RESEARCH ARTICLE
The regulation of different metabolic pathways through the
Pal/Rim pathway in Ustilago maydis
Citlali Fonseca-Garcı́a, Claudia G. León-Ramı́rez & José Ruiz-Herrera
Departamento de Ingenierı́a Genética, Unidad Irapuato, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional,
Irapuato, Guanajuato, México
Correspondence: José Ruiz-Herrera,
Departamento de Ingenierı́a Genética,
Unidad Irapuato, Centro de Investigación y
de Estudios Avanzados del IPN, Apartado
Postal 629, 36821 Irapuato, Guanajuato,
México. Tel.: +52 462 6239600;
fax: +52 462 62345849;
e-mail: [email protected]
Received 5 December 2011; revised 20
March 2012; accepted 21 March 2012.
Final version published online 23 April 2012.
DOI: 10.1111/j.1567-1364.2012.00805.x
Editor: Jens Nielsen
Keywords
pH regulation; Pal/Rim pathway; stress
response; cell wall; Ustilago maydis.
Abstract
One of the most important physicochemical factors that affect cell growth and
development is pH, and living organisms have developed specific mechanisms
to adapt to media with variable pH values. Most fungi posses a specific mechanism for such adaptation: the Pal/Rim pathway. To analyze the different metabolic processes regulated by this pathway, and its possible relationships with
other physiological regulatory mechanisms, we analyzed the phenotype of a
mutant in the PALB/RIM13 gene of the phytopathogenic fungus Ustilago
maydis. The mutant displayed important alterations in the synthesis and
organization of the cell wall and was affected in its response to stress, revealing
its relationship with the MAPKC pathway involved in maintaining the integrity
of the cell wall, and the stress response pathway, but not with the HOG
pathway. An important observation was that the mutant, in contrast to the
wild-type strain, was unable to maintain a constant intracellular pH, suggesting
that probably the main function of the Pal/Rim pathway, in collaboration with
other regulatory mechanisms, is to maintain a constant intracellular pH,
despite the changes occurring in the environment.
YEAST RESEARCH
Introduction
One of the most important physicochemical factors that
affect cell growth and development is pH. Accordingly, all
living organisms have developed important mechanism to
control this factor. In the case of multicellular organisms
that have the facility to regulate the conditions of their
internal environment, and whose cells live under steady
state conditions, it has been shown that important cellular processes such as protein synthesis, growth, and proliferation may be negatively impacted by even mild
acidification (Pouyssegur et al., 1985; Bravo & Macdonald-Bravo, 1986; Chambard & Pouyssegur, 1986; Musgrove et al., 1987; Chiche et al., 2009). This alteration
reflects an inability of the cells to function normally at
suboptimal pH, and it has been shown that the Tsc1/Tsc2
complex and the master regulatory protein kinase mTorc1
respond to changes in extracellular or cytoplasmic pH
(Balgi et al., 2011). More difficult is the condition of single-celled organisms that live in the most diverse media.
FEMS Yeast Res 12 (2012) 547–556
To survive under the variable conditions of pH encountered, these organisms have developed mechanisms that
monitor the external pH and respond regulating the entry
and exit of different ions. In fungi, several mechanisms
involved in this process have been described (Latge, 1999;
Davis et al., 2000; Lamb et al., 2001; Peñalva & Arst,
2002; Caracuel et al., 2003; Rollins, 2003; You & Chung,
2007), but apparently the most widely distributed mechanism, with some variants, is a signal transduction pathway designated by various authors as Rim or Pal for
yeasts or filamentous fungi, respectively (Orejas et al.,
1995; Tilburn et al., 1995; Peñalva & Arst, 2002; Arst &
Peñalva, 2004), that we have neutrally designated Pal/Rim
(Aréchiga-Carvajal & Ruiz-Herrera, 2005; Cervantes-Chávez et al., 2010; Fonseca-Garcı́a et al., 2011).
The Pal/Rim signaling pathway depends on the proteolytic activation of a zinc finger transcription factor named
PacC in filamentous fungi or Rim101 in yeast (Davis
et al., 2000; Peñalva & Arst, 2002). This factor activates
the transcription of some genes at alkaline pH and
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
548
represses other ones at acid pH (Su & Mitchell, 1993; Orejas et al., 1995; Tilburn et al., 1995). In Ascomycota species, PacC/Rim101 activation depends on the action of
five or six proteins depending on the species: PalH/
Rim21, PalF/Rim8, PalI/Rim9, PalA/Rim20, PalC/Rim23,
and PalB/Rim13, in combination with some components
of the machinery of the endocytic system arranged into
two complexes: one involved in reception of the pH stimulus located at the plasma membrane and another
responsible for the final activation mechanism associated
with the endocytic membranes (Peñalva & Arst, 2002,
2004; Xu et al., 2004; Blanchin-Roland et al., 2005, 2008;
Cornet et al., 2005; Peñalva et al., 2008).
Previously we identified, isolated, and disrupted a
PacC/Rim101 homologue from Ustilago maydis paving
the way for the study of this pathway in Basidiomycota
(Aréchiga-Carvajal & Ruiz-Herrera, 2005), because previously it had been assumed that the pathway was specific
to Ascomycota. Our in silico analyses demonstrated that
Basidiomycota, U. maydis included, in general possessed
homologues of only five of the seven components identified in most Ascomycota species: PacC/Rim101, PalA/
Rim20, PalB/Rim13, and PalC/Rim23, which constitute
the complex present at the endosomal membrane and
PalI/Rim9 from the plasma membrane complex, although
without a detectable role in signal transduction (Cervantes-Chávez et al., 2010).
