From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
IMMUNOBIOLOGY
The mismatch repair pathway functions normally at a non-AID target in germinal
center B cells
Blerta Green,1 Antoaneta Belcheva,1 Rajeev M. Nepal,1 Bryant Boulianne1, and Alberto Martin1
1Department
of Immunology, University of Toronto, Toronto, ON
Deficiency in Msh2, a component of the
mismatch repair (MMR) system, leads to
an approximately 10-fold increase in the
mutation frequency in most tissues. By
contrast, Msh2 deficiency in germinal center (GC) B cells decreases the mutation
frequency at the IgH V region as a dU:dG
mismatch produced by AID initiates modifications by MMR, resulting in mutations
at nearby A:T base pairs. This raises the
possibility that GC B cells express a fac-
tor that converts MMR into a globally
mutagenic pathway. To test this notion,
we investigated whether MMR corrects
mutations in GC B cells at a gene that is
not mutated by AID. Strikingly, we found
that GC B cells accumulate 5 times more
mutations at a reporter gene than during
the development of the mouse. Notably,
the mutation frequency at this reporter
gene was approximately 10 times greater
in Msh2ⴚ/ⴚ compared with wild-type
GC B cells cells. In contrast to the V region, the increased level of mutations at
A:T base pairs in GC B cells was not
caused by MMR. These results show that
in GC B cells, (1) MMR functions normally
at an AID-insensitive gene and (2) the
frequency of background mutagenesis
is greater in GC B cells than in their
precursor follicular B cells. (Blood. 2011;
118(11):3013-3018)
Introduction
Mismatch repair (MMR) is an evolutionary conserved DNA repair
pathway that is required to repair mutations that arise through DNA
replication or other processes.1,2 MutS homologue 2 (Msh2)
dimerizes with either Msh6 or Msh3 to recognize single base-pair
mismatches or mismatches caused by insertion/deletions, respectively.2 After binding to the mismatch, Msh2 hydrolyzes ATP,
which induces a change in the heterodimer that allows for the
recruitment of downstream repair factors such as MutL homologue
1, postmeiotic segregation 2, and exonuclease 1 (Exo1).3,4 Because
of Msh2’s essential role in repairing DNA mutations, Msh2⫺/⫺
mice have 5-fold, 11-fold, and 15-fold greater mutation frequencies
in the brain, small intestine, and thymus, respectively,5 and are
predisposed to cancer.6-8
During an immune response, Ig genes undergo somatic hypermutation (SHM) to produce high-affinity antibodies. SHM is
initiated by activation-induced cytidine deaminase (AID),9 which
deaminates cytidine molecules within the V region to produce
dU:dG mispairs.10-12 The dU:dG mismatch is recognized by the
Msh2/Msh6 heterodimer, but instead of repairing this mutation,
MMR produces mutations.13-18 Mice deficient in Msh2, Msh6,
postmeiotic segregation 2, MutL homologue 1, or Exo1 have an
approximately 2-fold decrease in overall mutation frequency at the
V region.13,14,16-18 In particular, there is an approximately10-fold
decrease in mutations at A:T base pairs at the V region in
MSH2-deficient mice, whereas the mutation frequency at G:C base
pairs is unaltered.15-19 These results indicate that the MMR pathway
is required to produce mutations at A:T base pairs in the V region.
MMR proteins have also been implicated in mutagenic processes
that cause disease, including trinucleotide-repeat diseases.20
Two sets of recent results suggest the possibility that the MMR
system is generally defective in germinal center (GC) B cells.
Ouchida et al21 reported that GC B cells have a generally greater
mutation rate than other cells, as measured by the frequency of
mutations on a lacZ transgene. Liu et al22 found that in Msh2
mutant mice, the mutation frequency of AID-sensitive genes was
either lower or only slightly greater than in wild-type (WT) cells;
they argued that the Msh2-dependent pathway was not functioning
normally in GC cells. Together, these results would fit a simple
unified model in which the expression of a GC/B cell–specific
factor commandeers MMR and transforms this DNA repair pathway into a mutagenic pathway.
An alternative explanation is that the MMR pathway is only
mutagenic at sites mutated by AID, which would argue against a
factor that disrupts global MMR function in GC B cells. To explore
this issue, we examined the impact of Msh2-deficiency at a lacI
transgene that is not mutated by AID in GC B cells. Our results
indicate that Msh2 efficiently repairs lacI mutations in all cell
populations examined, including GC B cells. Thus, MMR functions normally in GC B cells except at AID-targeted loci.
Methods
Mice
Msh2⫹/⫺ mice were kindly provided by Tak W. Mak (Ontario Cancer
Institute). Big Blue C57BL/6 hemizygous male mice were purchased from
Stratagene. Msh2⫺/⫺ were bred with Big Blue (BB⫹) mice to generate BB⫹
Msh2⫺/⫺ mice. All mice were on the C57BL/6 genetic background.
