Journal
of General Virology (1998), 79, 3015–3018. Printed in Great Britain
..........................................................................................................................................................................................................
SHORT COMMUNICATION
Cis-acting elements in the lytic origin of DNA replication of
Marek’s disease virus type 1
Atsushi Katsumata, Akira Iwata and Susumu Ueda
Nippon Institute for Biological Science, Shin-machi 9-2221-1, Ome, Tokyo 198-0024, Japan
The replication origin of Marek’s disease virus
(MDV) type 1 was analysed by using a transient
replication assay with plasmids containing various
fragments of MDV strain Md5 genomic DNA. Plasmid pMBH, containing the BamHI-H fragment,
showed replication activity in MDV-infected chicken
embryonic fibroblasts (CEF). By deletion analysis of
pMBH, two regions, the promoter–enhancer region
of the MDV pp38 gene and the 132 bp tandem
direct repeat, were shown to be required for
replication activity. Replication of pMBH was not
observed in uninfected CEF, suggesting that a
trans-acting factor(s) encoded by the MDV genome
was necessary for replication.
Marek’s disease is a lymphomatous disease of chickens
caused by Marek’s disease virus (MDV), an α-herpesvirus.
MDV infects chickens via the respiratory tract and replicates in
epithelial cells (Adldinger & Calnek, 1973) ; viral antigens are
detected in lymphoid organs 2–3 days after infection (Payne &
Rennie, 1973). An early cytolytic infection occurs in lymphoid
organs 3–7 days after infection, both in B cells (Shek et al.,
1983) and to a lesser extent in T cells (Calnek et al., 1984).
Concomitant with the appearance of the early immune
response about 1 week after infection, a change takes place
from cytolytic to latent infection of lymphocytes, particularly
in activated T cells and T cell-derived cell lines established in
vitro from Marek’s disease tumours (Calnek et al., 1989). In
established cell lines, the MDV genome is maintained in both
integrated (Delecluse & Hammerschmidt, 1993 ; Delecluse et
al., 1993) and episomal (Tanaka et al., 1978) states, indicating
that MDV genomic DNA is replicated even during latent
phases of the virus life-cycle.
MDV is classified as an α-herpesvirus on the basis of its
genome organization (Cebrian et al., 1982 ; Fukuchi et al., 1984)
and similarity in nucleotide and amino acid sequences
(Buckmaster et al., 1988). Replication origins (ori) have been
Author for correspondence : Akira Iwata.
Fax ­81 428 32 0670.
0001-5720 # 1998 SGM
identified for some herpesviruses, but the nucleotide sequences
so far determined are different among α-, β- and γ-herpesviruses
(Stow, 1982 ; Yates et al., 1984 ; Stow & Davison, 1986 ;
Hammerschmidt & Sugden, 1988 ; Baumann et al., 1989 ;
Hamzeh et al., 1990). The DNA sequence of the ori region has
been determined for MDV type 1 (Bradley et al., 1989), type 2
(Camp et al., 1991) and type 3 (Smith et al., 1995), and each
consists of a core stretch of AT-rich palindromic sequence and
three repeats of a highly conserved 9 bp sequence
(CGTTCGCAC) which functions as the binding site for the
origin binding protein (Elias et al., 1986 ; Koff & Tegtmeyer,
1988).
These ori sequences share 81±3 % nucleotide identity among
the three types of MDV, and 70–75 % identity with those of
other α-herpesviruses (Bradley et al., 1989 ; Camp et al., 1991 ;
Smith et al., 1995). The ori sequences of MDV types 2 and 3
have been shown to function as origins of replication by a
transient replication assay (Camp et al., 1991 ; Smith et al.,
1995). In contrast, replication origin activity has not been
observed for MDV type 1. In this study, we show that the ori
sequence of MDV type 1 indeed functions as a replication
origin. Using a series of deletion mutants, we also determined
that the essential cis-elements are located adjacent to the core
sequence.
