
cells make the RNA more accessible for the probe, causing a
much higher hybridization efficiency compared to that in
living cells. Post-hybridization washing steps removed the
unbound probe from fixed cells. The homogeneous nucleoplasmic staining observed with the U3 snRNA probe in living
cells, that obscured the detection of U3 snRNA in Cajal bodies,
was not observed in fixed cells (Fig. 1E). The microinjected
cells were followed for several days and underwent mitosis.
Similar localization patterns were observed in daughter cells
(not shown). This indicated that the probes did not interfere
with cell vitality. When non-fluorescent probes for U1 snRNA
and U3 snRNA were injected in a 5-fold higher concentration
As 2′ OMe RNA oligonucleotides were shown to hybridize to
high abundant RNAs in living cells these probes were
subsequently used to detect CMV IE mRNA in a transformed
rat fibroblast cell line. Induced R9G cells were microinjected
with up to five TAMRA-labeled 2′ OMe RNA oligonucleotides specific for IE mRNA. Injection of single probes
did not result in specific hybridization signals. Nevertheless,
when a mixture of three 2′ OMe RNA oligonucleotides (I, II
and IV in Table 1) was injected, a fluorescent dot representing
IE RNA at the integrated IE gene repeat was visible (Fig. 3A).
This nuclear signal was similar to the one observed in fixed
cells after FISH with these probes (Fig. 3B), and as observed in
previous studies (31,41). In addition to the fluorescent dot, live
cells revealed a homogeneous fluorescent staining throughout
the nucleus including nucleoli. This can be ascribed to nonhybridized probes and non-specifically hybridized probes.
Cytoplasmic IE mRNA could not be detected in living cells.
2′ OMe RNA molecular beacons
To test their performance in living cells, 2′ OMe RNA molecular
beacon probes specific for U1 and U3 snRNA, for 28S rRNA
and for poly(A) RNA were designed. As control probes, a
poly(A) beacon and an HCMV IE mRNA specific 2′ OMe
RNA beacon were used (Table 1). Since not much is known
about the hybridization kinetics of these types of probes in
living cells, all molecular beacons were tested in solution for
specificity for their target sequences and their ability to fluoresce
upon hybridization (not shown). 2′ OMe RNA molecular
beacons specific for U1 snRNA, U3 snRNA, 28S rRNA and
poly(A) RNA microinjected in U2OS cells showed initially a
very low signal intensity because they are in a closed and thus
quenched form. However, after 5–10 min, the signal intensity
PAGE 5 OF 9
Nucleic Acids Research, 2001, Vol. 29, No. 17 e89
fixed cells (data not shown). In addition to nuclear compartments a diffuse background staining of the nucleoplasm was
observed following microinjection of the beacon probes in
living cells. This background staining was independent from
specific hybridization to an RNA target, since opening of the
molecular beacon also occurred when 2′ OMe RNA beacons
were injected with no RNA target in U2OS cells. This was
observed after injection of a beacon with a loop containing
only 18 adenines or a beacon specific for HCMV IE RNA (not
shown).
To find the optimal beacon probe structure for hybridization
in living cells, probes for U3 snRNA and poly(A) RNA with
different stem–loop lengths were tested (Table 1). The altered
probe structures did not result in improved signal-to-noise
ratios. For example, a poly(U) molecular beacon with a length
of 28 bases (loop, 18 bases; stem, 5 bp) and a molecular beacon
with a length of 36 bases (loop, 22 bases; stem, 7 bp) were used
to detect poly(A) tails in live cells. Microinjection of the 28 base
probe resulted in the specific ‘speckled’ pattern that was
obtained with the linear probe, although the intensity of the
signals was 2–3-fold lower (not shown). Injection of the 36 base
probe resulted in a diffuse nuclear staining (Fig. 4E), similar to
that obtained with the non-specific poly(A) beacon (Fig. 4G).
The performance of linear and molecular beacon DNA
probes
Figure 2. Hybridization of linear 2′ OMe RNA probes to abundant RNA
targets in living cells. Probes for 28S rRNA (A and C) and poly(A) RNA
(E and G) hybridized to fixed and living cells show a similar nuclear hybridization pattern but a different cytoplasmic localization pattern. Probes to 28S
rRNA and poly(A) RNA accumulate in the nucleus within minutes of injection
and the level of hybridization to the RNA present in the cytoplasm is negligible.