Animals carrying the shuttle vector (BB⫹) and Msh2 WT, heterozygous, or
homozygous for the “null allele” were identified with the use of 5⬘ACCACACCTATGGTGTATGCA and 3⬘-CCTCTGCCGAAGTTGAGTAT primers for the PCR of the transgene (95°C for 3 minutes, and
Submitted March 31, 2011; accepted July 5, 2011. Prepublished online as
Blood First Edition paper, July 25, 2011; DOI 10.1182/blood-2011-03-345991.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
The online version of this article contains a data supplement.
© 2011 by The American Society of Hematology
BLOOD, 15 SEPTEMBER 2011 䡠 VOLUME 118, NUMBER 11
3013
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3014
BLOOD, 15 SEPTEMBER 2011 䡠 VOLUME 118, NUMBER 11
GREEN et al
30 cycles at 95°C for 30 seconds, 50°C for 60 seconds, 72°C for 60 seconds, and a final extension at 72°C for 10 minutes) and Msh2 PCR as
previously described.23 Mice were housed in a specific pathogen-free
facility. Approximately 3-month-old WT and Msh2⫺/⫺ mice heterozygous
for the lacI-transgene were immunized once intraperitoneally with 150 ␮L
of hapten 4-hydroxy-3-nitrophenyl conjugated to chicken ␥ globulin
(Bioresearch Technologies) and precipitated in 1:1 ratio with alum (Thermo
Scientific). All animal study protocols were approved by the University of
Toronto’s Division of Comparative Medicine Committee.
Cells
BM cells were harvested from ⬃ 3-month-old WT and Msh2⫺/⫺ mice carrying
the lacI transgene and differentiated into macrophages by culturing the cells in
the presence of GM-CSF as described previously.24 Spleen cells were harvested
from BB⫹ WT and BB⫹ Msh2⫺/⫺ mice that were ⬃ 3 months of age and
heterozygous for the transgene 9-12 days after immunization. Each mouse was
studied individually. Cells were treated with 1 mL of RBC lysis buffer
(Sigma-Aldrich) for 3 minutes at room temperature. Cells were then
blocked in PBS with 5% NMS (Jackson ImmunoResearch Laboratories)
and anti-Fc␥III/II antibody (2.4G2).
To visualize follicular B cells and GC B cells by flow cytometry, we
used the following antibodies: anti–mouse B220 (Southern Biotech),
anti–mouse Fas (clone 15A7, eBioscience), and anti–mouse GL7 (clone
GL7, Biosciences Pharmingen). Approximately 5 ⫻ 106 follicular B cells
and 2-5 ⫻ 105 GC B cells were sorted from each mouse on a FACSAria II
(BD Biosciences) flow cytometer. Follicular B cells were defined as
B220⫹GL7⫺Fas⫺, and GC B cells were defined as B220⫹GL7⫹Fas⫹.
High-molecular-weight genomic DNA was isolated from these cells by the
use of a standard genomic DNA isolation protocol.
Mutation analysis
Transgenic ␭ phage rescue was performed as described.25 Phage was
packaged with the Stratagene Transpack Packaging Extract (SigmaAldrich). The dilution assay was performed on 10-cm plates with SCS-8
bacterial lawn, and the next day, the virus was plated on 15-cm plates in
presence of X-gal. The number of blue plaques (mutants) over the total
number of plaques indicates mutation frequency. Sectored plaques, arising
from bacterial processing of DNA damage acquired within the murine host,
were not included in the results (ie, only plaques that were at least 50% blue
were counted). We confirmed that the mutation frequency was not affected
by the amount of DNA in the preparation: We found that the mutation
frequency from DNA isolated from 5 million and 0.5 million BB⫹ spleen
cells was 7.5 ⫻ 10⫺5 and 6 ⫻ 10⫺5, respectively, indicating that the number
of cells used to isolate DNA does not affect the overall mutation frequency.
To sequence the lacI gene, the blue plaques were isolated in 100 ␮L of SM
buffer and stored at 4°C. A total of 1.5 ␮L of virus was used for the PCR
experiment in the section “PCR amplification and sequence analysis.” If the
blue plaques were contaminated by colorless plaques, we purified them by
plating a small volume of virus in a 10-cm plate and isolating blue plaques
that were not contaminated.
PCR amplification and sequence analysis
LacI mutants were chosen at random from indicated cell types derived from
Msh2⫺/⫺ and control animals for DNA sequencing. These blue plaques
were amplified by PCR for the lacI region and LacZ promoter with primers
previously reported (55D and 1283U).26 PCR products were purified by a
MultiScreen PCR96 Filter Plate (Millipore) and sent to Macrogen for
sequencing with the use of primers 55D and 1232U.26 Alignment and
analysis of unique mutations was performed by SeqMan.
Reverse transcriptase
RNA was extracted from splenic B cells from a 3-month-old BB⫹ and a
WT mouse with TRIzol (Invitrogen) per the manufacturer’s instructions.