Mutation of PAL/RIM genes in U. maydis gave rise to a
pleiotropic phenotype, as occurs in other system, for example Aspergillus nidulans (Peñalva & Arst, 2002), Saccharomyces cerevisiae (Lamb & Mitchell, 2003), Candida albicans
(Davis, 2003), Yarrowia lipolytica (González-López et al.,
2002; Blanchin-Roland et al., 2005), and the phytopathogenic fungi Sclerotinia sclerotiorum and Colletotrichum acutatum (Rollins & Dickman, 2001), although the processes
affected do not strictly coincide in the pal/rim mutants
from the different fungal species. In this study, we have
made a comparative analysis of the phenotype of a representative pal/rim mutant of U. maydis to determine the
possible relations existing between this and other pathways
responsible for the metabolic regulation of the fungus.
Material and methods
Organisms used and growth conditions
The U. maydis strains used in this study were FB2 (a2b2;
Banuett & Herskowitz, 1989) provided by F. Banuett
(California State University, Long Beach), AC401
(a1b1Drim13::Cbx) described by Cervantes-Chávez et al.
(2010), a PKA pathway mutant (a2b2Δuac1), and a
MAPK pathway mutant (a2b2Δubc4) provided by S. Gold
(University of Georgia). The strains were maintained at
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
C. Fonseca-Garcı́a et al.
70 °C in 50% (v/v) glycerol and recovered in liquid
complete medium (CM; Holliday, 1961). All strains were
grown in liquid or solid minimal (MM; Holliday, 1961)
or CM media, with or without different additions as
described later.
Stress assays
The effects of different stress conditions on U. maydis
were tested as described by Cervantes-Chávez et al.
(2010) on plates of solid MM adjusted to the indicated
pH values for each experiment with 100 mM Tris–HCl
and addition of the compounds under assay.
Cell wall purification
Cells were grown in pH 8.5 MM for 20 h at 28 °C,
washed with 10 mM Tris–HCl pH 7.5 supplemented with
one tablet of a protease inhibitor cocktail (Roche) and
broken with glass beads according to the protocol
described by Ruiz-Herrera et al. (1996).
Chemical analyses
Neutral sugars were measured with anthrone (Dimler
et al., 1952), and aminosugars were measured by the Elson-Morgan technique as described by Dische (1962),
after hydrolysis with HCl as described by Ruiz-Herrera
et al. (1996). Protein was measured as described by Bradford (1976) using bovine serum albumin as standard. All
chemical determinations were made at least twice with
triplicate samples. Data are expressed as averages ± standard error of the mean.
Sequential analyses of cell wall
polysaccharides
We made the analyses of cell wall polysaccharides through
a step sequence. Cell walls were extracted with 2 N KOH in
a boiling water bath for 2 h and centrifuged at 1500 g. An
aliquot was recovered from the supernatant to measure
neutral sugars with anthrone. This sample corresponded to
wall mannans and alkali-soluble b-1,3-glucans. The rest
was treated overnight with 2 volumes of Fehling reagent (a
mixture of 1 volume of 7% CuSO4·5H2O and 3 volumes of
3.4% sodium and potassium tartrate in 10% NaOH). The
precipitated material was recovered by centrifugation, and
the sediment was washed with Fehling reagent and distilled
water and dissolved in 1 N acetic acid, and neutral sugars
were determined as earlier. This fraction corresponded to
mannans. The content of alkali-soluble glucans was determined by subtracting the mannan value from the total
alkali-soluble sugar. The alkali-insoluble sediment from
FEMS Yeast Res 12 (2012) 547–556
549
Pal/Rim regulation in U. maydis
above was washed with sterile water and suspended in
10 mM pH 7.0 potassium phosphate containing
2 mg mL 1 Zymolyase (a b-1,3 glucanase; Sigma) and
incubated at 30 °C for 5 h. Neutral sugars in the hydrolyzed material corresponding to alkali-insoluble b-glucans
were measured with anthrone as described. Subsequently,
an aliquot of the supernatant was dialyzed, and the nondialyzable fraction corresponding to b-1,6-glucan was also
measured with anthrone.
responding pH values of the buffers used. To measure
intracellular pH, U. maydis was grown at 28 °C in pH 6
MM containing 100 mM potassium phosphate or pH 8.5
MM containing 100 mM Tris–HCl, and measurements of
fluorescence were made as described previously, but omitting nigericin. The values obtained were interpolated in
the calibration curve prepared as described previously. All
determinations were made at least twice with triplicate
samples. Data are expressed as averages ± standard error
of the mean.
Electron microscopy
Cells grown for 20 h at 28 °C in pH 8.5 MM were fixed
with 1% glutaraldehyde in cacodylate buffer pH 7,
washed with cacodylate buffer and postfixed with 2%
osmium tetroxide, dehydrated in a graded acetone series,
contrasted with lead acetate and uranyl acetate, included
in epoxy resin, and cut with an ultramicrotome. The sections were observed in a Philips Morgagni 268 microscope, photographs were taken, the thickness of the cell
wall was measured in four equidistant points of the cell
profile, and their average values were used for comparison between the wild-type strain and the mutant.
Lipase assays
The activity of extracellular triacylglycerol lipase was
determined by a turbidimetric method described by von
Tigerstrom & Stelmaschuk (1989). Cells were grown in
liquid MM containing olive oil as carbon source for variable periods of time. The cultures were centrifuged at
6000 g for 20 min, and the supernatant was used as the
source of the extracellular lipase activity. A standard reaction mixture contained 300 lL of the supernatant from
cultures, 3.6 mL 2% Tween 20 in 20 mM Tris–HCl pH 8,
and 100 lL of 120 mM CaCl2. Incubation proceeded at
37 °C for 30 min, and turbidity was measured as optical
density at 600 nm.
