1
Revised s12
DNA FINGERPRINTING VIA THE PCR
HUMAN Alu INSERTION POLYMORPHISM
Objectives




Understand the technique of the PCR
Extract, amplify, and analyze human DNA
Observe genetic variation among individuals
Calculate allelic frequencies and relate to Hardy-Weinberg theory via web-based
bioinformatics
Alu Elements in DNA
DNA from individuals is more alike than different. However, some regions of DNA show a great
deal of diversity. These variable, or polymorphic, sequences are useful in DNA fingerprinting for
forensics, paternity, and disease testing. Alu elements are a component of the non-coding DNA
of primate genomes. These small, repetitive, elements are approximately 300 bp long and are
thought to be derived from a gene that encodes the RNA component of the signal recognition
particles, which labels proteins to be exported from the cell. The human genome contains about 1
million copies of Alu elements, up to 10% of the genome.
Alu is an example of a "jumping sequence". It is a transposable DNA sequence that copies itself
and inserts into new chromosomal locations. It is estimated that there are only several "masters"
capable of transposition. Each Alu element in primate DNA is a "fossil" of a unique transposition
event that occurred only once in evolution. Thus, all primates sharing an Alu allele are
descended from a common ancestor in whom the transposition first occurred. Alu elements are a
type of SINE, a short interspersed DNA element. Of the million of Alu elements in human
DNA, only 500 – 2000 Alu elements are restricted to the human genome and not found in other
primates. The Alu element used in this laboratory, called PV-92, is located on chromosome 16,
and is 300 bases in length.
Most Alu sequences are "fixed" meaning both chromosomes (alleles) have the same Alu
element. However, there are some that are dimorphic, meaning that a particular Alu element may
be either present, or, absent, on a chromosome. PV-92 is dimorphic. This means that some
individuals contain an Alu element on both chromosomes and are homozygous for the element
(+/+ genotype). Others contain an Alu element on one chromosome only (+/- genotype) and
others are the -/- genotype and do not contain an Alu element on either allele. Those
chromosomes that contain one Alu element are 300 bases longer than those that do not so that
genotypes can be scored by examining DNA length.
Because these dimorphic Alu elements inserted into the genome within the last million years,
differences in allele and genotype frequencies between modern populations can be used to
reconstruct human prehistory. DNA fingerprinting of Alu elements affords a simple measure of
genetic diversity with no reference to disease or relatedness among individuals.
2
The Polymerase Chain Reaction (PCR)
You will generate a DNA fingerprint by using a technique called the polymerase chain reaction
(PCR). Thousands of epithelial cells are obtained from either cheek epithelium or hair sheaths.
Cell lysis is accomplished by boiling. High heat also denatures DNA-degrading enzymes called
endonucleases.
Treatment with Chelex removes divalent metal ions that would otherwise inhibit the PCR
reaction.
The PCR has the ability to make millions of copies of a target DNA sequence from a very small
amount of template DNA. In this lab, the PV92 locus is amplified (copied many times) to
generate a DNA fingerprint. The DNA is then electrophoresed on an agarose gel to determine the
size of the fragments. The PCR reaction includes:
Buffer – contains salt and appropriate pH for the DNA polymerase enzyme to have
maximal activity.
Template DNA
Deoxyribonucleotides, G, A, T, C – the building blocks of DNA. The nucleotides are
incorporated into a new DNA strand by the DNA polymerase enzyme.
DNA polymerase - enzyme that assembles nucleotides to form a DNA polymer. The
DNA polymerase in a human cell would denature well below 95 °C, but Taq polymerase
makes the PCR possible because it can withstand multiple rounds of heating without
losing activity.
Magnesium ions - a cofactor for the DNA polymerase
Primers – short single stranded DNA sequences (approximately 20 base pairs). Primers
are made in the laboratory and are designed to be complementary to the target DNA only.
Through complementary base pairing, one primer (the forward primer) anneals to the top
strand of DNA and the other primer (the reverse primer) binds to the bottom strand. It is
from these locations that a complementary DNA strand will be synthesized. Primers are
also necessary because DNA polymerase can only add nucleotides to an existing piece of
DNA (a primer). The primers provided are complementary to the regions of DNA
flanking the PV92 locus. Once the primers are hybridized to the single stranded DNA,
polymerization by the taq enzyme extends the new DNA strands.
The cycles of the PCR consist of:
An initial heating at 94oC for 2 minutes to denature DNA into single strands.
