Biochem. J. (2010) 429, 593–602 (Printed in Great Britain)
doi:10.1042/BJ20100240
593
The role of transmembrane domain 9 in substrate recognition by the fungal
high-affinity glutathione transporters
Anil THAKUR and Anand K. BACHHAWAT1
Institute of Microbial Technology, Sector 39-A, Chandigarh 160 036, India
Hgt1p, a high-affinity glutathione transporter from Saccharomyces cerevisiae belongs to the recently described family of
OPTs (oligopeptide transporters), the majority of whose members
still have unknown substrate specificity. To obtain insights into
substrate recognition and translocation, we have subjected all 21
residues of TMD9 (transmembrane domain 9) to alanine-scanning
mutagenesis. Phe523 was found to be critical for glutathione
recognition, since F523A mutants showed a 4-fold increase in
K m without affecting expression or localization. Phe523 and the
previously identified polar residue Gln526 were on the same
face of the helix suggesting a joint participation in glutathione
recognition, whereas two other polar residues, Ser519 and Asn522 ,
of TMD9, although also orientated on the same face, did not
appear to be involved. The size and hydrophobicity of Phe523 were
both key features of its functionality, as seen from mutational
analysis. Sequence alignments revealed that Phe523 and Gln526
were conserved in a cluster of OPT homologues from different
INTRODUCTION
Hgt1p (or ScOpt1p), a high-affinity glutathione transporter of
the yeast Saccharomyces cerevisiae [1,2], is a member of the
relatively novel, and poorly characterized OPT (oligopeptide
transporter) family [3]. The members of the OPT family
[Transporter Classification (TC) # 2.A.67; http://www.tcdb.org/]
are found in plants, fungi, bacteria and archaea, but are absent
from metazoans [4]. The OPT family has been divided into two
distinct clades: the PT (peptide transport) clade and the YS (yellow
stripe) clade [3,5]. Despite the discovery of the family a decade
ago, only a few members of the OPT family have been functionally
characterized for their substrate specificity and physiological role.
Among the fungi, the functionally characterized members of
the PT clade include Hgt1p from S. cerevisiae, and Pgt1 from
Schizosaccharomyces pombe, both of which have been shown
to function as high-affinity glutathione transporters, although
Hgt1p has also been shown to transport oligopeptides, albeit with
lower affinity [1,2,6]. A second PT homologue in S. cerevisiae,
OPT2, in contrast does not transport glutathione and has not been
assigned any function. In S. pombe also, in addition to Pgt1,
there are two other OPT members, and, of these, whereas Isp4
was shown to be able to transport oligopeptides, neither Isp4
nor the uncharacterized ORF (open reading frame) SPCC1840.12
was able to transport glutathione [1,3,6]. Candida albicans
has eight OPT members: CaOPT1–CaOPT8. These have been
shown to be involved in oligopeptide uptake, but the role in
glutathione uptake, if any, has not been evaluated [7,8]. Among
the PT clade members in plants, Arabidopsis thaliana has eight
fungi. A second cluster contained isoleucine and glutamate residues in place of phenylalanine and glutamine residues, residues
that are best tolerated in Hgt1p for glutathione transporter
activity, when introduced together. The critical nature of the
residues at these positions in TMD9 for substrate recognition was
exploited to assign substrate specificities of several putative fungal
orthologues present in these and other clusters. The presence of
either phenylalanine and glutamine or isoleucine and glutamate
residues at these positions correlated with their function as highaffinity glutathione transporters based on genetic assays and the
K m of these transporters towards glutathione.
Key words: alanine scanning, glutathione, glutathione transporter,
high-affinity glutathione transporter 1 (HGT1), oligopeptide
transporter family (OPT), Saccharomyces cerevisiae oligopeptide transporter family 1 (ScOPT1/OPT1).
members, but their substrate specificities have not been clearly
defined. AtOPT1 and AtOPT4 appear to be OPTs, AtOPT3 is
a transporter of a still undefined Fe–chelator complex, whereas
AtOPT6 has also been shown to be able to transport glutathione,
albeit at a very low affinity [9–13]. A very weak glutathione
transporter activity has been shown for the rice OPT, OsOPT6, and
Brassica juncea, BjOPT6 [14,15]. In contrast, few of the plant YS
members from Arabidopsis and Zea mays have been implicated
in the transport of metal-chelating secondary amino acids, such
as iron–deoxymugineic acid complexes [16–18]. However, no
information is available on the substrate specificity or functions
of the fungal or bacterial counterparts in the YS clade.
The ability to assign functions to the members of the OPT
family has been hampered by the very limited information
available on mechanistic or structural aspects of members of the
OPT family, in both the PT and YS clades. Although it is known
that members of this family are proton-coupled transporters [11],
the structural features that confer such distinct substrate specificity
between the two clades and among the individual members within
each clade need to be elucidated. The most extensively studied
OPT member is Hgt1p. Investigations into the role of the cysteine
residues, as well as the polar and charged amino acids in the
TMDs (transmembrane domains) of Hgt1p have revealed that
the TMD helices 1, 4 and 9 and the intracellular loop region
537–568 are important for substrate translocation [19,20].
Furthermore, two residues, Gln222 in TMD4 and Gln526 in TMD9,
were found to be required for substrate recognition [19]. Although
Gln222 in TMD4 was widely conserved in the OPT family, Gln526
of TMD9 appeared to be present only in two known glutathione
Abbreviations used: ECL, enhanced chemiluminescence; HA, haemagglutinin; HGT, high-affinity glutathione transporter; OPT, oligopeptide transporter;
ORF, open reading frame; PT, peptide transport; SD, synthetic-defined; TEF, transcriptional enhancer factor; TMD, transmembrane domain; YS, yellow
stripe.
1
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2010 Biochemical Society
594
A. Thakur and A. K. Bachhawat
transporters, Hgt1p and Pgt1p, further suggesting that it might be
specific for glutathione recognition.
In an effort to further investigate TMD9, which appeared to
be important for substrate recognition among the family of OPT
members, we have, in the present study, carried out an alaninescanning mutagenesis of the 21 amino acid residues of TMD9
of Hgt1p followed by their functional characterization. Whereas
several residues led to a moderate loss in activity, kinetic analysis
of the most severely affected mutant, F523A, revealed that it
plays a critical role in substrate recognition. Multiple sequence
alignments of the TMD9 region of fungal OPTs revealed that the
two key residues of TMD9 involved in glutathione recognition,
Phe523 and Gln526 , were conserved in some OPT members. Some
members contained glutamate and isoleucine residues at these
positions, two changes that we examined in Hgt1p, and found
to be tolerated in relation to glutathione transport by Hgt1p.
Expression and kinetic analysis of representive members of
these putative orthologues indicated that they functioned as
high-affinity glutathione transporters. In contrast, CaOPT1p of
C. albicans, which has hydrophobic amino acids at both of these
positions in TMD9 despite sharing a high overall similarity
with Hgt1p, retained a very weak glutathione transport activity.
In addition to defining the residues important for substrate
recognition in Hgt1p, the present study thus also succeeds in
identifying a glutathione transporter signature present in the
fungal OPT family.
EXPERIMENTAL
Chemicals and reagents
All of the chemicals used in the present study were
analytical grade and obtained from commercial sources. Medium
components were purchased from Difco, Sigma–Aldrich,
HiMedia, Merck India and USB Corporation. Oligonucleotides
were purchased from Sigma India. Restriction enzymes, Vent
DNA polymerase and other DNA-modifying enzymes were
obtained from New England Bio Labs. A DNA sequencing kit
(ABI PRISM 310 XL with dye-termination cycle sequencing
ready reaction kit) was obtained from PerkinElmer. Gel-extraction
kits and plasmid miniprep columns were obtained from Qiagen
or Sigma. [35 S]GSH (specific activity 1000 Ci/mmol) was
purchased from the Bhabha Atomic Research Centre. HA
(haemagglutinin)-tagged (6E2) mouse monoclonal antibody and
horse anti-mouse HRP (horseradish peroxidase)-linked antibody
were bought from Cell Signaling Technology. Alexa Fluor®
488-conjugated goat anti-mouse antibody was obtained from
Molecular Probes. Hybond ECL (enhanced chemiluminescence)
nitrocellulose membrane and ECL plus Western blotting detection
reagents were purchased from Amersham Biosciences.
Strains, medium and growth conditions
The Escherichia coli strain DH5α was used as a cloning host. The
S. cerevisiae strain ABC 817 (MATa his3Δ1 leu2Δ0 met15Δ-0
ura3Δ0 hgt1Δ:: LEU2) and the S. pombe strain ABC 2187 (hleu1-32 ura4-c190T cys1aΔ pgt1Δ::ura4) deficient in glutathione
uptake ability were used as hosts in the complementation
studies [1,6]. Kluyveromyces lactis (MTCC 223) and Pichia
guilliermondii (MTCC 1311) were obtained from the Microbial
Type Culture Collection (Institute of Microbial Technology,
Chandigarh, India). C. albicans Sc5314 was obtained from Dr
K. Ganesan (Institute of Microbial Technology, Chandigarh,
India), and Schizosaccharomyces japonicus (NCYC 419) was
a laboratory stock strain [21]. S. cerevisiae was regularly
c The Authors Journal compilation c 2010 Biochemical Society
maintained on YPD (yeast extract, peptone and dextrose) medium.