Determination of intracellular pH
The procedure of Jolicoeur et al. (1998) using the conjugated fluorophore 2′,7′-bis(2-carboxyethyl)-5,6-carboxyfluorescein acetoxymethyl ester (BCECF-AM, Sigma) was
followed. An intracellular in vivo signal calibration was
made by mixing 200 lL phosphate buffer of different pH
values with 106 U. maydis cells and 2 lL of 100 mM
BCECF-AM. This was followed by addition of 10 lL
96.8 lM nigericin (to deplete membrane potential and
allow ion equilibration through the cell membrane), fluorescence was measured at two excitation wavelengths: 450
and 505 nm, and the quotients of the respective values
were used to prepare a calibration curve against the corFEMS Yeast Res 12 (2012) 547–556
Expression analysis of CHS, GLS, PMA1, and
Na+/H+-Enhancer genes from U. maydis
It is known by analysis of the genome of U. maydis that the
fungus contains eight chitin synthase (Chs) encoding genes:
um10718.2, um04290, um10120, um10117, um02840,
um10367, um05480, and um03204, one gene encoding a b1,3-glucan synthase (um01639), one gene encoding a typeP plasma membrane PMA1 H+-ATPase (um02581), and
one Na+/H+-Enhancer-encoding gene (um02203). Expression of these genes was measured by the reverse transcription-polymerase chain reaction (RT-PCR) analysis in cells
incubated in pH 8 or pH 6 MM prepared as above, using
the primers shown in Table 1. As a control, a fragment
from the constitutive gene encoding the elongation factor a
(EFa) from U. maydis was used.
Results
Comparative analysis of the structure and
chemical composition of the cell wall of a
ΔpalB/rim13 mutant and the wild-type strain
from U. maydis
The structure of the cell wall of the wild-type strain and
the ΔpalB/rim13 mutant of U. maydis was observed by
electron microscopy of samples stained with the normal
osmium protocol. The microscopic appearance of the cell
wall from both strains was similar (Fig. 1), but they differed in thickness. The average thickness of the cell wall
of the wild-type strain measured as described in Materials
and methods in sections of 10 different cells was
0.24 ± 0.03 lm. In contrast, the average width of the wall
from the mutant strain (measured also in 10 different
cells) was 0.16 ± 0.015 lm. These results show that the
cell wall of the pal/rim mutant is considerably thinner
than the one from the wild-type strain.
Chemical composition of the cell wall
Analysis of the chemical composition of the cell wall of
the wild type and the ΔpalB/rim13 mutant of U. maydis
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
550
C. Fonseca-Garcı́a et al.
Table 1. Primers used in this work
Primer
Orientation
Sequence 5′?3′
Gene
Chs1F
Chs1R
Chs2F
Chs2R
Chs3F
Chs3R
Chs4F
Chs4R
Chs5F
Chs5R
Chs6F
Chs6R
Chs7F
Chs7R
Chs8F
Chs8R
GlsF
GlsR
EFaF
EFaR
PMA1F
PMA1R
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
CTTTCAGACGTTGGCGCCAGC
CGAGTGAGCTGGATCTTTTTG
CGAAGCACAGCAACCAACCAC
GATTTGCTGATACTGCTGGCC
GCCTATTATTCGAGACCGGCTT
GCGATACCAGCTGCTCTTCCAA
GCCACCTCGCTACCCATTT
CCCTCTTGAGCGTCTTGTAT
CACGTTGATTCCTGTCTCGAC
CTGTCCAACGTTCCGGTCCTTC
CGCAGGCGGCATCGATGA
CGGATTCGTTGCGTTGAGC
CGACCAGGAAGTGATTATCGATA
CGATGGCTGTGGTGGATGCTGAT
GGACCGACTATGAAAACGAGC
GAAGGCTGAGGCATGAACCC
GCCGAGGTCATCTTCCCCATCTGC
AAGCGCGGTTTGTCTCGTCGTG
GGGTAAAGAAAAGGCTCACG
GGGCGAAGGTGACAACCATAC
CGTCTTTATCGCTCTGTTCG
CGACACTTCGAGGAAAAGGA
CHS1
(a)
(b)
CHS2
CHS3
CHS4
CHS5
CHS6
CHS7
CHS8
GLS
EFa
PMA1 (ATPase)
Table 2. Chemical composition of purified cell walls of the wild-type
strain and the ΔpalB/rim13 mutant of Ustilago maydis
Percentage of total dry weight
Fig. 1. Electron micrographs of FB2 wild-type strain and ΔpalB/rim13
mutant of Ustilago maydis. Cell median sections were obtained as
described in Materials and methods. (a) ΔpalB/rim13 mutant; (b) wildtype strain. Magnification bar: 2 lm.
demonstrated that they showed significant differences
(Table 2). The cell wall from the wild-type strain was
made of about 63% neutral sugars, 13% chitin, and 16%
protein. In the case of the mutant strain, the values were
about 52% total neutral sugars, 5% chitin, and 10% protein. Based on the differences found in total and neutral
sugars between the wild-type and the mutant strain, we
performed a detailed analysis of the neutral polysaccharides present in the cell walls. To this end, we followed
the protocol described in Materials and methods for the
determination of the alkali-soluble polysaccharides (mannan and b-1,3-glucan) and alkali-insoluble polysacchaª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
Chemical components
Wild type
Neutral polysaccharides
Alkali soluble
Mannans
b-1,3-glucan
Alkali insoluble
b-1,6-glucans
b-1,3-glucans
Chitin
Protein
63.3
2.44
0.61
1.83
29.21
3.85
25.36
12.9
15.7
±
±
±
±
±
±
±
±
±
2.4
0.3
0.1
0.22
1.8
0.5
1.4
1.3
0.8
ΔpalB/rim13
51.8
0.69
0.42
0.27
25.21
2.48
22.73
4.8
10.1
±
±
±
±
±
±
±
±
±
1.2
0.2
0.1
0.1
1.6
0.4
1.1
2.3
1.1
Results are the average of three experiments ± experimental error. All
pairwise comparisons show differences that are statistically significant
at 95% confidence.