The (A)18 probe shows no specific hybridization pattern (K). Corresponding
phase contrast images (B, D, F, H and L).
increased steadily throughout the nucleus following injection
and similar localization patterns were observed as obtained
with linear 2′ OMe RNA probes (Fig. 4). Overall, the maximal
signal intensity achieved with the molecular beacons was 2–3-fold
lower compared to the linear probes. This difference in intensity
was also observed when the comparison was performed on
To test the theoretical advantage of 2′ OMe RNA probes
compared to unmodified oligodeoxynucleotides for detecting
RNA species in vivo, we directly compared the two types of
probes. Linear fluorescent DNA probes with the same
sequences as the 2′ OMe RNA probes (Table 1) were synthesized.
Upon microinjection, all DNA probes rapidly accumulated in
the cell nucleus which resulted in a diffuse staining, without
revealing any specific hybridization pattern (Fig. 5). Hybridization on fixed cells indicated that the probes were specific for
their RNA target (data not shown). These results suggest that in
living cells, linear DNA probes have an insufficient affinity for
the RNA target sequences to allow specific and stable hybridization. The inability to show specific hybridization was not
caused by degradation of the probes, since the observations
were done within minutes of injection of the probes, and the
half-life of DNA oligonucleotides injected in living cells was
shown to be 15 min (42). It is feasible that a low percentage of
the injected DNA oligonucleotides did in fact hybridize to the
target RNA, but that the relatively dim specific signal was very
much disturbed by the high amount of the non-specific
staining. Even 35 and 40 base long DNA probes for 28S rRNA
(Fig. 5A) and poly(A) RNA (Fig. 5B), possessing higher
affinities compared to the 15–22 base probes, did not result in
distinct localization patterns in living cells. Also molecular
beacon DNA probes for the same targets did not reveal a
specific hybridization pattern in living cells upon injection.
Combined RNA and protein detection in living cells
Having established that linear 2′ OMe RNA probes are suited
for detection of RNA species in living cells, we examined the
possibility to simultaneously detect RNA and protein molecules in living cells. U2OS cells were transiently transfected
with GFP expression vectors containing the coding sequences
for alternative splicing factor (ASF) and fibrillarin and
expressing cells were microinjected with a 2′ OMe RNA probe.
e89 Nucleic Acids Research, 2001, Vol. 29, No. 17
PAGE 6 OF 9
Figure 3. Detection of the transcription site of CMV RNA, transcribed from the integrated HCMV IE 1 gene in R9G cells. (A) Transcription sites and cytoplasmic
mRNA are visible. Detection of transcription sites in living cells. The small bright spot shows transcription from the integration sites. A high background was
observed in the nucleus and nucleoli. The signal in the cytoplasm was very weak. (B) Representative example of an in situ hybridization with three linear 2′ OMe
RNA oligonucleotides on fixed R9G cells.
Figure 6A–D shows the simultaneous detection of ASF–GFP
together with poly(A) RNA in a living cell. As expected from
previous localization studies on fixed cells, ASF and
poly(A) RNA were shown to co-localize in a speckled
pattern. Fibrillarin–GFP, which localizes to nucleoli and Cajal
bodies (9), was shown to co-localize with U1 snRNA in Cajal
Bodies (Fig. 6E–H). These results indicate that proteins and
RNA species can be visualized simultaneously in living cells
without disturbing their integrity. The simultaneous labeling of
RNA and proteins in living cells not only allows microscopic
co-localization studies as was shown here, but could also
provide the opportunity to study their interaction, by applying
RNA–Protein Fluorescence Resonance Energy Transfer
(FRET).