To identify the minimum sequence for replication initiation,
we used as a starting material the plasmid pMBH, which
contains the BamHI-H fragment of MDV strain Md5, including
the putative ori sequence, in the pUC18 vector (Iwata et al.,
1992). To assess replication activity, CEF (1¬10') were
infected overnight with MDV type 1 strain Md5 (10% focusforming units from passage 14) and then transfected with
10 µg pMBH by a lipofectin method (Gibco BRL). After
incubation for various time periods, DNA was extracted and
digested with DpnI or NdeII. If the transfected DNA has been
replicated, the newly synthesized DNA strands should not be
methylated ; unmethylated DNA is resistant to DpnI cleavage,
but sensitive to NdeII (Hammerschmidt & Sugden, 1988). To
identify the vector DNA clearly, DNA was treated with
BamHI, which cleaves pMBH at two points giving pUC18
DNA (2±7 kbp) and the MDV BamHI-H fragment, and then
analysed by Southern hybridization using pUC18 DNA as a
probe.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 09:30:58
DABF
A. Katsumata, A. Iwata and S. Ueda
Fig. 1. Time-course of replication of pMBH in MDV-infected CEF.
(A) Transient replication assay of pMBH. DNA samples from 3, 6 and 8
days post-transfection (dpt) were digested with BamHI and then with
NdeII (lane N) or DpnI (lane D). As a control pUC18 DNA was transfected
and analysed 8 days post-transfection. (B) Effect of MDV infection on
replication of pMBH. pMBH was transfected into infected or uninfected
CEF. The positions of pUC18 (2±7 kbp) and pMBH (8±1 kbp) are
indicated.
The DpnI-resistant band of intact pUC18 was detected
from 3 to 8 days after transfection (Fig. 1 A), suggesting that
unmethylated pMBH existed in the transfected cells. In
contrast, the NdeII-resistant form of the plasmid, which had
been methylated during replication in a bacterial host (dam+),
was detected 3 days after transfection, but thereafter decreased
gradually and had disappeared by 8 days after transfection.
These results suggest that pMBH was replicated in MDVinfected CEF. Transfected pUC18 without the MDV BamHI-H
fragment remained in the NdeII-resistant form until day 8, and
no DpnI-resistant form was observed, indicating that pUC18
by itself was not replicated.
One possible explanation for pMBH replication in MDVinfected cells is that the pMBH plasmid was integrated either
into the viral genome or into a cellular chromosome. To
exclude this possibility, we prepared DNA from cells by the
method of Hirt (1967) to remove high molecular mass DNA.
The DNA was digested with XbaI, which cleaves pMBH at a
unique site to give an 8±1 kbp linear molecule. As shown in Fig.
1 (B), a DpnI-resistant band of 8±1 kbp was observed in samples
obtained 1, 3 and 5 days after transfection. We therefore
concluded that pMBH was replicated without being integrated
into the MDV or CEF genome.
To determine whether pMBH replication required a transacting factor(s) encoded by the MDV genome, we introduced
the plasmid into uninfected CEF (Fig. 1 B). No band cor-
DABG
responding to pMBH was detected 1, 3 or 5 days after
transfection, indicating that replication of pMBH requires an
MDV-encoded trans-acting factor(s).
To identify the sequence required for replication, we
constructed a set of pMBH deletion derivatives. Various DNA
fragments, each corresponding to a segment of the MDV type
1 ori region, were prepared by PCR with Md5 DNA as the
template and a series of primers (Fig. 2 A). Self-replication
activity was examined as above for all these deletion plasmids.
In preliminary experiments, plasmid p2021 was found to
replicate as efficiently as pMBH. However, replication of
p2021 decreased from 5 days after transfection relative to
pMBH (Fig. 2 B). For a systematic comparison, samples were
prepared 5 days after transfection. To avoid errors due to
differences in transfection efficiency or sample preparation,
equal amounts of pMBH were added as an internal control for
standardization. The replication efficiency of the ori plasmids
was quantified by scanning specific bands detected after
Southern hybridization and autoradiography.