rides (b-1,3- and b-1,6-glucans). It was observed that the
mutant strain showed significant quantitative differences
compared to the wild-type strain in their content of
alkali-soluble sugars, mainly in the content of b-1,3-glucan.
Expression of genes encoding chitin synthases
(CHS) and glucan synthase (GLS)
Taking into consideration the quantitative differences
found in the chemical composition of the isolated cell
FEMS Yeast Res 12 (2012) 547–556
551
Pal/Rim regulation in U. maydis
walls of the wild-type strain and the ΔpalB/rim13 mutant,
we proceeded to determine the transcript levels of genes
encoding chitin synthase (CHS) and the single gene
encoding a b-1,3-glucan synthase (GLS) of U. maydis cells
grown in liquid pH 8.5 MM for 20 h. The data obtained
were expressed relative to the levels of the EFa gene transcript, which is known to be constitutive (Negrutskii &
El’skaya, 1998). In the case of chitin synthases encoding
genes, the results obtained showed that the expression of
CHS1, CHS2, CHS5, and CHS8 showed lower values in
the mutant, but in contrast, the expression of CHS6
showed higher values in the mutant compared to wildtype strain, whereas genes CHS3, CHS4, and CHS7 had
almost the same levels of transcript in the wild-type and
mutant strains, likewise the GLS gene that encodes the b1,3-glucan synthase showed similar levels in both genotypes (see Fig. 2).
Amounts of protein excreted to the culture
medium
We determined the amount of protein present in the culture medium of the wild-type and the mutant strain grown
for 24 h in pH 8.5 MM (see Materials and methods). The
results reveal the presence of a greater amount of protein in
the culture medium of the mutant strain, 1.41 mg protein/
100 mL of culture medium, compared to the wild type,
0.125 mg protein per 100 mL of growth medium.
Effect of different stress conditions on pal/rim
mutants
It has been described in Ascomycota that some pal/rim
mutants are more sensitive to ionic stress than the
parental strains (Lamb & Mitchell, 2003; Bensen et al.,
Fig. 2. Expression of CHS and GLS genes in the wild-type strain and
ΔpalB/rim13 mutant of Ustilago maydis. Cells were grown in pH 8.5
MM containing 100 mM Tris–HCl for 20 h. The values are expressed
related to the transcript of the EFa gene (1.0). Gray bars, wild-type
strain; black bars, ΔpalB/rim13 mutant. Results are the average of
three experiments.
FEMS Yeast Res 12 (2012) 547–556
2004; Kullas et al., 2007). In further studies, CervantesChávez et al. (2010) reported that growth of the
U. maydis wild-type strain and pal/rim mutants was not
affected when subjected to osmotic stress with 1.5 M
sorbitol, but that the mutants were more sensitive to
monovalent ions (Na+, K+, and Li+) than the wild-type
strain. We confirmed the resistance of the mutants to
even higher concentrations of sorbitol (3 M) (data not
shown) and observed their tolerance to divalent cations:
Mg2+ and Ca2+ at pH 9 (data not shown), at which the
alkaline sensitivity of the mutants is well documented
(Cervantes-Chávez et al., 2010). By incubation of the
cells during the whole growth period with H2O2, and
not merely subjecting them to a short pulse with hydrogen peroxide, as previously performed (Cervantes-Chávez
et al., 2010), we confirmed the hypersensitivity of the
mutant DpalB/rim13 to oxidative stress (data not
shown).
To assess whether a relationship exists between the Pal/
Rim and the MAPK and PKA pathways involved in the
dimorphic transition of U. maydis (see Martı́nez-Espinoza
et al., 1997), we measured the effect of caffeine, an agent
that increases cAMP levels (Butcher & Sutherland, 1962)
on the growth of the wild-type strain and the DpalB/
rim13 mutant. Two mutants, one in the PKA and another
in the MAPK pathway, were used as controls. We found
that only growth of the mutant deficient on the PKA
pathway was inhibited in the presence of 5 mM caffeine
(not shown).
Triacylglycerol lipase secretion by the wildtype strain and the pal/rim mutant
Previously we reported that pal/rim mutants, contrasting
with the wild-type strain, were unable to secrete a protease to the culture medium (Aréchiga-Carvajal & RuizHerrera, 2005; Cervantes-Chávez et al., 2010). To analyze
whether the observed effect on secretion was specific for
the protease or a general phenomenon of secreted
enzymes, we measured the ability of the mutant to use
triglycerides, Tween 20 (polyoxyethylene (20) sorbitan
monolaurate) as the sole carbon source at pH 8.5 and
secrete a triacylglycerol lipase to the culture medium. As
described by Klose et al., (2004), the wild-type strain
grew in the mycelial form when triglycerides Tween 20 or
a fatty acid was used as the sole carbon source (see Figs 3
and 4a) and secreted a triacylglycerol lipase to the medium (Fig. 4b). On the other hand, the mutant was unable
to grow in the medium containing olive oil, or Tween 20
as the carbon source (Fig. 4a) and as would be expected
did not secrete lipase to the medium (Fig. 4b), but grew
in the medium containing a fatty acid, although with a
yeast morphology (Fig. 3).