DISCUSSION
In this study we evaluated the performance of different probe
types, for the detection of representatives of the major RNA
classes, rRNA, snRNA, poly(A) RNA and a specific mRNA,
in living cells. Our results show that 2′ OMe RNA probes can
be designed such that they hybridize with high specificity to
the corresponding target sequences in living cells without
affecting cell vitality, and that they are superior to DNA oligonucleotides. Cells microinjected with the 2′ OMe RNA probes
could be monitored for several days and underwent mitosis,
showing that processes like transcription and proliferation
were not irreversibly disturbed. Long-term observation
however was only found possible when low light level illumination was applied, in order to prevent fluorescence fading and
phototoxic effects. As was observed before (37,38,43), oligonucleotide probes rapidly entered the cell nucleus after microinjection in the cytoplasm, and specific hybridization patterns
were observed within 1–2 min irrespective of the target RNA.
This suggests that oligonucleotide probes can move freely
throughout the cell nucleus.
RNA targets in the cytoplasm could not be labeled presumably
because rapid entrapment of the probes in the nucleus caused
depletion of the cytoplasm and prevented successful hybridization to cytoplasmic RNA targets. One possibility to overcome
this nuclear entry of probes when injected in the cytoplasm, is
to couple a high molecular weight tag to the oligonucleotide.
Tsuji et al. (18) used streptavidin to tag oligonucleotide probes
to detect mRNA in the cytoplasm. Alternatively, oligo-peptide
conjugates, where the peptide sequence is a nuclear export
signal, could be tested (44). Interestingly, 24 h after injection
of a probe to poly(A) tails, an increase in cytoplasmic signal
was observed, suggestive for the export of mRNA from the
nucleus to the cytoplasm. This signal, however, could also
have been derived from degradation products.
Using linear 2′ OMe RNA probes, U1 and U3 snRNA, 28S
rRNA and poly(A) RNA were detected with high signal-to-noise
ratios, indicating that the majority of the injected probe
was hybridized specifically to the RNA of interest. This was
particularly true when the injected amount of probe was
estimated to be lower or equal to the number of target RNA
molecules. The probes for U1 and U3 snRNA and poly(A)
RNA that localized to specific nuclear compartments as
speckles, Cajal bodies and nucleoli, were also found present
throughout the nucleoplasm. Since this diffuse staining was
much weaker after FISH on fixed cells, it is possible that part
of this signal is derived from non-hybridized fractions of
probes.
HCMV IE mRNA was detected as a single confined spot in
the nucleus. This shows that the high concentration of HCMV
IE mRNA that is present at the transcribing HCMV gene
cluster can be detected in living cells, and suggests that this
method provides a useful additional tool for the visualization
of gene activity in vivo. The IE mRNAs emanating from the
transcription site towards the cytoplasm, as revealed by FISH
on fixed cells (31), could however not be detected. This could
be attributed to a low signal-to-noise ratio. Interestingly,
Sei-Iida et al. (45) observed that DNA probes hybridize
efficiently to RNA molecules in vitro during or just after
synthesis and less efficiently after folding. Thus, also in vivo,
the nascent RNA transcripts are probably better accessible for
probes compared to the folded mRNA–protein complexes in
transport through the nucleus. The efficiency of hybridization
of antisense probes to mRNA varies along the target sequence,
depending on secondary RNA structures and proteins
occupying the probe binding sites (18). Testing a series of
probes along the sequence may identify the most optimal
probes for a particular mRNA. In this study 2′ OMe RNA
oligonucleotides were shown to be well suited for detection of
PAGE 7 OF 9
Nucleic Acids Research, 2001, Vol. 29, No. 17 e89
Figure 5. No specific hybridization visible after microinjection of DNA oligonucleotides. Two examples of microinjected cells where RNA was targeted
with DNA oligonucleotides. Thirty-five and 40 base antisense DNA probes for
28S ribosomal RNA (A) and the poly(A) tail of mRNA (C) were microinjected
into living U2OS cells. The probes accumulated in the nucleus with time as
was expected but did not show any further specific localization as was observed
with the 2′ OMe RNA probes (as in Figs 1 and 2). (B and D) Corresponding
phase contrast images.