RNA was treated with DNase I (Fermentas) and reverse-transcribed with
the use of superscript III reverse transcriptase (Invitrogen) and random
primers following the company’s protocol. The resulting cDNA was diluted
Figure 1. Frequency of mutations at the lacI gene in macrophages, follicular
B cells, and GC B cells from WT and Msh2ⴚ/ⴚ mice. Figure is plotted with data from
supplemental Table 1 (available on the Blood Web site; see the Supplemental Materials link
at the top of the online article). Statistical analysis involved a 2-tailed t test.
1 in 5, 1 in 25, and 1 in 125 dilution, and 1.5 ␮L of each dilution was used
for the PCR. Gene expression was examined by the use of appropriate
GAPDH-specific primers (forward primer AACTTTGGCATTGTGGAAGG and reverse primer GGAGACAACCTGGTCCTCAG). The
lacI gene was amplified by PCR with primers 331D and 803U.26
Data analysis
Data were analyzed with GraphPad Prism Version 5.0, in which we
performed 2-tailed Student t tests.
Results
The lacI mutation frequency is elevated in GC B cells from
Msh2ⴚ/ⴚ mice relative to WT mice
AID deficiency leads to significant alterations in the GCs in
mice9,27 and might therefore complicate the interpretation of any
results. For this reason, we measured the effects of Msh2 deficiency
in AID-sufficient mice by using the lacI-containing transgenic
mouse mutation detection system (Big Blue, hereafter referred to as
BB⫹). This transgene lacks eukaryotic transcriptional promoters
and is expected not to be transcribed and consequently is expected
not to be a substrate for AID, which generally requires a high rate of
transcription.28-31
The lacI transgene is part of a shuttle vector that can be
recovered as phage particles giving rise to white plaques (unmutated) or blue plaques (lacI mutated), thereby yielding information
regarding tissue specific- or cell-specific mutation frequencies. To
validate our system, we first examined the mutation frequency in
macrophages. Macrophages were generated from the BM of
WT and Msh2⫺/⫺ BB⫹ mice. We found a 6-fold increase in the
mutation frequency in Msh2⫺/⫺ mice compared with WT controls
(Figure 1, P ⫽ .0011). This result confirms the important role of
MMR in reducing the cellular mutation load.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
BLOOD, 15 SEPTEMBER 2011 䡠 VOLUME 118, NUMBER 11
NONMUTAGENIC MISMATCH REPAIR IN GC B CELLS
To determine whether MMR is mutagenic at the lacI gene in
GC B cells, it was necessary to know the mutation frequency at the
stage of differentiation before GC B cells to determine whether
mutations were inherited from follicular B cells or whether they
occurred at the GC B-cell stage. Therefore, we measured the
mutation frequency in follicular B cells from WT and Msh2⫺/⫺BB⫹
mice. At 10 days after mice were immunized with hapten 4-hydroxy3-nitrophenyl conjugated to chicken ␥ globulin, B220⫹GL7⫺Fas⫺
and follicular B cells from spleen were sorted and analyzed for
mutations in the lacI gene. We found that Msh2⫺/⫺ follicular
B cells had a significant 5.5-fold increase in the mutation frequency
compared with WT follicular B cells (Figure 1 and supplemental
Table 1).
From the same immunized WT and Msh2⫺/⫺ mice, we prepared
GC B cells from spleen by sorting for B220⫹GL7⫹Fas⫹ and
analyzed the mutation frequency of the lacI gene. If MMR repairs
mutation at the lacI gene in GC B cells, we would expect to observe
an increase in mutations in Msh2⫺/⫺ mice. Indeed, we observed a
10-fold increase in the lacI mutation frequency in Msh2⫺/⫺
GC B cells compared with WT GC B cells (Figure 1 and supplemental Table 1). This result is in striking contrast to the ⬃ 2-fold
decrease in mutation frequency observed at the V region of the IgH
gene in Msh2⫺/⫺ mice.17 Importantly, there was a 4.6-fold and an
8.8-fold increase in lacI mutation frequencies in GC B cells
relative to follicular B cells from WT and Msh2⫺/⫺ mice, respectively (Figure 1 and supplemental Table 1). This result indicates
that ⬎ 80% of mutations in GC B cells were not inherited from
follicular B cells but occurred at the GC B-cell stage. Collectively,
these results show that the MMR system repairs mutations that
arise at the lacI gene in GC B cells, indicating that MMR functions
normally at this genetic locus in GC B cells.
3015
Figure 2. Measurement of lacI mRNA in splenocytes. RNA was extracted from
splenocytes harvested from BB⫹ and BB⫺ mice and used to make cDNA with random
hexamers. PCR amplifications for GAPDH and for lacI were performed on 5-fold
serial dilutions of cDNA. Genomic DNA from a BB⫹ mouse was used as a positive
control in the GAPDH and lacI PCR. M indicates Mock; and RT, reverse transcription.
the lacI transgene could be a target of AID, we first tested whether
the lacI gene is transcribed in B cells. We carried out a reversetranscriptase PCR by using random hexamers (in case the lacI
transcript is not polyadenylated) on RNA isolated from splenocytes from BB⫺ and BB⫹ WT mice. Although GAPDH was
readily amplified from these cDNA preparations, we could not
amplify the lacI transcript from either BB⫺ or BB⫹ splenocytes
(Figure 2), indicating that this transgene is not detectably transcribed in splenocytes.