S. pombe was maintained on YES (yeast extract, dextrose
and supplements) medium. S. cerevisiae SD (synthetic-defined)
minimal medium contained yeast nitrogen base, ammonium
sulfate and dextrose supplemented with histidine, leucine and
methionine (when required) at 50 mg/l [22]. For S. pombe, SD
EMM (Edinburgh minimal medium) was prepared as described
previously [23]. Glutathione was added as required. Growth,
handling of bacteria and yeast, and all of the molecular techniques
used in the present study were according to standard protocols [24]
Site-directed mutagenesis
HGT1, tagged with an HA tag at the C-terminus, was subcloned
downstream of the TEF (transcriptional enhancer factor) promoter
at BamHI and EcoRI sites of a modified p416TEF vector
[20]. This construct was used as a template for site-directed
mutagenesis for creation of different site-directed mutants of
Hgt1p, by a splice overlap extension strategy. The mutations
were directly generated using different mutagenic oligonucleotides (Supplementary Table S2 at http://www.BiochemJ.
org/bj/429/bj4290593add.htm), and the PCR products generated
with these oligonucleotides were subcloned back into the TEF
vector background (pTEF-His-HGT1m-HA) using appropriate
restriction sites, for subsequent analyses. The resulting mutants
were sequenced to confirm the presence of the desired nucleotide
changes and rule out any undesired mutations introduced during
the mutagenic procedure. For tagging the CaOPT1 gene with HA,
we tagged the C-terminus of CaOPT1 with an HA epitope by
PCR mutagenesis. CaOPT1 has a single CUG codon at position
371, predicted to code for serine in C. albicans and leucine in
S. cerevisiae, and we also mutated this codon by site-directed
mutagenesis so that it codes for serine in S. cerevisiae.
The dual ‘complementation-cum-toxicity’ plate assay for assessing
HGT1 functionality
The dual complementation-cum-toxicity assay has been described
previously [19,20]. The S. cerevisiae met15hgt1 strain (ABC
817) was transformed with a single-copy centromeric vector expressing wild-type or different mutants of TMD9 of HGT1
expressed downstream of the TEF promoter. Transformants were
grown in minimal medium containing methionine and other
supplements, without uracil, overnight. These cultures were reinoculated in the same medium and allowed to grow until they
reached exponential phase. An equal number of cells were
harvested, washed with water and resuspended in sterile water
to a D600 of 0.2. These were serially diluted 1:10, 1:100 and
1:1000. Cell resuspensions (10 μl) were spotted on to minimal
medium containing different concentrations of glutathione (15,
30, 50, 100, 150 and 200 μM) or methionine (200 μM) as the
sole organic sulfur source. The plates were incubated at 30 ◦C for
2–3 days and photographs were taken.
Glutathione transport assay
The S. cerevisiae ABC 817 strain (met15Δhgt1Δ) was
transformed with different plasmids constructs bearing wildtype or HGT1 mutants under the TEF promoter and were
grown in minimal medium containing methionine and other
supplements, without uracil, overnight. These cultures were reinoculated in the same medium and allowed to grow until they
reached exponential phase. Cells were harvested, washed and
placed on ice in a Mes-buffered medium, until the transport was
initiated. Transport experiments were carried out with [35 S]GSH
High-affinity glutathione transporter clusters in fungi
595
as described previously [1]. The results were expressed as nmol
of glutathione/mg of protein per min. For the measurements of
total protein, 100 μl of the above cell suspension (cell suspension
volume used for the transport assay) was boiled with 15 % sodium
hydroxide for 10 min, followed by neutralization of total cell
lysate by the addition of hydrochloric acid. A 100 μl aliquot of
this crude cell lysate was incubated with 0.1 % Triton X-100 for
10 min and total protein was estimated using Bradford reagent
(Sigma) with BSA as a standard. For saturation kinetics, the initial
rate of glutathione uptake was measured at a range of glutathione
concentrations from 12.5 μM to 400 μM, with specific activity
being kept constant at each concentration. The initial rate of glutathione uptake was determined by measuring the radioactive
glutathione accumulated in the cells at 30 s and 180 s time
points in the ABC 817 strain transformed with different plasmid
constructs bearing wild-type or HGT1 mutants and KlHgt1,
SjHgt1 or CnHgt1 under the TEF promoter or only empty vector,
after subtracting the initial rate of glutathione uptake with vector
alone from the initial rate of glutathione uptake with the different
test constructs. Using Microsoft Excel, the Lineweaver–Burk
best-fit plot was obtained, which was used to calculate the kinetic
parameters. The average K m and V max values were calculated.
The experiment was repeated a minimum of two times for each
test construct in duplicate at each glutathione concentration. The
corrected V max values indicated that the kinetic parameters were
normalized to the protein expression levels.
Preparation of cell extract and immunoblot analysis
Total crude cell preparation and immunoblot analysis was
performed as described previously [20]. Densitometry analysis of
the unsaturated band signals was performed using the Scion Image
software to quantify the protein expression levels in different
mutants. The resulting signal intensity was normalized with
respect to the band surface area (in square pixels) and expressed
in arbitrary units. The relative protein expression levels in the
mutant Hgt1p were represented as the percentage expression
relative to wild-type Hgt1p, as the means of three independent
blotting experiments.
Cellular localization of the mutant proteins by confocal microscopy
To localize Hgt1p and its different alanine mutants, indirect
immunofluorescence was performed using a published protocol,
modified as described previously [20]. Images were obtained with
an inverted LSM510 META laser-scanning confocal microscope
(Carl Zeiss) fitted with a Plan-Apochromat ×100 (numerical
aperture, 1.4) oil-immersion objective. The 488 nm line of an
argon ion laser was directed over an HFT UV/488 beam splitter,
and fluorescence was detected using an NFT 490 beam splitter in
combination with a BP 505–530 band pass filter. Images obtained
were processed using Adobe Photoshop version 5.5.
Multiple sequence analysis and phylogenetic analysis
The OPT sequences were retrieved from Entrez. The multiple
sequence alignment of the protein sequences was generated using
the ClustalW program using default parameters [27], and MEGA
3.1 software [28] was used to visualize the phylogenetic tree of
the family
RESULTS
Alanine-scanning mutagenesis of TMD9
The predicted TMD9 of Hgt1p contains 21 amino acids [29]
that include three polar residues, Ser519 , Asn522 and Gln526
Figure 1 Hgt1p topology showing that the location of the TMDs and residues
Phe523 and Gln526 in TMD9 critical for the transport activity of Hgt1p falls on
the hydrophilic face of the transmembrane domain
(A) The 12 TMDs are shown as rectangular bars. TMD9 is drawn out to display all of the 21
amino acid residues. The shaded circles indicate the key residues Phe523 and Gln526 . (B) Helical
wheel representation of TMD9 of Hgt1p viewed from the exoplasmic surface of the membrane.
Amino acid representation is by the single letter code. The black arrows point to the residues
where alanine substitution resulted in a drastic fall in the transport activity of Hgt1p. The helical
wheel model of the TMD9 of Hgt1p was constructed using the Lasergene software Protean
version 8.1 (DNAstar) [35]. (C) The side view of the helix with the extracellular side kept on the
top. The key residues showing severe and moderate effects are highlighted. The side view of
the TMDs was drawn using the prediction model PyMol Molecular Viewer (version 0.99).
(Figure 1). To assess the contribution of these individual residues
in glutathione transport, each of the 18 non-alanine residues were
mutated to alanine by site-directed mutagenesis. In addition,
the three alanine residues (Ala509 , Ala511 and Ala515 ) were
mutated to glycine, to examine whether the side chains of these
alanine residues might be functionally important. Each of the
mutants was subjected to an initial functional characterization
using a previously designed sensitive plate assay, termed a
dual complementation-cum-toxicity assay [19,20]. The assay
is based on the dual behaviour of HGT1 expressed under the
strong constitutive TEF promoter in a met15Δhgt1Δ strain.