Then, 40 cycles of denaturation/annealing/extension
A 94oC step to denature the DNA. Heat breaks hydrogen bonds
A 60oC step to anneal (form hydrogen bonds with complementary bases) the primers to
the target DNA
A 72oC step to extend, or polymerize, the new DNA
A final incubation at 72oC for 10 minutes is conducted to fully extend all new strands of DNA.
3
During each cycle of DNA replication, a new copy of the target DNA (PV-92 Alu sequence) is
produced so that after 1 cycle, there is 2X the amount of target DNA, after 2 cycles, 4X the
amount and so on. Amplification of the specific DNA sequence is exponential. The PCR is run
for 30 - 40 cycles so that millions of DNA copies (1012 times the original amount of DNA) are
produced yeilding an amount of DNA that can be visualized via electrophoresis. The entire
reaction will be conducted in a thermocycler which is programmed to shuttle between the desired
temperatures. Samples are stored at -20 oC until further use.
After electrophoresis and staining with a visible dye, each student is scored one of the three Alu
genotypes (+/+, +/-, or -/-)
Chromosome 16 PV92 locus
Genotype
PCR product
<-300
bp->
300bp
Alu
Homozygous +/+
941 bases
Heterozygous +/-
941 + 641
bases
Homozygous -
641 bases
Alu
Alu
/-
4
revised s12
DNA Fingerprinting the PV92 Alu insertion via the Polymerase Chain Reaction
Equipment and Reagents
DNA isolation and PCR
Microcentrifuge tubes and rack
Chelex 10% solution in sterile dH2O
Saline solution (0.9% NaCl) 10 ml
Boiling water bath or heat block
Ice
60 degree water bath or heat block
PCR master mix (contains nucleotides, buffer, Magnesium and Taq DNA polymerase)
Primer mix (50X forward and reverse primers)
Forward primer: 5' GGATCTCAGGGTGGGTGGCAATGCT 3'
Reverse primer: 5' GAAAGGCAAGCTACCAGAAGCCCCAA3'
Pipetteman and tips
Foam racks
Vortex
Paper cups
Gloves
Thermocycler
Microcentrifuge
Electrophoresis
Agarose
Microwave
UV transilluminator
Power supply
Erlenmeyer flask
Balance
Weigh paper
TBE buffer (5, 10, or 20X stock)
1000 ml graduated cylinder
Pipettemen and tips
Gel electrophoresis comb, tray, tans, and power supply
DNA loading dye (6X or 10X concentrate)
DNA size standards
Ethidium bromide stain
Parafilm
Masking tape
5
Procedure
CHEEK CELL DNA
I. Prepare cheek epithelial cell DNA
1. Wear gloves. Use a marker to mark a clean 1.5 ml tube.
2. Obtain a 15 ml tube containing 10 ml sterile saline (0.9% NaCl). Saline is isotonic to
cells and will keep them intact so that they do not lyse. Rinse your mouth vigorously for
30 seconds with the saline and expel the solution into a paper cup.
3. Transfer 1 ml of your saline rinse into the microfuge tube. Use a pipetteman with blue tip.
Never use pipettemen without a tip. Avoid bubbles. Save remaining cheek cells in cup.
4. Centrifuge in a balanced microcentrifuge for 2 minutes at 6,000 X g. Examine the tube
for a small, whitish pellet of cells. To decant the supernatant, invert the tube and blot
gently on a paper towel. Check to see that pellet remains adhered to the tube.
5. Add another 1 ml of your saline rinse to the same microfuge tube, spin again, and decant
as described in the previous steps. Try to remove all of the supernatant (!)
6. Set a pipetteman to 200 ul. Using a yellow pipette tip, draw 200 ul 10% well suspended
Chelex - careful, the resin settles quickly in the bottle. Add the Chelex to the cell pellet.
7. Resuspend the cells by gently pipetting in and out several times. No visible clumps of
cells should remain. This will insure that the Chelex can interact with all cellular
material. Cap tightly!
8. Place the sample in a 60oC heat block for 10 minutes to inactivate endonucleases,
enzymes that would otherwise degrade DNA. This temperature also softens cell
membranes and separates clumps of cells. Vortex the tube about halfway through this
incubation step for 15 seconds.
9. Vortex the tube. Incubate at 90 oC for 5 minutes to lyse the cells and denature proteins.
10. Vortex the tube. Spin in a balanced microcentrifuge for 30 seconds at 6,000 X g to collect
Chelex in a pellet.
11. Use a fresh tip to transfer 100 ul of the clear supernatant to a clean, labeled 1.5 ml tube.
Do not remove or disturb the Chelex – it will inhibit the PCR (because it will bind the
magnesium ions required by taq polymerase).