Reducing or eliminating signals from unbound or nonspecifically bound probe
Figure 4. Hybridization of molecular beacons in living cells. U1 snRNA
(A) and U3 snRNA (C) molecular beacons show similar hybridization patterns
as the linear probes (Fig. 1), but have a lower signal-to-noise ratio. A molecular
beacon targeted to poly(A) RNA consisting of a 22 base loop and a 7 bp stem
showed only a very vague specific staining (E), compared to the linear probe
(Fig. 2G). The overall intensity was lower for molecular beacons. For none of
the RNAs that were targeted, a molecular beacon showed hybridization with an
improved contrast. The control poly(A) molecular beacon probe does not show
a specific hybridization pattern (G). Corresponding phase contrast images
(B, D, F and H).
highly abundant nuclear RNA targets in living cells. The fact
that 2′ OMe RNA probes and RNA form a hybrid that is not
degraded by RNase H, whereas DNA/RNA and RNA/RNA
hybrids do form substrates for this enzyme, is an additional
argument to use the 2′ OMe modification. DNA analogs that
were shown to have a higher affinity or specificity for RNA,
such as 2′ allyl RNA (46), 2′ methoxy-ethoxy (2′ Moe) RNA
(47,48), peptide nucleic acids (PNAs) (49) and several others,
could possibly be used to further optimize hybridization in
living cells.
The key question is whether the signals obtained by in vivo
hybridization are actually derived from probes specifically
hybridized to RNA. To reduce or circumvent the contribution
of unwanted signals from unbound or non-specifically bound
probes, a method may be applied that enables discrimination
between signals derived from probes bound specifically to the
RNA target and signals from unbound or non-specifically
bound probes.
Therefore, we tested a series of molecular beacons for RNA
detection in living cells. In vitro experiments demonstrated the
improved specificity of 2′ OMe RNA molecular beacons
compared to 2′ OMe RNA linear probes in vitro (data not
shown). We could not confirm the beneficial properties of
molecular beacons for detecting RNA targets in living cells.
Although 2′ OMe RNA molecular beacons showed specific
hybridization in our study and were applied before in live cells
by Matsuo et al. (25) and Sokol et al. (19), for all RNAs in this
study the linear probes showed better signal-to-noise ratios
than molecular beacons. In general, the molecular beacons
used by us showed lower affinity for RNA targets in fixed and
living cells. Specific as well as control beacons were shown to
open up shortly after entering the cell nucleus, indicating that
their non-specific interaction with nuclear proteins or nucleic
acids imposes a conformational change leading to fluorescence. Recently, it has been shown that a beacon type structure
can be recognized by lactate dehydrogenase (50), and since
many nuclear proteins can interact with structural motives
present in RNA molecules, it is well possible that such interactions occur with molecular beacons, resulting in fluorescence
regardless of specific hybridization.
Sixou et al. (51) proposed an alternative method to discriminate
between specific and non-specific hybridization based on
e89 Nucleic Acids Research, 2001, Vol. 29, No. 17
PAGE 8 OF 9
various endogenous nuclear RNAs in living cells, without
interfering with cell vitality. In addition, we demonstrate that
simultaneous detection of RNA species with GFP-tagged
proteins is very feasible, opening a way to study the molecular
interactions involved in RNA transcription, processing and
transport in living cells.
ACKNOWLEDGEMENTS
We would like to thank S. Snaar, S. Khazen, H. Albus and
E. Manders for their excellent technical assistance, J. Bonnet
and H. Vrolijk for their expertise in digital imaging microscopy and C. Jost for her helpful comments on the manuscript.
We would like to thank Michel Dechamps and Dario Largana
(Eurogentec) for technical assistance in the synthesis of the
probes used in this study. C. Molenaar is supported by the
Dutch Scientific Organization NWO program ‘4D imaging of
living cells and tissues’, grant no. 901-34-144.
REFERENCES
Figure 6. Combined detection of RNA and expression of GFP in living cells.
(A–D) Co-localization of poly(A) RNA and ASF–GFP in living U2OS cells
in speckles and nucleoplasm. (E–H) Co-localization of U1 snRNA and
fibrillarin–GFP in coiled bodies. Arrows in (F) indicate Cajal Bodies containing fibrillarin–GFP. Cells expressing ASF–GFP (B) were microinjected with
a probe for poly(A) RNA (A) and cells expressing fibrillarin–GFP (F) with a
probe for U1 snRNA (E).
FRET. Recently Tsuji et al. (18) applied this method by using
adjacently hybridizing probes, labeled 3′ and 5′ with donor and
acceptor molecules, respectively, thereby facilitating FRET.