The met15Δhgt1Δ strain is an organic sulfur auxotroph owing
to met15Δ, and is also deficient in glutathione uptake owing to
hgt1Δ. At a low glutathione concentration (15 μM), HGT1
expressed under the TEF promoter complements the growth
defect, whereas at higher glutathione concentrations (50 μM or
higher), the HGT1 expressed under the TEF promoter shows
toxicity owing to excess glutathione accumulation [30]. Thus the
p416TEF plasmid bearing the different mutants of TMD9 (or
wild-type) were individually transformed into the met15Δhgt1Δ
strain and mutants were analysed for their ability to confer
complementation and/or toxicity on the cells over a range of
c The Authors Journal compilation c 2010 Biochemical Society
596
Figure 2
A. Thakur and A. K. Bachhawat
Functional characterization of alanine mutants of TMD9 of Hgt1p
Hgt1p and the different alanine mutants of Hgt1p expressed under the TEF promoter and corresponding vector (p416TEF) were transformed into strain ABC 817 and evaluated by the
complementation-cum-toxicity assay by dilution spotting on minimal medium containing glutathione. Transformants were grown in minimal medium containing methionine, harvested, washed and
resuspended in water and serially diluted to give D 600 values equal to 0.2, 0.02, 0.002 and 0.0002. A 10 μl aliquot of these dilutions were spotted on to minimal medium containing different
concentrations of glutathione (GSH). The photographs were taken after 2 days of incubation at 30 ◦C.
glutathione concentrations (Figure 2). As seen in Figure 2, the
different mutations exhibited a differential effect on the ability of
the cells to grow on glutathione at low and high concentrations as
compared with the wild-type Hgt1p. Hence, based on their growth
behaviour in the dual complementation-cum-toxicity assay, the
mutants were characterized into four groups. The ‘severe effect’
group included those in which complementation was defective at a
glutathione concentration of 15 μM. The ‘moderate effect’ group
included those in which complementation was observed at 15 μM,
but toxicity was not seen at higher glutathione concentrations.
The ‘mild effect’ group was those in which complementation was
observed at 15 μM, but which show limited toxicity at higher
concentrations. The ‘very mild to no effect’ group were mutants
in which complementation was observed at 15 μM, and toxicity
was seen at a higher concentration of glutathione (mutant very
similar to wild-type protein) (Table 1).
On the basis of this functional plate assay, only F523A, in
addition to Q526A, showed a very severe defect in functionality,
and the A515G, I524A, P525A and I529A mutants showed a
moderate effect on functional activity of Hgt1p. Five mutants
had a mild effect (W510A, F512A, I516A, S518A and I528A),
and the remaining mutants (A509G, A511G, V513A, I514A,
L517A, S519A, L520A, V521A, N522A and G527A) had no,
or an insignificant, effect being close to or comparable with wildtype (Table 1), and were not pursued further.
Functional evaluation of mutants by radioactive-uptake assay
Although the plate assay is a very sensitive reflection of the
functionality of the mutants, it was still necessary to confirm
their functionality biochemically, by direct radioactive uptake
assays. The mutants falling in the ‘severe’, ‘moderate’ or ‘mild’
category were evaluated by measuring the initial rate of [35 S]GSH
uptake in the met15Δhgt1Δ strain, transformed with the different
mutants of TMD9 of Hgt1p. We found that the results from the
uptake assay were similar to the genetic assay and defined groups
c The Authors Journal compilation c 2010 Biochemical Society
of activity similar to the plate assay (Table 1). Out of the 21
mutants of TMD9, F523A, like the previously described Q526A,
displayed substantially reduced transport activity. Four mutants
(A515G, I524A, P525A and L529A) led to a moderate effect on
functional activity of Hgt1p. Five mutants had a mild effect
(W510A, F512A, I516A, S518A and I528A). The remaining
mutants showed little or no effect in the genetic assay and
were not analysed (Table 1). Analysis of the steady-state
protein levels of these mutants revealed that the protein expression levels of the mutants ranged between 50 and 90 % relative
to the wild-type protein levels (Supplementary Figures S1A
and S1B at http://www.BiochemJ.org/bj/429/bj4290593add.htm).
Only mutants I524A and P525A showed a significant fall in
protein levels, and it is likely that the decreased protein levels
in these mutants could account for the loss in functionality for
these, but not for the other, mutants.
Analysis of cell-surface trafficking of mutants with loss in
functional activity
As Hgt1p is a plasma-membrane-localized transporter [20],
it was important to examine the defective mutants expressed
under the TEF promoter for their subcellular localization.
This was carried out by indirect immunofluorescence using an
anti-HA monoclonal antibody as a primary antibody followed
by the Alexa Fluor® 488-conjugated secondary antibody images
captured by confocal microscopy as described previously [20].
A signal was observed at the plasma membrane of the cells
transformed with wild-type Hgt1p as well as the defective mutants
(Supplementary Figure S2 at http://www.BiochemJ.org/bj/429/
bj4290593add.htm). Interestingly, although F512A and I524A
were predominantly localized to the plasma membrane, they also
showed a small amount of intracellular signal in addition to the
cell-surface signal in a few of the cells, suggesting a partial defect
in trafficking of these mutants. However, the remaining mutants,
W510A, F512A, A515G, I516A, S518A, F523A, I524A, P525A,
High-affinity glutathione transporter clusters in fungi
597
Table 1 Grouping of the alanine mutants of Hgt1p based upon their effect
on the functional activity of the transporter using the dual complementationcum-toxicity assay and percentage transport activity
Data were obtained from three independent experiments performed with duplicates and are
represented as the percentage activity relative to wild-type Hgt1p. Visual scoring symbols: +,
yes; +/−, mild; −, no; N.D., not determined.
Mutant
Wild-type Hgt1p
Severe effect
(complementation
defective)
F523A
Q526A
Moderate effect (no
toxicity)
A515G
I524A
P525A
L529A
Mild effect (mild
toxicity at high GSH
concentrations)
W510A
F512A
I516A
I518A
I528A
No effect
A509G
A511G
V513A
I514A
L517A
S519A
L520A
V521A
N522A
G527A
Complementation
(15 μM GSH)
Toxicity
(>50 μM GSH)
Transport
activity (%)
+
+
100
−
−
−
−
18
20
+
+
+
+
−
−
−
−
29
24
24
31
+
+
+
+
+
+/−
+/−
+/−
+/−
+/−
83
49
69
54
39
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+/−
+
N.D.
N.D.
N.D.
N.D.
N.D.
N.D.
N.D.
N.D.
N.D.
N.D.
Q526A, I528A and L529A, localized correctly to the plasma
membrane.
Kinetic analysis of F523A reveals a role in substrate binding and
translocation
The only mutant in TMD9, other than the previously described
Q526A, that was severely affected in function was F523A. Among
the mutants that were moderately affected in function were
A515G, I524A, P525A and L529A. In a previous study using
similar criteria, we had observed that mutants that were falling into
the ‘moderately effected’ group which were amenable to kinetic
analysis showed no significant change in either substrate binding
or catalysis [19]. Furthermore, of the four mutants falling into
this category in the present study, mutants I524A and P525A had
significantly lower protein level expression, which might account
for much of the defect. We therefore did not follow up this category
of mutants for kinetic analysis and only focused on F523A, the
single mutant other than the previously described Q526A that
showed a severe affect in activity. As this mutant displayed almost
normal levels of protein expression, and was also localized to
the cell surface, it suggested a more direct role in glutathione
binding and translocation. To gain further insight into the
mechanism by which the F523A mutant resulted in decreased
transport of glutathione, this mutant was further characterized by
carrying out detailed kinetic analysis. The K m and V max values
Figure 3 Multiple sequence alignment for the protein sequences of the PT
members of the OPT family
Sequences of S. cerevisiae Hgt1, K. lactis (GenBank® accession number XP 453962.1), Z.
rouxii (GenBank® accession number XP 002496449.1), P. pastoris (GenBank® accession
number XP 002493413.1), C. lusitaniae (GenBank® accession number XP 002615150.1), P.
guilliermondii (GenBank® accession number XP 001486861.1), S. pombe Pgt1, S. japonicus
(GenBank® accession number XP 002172910.1), C. neoformans (GenBank® accession
number XP 772672.1), Aspergillus niger (GenBank® accession number XP 001397394.1),
Aspergillus flavus (GenBank® accession number XP 002381590.1), Penicillium chrysogenum
(GenBank® accession number XP 002567631.1), Sclerotinia sclerotiorum (GenBank®
accession number XP 001585829.1), Botryotinia fuckeliana (GenBank® accession number
XP 001547017.1), C. albicans Opt1, Candida tropicalis (GenBank® accession number
XP 002546105.1), Debaryomyces hansenii (GenBank® accession number XP 458419.1),
Yarrowia lipolytica (GenBank® accession number XP 502145.1), Aspergillus nidulans
(GenBank® accession number XP 664792.1) and Neurospora crassa (GenBank® accession
number XP 964577.1) were retrieved from Entrez at the NCBI website and aligned using the
ClustalW program. The sequence alignment has been edited to show only TMD9. Residues
corresponding to Phe523 and Gln526 are shaded.
for wild-type Hgt1p were estimated to be 48.1 +
− 10.5 μM and
57.8 +
3.9
nmol
of
glutathione/mg
of
protein
per
min
[19]. Kinetic
−
characterization of the mutant revealed that the F523A mutant had
a 4-fold increased K m for GSH (K m = 182.2 +
− 39.9 μM) and also
exhibited a loss in V max value (corrected V max = 29.2 +
− 3.0 nmol
of glutathione/mg of protein per min). These findings suggest that
this residue is likely to play a critical role in interacting with the
substrate. Although an approx. 2-fold higher V max value was observed in the wild-type as compared with the F523A, this might be
partially explained by the approx. 1.25-fold higher protein levels
seen in the wild-type as compared with the mutant (Figure 3B).