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
552
C. Fonseca-Garcı́a et al.
a
b
c
(A)
(B)
Fig. 3. Cell morphology of wild type and ΔpalB/rim13 mutant of Ustilago maydis grown with a lipid compounds as carbon source. Strains were
grown in pH 8.5 MM with 0.5% olive oil (a), Tween 20 (b) or 0.5% oleic acid methyl ester (c) as carbon source for 48 h. (A) ΔpalB/rim13
mutant; (B) wild-type strain. Magnification bar: 15 lm.
(a)
(b)
Fig. 4. Growth of the wild-type strain and ΔpalB/rim13 mutant of
Ustilago maydis with olive oil as carbon source and triacylglycerol
lipase secretion. The strains were grown in pH 8.5 MM with 1% olive
oil as carbon source. (a) Growth kinetics. At intervals, cell samples
were recovered and protein content was measured. Squares and
broken lines, wild-type strain; diamonds and solid line, ΔpalB/rim13
mutant. (b) Lipase determination. Symbols as above.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
Intracellular pH homeostasis
We observed that alkaline pH, especially in the presence
of a buffered medium, was inhibitory of the growth of
the mutant in comparison with the wild-type strain, suggesting a decreased capacity to regulate the intracellular
pH (not shown). We, therefore, proceeded to measure
the internal pH of the wild-type and the mutant strains
as a response to alterations in the pH of the culture medium. As shown in Table 3, the wild-type strain showed an
intracellular pH (pHi) of about 7.83 and the mutant
strain a pH of about 7.92 in both culture media of pH
6.0 or 8.5. Then, we proceeded to induce a change in the
pH of the culture medium. Cells incubated for 24 h in
pH 6.0 MM were transferred to media of different pH
values for different time periods, and pHi was measured.
The wild-type strain showed the capacity to maintain
almost constant pHi values, whereas the mutant failed to
do so (Table 3).
Analysis of the expression of genes encoding a
membrane ATPase and a sodium/proton
transporter
In light of the results obtained, we proceeded to measure
the transcript levels of the genes that encode a H+-ATPases of P-type from the plasma membrane (PMA1) and the
Na+/H+-Enhancer. The results shown in Fig. 5 show that
FEMS Yeast Res 12 (2012) 547–556
553
Pal/Rim regulation in U. maydis
Table 3. Homeostasis of intracellular pH of Ustilago maydis
ΔpalB/rim13
Wild type
External pH
Internal pH
6.0
8.5
6.0–9.0 (5 h)
6.0–9.5 (3 h)
6.0–10.0 (3 h)
7.846
7.805
7.896
7.911
7.928
±
±
±
±
±
0.01
0.013
0.015
0.018
0.02
pH
variation
0.040
–
0.050
0.065
0.082
Internal pH
7.945
7.905
8.294
8.467
8.674
±
±
±
±
±
0.034
0.031
0.08
0.07
0.091
pH
variation
0.040
–
0.249
0.522
0.729
Intracellular pH of the wild-type strain and the DpalB/rim13 mutant
was measured with the fluorophore BCECF-AM. Results are the average of three experiments; ±experimental error. The differences of
internal pH between the wild type and the mutant are statistically significant at 95% confidence.
Fig. 5. Expression of the H+-ATPase PMA1 gene in the wild-type
strain and ΔpalB/rim13 mutant of Ustilago maydis. Cells were grown
in pH 6.0 MM containing 100 mM potassium phosphate or pH 8.5
MM containing 100 mM Tris–HCl at 28 °C for 20 h under constant
shaking, and gene expression was measured by RT-PCR. Data are
expressed related to EFa expression (1.0). White bars, PMA1
expression in the wild-type strain; black bars, PMA1 expression in the
ΔpalB/rim13 mutant; gray bars, EFa expression in the wild-type strain.
transcript of the gene encoding the H+-ATPase PMA1 in
the wild strain showed higher values at slightly acidic pH,
whereas in the mutant strain, it was higher at alkaline
pH. On the other hand, the Na+/H+-Enhancer was
unchanged in its expression in the mutant strain as compared to wild type (data not shown).
Discussion
The response of fungi to changes in the pH of the medium is an important mechanism for survival in the wild.
Until now, three different mechanisms that play this
function have been described, probably the most important of which is the one called Pal or Rim pathway
(reviewed by Peñalva & Arst, 2004; Peñalva et al. 2008).
This pathway, originally described in Ascomycota species,
is now known to be present in Basidiomycota as well
FEMS Yeast Res 12 (2012) 547–556
(Aréchiga-Carvajal & Ruiz-Herrera, 2005; Cervantes-Chávez et al., 2010), although it is noteworthy that unlike
Ascomycota, Basidiomycota posses only homologues of
the genes encoding the components of the endosomal
membrane complex of the pathway, plus PalI/Rim9
known to be located in the plasma membrane, but playing only a minimal role (Cervantes-Chávez et al., 2010).
Accordingly, the mechanisms by which Basidiomycota,
including U. maydis, perceive the external pH are still
unknown.
In this study, we analyzed the characteristics of a representative pal/rim mutant of U. maydis, ΔpalB/rim13, that
shares with mutants ΔpacC/rim101, ΔpalA/rim20, and
ΔpalC/rim23, a pleiotropic phenotype (Aréchiga-Carvajal
& Ruiz-Herrera, 2005; Cervantes-Chávez et al., 2010),
with the goal to identify the signaling mechanisms that
have a relationship with the Pal/Rim pathway.