This approach was used to detect cFos mRNA in transfected
COS cells using Bodipy 493/503 and Cy5 labeled DNA oligonucleotides. For the detection of FRET it is required that both
probes are simultaneously hybridized on the target molecule,
demanding very efficient probe hybridization. For this reason,
high affinity probes should improve FRET efficiency.
In conclusion, linear 2′ OMe RNA antisense probes promise
to be a general applicable probe type allowing the detection of
1. Lamond,A.I. and Earnshaw,W.C. (1998) Structure and function in the
nucleus. Science, 280, 547–553.
2. Verschure,P.J., van Der Kraan,I., Manders,E.M. and van Driel,R. (1999)
Spatial relationship between transcription sites and chromosome
territories. J. Cell Biol., 147, 13–24.
3. Leonhardt,H., Rahn,H.P., Weinzierl,P., Sporbert,A., Cremer,T., Zink,D.
and Cardoso,M.C. (2000) Dynamics of DNA replication factories in
living cells. J. Cell Biol., 149, 271–280.
4. Dirks,R.W., Hattinger,C.M., Molenaar,C. and Snaar,S.P. (1999)
Synthesis, processing, and transport of RNA within the three-dimensional
context of the cell nucleus. Crit. Rev. Eukaryot. Gene Expr., 9, 191–201.
5. Misteli,T. (2000) Cell biology of transcription and pre-mRNA splicing:
nuclear architecture meets nuclear function. J. Cell Sci., 113, 1841–1849.
6. Tsukamoto,T., Hashiguchi,N., Janicki,S.M., Tumbar,T., Belmont,A.S.
and Spector,D.L. (2000) Visualization of gene activity in living cells.
Nature Cell Biol., 2, 871–878.
7. Zink,D., Cremer,T., Saffrich,R., Fischer,R., Trendelenburg,M.F.,
Ansorge,W. and Stelzer,E.H. (1998) Structure and dynamics of human
interphase chromosome territories in vivo. Hum. Genet., 102, 241–251.
8. Phair,R.D. and Misteli,T. (2000) High mobility of proteins in the
mammalian cell nucleus. Nature, 404, 604–609.
9. Snaar,S., Wiesmeijer,K., Jochemsen,A.G., Tanke,H.J. and Dirks,R.W.
(2000) Mutational analysis of fibrillarin and its mobility in living human
cells. J. Cell Biol., 151, 653–662.
10. Pederson,T. (1999) Movement and localization of RNA in the cell
nucleus. FASEB J., 13 (supp. 2), S238–S242.
11. Pederson,T. (2001) Fluorescent RNA cytochemistry: tracking gene
transcripts in living cells. Nucleic Acids Res., 29, 1013–1016.
12. Bassell,G.J., Oleynikov,Y. and Singer,R.H. (1999) The travels of mRNAs
through all cells large and small. FASEB J., 13, 447–454.
13. Dirks,R.W., Molenaar,C. and Tanke,H.J. (2001) Methods for visualizing
RNA processing and transport pathways in living cells. Histochem. Cell
Biol., 115, 3–11.
14. Ainger,K., Avossa,D., Diana,A.S., Barry,C., Barbarese,E. and
Carson,J.H. (1997) Transport and localization elements in myelin basic
protein mRNA. J. Cell Biol., 138, 1077–1087.
15. Rook,M.S., Lu,M. and Kosik,K.S. (2000) CaMKIIalpha 3′ untranslated
region-directed mRNA translocation in living neurons: visualization by
GFP linkage. J. Neurosci., 20, 6385–6393.
16. Beach,D.L., Salmon,E.D. and Bloom,K. (1999) Localization and
anchoring of mRNA in budding yeast. Curr. Biol., 9, 569–578.
17. Bertrand,E., Chartrand,P., Schaefer,M., Shenoy,S.M., Singer,R.H. and
Long,R.M. (1998) Localization of ASH1 mRNA particles in living yeast.
Mol. Cell, 2, 437–445.
18. Tsuji,A., Koshimoto,H., Sato,Y., Hirano,M., Sei-Iida,Y., Kondo,S. and
Ishibashi,K. (2000) Direct observation of specific messenger RNA in a
single living cell under a fluorescence microscope. Biophys. J., 78,
3260–3274.