Functional analysis of Phe523 mutants
The drastic fall in the activity of the F523A mutant and the 4-fold
increase in K m for GSH in this mutant suggested that Phe523
played an important role in binding and transport activity of the
protein. To investigate the nature of interactions being made by
Phe523 that are important for GSH recognition and transport, we
created different mutants where we changed the phenylalanine
c The Authors Journal compilation c 2010 Biochemical Society
598
A. Thakur and A. K. Bachhawat
residue to tryptophan, tyrosine or isoleucine and evaluated
them for their ability to transport glutathione. Functionality
of the transporter was examined by both the genetic assay as
well as by measurement of radioactive uptake. All of these
mutants, F523W, F523I and F523Y, exhibited complementation
at a glutathione concentration of 15 μM, but, with increasing
GSH concentrations, F523Y and F523I showed toxicity at
higher GSH concentration, thus showing a behaviour similar to
that of wild-type protein, whereas F523W was less active as it
showed less toxicity at higher concentrations. F523I exhibited
moderate toxicity as compared with Phe523 (Supplementary Figure
S3A at http://www.BiochemJ.org/bj/429/bj4290593add.htm).
These results were further validated by the radioactive-uptake
assay, where F523W displayed 25–30 % GSH uptake (F523A
had 18–20 %) relative to the wild-type protein at 100 μM GSH.
In contrast, F523Y exhibited approx. 85 % and F523I exhibited
65 % transport activity in the radiolabelled GSH uptake as
compared with wild-type protein (Supplementary Figure S3B).
These observations suggest that the presence of an aromatic
residue was not mandatory for the activity, although it did
influence the transport.
Sequence comparisons of the TMD9 regions of the fungal OPTs
The observation that Phe523 and Gln526 in TMD9 were critical
for substrate recognition in Hgt1p prompted us to examine the
occurrence of these residues as well as other possible conserved
residues in TMD9 of fungal OPT members of the PT clade.
Previously Gln526 was found to be present in the two reported
glutathione transporters, Hgt1 and Pgt1, and was absent from
the other functionally characterized non-glutathione transporters,
suggesting that Gln526 might be a residue specific for high-affinity
glutathione transporters. Multiple sequence alignment of the PT
clade of the fungal OPT family revealed that in TMD9 only two
residues, Phe525 and Gly527 , were conserved across the family.
However, whereas P525A mutants led to a significant fall in
protein expression levels, implicating a role for this residue
primarily in protein stability, the G527A mutant surprisingly
showed no apparent role in glutathione uptake despite its wide
conservation in the family.
When we examined the conservation pattern of Phe523 and
Gln526 of TMD9, we observed that these residues are simultaneously conserved in only a small subset of OPT family members.
Other than S. cerevisiae, these members include the S. pombe
glutathione transporter, Pgt1, as well as still uncharacterized
homologues, present in six other yeasts which include K. lactis,
Zygosaccharomyces rouxii, Candida lusitaniae, Pichia pastoris,
P. guilliermondii and S. japonicus (Figure 3). Importantly,
the phenylalanine and glutamine residues are not found in the
fungal OPT members that have been clearly shown not to play
any role in glutathione transport, such as OPT2 of S. cerevisiae,
Isp4 and SPCC1840.12 of S. pombe [1,6]. It therefore appeared
possible that Phe523 and Gln526 might be critical determinants for
recognition of glutathione as a substrate.
Functional analysis of HGT1 orthologues from K. lactis,
P. guilliermondii and S. japonicus containing phenylalanine
and glutamine in TMD9 identifies these as high-affinity
glutathione transporters
To investigate whether the orthologues of HGT1 in K. lactis
(KlHGT1), P. guilliermondii (PgHGT1) and S. japonicus
(SjHGT1), representatives of members containing the
corresponding Phe523 and Gln526 residues of TMD9, might also
function as high-affinity glutathione transporters, we amplified
c The Authors Journal compilation c 2010 Biochemical Society
and cloned each of these ORFs under the strong constitutive
TEF promoter of S. cerevisiae. We observed complementation of
the mutant strains by KlHGT1 and SjHGT1 indicating that these
two ORFs were able to transport glutathione. We have observed
previously that a strong correlation exists between the ability of
transporters (or mutants) to complement at low concentrations
of glutathione and their affinity for the substrate [6,19]. Thus
complementation at a low concentration of glutathione (15 μM)
requires a transporter to have a low K m (high affinity) for the
substrate. KlHGT1 and SjHGT1 could complement the growth
defect of the met15Δhgt1Δ strain of S. cerevisiae even at low
(15 μM) glutathione concentrations (Supplementary Figure
S4A at http://www.BiochemJ.org/bj/429/bj4290593add.htm).
These results clearly suggest that the KlHGT1 and SjHGT1
encode high-affinity glutathione transporters in K. lactis and S.
japonicus respectively. In the case of PgHGT1, however, it did not
complement the S. cerevisiae met15Δhgt1Δ strain. We therefore
expressed PgHGT1 in S. pombe [under the strong constitutive
ADH (alcohol dehydrogenase) promoter]. PgHGT1 was able
to restore the growth of the S. pombe cys1aΔpgt1Δ strain
(cysteine auxotroph and lacking the glutathione transporter) on
glutathione. Furthermore, PgHGT1 complemented the growth
defect even at low glutathione concentrations, suggesting that
PgHGT1 also functions as a high-affinity glutathione transporter
(Supplementary Figure S4B).
To confirm whether these transporters displayed a high affinity
for glutathione, we determined the K m of the two transporters
that were functional in S. cerevisiae KlHGT1 and SjHGT1. We
observed that KlHGT1 had a K m of 64.3 +
− 8.7 μM, whereas
SjHGT1 had a slightly higher K m of 204.1 +
− 56 μM. These
transporters were therefore clearly functioning as high-affinity
glutathione transporters.
Q526E and the double mutant Q526E/F523I show increased GSH
transport activity as compared with Q526A
Multiple sequence alignment of S. cerevisiae HGT1 with other
fungal OPT family members revealed an isoleucine residue in the
position of phenylalanine (Phe523 ) and a glutamate residue in
the position of glutamine (Gln526 ) (Figure 3). As a phenylalanine to
isoleucine is an acceptable amino acid change at position 523 for
Hgt1p activity, we examined whether Q526E could also display
glutathione transport activity. Glutamine is an amide of glutamate,
and the change from glutamine to glutamate changes the charge at
this position, although the side-chain group is essentially the same.
We observed that the Q526E mutant restored the activity
relative to Q526A, albeit to a very limited extent, but when
we introduced both F523I and Q526E creating a double mutant
Q526E/F523I, it was able to support growth of the met15Δhgt1Δ
strain even at a GSH concentration of 15 μM (Supplementary Figure S5A at http://www.BiochemJ.org/bj/429/bj4290593add.htm).
In terms of radioactive uptake, 35–45 % of activity was observed
in this double mutant (Q526E/F523I) compared with wildtype protein (Figure 4A), and this was despite the mutant
showing reduced protein expression levels relative to the wildtype (Figure 4B). The single and double mutants were all correctly
localized to the cell surface (Supplementary Figure S5B).
Investigation of the putative HGT1 orthologues from Cryptoccocus
neoformans and C. albicans reveals CnHGT1, but not CaOPT1,
as a high-affinity glutathione transporter: enlarging the clusters
of glutathione transporters in fungi
To investigate whether the orthologues of HGT1 which contained
isoleucine and glutamate in place of Phe523 and Gln526 in TMD9
High-affinity glutathione transporter clusters in fungi
Figure 5
599
CaOPT1 of C.albicans is not an efficient glutathione transporter
(A) CaOPT1 of C. albicans expressed under the TEF promoter only weakly accumulates
radiolabelled glutathione in the met15Δhgt1Δ strain of S. cerevisiae. HGT1 of S. cerevisiae and
CaOPT1 of C. albicans under the TEF promoter and the corresponding vectors were used for
the transport assay as described in the Experimental section. Exponential-phase cells were
incubated with [35 S]glutathione (at 100 μM GSH) for different time intervals and counts
were taken to determine the intracellular glutathione accumulation with time. Data are shown as
means +
− S.D. (n = 2). (B) Analysis of the protein expression levels of CaOPT1 in S. cerevisiae
ABC 817. HGT1 of S. cerevisiae and CaOPT1 of C. albicans under the TEF promoter were used
for analysis of the protein expression level as described in the Experimental section.