An early observation of the alterations occurring in
pal/rim mutants was their incapacity to secrete extracellular enzymes (see reviews by Peñalva & Arst, 2002, 2004
for a discussion). This phenotype was also displayed by
the homologous mutants of U. maydis that failed to
secrete a protease (Aréchiga-Carvajal & Ruiz-Herrera,
2005; Cervantes-Chávez et al., 2010). The evidence that
this alteration can be applied in general to other extracellular enzymes is the observation that the ΔpalB/rim13
mutant used in this study failed to secrete a triacylglycerol lipase, in contrast to the parental strain.
One of the most salient phenotypic characteristic of
pal/rim mutants of U. maydis is to secrete a polysaccharide to the culture medium which we have characterized
as a nonbranched b-1,3-glucan (Fonseca-Garcı́a et al.,
2011). This result suggested that the mutant might be
affected in the construction of the cell wall and that the
secreted glucan should form part of the structure in the
normal cell wall from the wild-type strain. This hypothesis is supported by the observation that the cell wall of
the palB/rim13 mutant contains significantly lower levels
of b-1,3-glucan, mainly the alkali-soluble one, than the
wild-type strain. However, the observation that the GLS
gene that encodes the single b-1,3-glucan synthase was
expressed to the same levels in the wild-type and the
mutant strains indicates that the alterations in the regulation do not occur at the level of the transcription of the
structural gene.
Further results showing major alterations in the structure of the cell wall of the palB/rim13 strain suggest a
possible mode of action of the mutation. Accordingly,
transmission electron microscopy of the cells showed that
the wall of the mutant strain is considerably thinner than
the cell wall of the wild-type strain. Additionally, the
mutant contains lower amounts of chitin in the cell wall,
an observation associated with the demonstration that the
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
554
transcript levels of three Chs encoding genes: CHS1,
CHS2, and CHS8 are lower in the mutant strain, against
a single gene (CHS6) that contains higher transcript levels
in the mutant strain. A further piece of evidence in the
same line is that the mutant contains lower amounts of
protein in the cell wall; and finally, that it excretes larger
amounts of proteins to the culture medium. All these differences may suggest a weakening and failure of the wall
structure in the mutant strain, revealing a relationship
between the Pal/Rim pathway and the MAPK pathway,
which is involved in maintaining the integrity of the cell
wall (Antonsson et al., 1994; Davenport et al., 1995;
Levin, 2005; Castrejon et al., 2006).
In this work, we confirmed the data previously
described (Cervantes-Chávez et al., 2010) that the palB/
rim13 mutant was more sensitive than the wild-type
strain to different types of stress effectors, such as oxidative and monovalent cations, but not osmotic or divalent
cations. The sensitivity of U. maydis pal/rim mutants to
monovalent cations is probably related to the observation
that they are affected in the transcription of ENA genes
(Benito et al., 2009; Cervantes-Chávez et al., 2010) that
have been described to encode proteins involved in cation
pumping and that are regulated by the Pal/Rim pathway
(Cervantes-Chávez et al., 2010). In contrast to these
results, we observed that transcription of the gene encoding the Na+/H+-Enhancer was unchanged in the mutant
strain as compared to wild type, apparently indicating
that this gene is not under regulation of the Pal/Rim
pathway. On the other hand, the gene encoding the H+ATPase PMA1 is under negative regulation at alkaline pH
by the Pal/Rim pathway. Interestingly, the PMA1-encoding gene has a putative binding motif of PacC/Rim101,
whereas the one that codes for the Na+/H+-Enhancer
does not. It is known that the H+-ATPase PMA1 is a vital
enzyme generating and maintaining a transmembrane
electrochemical proton gradient, thus supporting secondary solute transport systems. This proton pump plays an
active role in maintaining yeast cell ion homeostasis and
intracellular pH (Petrov, 2010). All these results suggest
that the Pal/Rim pathway has a relationship with the
pathway involved in stress response (Gustin et al., 1998),
but not with the high osmolarity pathway (HOG) (Gustin
et al., 1998).
Although it is accepted that the Pal/Rim pathway is
responsible for the response to changes in the external
pH, it seems odd that there are no data on the changes
in the internal pH of pal/rim fungal mutants, when they
are subjected to changes in the pH of the medium. For
this reason, our data on the determination of the changes
occurring in the intracellular pH of the U. maydis mutant
and the wild-type strains in response to alterations in the
extracellular pH are very important. The observation that
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
C. Fonseca-Garcı́a et al.
the wild-type strain is able to maintain almost constant
the internal pH independently of the changes occurring
in the exterior, whereas the mutant is unable to do so,
suggests that possibly the main role of the Pal/Rim pathway is to maintain constant the internal pH independently of changes occurring in the external medium, a
feat apparently performed by an adequate maneuvering of
the membrane ion transporters.
Acknowledgements
This work was partially supported by CONACYT, México. CFG was an MSc student supported by a CONACYT
fellowship. We thank Aurora Verver-y-Vargas and Alicia
Mireles for their valuable technical support and to Mr.
Antonio Cisneros for photographs.
References
Antonsson B, Montessuit S, Friedli L, Payton MA & Paravicini
G (1994) Protein kinase C in yeast. Characteristics of the
Saccharomyces cerevisiae PKC1 gene product. J Biol Chem
269: 16821–16828.
Aréchiga-Carvajal ET & Ruiz-Herrera J (2005) The RIM101/
pacC homologue from the Basidiomycete Ustilago maydis is
functional in multiple pH-sensitive phenomena. Eukaryot
Cell 4: 999–1008.