To more precisely investigate whether the lacI transgene was
mutated by AID, we sequenced blue plaques from GC B cells to
determine whether mutations occurred at WRCY motifs (W ⫽ A or
T, R ⫽ A or G, Y ⫽ T or C). WRCY is a SHM hotspot sequence
that is preferentially mutated by AID. A total of 16% and 26% of
mutations within the IgH JH2-JH4-region occur within WRCY
motifs in WT and Msh2⫺/⫺ mice, respectively.17 However, the
frequency of WRCY mutations within the lacI gene in WT and
Msh2⫺/⫺ GC B cells was only 7% and 4%, respectively (Table 1),
although there are more WRCY motifs in the lacI gene than in the
IgH JH2-JH4-region (ie, 60.3 WRCY/kb in the lacI gene vs 50.8
WRCY/kb in the IgH JH2-JH4-region). Collectively, these results
show that the increase in mutation frequency in GC B cells
compared with follicular B cells is not because of AID.
AID does not mutate the lacI transgene
We selected the lacI-containing transgenic BB⫹ mice because they
are expected to be refractory to AID because they lack eukaryotic
transcriptional promoters. However, it is possible that the transgene
was inserted into a transcriptionally active site in B cells and might
be subjected to AID activity. Indeed, the significant increase in
mutation frequency from follicular B cells to GC B cells could be
because of AID’s promiscuous activity.22,32-37 To determine whether
Table 1. Characteristics of mutations within the lacI gene in wild-type and Msh2ⴚ/ⴚ mice
BBⴙMSH2ⴙ/ⴙ
Macrophage (n ⴝ 3),*
n (%)†
Follicular B cell (n ⴝ 3),
n (%)
BBⴙMSH2ⴚ/ⴚ
GC B cell (n ⴝ 4),
n (%)
Macrophage (n ⴝ 3),
n (%)
Follicular B cell (n ⴝ 3),
n (%)
GC B cell (n ⴝ 3),
n (%)
Sequences analyzed
11
2
35
39
31
Mutated sequences
9
2
27
28
21
23
21
Total mutations‡
7 (100)
2 (100)
30 (100)
33 (100)
20 (100)
24 (100)
Base substitutions
6 (86)
2 (100)
30 (100)
27 (82)
19 (95)
23 (96)
Mutations at C:G
6 (86)
2 (100)
17 (57)
20 (61)
13 (65)
11 (46)
Mutations at A:T
0
0
13 (43)
7 (21)
6 (30)
12 (50)
Mutations at CpG§
3 (43)
2 (100)
9 (30)
13 (40)
13 (65)
6 (25)
Mutations at WRCY¶
2 (29)
0
2 (7)
1 (3)
0
1 (4)
Mutations at WA
0
0
9 (30)
4 (12)
5 (25)
7 (29)
Insertions/deletions
1 (14)
0
0
6 (18)
1 (5)
1 (4)
Insertions
0
0
0
2 (6)
0
0
Deletions
1 (14)
0
0
4 (12)
1 (5)
1 (4)
GC indicates germinal center.
*Denotes the number of animals assayed in each group.
†Percent mutations were calculated from total mutations (ie, base substitutions and insertion/deletion mutations).
‡Only unique mutations were considered.
§Mutations at CpG include transition and transversion mutations at dC (on either DNA strand).
¶Mutations at WRCY occur within the underlined dC nucleotide of this motif on either DNA strand.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3016
GREEN et al
BLOOD, 15 SEPTEMBER 2011 䡠 VOLUME 118, NUMBER 11
A:T base pairs in GC B cells at a different reporter gene, and some
of these mutations were caused by DNA polymerase ␩. Because
SHM at A:T base pairs within the V region are because of Msh2
and its recruitment of DNA polymerase ␩,41-43 we examined
whether mutations at A:T base pairs within the lacI gene were
reduced in Msh2⫺/⫺ mice. However, we found that the fraction of
mutations at A:T and G:C base pairs at the lacI gene was not altered
in Msh2⫺/⫺ GC B cells (Figures 3-4, Table 1). Furthermore, we
found that ⬃ 30% of all mutations within the lacI gene in WT and
Msh2⫺/⫺ GC B cells occur within WA dinucleotides (Table 1), a
motif that is preferentially mutated by DNA polymerase ␩. This
value is greater than the expected frequency of 15%
(151 WA motifs/kb in the lacI gene) for a mutation process that
displays no sequence bias. Thus, in contrast to the V-region, some
of the mutations at the lacI gene are likely because of polymerase ␩
but independent of Msh2.