Figure 4
Functional analysis of Q526E and F523I/Q526E mutants
The ABC 817 strain was transformed with plasmids bearing the mutation in Q526E and
F523I/Q526E of Hgt1p. (A) Measurement of rate of radiolabelled glutathione uptake described
in the Experimental section. The data are presented as the percentage of the rate of uptake by the
mutants relative to wild-type Hgt1p (W.T.). The experiment was repeated twice in triplicate, and
representative data are shown as means +
− S.D. (B) Quantification of the total protein expression
levels as described in the Experimental section. The data are expressed as the percentage
of protein expression normalized to the wild-type expression level; representative data are
means +
− S.D. of the protein expression levels obtained in two independent experiments.
might also function as high-affinity glutathione transporters, we
expressed the C. neoformans orthologue CnHGT1 under the TEF
promoter of S. cerevisiae and examined its ability to complement
the growth defect of the met15Δhgt1Δ strain. Even at 15 μM
glutathione, complementation could be observed and suggested
that CnHGT1 is also a glutathione transporter (Supplementary
Figure S4C). Kinetic analysis revealed it to be a high-affinity
glutathione transporter (K m = 82.5 +
− 15.5 μM)
CaOPT1 is the apparent C. albicans orthologue of Hgt1p (they
are the respective best hit of each other as seen from Reverse
BLAST analysis), and also shows significant sequence similarity
to Hgt1p. CaOPT1 has been described as an OPT that can transport tetra- and octa-peptides [8], but its role in glutathione
transport has never been evaluated. When we examined the TMD9
of CaOPT1 it lacked the important phenylalanine and glutamine
residues (Figure 3), but, being the apparent orthologue of Hgt1p,
it was of interest to evaluate whether CaOPT1 might function
as a glutathione transporter. CaOPT1 was cloned and expressed
downstream of the TEF promoter and when transformed into the S.
cerevisiae met15Δhgt1Δ strain it failed to complement the growth
defect at lower glutathione concentrations (15–30 μM). However,
at significantly higher concentrations of glutathione (greater
than 150 μM) growth was observed (Supplementary Figure S6A
at http://www.BiochemJ.org/bj/429/bj4290593add.htm). This
observation suggested that CaOPT1 is only a weak transporter
of glutathione. We measured the uptake of radiolabelled
glutathione ([35 S]GSH) (at 100 μM GSH) in the met15Δhgt1Δ
strain of S. cerevisiae. CaOPT1p resulted in very low glutathione
accumulation in the cells, 5–6-fold lower than Hgt1p (Figure 5A).
The level of transport was too low to enable us to determine
the kinetic parameters. The lower activity of the CaOPT1 was
not due to improper expression in an heterologous system
(Figure 5B), nor was it due to a defect in localization to the
cell surface, as seen by immunoblotting (Supplementary Figure
S6B). The little transport that was observed when normalized to
expression levels indicated extremely poor glutathione transport
capabilities compared with HGT1.
DISCUSSION
The identification of Phe523 of HGT1 as a second residue together
with Gln526 of TMD9 as playing an important role in determining
the affinity of the transporter towards its substrate, glutathione,
has allowed us to define two key residues important for substrate
specificity of Hgt1p. It has also led to a means to identify
the substrate specificity of other members of the OPT family
c The Authors Journal compilation c 2010 Biochemical Society
600
Figure 6
A. Thakur and A. K. Bachhawat
Unrooted phylogenetic tree of the OPT family
The homologous proteins with Phe523 and Gln526 in TMD9 were observed to form a ‘phenylalanine and glutamine cluster’ or the ‘Sc-HGT1 cluster’. The orthologous proteins with the ‘Iso523 and Glu526
residues’ also cluster together (‘glutamate and isoleucine cluster’) or the ‘CnHGT1 cluster’. CaOPT1 lacking these residues in TMD9 formed a distinct CaOPT1 cluster. Multiple sequence alignment
of the representative members from the OPT family (listed in Supplementary Table S1 at http://www.BiochemJ.org/bj/429/bj4290593add.htm). Other OPT members have their own branch and are
marked accordingly.
since the phenylalanine and glutamine residues at these positions
appeared as a possible signature motif for recognizing highaffinity glutathione transporters of the OPT family. Sequence
retrieval and comparison reveal that yeasts of seven other different
genera also had orthologues of Hgt1p that contained these same
residues in the corresponding positions of TMD9. Functional
analysis of the putative orthologues from three of the yeasts
of this group, K. lactis, P. guilliermondii and S. japonicus,
reveal that these were indeed coding for high-affinity glutathione
transporters. The K m of SjHGT1 was a little higher (204.1 μM)
than those of the other transporters, but the growth at 15 μM
clearly classified it as a high-affinity glutathione transporter. The
orthologous proteins with phenylalanine and glutamine in TMD9
were observed to form a clear cluster in phylogenetic analysis that
we refer to as the ‘phenylalanine and glutamine cluster’ or the
‘ScHGT1 cluster’. As subsequent analysis with Hgt1p revealed
that replacement of phenylalanine with isoleucine and glutamine
with glutamate also led to functional activity, and these residues
c The Authors Journal compilation c 2010 Biochemical Society
were found in the corresponding position of phenylalanine and
glutamine in many proteins, we also investigated a putative
orthologue from C. neoformans belonging to this group, CnHGT1,
and found that CnHGT1 also functioned as a high-affinity
glutathione transporter. Interestingly, phylogenetic analysis with
members of the OPT family [that included all members present
in the TCDB (transporter classification database)] reveals that
proteins with the glutamate and isoleucine residues also cluster
together (‘glutamate and isoleucine cluster’ or the ‘CnHGT1
cluster’) (Figure 6). The observation that the double mutant
containing glutamate and isoleucine changes in HGT1 was more
effective in transporting glutathione than the single mutants
suggests the need for the co-evolution of these residues for
glutathione transport in these orthologues.
The demonstration that the closest homologue of Hgt1p
in C. albicans, CaOPT1, lacks the corresponding phenylalanine/isoleucine and glutamine/glutamate residues, and does not
display any significant capability of glutathione transport further
High-affinity glutathione transporter clusters in fungi
underlines the importance of these residues in glutathione
recognition. The present study should also help to resolve much
of the confusion that has surrounded the yeast members of the
OPT family. CaOPT1, the first member of the OPT family to
have been investigated, was described as an OPT. In contrast,
Hgt1p of S. cerevisiae, which shows significant similarity to
CaOPT1, was described as a high-affinity glutathione transporter,
and simultaneously also as an OPT [2]. However, the higher
affinity for glutathione and the transcriptional regulation of
the protein by sulfur limitation [30] has clearly underlined its
true physiological role in glutathione transport. It was therefore
imperative to assess the role of CaOPT1 in glutathione transport
as this had not been investigated previously. CaOPT1 was found
to have valine and leucine residues in the corresponding positions
in TMD9 to phenylalanine and glutamine, and on the basis of the
findings of the present study it is clear that their true substrate
specificity might indeed be other than glutathione. [CaOPT1 has
a single CUG codon that codes for serine rather than leucine.
However, introducing this change in CaOPT1 expressed in S.
cerevisiae led only to a further decrease in glutathione transport
capability (results not shown).] Although previous studies on the
OPT members CaOPT1–CaOPT5 in C. albicans have revealed
that several of the CaOPTs are up-regulated during conditions
of nitrogen limitation and were capable of utilizing different
oligopeptides of different sequence and sizes, the affinities for
the different substrates were not examined [8]. Several plant
homologues of the OPT family in the PT clade have also been
evaluated for glutathione transport, but it has been observed
that none of the plant transporters are high-affinity glutathione
transporters, even though some of them can transport glutathione
at lower affinity. The substrate specificity of these transporters
has thus not yet been clearly defined, although in many cases
they also have been shown to transport different oligopeptides.
Interestingly, none of the plant clones contained the phenylalanine
and glutamine residues in TMD9. The clear demonstration that
TMD9 plays a key role in substrate specificity will thus greatly
facilitate and accelerate work on assigning the substrate specificity
of not only the fungal, but also the plant, OPTs.
Although the present study has focused on residues in TMD9
that are important for glutathione recognition and translocation
in HGT1 and would be of great use in assigning function to the
rapidly increasing numbers of OPT members, one needs to bear in
mind that in addition to TMD9, other TMDs and residues within
these other TMDs might also participate in forming the channel
that would be critical for substrate binding and translocation. This
is, as yet, only the first TMD of any OPT subjected to such a detailed analysis. Thus the complete signature motif for glutathione
recognition would only be available when the other TMDs have
been similarly examined. A previous study had implicated TMDs
1, 4 and 9 [19] and it would be important to investigate TMDs 1
and 4 in greater detail, as well as other TMDs (TMDs 5 and 8)
that were not targeted in the previous study, among others.