PAGE 9 OF 9
19. Sokol,D.L., Zhang,X., Lu,P. and Gewirtz,A.M. (1998) Real time
detection of DNA.RNA hybridization in living cells. Proc. Natl Acad.
Sci. USA, 95, 11538–11543.
20. Politz,J.C., Tuft,R.A., Pederson,T. and Singer,R.H. (1999) Movement of
nuclear poly(A) RNA throughout the interchromatin space in living cells.
Curr. Biol., 9, 285–291.
21. Paillasson,S., Robert-Nicoud,M. and Ronot,X. (1996) Specific detection
of RNA molecules by fluorescent in situ hybridization in living cells.
Cell Biol. Toxicol., 12, 359–361.
22. Carmo-Fonseca,M., Pepperkok,R., Sproat,B.S., Ansorge,W.,
Swanson,M.S. and Lamond,A.I. (1991) In vivo detection of snRNP-rich
organelles in the nuclei of mammalian cells. EMBO J., 10, 1863–1873.
23. Pitts,A.E. and Corey,D.R. (1998) Inhibition of human telomerase by
2′-O-methyl-RNA. Proc. Natl Acad. Sci. USA, 95, 11549–11554.
24. Majlessi,M., Nelson,N.C. and Becker,M.M. (1998) Advantages of
2′-O-methyl oligoribonucleotide probes for detecting RNA targets.
Nucleic Acids Res., 26, 2224–2229.
25. Matsuo,T. (1998) In situ visualization of messenger RNA for basic
fibroblast growth factor in living cells. Biochim. Biophys. Acta, 1379,
178–184.
26. Tyagi,S. and Kramer,F.R. (1996) Molecular beacons: probes that
fluoresce upon hybridization. Nat. Biotechnol., 14, 303–308.
27. Tyagi,S., Bratu,D.P. and Kramer,F.R. (1998) Multicolor molecular
beacons for allele discrimination. Nat. Biotechnol., 16, 49–53.
28. Luhrmann,R., Kastner,B. and Bach,M. (1990) Structure of spliceosomal
snRNPs and their role in pre-mRNA splicing. Biochim. Biophys. Acta,
1087, 265–292.
29. Boom,R., Geelen,J.L., Sol,C.J., Raap,A.K., Minnaar,R.P., Klaver,B.P.
and van der Noordaa,J. (1986) Establishment of a rat cell line inducible for
the expression of human cytomegalovirus immediate-early gene products
by protein synthesis inhibition. J. Virol., 58, 851–859.
30. van de Corput,M.P., Dirks,R.W., van Gijlswijk,R.P., van de Rijke,F.M.
and Raap,A.K. (1998) Fluorescence in situ hybridization using
horseradish peroxidase-labeled oligodeoxynucleotides and tyramide
signal amplification for sensitive DNA and mRNA detection.
Histochem. Cell Biol., 110, 431–437.
31. Dirks,R.W., de Pauw,E.S. and Raap,A.K. (1997) Splicing factors
associate with nuclear HCMV-IE transcripts after transcriptional
activation of the gene, but dissociate upon transcription inhibition:
evidence for a dynamic organization of splicing factors. J. Cell Sci., 110,
515–522.
32. Dirks,R.W., van de Rijke,F.M., Fujishita,S., van der,P.M. and Raap,A.K.
(1993) Methodologies for specific intron and exon RNA localization in
cultured cells by haptenized and fluorochromized probes. J. Cell Sci., 104,
1187–1197.
33. Sleeman,J.E. and Lamond,A.I. (1999) Nuclear organization of pre-mRNA
splicing factors. Curr. Opin. Cell Biol., 11, 372–377.
34. Tollervey,D. and Kiss,T. (1997) Function and synthesis of small nucleolar
RNAs. Curr. Opin. Cell Biol., 9, 337–342.
35. Huang,S., Deerinck,T.J., Ellisman,M.H. and Spector,D.L. (1994) In vivo
analysis of the stability and transport of nuclear poly(A)+ RNA. J. Cell
Biol., 126, 877–899.