Discussion
Figure 3. The mutation spectrum at the lacI gene in macrophages, follicular
B cells, and GC B cells from WT and Msh2ⴚ/ⴚ mice. (A) The mutation spectrum in
the indicated cell types and genotypes showing the original nucleotide (left) and the
mutation (top). Most of the mutations in macrophages and follicular B cells are G:C to
A:T transition mutations, whereas in GC B cells, there is a high proportion of
mutations at A:T base pairs. (B) The percentage of G:C and A:T mutations are plotted
for the indicated cell types and genotypes. This figure was plotted from the data
shown in panel A. Statistical analysis was carried out with a 2-tailed t test.
The increased mutation frequency at A:T base pairs in
GC B cells is not because of Msh2
In a separate approach to investigate whether MMR is inducing
mutations at A:T base pairs within the lacI gene as it does at the
V region, we characterized the mutations at the lacI gene by
sequencing blue plaques from macrophages, follicular B cells, and
GC B cells. We found that the majority of lacI mutations in
macrophages and follicular B cells occurred at G:C base pairs
(Figures 3-4) and that ⬃ 50% of all mutations occurred within CpG
dinucleotides in both WT and Msh2⫺/⫺ mice (Table 1). CpG
dinucleotides frequently undergo spontaneous deamination,38 and
thus our data suggest that this is a dominant type of mutation during
hematopoiesis or the development of the mouse, as previously
shown.39,40
Within GC B cells, we observed that the spectrum of mutations
was different from follicular B cells, with a greater proportion of
mutations at A:T base pairs observed (Figures 3-4, Table 1).
Combined with the 5-fold increase in the overall mutation frequency in GC B cells (Figure 1), these data suggest that mutations
at both G:C and A:T base pairs have increased relative to follicular
B cells but with a slight bias toward the latter. Ouchida et al21
previously observed an increase in the mutation frequency at
The finding that the MMR pathway is required to produce
mutations within the immunoglobulin V region during SHM, and
hence do the exact opposite of what this DNA repair pathway is
intended to do, is currently unexplained. What is clear is that
mutations at A:T base pairs within the V-region require the actions
of the Msh2/Msh6 heterodimer,14,16,17,19 Exo1,18 PCNA ubiquitination,44 and DNA polymerase ␩.41-43 In addition, non-Ig genes that
were mutated by AID also showed a decrease in mutation
frequency in the absence of Msh2.22 These data suggest either that
(1) Msh2 produces mutations at genes mutated by AID or (2) Msh2
is mutagenic throughout the genome.
The authors of previous studies have shown that there is
increased expression of MMR proteins in GC B cells45,46 and that
proteins isolated from GC B cells can bind to a mismatched
substrate and repair it in vitro.46 Although these results suggest that
MMR proteins are actively participating in GC B-cell physiology,
they do not address the specific question whether MMR has been
co-opted to produce mutations throughout the genome. To resolve
this issue, we examined whether mutations depend on Msh2 at a
non-AID target in GC B cells. Indeed, we found that Msh2 does not
induce mutations at the lacI gene in GC B cells and instead reduces
the mutation load at this genetic locus. These results show that the
MMR system functions normally in GC B cells at an AIDinsensitive site, indicating that something interferes with normal
MMR activity at some or all genes that are mutated by AID.
As to why MMR is mutagenic at sites of AID activity is still
unknown. The finding that DNA polymerase ␩ and Msh2 function
together to induce SHM at A:T base pairs was surprising because
this translesional polymerase is not normally recruited by MMR.47
This finding suggests that a replicative blocking lesion might
stimulate recruitment of this translesional polymerase during repair
of the AID-induced dU:dG mismatch. Indeed, we previously
observed that mutations at A:T base pairs were closely linked to
transversion mutations at cytidine molecules, suggesting that an
abasic site was stimulating error-prone MMR.48 Furthermore,
deficiency in UNG or MMR reduced this association, indicating
that an abasic site generated by UNG within the MMR tract recruits
DNA polymerase ␩, which then introduces mutations at A:T base
pairs.48 A similar finding was reported by Krijger et al.49 As to why
UNG interferes with MMR at the V-region and not elsewhere is
still unclear, but one possibility is that Msh2/6 directs repair of the
strand opposite to the AID-induced dU-containing strand, exposing
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
BLOOD, 15 SEPTEMBER 2011 䡠 VOLUME 118, NUMBER 11
NONMUTAGENIC MISMATCH REPAIR IN GC B CELLS
3017
Figure 4. The locations of base substitutions in the
lacI gene in the WT and Msh2ⴚ/ⴚ mice. (A) Position of
mutations within the lacI gene in the indicated cell types
from WT mice. (B) Position of mutations within the lacI
gene in the indicated cell types from Msh2⫺/⫺ mice.
the dU to UNG attack.48 This could come about by the asynchronous replication of the V-region in which Okazaki fragments
preferentially occur on the top strand because of an origin of
replication downstream of the V region.50 Because MMR preferentially excises the lagging strand,51 and if AID mutates the bottom
strand, this would create the aforementioned scenario, leading to
the concerted activity of MMR and UNG in stimulating mutations
at A:T base pairs.