As shown in Fig. 2 (C), the replication activity of p321 was
as high as that of p2021, but the replication activity of p221
was about one-quarter of that of p321, implying that the
sequence deleted between p221 and p321 includes a signal for
the enhancement of DNA replication. In this region there are
two copies of a 132 bp direct repeat (see Fig. 2 A). A low level
of activity was retained even after further deletion up to
p1821. Therefore, it appears that the repeats, in addition to the
α-herpesvirus consensus motif, have a role in enhancing DNA
replication.
The direct repeats are thought to have a tumour-associated
function (Kato & Hirai, 1988). An oncogenic strain of MDV
contained only two or three repeats of this 132 bp sequence
(Maotani et al., 1986). Repeated passage of an oncogenic MDV
in CEF caused attenuation of tumour-inducing ability in chicken
and, concomitantly, the 132 bp sequences were amplified 5- to
20-fold in attenuated strains of MDV (Kato & Hirai, 1988).
However, the relationship between replication origin activity
and tumorigenicity is not known. After serial passage in CEF,
the growth rate of MDV increases and its plaques become
larger (Churchill et al., 1969). One explanation for this adaptive
growth is that expansion of the 132 bp direct repeat enhances
replication activity and thereby MDV growth in CEF.
Elucidation of the role of the 132 bp repeat in MDV lytic
replication will require further analysis.
Excision of the 5«-proximal part of the BamHI-H region
including the promoter–enhancer region of the pp38 gene (Cui
et al., 1991), as in pX20, pX18 and p1022, abolished replication
activity (Fig. 2 C). The direction of transcription of the pp38
gene (Cui et al., 1991) and the BamHI-H gene family (Bradley
et al., 1989 ; Iwata et al., 1992 ; Peng et al., 1992) is away from
the ori. Such a gene organization is conserved among
herpesviruses. The replication origins of herpes simplex virus
type 1, oriL and two sets of oriS, are flanked by transcriptional
regulatory elements of the single-stranded DNA-binding
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 09:30:58
Replication origin of MDV type 1
Fig. 2. Transient replication assay of deletion plasmids. (A) A schematic representation of the BamHI-H fragment and the
location of each PCR product. The transcription start sites of pp38 and the BamHI-H gene family are indicated by arrows,
positions of each primer are indicated by arrowheads and the position of the 132 bp direct repeats are indicated by boxes.
(B) Time-course of replication of p2021 co-transfected with pMBH. dpt, Days post-transfection. (C) Transient replication assay of
the deleted plasmids shown in (A). Plasmids p2021, p321, p221 and p1821 have inserts which start from primer 21 and end
at primers 20, 3, 2 and 18, respectively. Plasmids pX20 and pX18 were constructed from p2021 and p1821, respectively, by
cutting with XhoI. Plasmid p1022 contains a PCR product from primers 10 and 22. Nucleotide sequences of plasmids were
confirmed before use. The nucleotide sequences of primers were : 2, 5« ATTCCTCCATAGCACTTTCATCGCA ;
3, 5« CTCAAAGGAATTACTGGACTCGAAT ; 10, 5« CAACACTCAAGTGCGAATTTG ; 18, 5« GAACCGCTTCATCATCAAATATCGC ;
20, 5« TCGACAACTGAGAAGGGTTTCTTT ; 21, 5« GAATTCCATCACCCCCTGCC ; 22, 5« TTACGATTCTTATACGGGTG.
protein (ssDBP) and the DNA polymerase genes, and of the
IE175 and IE68 genes, respectively (Stow & McMonagle,
1983 ; Wong & Schaffer, 1991). The promoter–enhancer region
of the IE175 and IE68 genes enhances the replication origin
function of herpes simplex virus type 2 oriS by about 80-fold
(Smith et al., 1989). The origin of replication of a β-herpesvirus,
human cytomegalovirus, was identified in an upstream region
of the ssDBP gene (Hamzeh et al., 1990). The oriLyt of
Epstein–Barr virus consists of two essential elements located
between two genes, BHLF1 and BHRF1 ; the upstream element
co-localizes with the promoter of the BHLF1 gene (Gruffat et
al., 1990 ; Schepers et al., 1993). The ori of MDV therefore has
the characteristic features of herpesvirus replication origins.