Nucleic Acids Research, 2001, Vol. 29, No. 17 e89
36. Fay,F.S., Taneja,K.L., Shenoy,S., Lifshitz,L. and Singer,R.H. (1997)
Quantitative digital analysis of diffuse and concentrated nuclear
distributions of nascent transcripts, SC35 and poly(A). Exp. Cell Res.,
231, 27–37.
37. Chin,D.J., Green,G.A., Zon,G., Szoka,F.C.,Jr and Straubinger,R.M.
(1990) Rapid nuclear accumulation of injected
oligodeoxyribonucleotides. New Biol., 2, 1091–1100.
38. Leonetti,J.P., Mechti,N., Degols,G., Gagnor,C. and Lebleu,B. (1991)
Intracellular distribution of microinjected antisense oligonucleotides.
Proc. Natl Acad. Sci.USA, 88, 2702–2706.
39. Lamond,A.I. and Carmo-Fonseca,M. (1993) Localisation of splicing
snRNPs in mammalian cells. Mol. Biol. Rep., 18, 127–133.
40. Carmo-Fonseca,M., Pepperkok,R., Carvalho,M.T. and Lamond,A.I.
(1992) Transcription-dependent colocalization of the U1, U2, U4/U6, and
U5 snRNPs in coiled bodies. J. Cell Biol., 117, 1–14.
41. Lawrence,J.B., Singer,R.H. and Marselle,L.M. (1989) Highly localized
tracks of specific transcripts within interphase nuclei visualized by in situ
hybridization. Cell, 57, 493–502.
42. Sixou,S., Szoka,F.C.,Jr, Green,G.A., Giusti,B., Zon,G. and Chin,D.J.
(1994) Intracellular oligonucleotide hybridization detected by
fluorescence resonance energy transfer (FRET). Nucleic Acids Res., 22,
662–668.
43. Fisher,T.L., Terhorst,T., Cao,X. and Wagner,R.W. (1993) Intracellular
disposition and metabolism of fluorescently-labeled unmodified and
modified oligonucleotides microinjected into mammalian cells.
Nucleic Acids Res., 21, 3857–3865.
44. Meunier,L., Mayer,R., Monsigny,M. and Roche,A.C. (1999) The nuclear
export signal-dependent localization of oligonucleopeptides enhances the
inhibition of the protein expression from a gene transcribed in cytosol.
Nucleic Acids Res., 27, 2730–2736.
45. Sei-Iida,Y., Koshimoto,H., Kondo,S. and Tsuji,A. (2000) Real-time
monitoring of in vitro transcriptional RNA synthesis using fluorescence
resonance energy transfer. Nucleic Acids Res., 28, e59.
46. Iribarren,A.M., Sproat,B.S., Neuner,P., Sulston,I., Ryder,U. and
Lamond,A.I. (1990) 2′-O-alkyl oligoribonucleotides as antisense probes.
Proc. Natl Acad. Sci. USA, 87, 7747–7751.
47. McKay,R.A., Miraglia,L.J., Cummins,L.L., Owens,S.R., Sasmor,H. and
Dean,N.M. (1999) Characterization of a potent and specific class of
antisense oligonucleotide inhibitor of human protein kinase C-alpha
expression. J. Biol. Chem., 274, 1715–1722.
48. Elayadi,A.N., Demieville,A., Wancewicz,E.V., Monia,B.P. and
Corey,D.R. (2001) Inhibition of telomerase by 2′-O-(2-methoxyethyl)
RNA oligomers: effect of length, phosphorothioate substitution and time
inside cells. Nucleic Acids Res., 29, 1683–1689.
49. Nielsen,P.E., Egholm,M. and Buchardt,O. (1994) Peptide nucleic acid
(PNA). A DNA mimic with a peptide backbone. Bioconjug. Chem., 5, 3–7.
50. Fang,X., Li,J.J. and Tan,W. (2000) Using molecular beacons to probe
molecular interactions between lactate dehydrogenase and single-stranded
DNA. Anal. Chem., 72, 3280–3285.
51. Sixou,S., Szoka,F.C.J., Green,G.A., Giusti,B., Zon,G. and Chin,D.J.
(1994) Intracellular oligonucleotide hybridization detected by
fluorescence resonance energy transfer (FRET). Nucleic Acids Res., 22,
662–668.