We observed that the background level of mutation increased by
5-fold from the follicular B-cell stage to the GC B-cell stage.
Ouchida et al21 instead observed an approximately 2-fold increase
in the background level of mutation from non-GC B cells to
GC B cells. Differences in the reporter gene used and/or in the
methodology used to analyze mutation frequencies might account
for this discrepancy. For example, GC B-cell populations were
pooled from different animals in the previous study21 whereas we
examined GC B-cell populations from individual mice. Nevertheless, the increase in mutation frequency that we observed is
remarkable when one considers that the level of mutations that
accumulated from the fertilized egg, that is, when the lacI transgene
was cloned, to the follicular B-cell stage from a 3-month-old mouse
is 5 times less than the background mutation frequency that occurs
in a 10-day GC reaction.
One possible explanation for this increase in background
mutation frequency is the significant replication burst that occurs in
GC B cells. However, considering that the replication error rate in
mice is ⬃ 10⫺9 mutations/base pair/cell division,52 if replication
was the only source of error, a GC B cells would require ⬃ 300 000
cell divisions in 10 days (to go from 0.86 ⫻ 10⫺4 in the follicular
B-cell compartment to 3.94 ⫻ 10⫺4 in the GC B-cell compartment). This scenario is clearly impossible and suggests that the
replication error-rate has increased or that an active non-AID
mutagenic process is ongoing during the GC reaction (eg, reactive
oxygen species). The high background mutation frequency in
GC B cells coupled with AID-induced chromosomal translocations53 might explain why greater than 75% of all hematologic
malignancies derive from GC or post-GC B cells.54
Acknowledgments
The authors thank Maribel Berru and Ashley Weiss for technical
help, Dr Marc Shulman for critically reading the manuscript, and
the Martin laboratory for helpful discussions. They also are grateful
to Dr Tak Mak for the Msh2⫺/⫺ mice.
This research is supported by studentships from the Canadian
Institutes of Health Research to B.G. and B.B., and a grant from the
Canadian Institutes of Health Research (MOP66965) to A.M., who
is supported by a Canada Research Chair tier II award.
Authorship
Contribution: B.G. designed the research, analyzed data, and wrote
manuscript; A.B., R.M.N., and B.B. designed the research and
analyzed data; and A.M. designed the research and wrote manuscript.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Alberto Martin, Department of Immunology,
University of Toronto, Medical Sciences Building 7302, Toronto,
ON, Canada, M5S 1A8; e-mail: [email protected].
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3018
GREEN et al
BLOOD, 15 SEPTEMBER 2011 䡠 VOLUME 118, NUMBER 11
References
1. Barnes DE, Lindahl T. Repair and genetic consequences of endogenous DNA base damage in
mammalian cells. Annu Rev Genet. 2004;38:445476.
2. Jiricny J. The multifaceted mismatch-repair system. Nat Rev Mol Cell Biol. 2006;7(5):335-346.
3. Harfe BD, Jinks-Robertson S. DNA mismatch repair and genetic instability. Annu Rev Genet.
2000;34:359-399.
4. Hegan DC, Narayanan L, Jirik FR, Edelmann W,
Liskay RM, Glazer PM. Differing patterns of genetic instability in mice deficient in the mismatch
repair genes Pms2, Mlh1, Msh2, Msh3 and
Msh6. Carcinogenesis. 2006;27(12):2402-2408.
5. Andrew SE, Reitmair AH, Fox J, et al. Base transitions dominate the mutational spectrum of a
transgenic reporter gene in MSH2 deficient mice.
Oncogene. 1997;15(2):123-129.
6. Fishel R, Lescoe MK, Rao MR, et al. The human
mutator gene homolog MSH2 and its association
with hereditary nonpolyposis colon cancer. Cell.
1993;75(5):1027-1038.
7. Reitmair AH, Schmits R, Ewel A, et al. MSH2 deficient mice are viable and susceptible to lymphoid
tumours. Nat Genet. 1995;11(1):64-70.
8. Wei K, Kucherlapati R, Edelmann W. Mouse
models for human DNA mismatch-repair gene
defects. Trends Mol Med. 2002;8(7):346-353.
9. Muramatsu M, Kinoshita K, Fagarasan S,
Yamada S, Shinkai Y, Honjo T. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell. 2000;102(5):553563.
10. Li Z, Woo CJ, Iglesias-Ussel MD, Ronai D,
Scharff MD. The generation of antibody diversity
through somatic hypermutation and class switch
recombination. Genes Dev. 2004;18(1):1-11.
11. Di Noia JM, Neuberger MS. Molecular mechanisms of antibody somatic hypermutation. Annu
Rev Biochem. 2007;76:1-22.
12. Frieder D, Larijani M, Tang E, Parsa JY, Basit W,
Martin A. Antibody diversification: mutational
mechanisms and oncogenesis. Immunol Res.