Although hydrophilic residues in TMDs are in many cases
known to play a key role in forming the aqueous channel for
substrate translocation of hydrophilic substrates, and was in fact
the basis for the original strategy where polar charged amino
acids of the TMDs of HGT1 were targeted leading to the identification of Gln526 , the identification of the aromatic residue Phe523
as important for substrate specificity was initially surprising.
However, several reports have identified aromatic amino acid
residues in TMDs of transporters of even hydrophilic substrates as
being critical in substrate recognition and transport activity [31–
33]. Thus, for example, two aromatic residues in TMD10 of the
high-affinity galactose transporter, Gal2, Tyr446 and Trp455 , were
found to be critical for galactose recognition [34].
601
The interactions involving Phe523 in substrate recognition
are unclear. However, the observation that F523Y and F523I
mutants were functional although they showed lower activity
compared with the wild-type protein, whereas the F523W showed
a severe loss in activity, suggested that both size, as well as
hydrophobicity, of the residue were important at that position.
Clearly, more structural insights are required. However, in the
absence of any structures currently available in even remote
members of this family, current insights on the functioning of
these transporters would have to be gathered from biochemical
and genetic analysis of these transporters. It is hoped that future
studies directed towards these goals would yield a clearer picture
on the mechanism of substrate recognition and translocation by
these important class of transporters.
AUTHOR CONTRIBUTION
Anil Thakur performed all of the experiments. Anand Bachhawat supervised the project.
Both authors contributed to the experiment design, analysis of the data and the preparation
of the manuscript.
ACKNOWLEDGEMENTS
We thank Pragya Yadav for help in cloning the CaOPT1 alleles, Akhilesh Kumar for making
the CUG to UCG mutation in CaOPT1 and for HA tagging of CaOPT1. We thank Mr Deepak
Bhatt and Dr Alok Mondal for their help in acquiring confocal images. We thank Mr Manish
Datt for drawing the side-view of TMDs using the PyMol Viewer. We also thank Jaspreet
Kaur for suggestions and critical input during the course of this study. All individuals
acknowledged are from the Institute of Microbial Technology, Chandigarh, India.
FUNDING
This work was supported in part by Grant-in-Aid projects to A.K.B. from the Department
of Science and Technology, Government of India [grant number SR/SO/BB-10/2009] and
Department of Biotechnology, Government of India [grant number SR/SO/BB-24/2004].
A.T. was the recipient of a Research Fellowship from the Council of Scientific and Industrial
Research, Government of India.
REFERENCES
1 Bourbouloux, A., Shahi, P., Chakladar, A., Delrot, S. and Bachhawat, A. K. (2000) Hgt1p, a
high affinity glutathione transporter from the yeast Saccharomyces cerevisiae . J. Biol.
Chem. 275, 13259–13265
2 Hauser, M., Donhardt, A. M., Barnes, D., Naider, F. and Becker, J. M. (2000) Enkephalins
are transported by a novel eukaryotic peptide uptake system. J. Biol. Chem. 275,
3037–3041
3 Lubkowitz, M. A., Barnes, D., Breslav, M., Burchfield, A., Naider, F. and Becker, J. M.
(1998) Schizosaccharomyces pombe isp4 encodes a transporter representing a novel
family of oligopeptide transporters. Mol. Microbiol. 28, 729–741
4 Yen, M. R., Tseng, Y. H. and Saier, Jr, M. H. (2001) Maize Yellow Stripe1, an
iron-phytosiderophore uptake transporter, is a member of the oligopeptide transporter
(OPT) family. Microbiology 147, 2881–2883
5 Lubkowitz, M. (2006) The OPT family functions in long-distance peptide and metal
transport in plants. Genet. Eng. (NY) 27, 35–55
6 Thakur, A., Kaur, J. and Bachhawat, A. K. (2008) Pgt1, a glutathione transporter from the
fission yeast Schizosaccharomyces pombe . FEMS Yeast Res. 8, 916–929
7 Lubkowitz, M. A., Hauser, L., Breslav, M., Naider, F. and Becker, J. M. (1997) An
oligopeptide transport gene from Candida albicans . Microbiology 143, 387–396
8 Reuss, O. and Morschhauser, J. (2006) A family of oligopeptide transporters is required
for growth of Candida albicans on proteins. Mol. Microbiol. 60, 795–812
9 Koh, S., Wiles, A. M., Sharp, J. S., Naider, F. R., Becker, J. M. and Stacey, G. (2002) An
oligopeptide transporter gene family in Arabidopsis . Plant Physiol. 128, 21–29
10 Cagnac, O., Bourbouloux, A., Chakrabarty, D., Zhang, M. Y. and Delrot, S. (2004) AtOPT6
transports glutathione derivatives and is induced by primisulfuron. Plant Physiol. 135,
1378–1387
c The Authors Journal compilation c 2010 Biochemical Society
602
A. Thakur and A. K. Bachhawat
11 Osawa, H., Stacey, G. and Gassmann, W. (2006) ScOPT1 and AtOPT4 function as
proton-coupled oligopeptide transporters with broad but distinct substrate specificities.
Biochem. J. 393, 267–275
12 Stacey, M. G., Patel, A., McClain, W. E., Mathieu, M., Remley, M., Rogers, E. E.,
Gassmann, W., Blevins, D. G. and Stacey, G. (2008) The Arabidopsis AtOPT3 protein
functions in metal homeostasis and movement of iron to developing seeds. Plant Physiol.
146, 589–601
13 Pike, S., Patel, A., Stacey, G. and Gassmann, W. (2009) Arabidopsis OPT6 is an
oligopeptide transporter with exceptionally broad substrate specificity. Plant Cell Physiol.
50, 1923–1932
14 Bogs, J., Bourbouloux, A., Cagnac, O., Wachter, A., Rausch, T. and Delrot, S. (2003)
Functional characterization and expression analysis of a glutathione transporter, BjGT1,
from Brassica juncea : evidence for regulation by heavy metal exposure. Plant Cell
Environ. 26, 1703–1711
15 Zhang, M. Y., Bourbouloux, A., Cagnac, O., Srikanth, C. V., Rentsch, D., Bachhawat, A. K.
and Delrot, S. (2004) A novel family of transporters mediating the transport of glutathione
derivatives in plants. Plant Physiol. 134, 482–491
16 Curie, C., Cassin, G., Couch, D., Divol, F., Higuchi, K., Le Jean, M., Misson, J., Schikora,
A., Czernic, P. and Mari, S. (2009) Metal movement within the plant: contribution of
nicotianamine and yellow stripe 1-like transporters. Ann. Bot. 103, 1–11
17 Curie, C., Panaviene, Z., Loulergue, C., Dellaporta, S. L., Briat, J. F. and Walker, E. L.
(2001) Maize yellow stripe1 encodes a membrane protein directly involved in Fe(III)
uptake. Nature 409, 346–349
18 Inoue, H., Kobayashi, T., Nozoye, T., Takahashi, M., Kakei, Y., Suzuki, K., Nakazono, M.,
Nakanishi, H., Mori, S. and Nishizawa, N. K. (2009) Rice OsYSL15 is an iron-regulated
iron(III)-deoxymugineic acid transporter expressed in the roots and is essential for iron
uptake in early growth of the seedlings. J. Biol. Chem. 284, 3470–3479
19 Kaur, J. and Bachhawat, A. K. (2009) Gln-222 in transmembrane domain 4 and Gln-526
in transmembrane domain 9 are critical for substrate recognition in the yeast high affinity
glutathione transporter, Hgt1p. J. Biol. Chem. 284, 23872–23884
20 Kaur, J., Srikanth, C. V. and Bachhawat, A. K. (2009) Differential roles played by the native
cysteine residues of the yeast glutathione transporter, Hgt1p. FEMS Yeast Res. 9, 849–866
21 Ingavale, S. S. and Bachhawat, A. K. (1999) Restoration of inositol prototrophy in the
fission yeast Schizosaccharomyces pombe . Microbiology 145, 1903–1910
Received 12 February 2010/5 May 2010; accepted 17 May 2010
Published as BJ Immediate Publication 17 May 2010, doi:10.1042/BJ20100240
c The Authors Journal compilation c 2010 Biochemical Society
22 Guthrie, C. and Fink, G. R. (1991) Guide to yeast genetics and molecular biology.
Methods Enzymol. 194, 3–37
23 Alfa, C., Fantes P., Hyams J. and Mcleod M., Warbrick E. (1993) Experiments with Fission
Yeast: A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor
24 Sambrook, J. and Fritsch E.F., Maniatis T. (1989) Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor
25 Reference deleted
26 Reference deleted
27 Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G. (1997)
The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment
aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882
28 Kumar, S., Nei, M., Dudley, J. and Tamura, K. (2008) MEGA: a biologist-centric software
for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9, 299–306
29 Wiles, A. M., Naider, F. and Becker, J. M. (2006) Transmembrane domain prediction and
consensus sequence identification of the oligopeptide transport family. Res. Microbiol.
