PEST MANAGEMENT: INSECTS
The Presence of Burkholderia
and Arthropods in Arkansas Rice Fields
A.P.G. Dowling and R.J. Sayler
ABSTRACT
Bacterial panicle blight (BPB) caused by Burkholderia glumae has become the
most important disease of 'Bengal' rice in Arkansas. Many arthropods with the capability
to vector bacteria are commonly found in rice fields, however no link has been made to
any arthropod vectors of BPB. This study was the second year of sampling rice fields for
the presence of BPB and any small arthropods typically implicated in disease vectoring
such as mites and sucking insects. Selective agar and Polymerase Chain Reaction (PCR)
screening were used to test for the presence of BPB in rice samples and arthropods
were collected and identified from the same samples. Out of 91 rice samples, only 13
tested positive for BPB. Of the 91 samples, 32 contained mites and other arthropods;
however, only five of these samples also tested positive for BPB. There appears to be no
correlation between presence of mites and BPB infection, likely due to the fact that the
mite species found are not known plant feeders. Other than mites, thrips, rice stinkbug,
and the occasional beetle larva were found on some of the rice samples.
INTRODUCTION
Bacterial panicle blight (BPB), caused by Burkholderia glumae, has become the
most important disease of Bengal rice in Arkansas, causing up to 35% yield losses in
some fields each year. This single disease has turned the high yield potential Bengal
variety into only an average yielding one. In certain years, the disease has affected the
entire medium-grain production area, but it is unknown how the bacterial blight may
be associated with mites or insects feeding on the plants. Many mites and insects are
known to transport and infect plants with bacteria, viruses, and other pathogens. The
111
AAES Research Series 600
spread of blight and other pathogens may be heavily influenced by mite activity and
may have synergistic effects with mite feeding damage. In addition to bacterial panicle
blight, extension personnel have witnessed panicle browning and kernel abortion to be
common in hot dry years. In many cases, no pathogens could be isolated, suggesting that
mite feeding alone may cause these symptoms. To our knowledge, the only systematic
survey of mites and pathogens in the southern U.S. was performed by the authors in
2010, however, due to heavy pesticide use that season, arthropod populations were very
low, or non-existent, making it impossible to draw a possible correlation between mite
presence and BPB infection (Dowling et al., 2011). Only a few studies have examined
the relationship between mites and pathogens worldwide; although this interaction appears to be the crucial factor in the rice panicle mite’s ability to cause up to 90% yield
losses in Central America (Almaguel et al., 2000). Minimizing the activity of mites in
the fields may be the key to minimizing or even eliminating the appearance and spread
of bacterial blights in Arkansas rice fields. Solving this problem should not only help
medium-grain growers, but hopefully help prevent the disease from spreading to the
major long-grain rice varieties as well.
To better understand the interaction between mites, stinkbugs, rice, and bacterial
panicle blight we conducted a second year of medium-grain rice sampling around the state,
with sampling after panicle emergence and lasting through later season maturation.
PROCEDURES
Rice samples were collected from 1 August through 15 September 2011. Collection involved locating rice plants displaying potential symptoms of BPB infection,
cutting a handful of these plants near the base and placing them into a large plastic bag.
Several samples were taken from each location and then shipped up to the University of
Arkansas in Fayetteville. Once received, samples were stored in a walk-in refrigerated
storage closet to keep arthropods, bacteria, and fungus alive, but in stasis. Each sample
was removed from the refrigerator and first sampled for the presence of bacterial blight
and then checked for mites and other arthropods.
Leaf samples were analyzed for the presence of the B. glumae by randomly removing three ten gram leaf samples and placing them in 50 ml conical tubes. The tubes
were filled with 20 ml of 10 mM sodium phosphate buffer pH 7.0 supplemented with
0.05% Tween 20. Each subsample was vortexed on high for 5 s. After vortexing the
subsamples, 100 ul of the subsample buffer was plated on CCNT media that is selective
for Burkholderia species (Kawaradani et al., 2000). The media was incubated at 37
°C for 48 h. Populations of B. glumea were quantified by counting bacterial colonies
producing yellow pigment on the CCNT after incubation at 37 °C for 48 h.
Plant samples were also screened using molecular techniques, as were some of
the mites collected from samples. Polymerase chain reaction (PCR) focused on a 529
bp fragment of the gyrb gene from B. glumae and the following primers were used: gluFW GAAGTGTCGCCGATGGAG and 18 glu-RV CCTTCACCGACAGCACGCAT
(Maeda et al., 2006). The protocol from these authors was selected because it allows
112
B.R. Wells Rice Research Studies 2011
multiplex PCR detection of B. gladioli and B. plantarii in addition to B. glumae. The
large 500 bp fragment produced by these primers facilitates easy visualization on an
agarose gel and reduces the potential for false positives that is more likely to occur with
primers that amplify smaller fragments. Extraction of DNA was performed using the
Qiagen DNeasy Tissue Kit and protocols therein (Qiagen, Germantown, Md.). Each
25 µl PCR sample contained 15.25 µl dH2O, 2.5 µl PCR buffer, 1.5 µl MgCl2, 1.5 µl
dNTP’s, 1 µl of each primer, 0.25 µl of Platinum Taq polymerase (Invitrogen), and 2
µl template DNA. Polymerase chain reaction conditions were as follows: 95 °C for 3
min; 35 cycles each of 95 °C for 20 s, 60 °C annealing for 30 s, and 72 °C extension
for 15 s; followed by a 10 minute extension at 72 °C; and an indefinite hold at 4 °C.