2006;35(1-2):75-88.
13. Cascalho M, Wong J, Steinberg C, Wabl M. Mismatch repair co-opted by hypermutation. Science. 1998;279:1207-1210.
14. Kim N, Bozek G, Lo JC, Storb U. Different mismatch repair deficiencies all have the same effects on somatic hypermutation: intact primary
mechanism accompanied by secondary modifications. J Exp Med. 1999;190(1):21-30.
15. Winter DB, Phung QH, Umar A, et al. Altered
spectra of hypermutation in antibodies from mice
deficient for the DNA mismatch repair protein
PMS2. Proc Natl Acad Sci U S A. 1998;95(12):
6953-6958.
16. Wiesendanger M, Kneitz B, Edelmann W,
Scharff MD. Somatic hypermutation in MutS homologue (MSH)3-, MSH6-, and MSH3/MSH6deficient mice reveals a role for the MSH2-MSH6
heterodimer in modulating the base substitution
pattern. J Exp Med. 2000;191(3):579-584.
17. Martin A, Li Z, Lin DP, et al. Msh2 ATPase activity
is essential for somatic hypermutation at a-T
basepairs and for efficient class switch recombination. J Exp Med. 2003;198(8):1171-1178.
18. Bardwell PD, Woo CJ, Wei K, et al. Altered somatic hypermutation and reduced class-switch
recombination in exonuclease 1-mutant mice. Nat
Immunol. 2004;5(2):224-229.
19. Rada C, Ehrenstein MR, Neuberger MS,
Milstein C. Hot spot focusing of somatic hypermutation in MSH2-deficient mice suggests 2 stages
of mutational targeting. Immunity. 1998;9(1):135141.
20. Slean MM, Panigrahi GB, Ranum LP, Pearson CE.
Mutagenic roles of DNA “repair” proteins in antibody
diversity and disease-associated trinucleotide repeat
instability. DNA Repair (Amst). 2008;7(7):1135-1154.
21. Ouchida R, Ukai A, Mori H, et al. Genetic analysis
reveals an intrinsic property of the germinal center B cells to generate A:T mutations. DNA Repair
(Amst). 2008;7(8):1392-1398.
22. Liu M, Duke JL, Richter DJ, et al. Two levels of
protection for the B cell genome during somatic
hypermutation. Nature. 2008;451(7180):841-845.
23. Peters AC, Young LC, Maeda T, Tron VA,
Andrew SE. Mammalian DNA mismatch repair
protects cells from UVB-induced DNA damage by
facilitating apoptosis and p53 activation. DNA Repair (Amst). 2003;2(4):427-435.
24. Nepal RM, Vesosky B, Turner J, Bryant P. DM,
but not cathepsin L, is required to control an aerosol infection with Mycobacterium tuberculosis.
J Leukoc Biol. 2008;84(4):1011-1018.
25. Kohler SW, Provost GS, Fieck A, et al. Spectra of
spontaneous and mutagen-induced mutations in
the lacI gene in transgenic mice. Proc Natl Acad
Sci U S A. 1991;88(18):7958-7962.
26. Nishino H, Buettner VL, Haavik J, Schaid DJ,
Sommer SS. Spontaneous mutation in Big Blue
transgenic mice: analysis of age, gender, and tissue type. Environ Mol Mutagen. 1996;28(4):299312.
27. Zaheen A, Boulianne B, Parsa JY, Ramachandran S,
Gommerman JL, Martin A. AID constrains germinal
center size by rendering B cells susceptible to apoptosis. Blood. 2009;114(3):547-554.
28. Peters A, Storb U. Somatic hypermutation of immunoglobulin genes is linked to transcription initiation. Immunity. 1996;4(1):57-65.
29. Fukita Y, Jacobs H, Rajewsky K. Somatic hypermutation in the heavy chain locus correlates with
transcription. Immunity. 1998;9(1):105-114.
30. Bachl J, Carlson C, Gray-Schopfer V, Dessing M,
Olsson C. Increased transcription levels induce
higher mutation rates in a hypermutating cell line.
J Immunol. 2001;166(8):5051-5057.
31. Chaudhuri J, Tian M, Khuong C, Chua K,
Pinaud E, Alt FW. Transcription-targeted DNA
deamination by the AID antibody diversification
enzyme. Nature. 2003;422(6933):726-730.
32. Pasqualucci L, Migliazza A, Fracchiolla N, et al.
BCL-6 mutations in normal germinal center B
cells: evidence of somatic hypermutation acting
outside Ig loci. Proc Natl Acad Sci U S A. 1998;
95(20):11816-11821.
33. Shen HM, Peters A, Baron B, Zhu X, Storb U. Mutation of BCL-6 gene in normal B cells by the process of somatic hypermutation of Ig genes. Science. 1998;280:1750-1752.