Arst HN Jr & Peñalva MA (2004) pH regulation in Aspergillus
and parallels with higher eukaryotic regulatory systems.
Trends Genet 19: 224–231.
Balgi AD, Diering GH, Donohue E, Lam KK, Fonseca BD,
Zimmerman C, Numata M & Roberge M (2011) Regulation
of mTORC1 signaling by pH. PLoS ONE 6: e21549.
Banuett F & Herskowitz I (1989) Different a alleles of Ustilago
maydis are necessary for maintenance of filamentous growth
but not for meiosis. P Natl Acad Sci USA 86: 5878–5882.
Benito B, Garciadeblás B, Pérez-Martı́n J & Rodrı́guezNavarro A (2009) Growth at high pH, and sodium and
potassium tolerance in above cytoplasmic pH media
depend on ENA ATPases in Ustilago maydis. Eukaryot
Cell 8: 821–829.
Bensen ES, Martin SJ, Li M, Berman J & Davis DA (2004)
Transcriptional profiling in Candida albicans reveals new
adaptive responses to extracellular pH and functions for
Rim101p. Mol Microbiol 54: 1335–1351.
Blanchin-Roland S, Da Costa G & Gaillardin C (2005)
ESCRT-I components of the endocytic machinery are
required for Rim101-dependent ambient pH regulation
in the yeast Yarrowia lipolytica. Microbiology 151: 3627–
3637.
Blanchin-Roland S, Da Costa G & Gaillardin C (2008)
Ambient pH signalling in the yeast Yarrowia lipolytica
involves YlRim23p/PalC, which interacts with Snf7p/
Vps32p, but does not require the long C terminus of
YlRim9p/PalI. Microbiology 154: 1668–1676.
FEMS Yeast Res 12 (2012) 547–556
Pal/Rim regulation in U. maydis
Bradford MM (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein dye binding. Anal Biochem 72: 248–254.
Bravo R & Macdonald-Bravo H (1986) Effect of pH on the
induction of competence and progression to the S-phase in
mouse fibroblasts. FEBS Lett 195: 309–312.
Butcher RW & Sutherland EW (1962) Adenosine 3′,5′phosphate in biological materials. I. Purification and
properties of cyclic 3′,5′-nucleotide phosphodiesterase and
use of this enzyme to characterize adenosine 3′,5′-phosphate
in human urine. J Biol Chem 237: 1244–1250.
Caracuel Z, Roncero MI, Espeso EA, González-Verdejo CI,
Garcı́a-Maceira FI & Di Pietro A (2003) The pH signalling
transcription factor PacC controls virulence in the plant
pathogen Fusarium oxysporum. Mol Microbiol 48: 65–779.
Castrejon F, Gomez A, Sanz M, Duran A & Roncero C (2006)
The rim101 pathway contributes to yeast cell wall assembly
and its function becomes essential in the absence of
mitogen-activated protein kinase slt2p. Eukaryot Cell 5: 507–
517.
Cervantes-Chávez A, Ortiz-Castellanos L, Tejeda-Sartorius M,
Gold S & Ruiz-Herrera J (2010) Functional analysis of the
pH responsive pathway Pal/Rim in the phytopathogenic
basidiomycete Ustilago maydis. Fungal Genet Biol 47: 446–
457.
Chambard JC & Pouyssegur J (1986) Intracellular pH controls
growth factorinduced ribosomal protein S6 phosphorylation
and protein synthesis in the G0–G1 transition of fibroblasts.
Exp Cell Res 164: 282–294.
Chiche J, Ilc K, Laferriere J, Trottier E, Dayan F, Mazure NM,
Brahimi-Horn MC & Pouyssegur J (2009) Hypoxiainducible
carbonic anhydrases IX and XII promote tumor cell growth
by counteracting acidosis through the regulation of the
intracellular pH. Cancer Res 69: 358–368.
Cornet M, Bidard F, Schwarz P, Da Costa G, Blanchin-Roland
S, Dromer F & Gaillardin C (2005) Deletions of endocytic
components VPS28 and VPS32 affect growth at alkaline pH
and virulence through both RIM101-dependent and
RIM101-independent pathways in Candida albicans. Infect
Immun 73: 7977–7987.
Davenport KR, Sohaskey M, Kamada Y, Levin DE & Gustin
MC (1995) A second osmosensing signal transduction
pathway in yeast. Hypotonic shock activates the PKC1
protein kinase-regulated cell integrity pathway. J Biol Chem
270: 30157–30161.
Davis D (2003) Adaptation to environmental pH in Candida
albicans and its relation to pathogenesis. Curr Genet 44: 1–7.
Davis DA, Edwards JE Jr, Mitchell AP & Ibrahim AS (2000)
Candida albicans rim101 pH response pathway is required
for host-pathogen interactions. Infect Immun 68: 5953–
5959.
Dimler RJ, Schaeffer WC, Wise CS & Rist CE (1952)
Quantitative paper chromatography of D-glucose and its
oligosaccharides. Anal Chem 24: 1411–1414.
FEMS Yeast Res 12 (2012) 547–556
555
Dische Z (1962) Color reactions of hexosamines. Methods in
Carbohydrate Chemistry, Vol. 1 (Whistler RL & Wolfram
ML, eds), pp. 507–512. Academic Press, New York.
Fonseca-Garcı́a C, López MG, Aréchiga-Carvajal ET & RuizHerrera J (2011) A novel polysaccharide secreted by pal/rim
mutants of the phytopathogen fungus Ustilago maydis.
Carbohydr Polym 86: 1646–1650.