Polymerase chain reaction products were visualized using gel electrophoresis on a 1%
agarose gel stained with GelRed (Biotium). Presence of a band around 500 bp in length
indicated confirmation of BPB.
Arthropod sampling involved visual inspection from a subsample of each rice plant
under the dissecting microscope. The leaves were inspected and rolled parts of the plant
were also dissected to look for arthropods inside. Any arthropods found were collected
and placed in a 2 ml microcentrifuge tube containing 95% EtOH. The rest of the plant
sample was cut up into small pieces (5 to 10 cm long) and placed in a sealed container
about one third full of 70% EtOH. If panicles were present, many of the developing
grains were cut in half and placed in the sealed container as well. The container was then
shaken for 5 min, allowed to settle, shaken again for 5 min, and then strained through a
#320 fine mesh screen. All arthropods from the sample plus plant debris were too big to
pass through the screen and were trapped on the top. This debris was washed into a petri
dish with 70% EtOH and examined for arthropods under the dissecting microscope. All
arthropods found in the wash were transferred to a 2 ml microcentrifuge tube containing
95% EtOH. After all washings were complete, a representative subsample of mites was
slide mounted and examined under the compound microscope for identification. Any
insects collected were identified under the dissecting microscope.
RESULTS AND DISCUSSION
A total of 91 different samples were collected and processed for both bacterial
infection and arthropod presence. Only 13 samples tested positive for BPB infection on
the agar plates, all of which were confirmed with PCR. Locality of the positive samples
is displayed on the map in Fig. 1.
Of all 91 samples examined for the presence of mites or insects (exclusive of
stinkbugs and grasshoppers), 32 produced mites, some of which exhibited large populations. Only three samples had thrips and only two had rice stinkbug; however, with the
latter, due to the collecting method, we would expect most adult hemipterans to fly off
and the immatures to possibly drop off the plant as it is harvested. The most common
mite species was Tarsonemus bilobatus (family Tarsonemidae) which is a common mite
associated with plants. The mite typically feeds on fungi growing on plants and has been
implicated as a vector of certain strains of fungi. There appeared to be no immediate
113
AAES Research Series 600
correlation between the presence of this mite and BPB. The other mite commonly collected was a predatory mite in the family Phytoseiidae genus Neoseiulus (species not
yet determined), likely feeding on T. bilobatus. Only five of the samples possessing
arthropods also tested positive for BPB infection and none of the mites found are known
plant feeders. Additionally, no plant feeding insects were found on those samples. None
of the mites examined with PCR tested positive for Burkholderia.
Overall, BPB prevalence was rather low in fields throughout Arkansas although
samples were taken from plants showing symptoms of possible infection. However,
this must have been due to other stressors, such as the extreme heat exhibited during
the 2011 summer. On the other hand, mite presence was moderate, with individuals
found on about one third of the sampled plants. No significant correlation between the
presence of mites and BPB infection was found. Mite abundance also appeared to have
no correlation to infection on the plant as populations ranged from 10 to 76 mites on
infected plants and 10 to 145 mites on uninfected plants.
SIGNIFICANCE OF FINDINGS
These findings lead to a few preliminary conclusions. First, 2011 was another year
of high pesticide use that may have knocked down mite and other insect populations.
This was evident in our sampling where two thirds of the plants were completely free
of any arthropods, a finding much unexpected based on samples from other years. The
few mites found on samples are not typical mites expected in transmission of BPB and
none tested positive for the presence of Burkholderia.
ACKNOWLEDGMENTS
The authors thank the producers of Arkansas for the check-off funds administered
by the Rice Research and Promotion Board for funding this research. The authors would
like to thank Gus Lorenz and Nicki Taillon for collection of rice samples.
LITERATURE CITED
Almaguel, L., J. Hernandez, P.E. de la Torre, A. Santos, R.I. Cabrera, A. García, L.E.
Rivero, L. Báez, I. Cácerez, and A. Ginarte. 2000. Evaluación del comportamiento del acaro Steneotarsonemus spinki (Acari: Tarsonemidae) en los estúdios de
regionalización desarrollados en Cuba. Fitosanidad. 4:15-19 [in Spanish].
Dowling, A.P.G., R.J. Sayler, and R.D. Cartwright. 2011. Survey of mites and bacteria associated with Arkansas rice and the potential link between the spread and
pathogenicity of bacteria and mite activity. In: R.J. Norman and K.A.K. Moldenhauer (eds.). B.R. Wells Rice Research Studies. University of Arkansas Agricultural Experiment Station Research Series 591:82-86. Fayetteville.
Kawaradani, M., K. Okada, and S. Kisakari. 2000. New selective medium for isolation
of Burkholderia glumae from rice seeds. General Plant Patholology. 66:234-237.
114
B.R. Wells Rice Research Studies 2011
Maeda, Y., H. Shinohara, A. Akinori Kiba, K. Ohnishi, N. Furuya, Y. Kawamura, T.
Ezaki, P. Vandamme, S. Tsushima, and Y. Hikichi. 2006. Phylogenetic study and
multiplex PCR-based detection of Burkholderia plantarii, Burkholderia glumae,
and Burkholderia gladioli using gyrB and rpoD sequences. Int. J. System. Evol.
Microbiol. 56:1031–1038.
Fig. 1. Localities of the 13 rice samples that
tested positive for bacterial panicle blight infection.
115