12. Store on ice.
You now have pure DNA which can be amplified in the polymerase chain reaction
6
PCR Reaction
1. Obtain a 0.2 ml PCR tube and label the cap with your initials using a Sharpie pen. Place
the tube in a PCR tube holder (foam rack).
2. Add 20 ul of DNA sample to the tube. Keep on ice.
3. Locate the yellow PCR master mix on ice. The master mix contains Taq polymerase,
magnesium ions, buffer, nucleotides, and primers. Add 20 ul of the master mix to the
DNA sample. Pipette up and down a few times to mix well. Avoid bubbles. Keep the
tube on ice! These reagents are very sensitive.
The final concentration in the PCR is:
Taq polymerase: 0.05 units enzyme per microliter (ul)
MgCl2 3 mM (millimolar = 1 X 10 -3 moles/liter)
dNTPs 1.6 mM each (nucleotides G,A,T,C)
Primer 1.0 uM (micromolar = 1 X 10 -6 moles/liter) each complementary primer
(forward and reverse primers)
4. Cap tube tightly. A poorly capped tube will result in evaporation. Keep your tube on ice
until the rest of the class is ready.
5. The thermocycler is programmed for the following single cycle: 94 oC for 2 minutes to
denature the double stranded DNA 
followed by 40 cycles of:
94 oC 1 minute (denature double stranded DNA)
60 oC 1 minute (anneal primers to complementary sequences)
72 oC 2 minutes (extend new DNA strands)
 72 oC final extension for 10 minutes  hold at 4 oC
6. Store the samples at -20 oC.
7
Electrophoresis of DNA Amplified by the Polymerase Chain Reaction
Prepare 50 ml agarose gel
1. Prepare the gel former by placing the comb in the top notches of the gel tray. Apply
masking tape to the ends to seal.
2. Prepare the molten agarose
o Pour 50 ml of 1X TBE (Tris.Borate.EDTA, pH 8.0) buffer into a 250ml Erlenmeyer
flask.
o Obtain 1 piece of weigh paper; fold in half to make a crease.
o Place the weigh paper on the balance and zero the balance. Add enough agarose to
make a 1% solution (weight/volume) in the 1X TBE. Add agarose to buffer. Swirl.
Example: 1 gram in 100 ml solution is 1% weight/volume, to prepare 50 ml, you will
need to recalculate the amount of agarose required.
3. Microwave 1 minute to dissolve the agarose. After 1 minute, examine the agarose for any
undissolved particles. Continue to microwave in 30 second pulses until the agarose is
completely dissolved. THE AGAROSE WILL BE HOT
Even one small undissolved particle will interfere with electrophoresis.
4. The instructor will add ethidium bromide to the agarose. Ethidium bromide is a
fluorescent dye that binds to DNA. It is known as an “intercalator” because it inserts in
between bases. For this reason, EthBr is also a mutagen. Wear gloves when handling and
dispose of properly in a waste container. EthBr fluoresces orange under UV light to
indicate the position of the DNA on the gel.
5. Pour the molten agarose into the gel tray until the liquid is about ½ way up the teeth of
the comb.
DO NOT MOVE THE GEL TRAY while the gel is solidifying.
6. Wear gloves. Add 10 ul of 6X loading dye to each PCR sample. The loading dye is used
to track the progress of the gel and contains glycerol to make the sample dense
7. Remove the tape and comb from the gel. Place it in the tank. Make sure the gel is in the
correct orientation. DNA is negatively charged and will migrate towards the positive pole
(red). Add 1X TBE buffer to just cover the gel. To make 1X TBE, dilute the stock with
distilled water as directed by the instructor.
Practice loading the gel with dye.
8. Load samples
8
Lane
1
2
3
4
Sample
DNA size markers
Student 1
Student 2
Student 3
Load volume
10 ul
20 ul
20 ul
20 ul
Make sure to remember the order in which the samples are loaded.
9. Place the lid on the gel, plug it into the power supply (red to red terminal, black to black).
Do not turn the power on until the lid is firmly in place and all electrical connections have
been made. Once the power is on, check the platinum electrodes (wires) that run along the
plexiglass bottom of the gel to insure that bubbles are forming. Electrophorese at 90 volts for
at least 30 minutes.
10. Visualize the DNA under the UV light box.
CLEAN UP:
Unplug power supplies
Rinse gel boxes and supplies and place overturned on a paper towel to dry.
Dispose of tubes and gloves in the regular trash
Wash hands