González-López CL, Szabo R, Blanchin-Roland S &
Gaillardin C (2002) Genetic control of extracellular
protease synthesis in the yeast Yarrowia lipolytica. Genetics
160: 417–427.
Gustin MC, Albertyn J, Alexander M & Davenport K (1998)
MAP Kinase pathways in the yeast Saccharomyces cerevisiae.
Microbiol Mol Biol Rev 62: 1264–1300.
Holliday R (1961) The genetics of Ustilago maydis. Genet Res
2: 203–230.
Jolicoeur M, Germette S, Gaudette M, Perrier M & Becard G
(1998) Intracellular pH in arbuscular mycorrhizal fungi. A
symbiotic physiological marker. Plant Physiol 116: 1279–
1288.
Klose J, de Sá MM & Kronstad JW (2004) Lipid-induced
filamentous growth in Ustilago maydis. Mol Microbiol 52:
823–835.
Kullas AL, Martin SJ & Davis D (2007) Adaptation to
environmental pH: integrating the Rim101 and calcineurin
signal transduction pathways. Mol Microbiol 66: 858–871.
Lamb TM & Mitchell AP (2003) The transcription factor
Rim101p governs ion tolerance and cell differentiation by
direct repression of the regulatory genes NRG1 and SMP1
in Saccharomyces cerevisiae. Mol Cell Biol 23: 677–686.
Lamb TM, Xu W, Diamond A & Mitchell AP (2001) Alkaline
response genes of Saccharomyces cerevisiae and their
relationship to the RIM101 pathway. J Biol Chem 276:
1850–1856.
Latge JP (1999) Aspergillus fumigatus and aspergillosis. Clin
Microbiol Rev 12: 310–350.
Levin DE (2005) Cell wall integrity signaling in Saccharomyces
cerevisiae. Microbiol Mol Biol Rev 69: 262–291.
Martı́nez-Espinoza AD, León C, Elizarraraz G & Ruiz-Herrera
J (1997) Monomorphic nonpathogenic mutants of Ustilago
maydis. Phytopathology 87: 259–265.
Musgrove E, Seaman M & Hedley D (1987) Relationship
between cytoplasmic pH and proliferation during
exponential growth and cellular quiescence. Exp Cell Res
172: 65–75.
Negrutskii BS & El’skaya AV (1998) Eukaryotic translation
elongation factor 1 alpha: structure, expression, functions,
and possible role in aminoacyl-tRNA channeling. Prog
Nucleic Acid Res Mol Biol 60: 47–78.
Orejas M, Espeso EA, Tilburn J, Sarkar S, Arst HN Jr &
Peñalva MA (1995) Activation of the Aspergillus PacC
transcription factor in response to alkaline ambient pH
requires proteolysis of the carboxy-terminal moiety. Genes
Dev 9: 1622–1632.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
556
Peñalva MA & Arst HN Jr (2002) Regulation of gene
expression by ambient pH in filamentous fungi and yeasts.
Microbiol Mol Biol Rev 66: 426–446.
Peñalva MA & Arst HN Jr (2004) Recent advances in the
characterization of ambient pH regulation of gene
expression in filamentous fungi and yeasts. Annu Rev
Microbiol 58: 425–451.
Peñalva MA, Tilburn J, Bignell E & Arst HN Jr (2008)
Ambient pH gene regulation in fungi: making connections.
Trends Microbiol 16: 291–300.
Petrov VV (2010) Point mutations in PMA1 H+-ATPase of
Saccharomyces cerevisiae: influence on its expression and
activity. Biochemistry (Mosc) 75: 1055–1063.
Pouyssegur J, Franchi A, L’Allemain G & Paris S (1985)
Cytoplasmic pH, a key determinant of growth factorinduced DNA synthesis in quiescent fibroblasts. FEBS Lett
190: 115–119.
Rollins JA (2003) The Sclerotinia sclerotiorum pac1 gene is
required for sclerotial development and virulence. Mol Plant
Microbe Interact 16: 785–795.
Rollins JA & Dickman MB (2001) pH signaling in Sclerotinia
sclerotiorum: identification of a pacC/RIM1 Homolog. Appl
Environ Microbiol 67: 75–81.
Ruiz-Herrera J, León C, Carabez-Trejo A & Reyes-Salinas E
(1996) Structure and chemical composition of the cell walls
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
C. Fonseca-Garcı́a et al.
from the haploid yeast and mycelial forms of Ustilago
maydis. Fungal Genet Biol 20: 133–142.
Su SS & Mitchell AP (1993) Molecular characterization of the
yeast meiotic regulatory gene RIM1. Nucleic Acids Res 21:
3789–3797.
Tilburn J, Sarkar S, Widdick DA, Espeso EA, Orejas M,
Mungroo J, Peñalva MA & Arst HN Jr (1995) The
Aspergillus PacC zinc finger transcription factor mediates
regulation of both acid- and alkaline-expressed genes by
ambient pH. EMBO J 14: 779–790.
von Tigerstrom RG & Stelmaschuk S (1989) The use of Tween
20 in a sensitive turbidimetric assay of lipolytic enzymes.
Can J Microbiol 35: 511–514.
Xu W, Smith FJ Jr, Subaran R & Mitchell AP (2004)
Multivesicular body escort components function in pH
response regulation in Saccharomyces cerevisiae and Candida
albicans. Mol Biol Cell 15: 5528–5537.
You BJ & Chung KR (2007) Phenotypic characterization of
mutants of the citrus pathogen Colletotrichum acutatum
defective in a PacC-mediated pH regulatory pathway. FEMS
Microbiol Lett 277: 107–114.
FEMS Yeast Res 12 (2012) 547–556