157, 395–406
30 Srikanth, C. V., Vats, P., Bourbouloux, A., Delrot, S. and Bachhawat, A. K. (2005) Multiple
cis -regulatory elements and the yeast sulphur regulatory network are required for the
regulation of the yeast glutathione transporter, Hgt1p. Curr. Genet. 47, 345–358
31 Kasahara, T. and Kasahara, M. (1998) Tryptophan 388 in putative transmembrane
segment 10 of the rat glucose transporter Glut1 is essential for glucose transport. J. Biol.
Chem. 273, 29113–29117
32 Zhou, X., Su, Z., Anishkin, A., Haynes, W. J., Friske, E. M., Loukin, S. H., Kung, C. and
Saimi, Y. (2007) Yeast screens show aromatic residues at the end of the sixth helix anchor
transient receptor potential channel gate. Proc. Natl. Acad. Sci. U.S.A. 104,
15555–15559
33 Denker, K., Orlik, F., Schiffler, B. and Benz, R. (2005) Site-directed mutagenesis of the
greasy slid aromatic residues within the LamB (maltoporin) channel of Escherichia coli :
effect on ion and maltopentaose transport. J. Mol. Biol. 352, 534–550
34 Kasahara, M., Shimoda, E. and Maeda, M. (1997) Amino acid residues responsible for
galactose recognition in yeast Gal2 transporter. J. Biol. Chem. 272, 16721–16724
35 Burland, T. G. (2000) DNASTAR’s Lasergene sequence analysis software. Methods Mol.
Biol. 132, 71–91
Biochem. J. (2010) 429, 593–602 (Printed in Great Britain)
doi:10.1042/BJ20100240
SUPPLEMENTARY ONLINE DATA
The role of transmembrane domain 9 in substrate recognition by the fungal
high-affinity glutathione transporters
Anil THAKUR and Anand K. BACHHAWAT1
Institute of Microbial Technology, Sector 39-A, Chandigarh 160 036, India
EXPERIMENTAL
Cloning of putative HGT1 orthologues from K. lactis, S. japonicus,
P. guilliermondii, C. albicans and C. Neoformans
The gene encoding the putative HGT1 orthologues from K.
lactis (GenBank® accession number XP_453962.1; KlHGT1)
S. japonicus (GenBank® accession number XP_002172910.1;
SjHGT1) and P. guilliermondii (GenBank® accession number
XP_001486861.1; PgHGT1) were amplified from primer pairs
KlOPT F and KlOPTR (for K. lactis), SjOPTF and SjOPTR
(S. japonicus) and PGlEcoF and PGlSalR (P. guilliermondii)
(Supplementary Table S2), digested with BamHI and EcoRI (K.
lactis), BamHI and XhoI (S. japonicus) and EcoRI and SalI (P.
guilliermondii) and cloned downstream of the TEF promoter in
p416TEF [1] vector. C. albicans has two CaOPT1 alleles [2,3],
one containing an intron, and a second one lacking an intron.
We amplified the CaOPT1 alleles and followed up the allele that
lacked the intron, and cloned it downstream of the TEF promoter
using the restriction sites EcoRI and XhoI.
As the gene encoding the putative HGT1 orthologue of
C. neoformans (GenBank® accession number XP_772672.1;
CnHGT1) contained several introns, the gene was customsynthesized from Genscript. This gene was excised from the
pUC57 vector using EcoRI and HindIII restriction enzymes and
subcloned downstream of the TEF promoter in the p416TEF
vector.
For cloning the PgHGT1 gene in an S. pombe expression vector,
the PgHGT1 gene was excised from the pTEF expression vector
using EcoRI and SalI restriction enzymes, the sites were blunted
by Klenow filling, and subcloned into the SmaI sites of the LEU2based S. pombe expression vectors pART1 [4], downstream of the
ADH promoter. BamHI was used to check the correct orientation
of the clones.
1
Table S1 List of the representative members of the OPT family used to
construct the phylogenetic tree in Figure 6 of the main text
Protein
GenBank® accession number
Organism name
AfOpt1
Aor1
AtOpt2
AtOpt9
AtYsl1
AtYsl2
AtYsl3
AtYsl18
BpYsl
CaOpt1
CaOpt6
CaOpt7
ClHgt1
CnHgt1
DdYsl
DhYSl
HiYsl
KlHgt1
KlYsl
MtYsl1
MtYsl
MxYsl
Ncr
NcYSl
NmeYsl
Osa
OsYs1
PgHgt1
Pgt1
Pgu
PhYsl
PpHgt1
PcHgt1
ScHgt1p
ScOpt2
ScYsl
SjHgt1
SpIsp4
Ssc
SsHgt1
Uma
Vvi
YliYSL
Zma
ZmYs1
XP_754401.1
BAE65899.1
O04514.1
NP_200163.1
AAS00691.1
NP_197826
NP_200167.2
NP_001044692.1.
NP_879902.1
AAB69628.1
XP_722872.1
ABD17831.1
XP_002615150.1
XP_772672.1
XP_635289.1
XP_457274.1
NP_438718.1.
XP_453962.1
XP_455569.1
XP_001262728.1
NP_216911.1
Q9S433
XP_955763.1
CAB99186.1
YP_001598245.1
EAY95386.1
BAD26556.1
XP_001486861.1
NP_594987.1
BI176125.1
NP_142337.1
XP_002493413.1
XP_002567631.1
NP_012323.1
NP_015520.1
NP_011401.1
XP_002172910.1
BAA12193.1
XP_001596456.1
XP_001585829.1
XP_760175.1
CAN81605.1
XP_503395.1
AAQ91200.1
NP_001104952.1
Aspergillus fumigatus
Aspergillus oryzae
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
Bordetella pertussis
C. albicans
C. albicans
C. albicans
C. lusitaniae
C. neoformans
Dictyostelium discoideum
D. hansenii
Haemophilus influenzae
K. lactis
K. lactis
Schizophyllum commune
Mycobacterium tuberculosis
Myxococcus xanthus
N. crassa
N. crassa
Neisseria meningitidis
Oryza sativa
O. sativa
P. guilliermondii
S. pombe
P. guilliermondii
Pyrococcus horikoshii
P. pastoris
Penicillium chrysogenum
S. cerevisiae
S. cerevisiae
S. cerevisiae
S. japonicus
S. pombe
S. sclerotiorum
S. sclerotiorum
Ustilago maydis
Vitis vinefera
Y. lipolytica
Z. mays
Z. mays
To whom correspondence should be addressed (email [email protected])
c The Authors Journal compilation c 2010 Biochemical Society
A. Thakur and A. K. Bachhawat
Figure S1 Quantification of the total protein expression levels of the
different TMD9 mutants of Hgt1p
Extracts were prepared from the ABC 817 strain transformed with plasmids bearing the alanine
mutants of TMD9 of Hgt1p. Total protein (20 μg) was resolved using SDS/PAGE (10 % gels), and
electroblotted on to a nitrocellulose membrane. The blot was probed with mouse anti-HA antibody
at a 1:1000 dilution as the primary antibody, and a goat anti-mouse IgG HRP (horseradish
peroxidase)-conjugated antibody (at a 1:2500 dilution) as a secondary antibody. The signal was
detected using an ECL kit. Molecular mass markers (SM0431; MBI fermentas) were used to
estimate the protein molecular mass. The total protein was quantified by densitometric analysis
of protein bands. The data are expressed as the percentage protein expression normalized to
the wild-type expression level, and are the means of the protein expression levels obtained
in three independent experiments. A representative blot is shown in the upper panels. Equal
loading of the proteins (20 μg) in each well of the gel was also visually monitored by Coomassie
Blue staining and Ponceau S staining of the membrane after transfer (results not shown). W.T.,
wild-type.
c The Authors Journal compilation c 2010 Biochemical Society
High-affinity glutathione transporter clusters in fungi
Figure S2
Cell-surface localization of alanine mutants of Hgt1p defective in functional activity
The strain ABC817 was transformed with plasmids bearing the different alanine mutants of TMD9 of Hgt1p and labelled by indirect immunofluorescence using a mouse anti-HA primary antibody (at
a 1:100 dilution), and a goat anti-mouse IgG HRP (horseradish peroxidase)-conjugated antibody secondary antibody (at a 1:500 dilution), and visualized using the confocal microscope, as described
in the Experimental section of the main text. Only fluorescence images have been shown. W.T., wild-type.