34. Martin A, Scharff MD. Somatic hypermutation of
the AID transgene in B and non-B cells. Proc Natl
Acad Sci U S A. 2002;99(19):12304-12308.
35. Wang CL, Harper RA, Wabl M. Genome-wide somatic hypermutation. Proc Natl Acad Sci U S A.
2004;101(19):7352-7356.
36. Parsa JY, Basit W, Wang CL, Gommerman JL,
Carlyle JR, Martin A. AID mutates a non-immunoglobulin transgene independent of chromosomal
position. Mol Immunol. 2007;44(4):567-575.
37. Yamane A, Resch W, Kuo N, et al. Deep-sequencing
identification of the genomic targets of the cytidine
deaminase AID and its cofactor RPA in B lymphocytes. Nat Immunol. 2011;12(1):62-69.
38. Cooper DN, Youssoufian H. The CpG dinucleotide and human genetic disease. Hum Genet.
1988;78(2):151-155.
39. Hendrich B, Hardeland U, Ng HH, Jiricny J,
Bird A. The thymine glycosylase MBD4 can bind
to the product of deamination at methylated CpG
sites. Nature. 1999;401(6750):301-304.
40. Krawczak M, Ball EV, Cooper DN. Neighboringnucleotide effects on the rates of germ-line
single-base-pair substitution in human genes.
Am J Hum Genet. 1998;63(2):474-488.
41. Zeng X, Winter DB, Kasmer C, Kraemer KH,
Lehmann AR, Gearhart PJ. DNA polymerase eta
is an A-T mutator in somatic hypermutation of immunoglobulin variable genes. Nat Immunol.
2001;2(6):537-541.
42. Delbos F, De Smet A, Faili A, Aoufouchi S,
Weill JC, Reynaud CA. Contribution of DNA polymerase eta to immunoglobulin gene hypermutation in the mouse. J Exp Med. 2005;201(8):11911196.
43. Delbos F, Aoufouchi S, Faili A, Weill JC,
Reynaud CA. DNA polymerase eta is the sole
contributor of A/T modifications during immunoglobulin gene hypermutation in the mouse. J Exp
Med. 2007;204(1):17-23.
44. Langerak P, Nygren AO, Krijger PH, van den Berk PC,
Jacobs H. A/T mutagenesis in hypermutated immunoglobulin genes strongly depends on PCNAK164
modification. J Exp Med. 2007;204(8):1989-1998.
45. Wu X, Tschumper RC, Gutierrez A Jr,
Mihalcik SA, Nowakowski GS, Jelinek DF. Selective induction of DNA repair pathways in human
B cells activated by CD4⫹ T cells. PLoS One.
2010;5(12):e15549.
46. Park K, Kim J, Kim HS, Shin HS. Isolated human
germinal center centroblasts have an intact mismatch repair system. J Immunol. 1998;161(11):
6128-6132.
47. Li GM. Mechanisms and functions of DNA mismatch repair. Cell Res. 2008;18(1):85-98.
48. Frieder D, Larijani M, Collins C, Shulman M,
Martin A. The concerted action of Msh2 and UNG
stimulates somatic hypermutation at A.T base
pairs. Mol Cell Biol. 2009;29(18):5148-5157.
49. Krijger PH, Langerak P, van den Berk PC,
Jacobs H. Dependence of nucleotide substitutions on Ung2, Msh2, and PCNA-Ub during somatic hypermutation. J Exp Med. 2009;206(12):
2603-2611.
50. Zhou J, Ashouian N, Delepine M, et al. The origin
of a developmentally regulated Igh replicon is located near the border of regulatory domains for
Igh replication and expression. Proc Natl Acad
Sci U S A. 2002;99(21):13693-13698.
51. Pavlov YI, Mian IM, Kunkel TA. Evidence for preferential mismatch repair of lagging strand DNA
replication errors in yeast. Curr Biol. 2003;13(9):
744-748.
52. Venkatesan RN, Treuting PM, Fuller ED, et al.
Mutation at the polymerase active site of mouse
DNA polymerase delta increases genomic instability and accelerates tumorigenesis. Mol Cell
Biol. 2007;27(21):7669-7682.
53. Ramiro AR, Jankovic M, Eisenreich T, et al. AID is
required for c-myc/IgH chromosome translocations in vivo. Cell. 2004;118(4):431-438.
54. Morton LM, Wang SS, Devesa SS, Hartge P,
Weisenburger DD, Linet MS. Lymphoma incidence patterns by WHO subtype in the United
States, 1992-2001. Blood. 2006;107(1):265-276.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
2011 118: 3013-3018
doi:10.1182/blood-2011-03-345991 originally published
online July 25, 2011
The mismatch repair pathway functions normally at a non-AID target in
germinal center B cells
Blerta Green, Antoaneta Belcheva, Rajeev M. Nepal, Bryant Boulianne and Alberto Martin
Updated information and services can be found at:
http://www.bloodjournal.org/content/118/11/3013.full.html
Articles on similar topics can be found in the following Blood collections
Immunobiology (5489 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.