c The Authors Journal compilation c 2010 Biochemical Society
A. Thakur and A. K. Bachhawat
Figure S3
Functional analysis of F523W, F523Y and F523I mutants
Functional analysis reveals that F523Y and F523I mutants restore the functional activity
comparable with wild-type protein. The ABC 817 strain was transformed with plasmid bearing the
F523W, F523Y and F523I mutations in Hgt1p. (A) Plate-based complementation-cum-toxicity
assay by dilution spotting on minimal medium containing different concentrations of glutathione
as explained in the Experimental section of the main text. (B) Measurement of the rate of
radiolabelled glutathione uptake as described in the Experimental section of the main text. The
data are presented as the percentage of the rate of uptake by the mutants relative to wild-type
Hgt1p. Each experiment was repeated twice, in triplicate and representative data are shown as
means +
− S.D. W.T., wild-type.
c The Authors Journal compilation c 2010 Biochemical Society
Figure S4 Functional complementation of (A) KlHgt1 and SjHgt1, (B)
PgHGT1 and (C) CnHGT1
(A) Plasmids bearing KlHgt1 and SjHgt1 under the TEF promoter and the corresponding
vectors were transformed into S. cerevisiae strain ABC 817 and dilution spotting was performed
at different glutathione concentrations, as described in the Experimental section of the main
text. The photographs were taken after 2 days of incubation at 30 ◦C. (B) PgHgt1 expressed
from the ADH promoter in the S. pombe pART1 vector was transformed into S. pombe strain AB
2187 and dilution spotting was carried out at different concentrations of glutathione. Plasmid
bearing PgHgt1 under the ADH promoter and corresponding vectors were transformed into strain
ABP2188 (cys1aΔpgt1Δ) o f S. pombe and dilution spotting was carried out, as described in the
Experimental section of the main text. The photographs were taken after 3 days of incubation at
30 ◦C. (C) Plasmid bearing CnHgt1 under the TEF promoter was transformed into S.cerevisiae
strain ABC 817 and dilution spotting carried out at different glutathione concentrations.
High-affinity glutathione transporter clusters in fungi
Figure S5
Functional analysis of Q526E and F523I-Q526E mutants
(A) The ABC 817 strain was transformed with plasmids bearing the mutation in Q526E and
F523I/Q526E of Hgt1p and used for the plate-based complementation-cum-toxicity assay by
dilution spotting on minimal medium containing different concentrations of glutathione. (B)
The met15Δhgt1Δ strain of S. cerevisiae transformed with C-terminally HA-tagged Q526E and
F523A/Q526E expressed under the TEF promoter (and corresponding vector) were used for
indirect immunofluorescence, as described in the Experimental section of the main text.
Figure S6 CaOPT1 of C. albicans is not an efficient glutathione transporter
as seen from the growth assay
(A) CaOPT1 expressed under the TEF promoter does not complement the growth defect of
strain met15Δhgt1Δ at low concentrations of glutathione, but does so at higher glutathione
concentrations. Plasmid bearing CaOPT1 under the TEF promoter and the corresponding vectors
were transformed into the met15Δhgt1Δ strain of S. cerevisiae (ABC 817) and dilution spotting
was carried out as described in the Experimental section of the main text. (B) CaOPT1-encoded
protein localizes at the plasma membrane in the met15Δhgt1Δ strain of S. cerevisiae cells.
C-terminally HA-tagged CaOPT1 expressed under the TEF promoter in S. cerevisiae ABC 817
(and corresponding vector) was used for indirect immunofluorescence, as described in the the
Experimental section of the main text
c The Authors Journal compilation c 2010 Biochemical Society
A. Thakur and A. K. Bachhawat
Table S2
List of oligonucleotides and their sequences used in the present study
Oligomer name
Sequence (5 to 3 )
A509G
W510A
A511G
F512A
V513A
I514A
A515G
I516A
L517A
I518A
S519A
L520A
V521A
N522A
F523A
I524A
P525A
Q526A
G527A
I528A
E529AF
E529AR
F523W
F523Y
F523I
Common (joining) primer
F523I with Q526E
P. Gl Eco F
P. Gl sal1 R
S. japonicus BamF
S. japonicus XhoR
KLOPTF
KLOPTR
CaOPT1F
CaOPT1R
CaOPT231SF
CaOPT231SR
ATTTACAAGGGAAATTAATATTGCAATAACAAATGCCCAACCTGGGAACTTAGTATCGAAACAG
ATTTACAAGGGAAATTAATATTGCAATAACAAATGCCGCAGCTGGGAACTTAGTATCGAAAC
ATTTACAAGGGAAATTAATATTGCAATAACAAATCCCCAAGCTGGGAACTTAGTATCG
ATTTACAAGGGAAATTAATATTGCAATAACAGCTGCCCAAGCTGGGAACTTAGTATC
ATTTACAAGGGAAATTAATATTGCAATAGCAAATGCCCAAGCTGGGAACTTAG
ATTTACAAGGGAAATTAATATTGCAGCAACAAATGCCCAAGCTGGGAAC
ATTTACAAGGGAAATTAATATTCCAATAACAAATGCCCAAGCTG
ATTGCTTCTAGAATACCTTGCGGGATGAAATTTACAAGGGAAATTAATGCTGCAATAACAAATGCCCAG
ATTGCTTCTAGAATACCTTGCGGGATGAAATTTACAAGGGAAATTGCTATTGCAATAACAAATGC
ATTGCTTCTAGAATACCTTGCGGGATGAAATTTACAAGGGAAGCTAATATTGCAATAACAAA
ATTGCTTCTAGAATACCTTGCGGGATGAAATTTACAAGGGCAATTAATATTGCAATAAC
ATTGCTTCTAGAATACCTTGCGGGATGAAATTTACAGCGGAAATTAATATTGCAAT
ATTGCTTCTAGAATACCTTGCGGGATGAAATTTGCAAGGGAAAT TAATATTGC
ATTGCTTCTAGAATACCTTGCGGGATGAAAGCTACAAGGGAAATTAATATTG
ATTGCTTCTAGAATACCTTGCGGGATGGCATTTACAAGGGAAATTAATATTG
ATTGCTTCTAGAATACCTTGCGGGGCGAAATTTACAAGGGAAATTAA
ATTGCTTCTAGAATACCTTGCGCGATGAAATTTACAAGGGAAAT
ATTGCTTCTAGAATACCTTCCGGGATGAAATTTACAAGGG
ATTGCTTCTAGAATAGCTTGCGGGATGAAATTTACAAG
ATTGCTTCTAGAGCACCTTGCGGGATGAAATTTAC
CATCCCGCAAGGTATTGCAGAAGCAATGACTAAC
GTTAGTCATTGCTTCTGCAATACCTTGCGGGATG
ATTGCTTCTAGAATACCTTGCGGGATCCAATTTACAAGGGAAATTAATATTG
ATTGCTTCTAGAATACCTTGCGGGATGTAATTTACAAGGGAAATTAATATTG
ATTGCTTCTAGAATACCTTGCGGGATGATATTTACAAGGGAAATTAATATTG
ATTGCTTCTAGAATACCTTGCGGGATGAAATTTACAAGGGAAATTAATATTGCAATAAC
ATTGCTTCTAGAATACCTTCCGGGATGATATTTACAAGGGAAATTAATATTG
ATCCCTGAATTCATGTCAGAGAAGCTCGAGAAG
CGTCGTCGACTTACCATTTACTGGGGCCAAAAG
ACTGCAGGATCCATGCCCTCGAAAGATCCTACAG
ACTCGACTCGAGCTACCACTTCTTATAGCCAAATG
ATGCGGGGATCCATGAGTGTGATCTATAGAGGCAC
ATGCGGGAATTCCTTTTGGACATACTAAATGGTGGT
ATCCCTGAATTCATGGACAAAATAAGGGCAGTAATTAG
ATGCGCTCGAGTTACCAGGAAGATGGCCCAAATGC
GGGCCATCTGGCCCTCGAATTTGGTCACCGCAACATTCTTG
CAAGAATGTTGCGGTGACCAAATTCGAGGGCCAGAT
REFERENCES
1 Mumberg, D., Muller, R. and Funk, M. (1995) Yeast vectors for the controlled expression of
heterologous proteins in different genetic backgrounds. Gene 156, 119–122
2 Lubkowitz, M.A., Hauser, L., Breslav, M., Naider, F. and Becker, J.M. (1997) An
oligopeptide transport gene from Candida albicans . Microbiology 143, 387–396
3 Reuss, O. and Morschhauser, J. (2006) A family of oligopeptide transporters is required for
growth of Candida albicans on proteins. Mol. Microbiol. 60, 795–812
4 McLeod, M., Stein, M. and Beach, D. (1987) The product of the mei3+ gene, expressed
under control of the mating-type locus, induces meiosis and sporulation in fission yeast.
EMBO J. 6, 729–736
Received 12 February 2010/5 May 2010; accepted 17 May 2010
Published as BJ Immediate Publication 17 May 2010, doi:10.1042/BJ20100240
c The Authors Journal compilation c 2010 Biochemical Society