The promoter–enhancer region of the BamHI-H gene family
may enhance replication, but this remains to be confirmed.
Replication of p1022, which contains the core sequence of
the ori, could not be detected when it was transfected into
infected cells. Because of the highly cell-associated nature of
MDV, only 10 % or less of the cells were likely to be infected
with MDV under our experimental conditions (data not
shown). A more sensitive method would be required to detect
replication of a plasmid containing only the core sequence and
to analyse the cis-elements in more detail.
We would like to thank Professor A. Ishihama for continued discussion
and critical reading of this manuscript.
References
Adldinger, H. K. & Calnek, B. W. (1973). Pathogenesis of Marek’s
disease : early distribution of virus and viral antigens in infected chicken.
Journal of the National Cancer Institute 50, 1287–1298.
Baumann, R. P., Yalamanchili, V. R. R. & O’Callaghan, D. J. (1989).
Functional mapping and DNA sequence of an equine herpesvirus 1 origin
of replication. Journal of Virology 63, 1275–1283.
Bradley, G., Hayashi, M., Lancz, G., Tanaka, A. & Nonoyama, M.
(1989). Structure of the Marek’s disease virus BamHI-H gene family :
genes of putative importance for tumor induction. Journal of Virology 63,
2534–2542.
Buckmaster, A. E., Scott, S. D., Sanderson, M. J., Boursnell, M. E. G.,
Ross, N. L. J. & Binns, M. M. (1988). Gene sequence and mapping data
from Marek’s disease virus and herpesvirus of turkeys : implications for
herpesvirus classification. Journal of General Virology 69, 2033–2042.
Calnek, B. W., Schat, K. A., Ross, L. J., Shek, W. R. & Chen, C. L.
(1984). Further characterization of Marek’s disease virus-infected
lymphocytes. I. In vivo infection. International Journal of Cancer 33,
389–395.
Calnek, B. W., Lucio, B., Schat, K. A. & Lillehoj, H. S. (1989).
Pathogenesis of Marek’s disease virus-induced local lesions. 1. Lesion
characterization and cell line establishment. Avian Disease 33, 291–302.
Camp, H. S., Coussens, P. M. & Silva, R. F. (1991). Cloning, sequencing
and functional analysis of a Marek’s disease virus origin of replication.
Journal of Virology 65, 6320–6324.
Cebrian, J., Kaschka-Dierich, C., Berthelot, N. & Sheldrick, P. (1982).
Inverted repeat nucleotide sequences in the genomes of Marek disease
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 09:30:58
DABH
A. Katsumata, A. Iwata and S. Ueda
virus and the herpesvirus of the turkey. Proceedings of the National
Academy of Sciences, USA 79, 555–558.
Churchill, A. E., Chubb, R. C. & Baxendale, W. (1969). The attenuation,
with loss of oncogenicity, of the herpes-type virus of Marek’s disease
(strain HPRS-16) on passage in cell culture. Journal of General Virology 4,
557–564.
Cui, Z., Lee, L. F., Liu, J.-L. & Kung, H.-J. (1991). Structural analysis and
transcriptional mapping of the Marek’s disease virus gene encoding
pp38, an antigen associated with transformed cells. Journal of Virology 65,
6509–6515.
Delecluse, H.-J. & Hammerschmidt, W. (1993). Status of Marek’s
disease virus in established lymphoma cell lines : herpesvirus integration
is common. Journal of Virology 67, 82–92.
Delecluse, H.-J., Schuller, S. & Hammerschmidt, W. (1993). Latent
Marek’s disease virus can be activated from its chromosomally integrated
state in herpesvirus-transformed lymphoma cells. EMBO Journal 12,
3277–3286.
Elias, P., O’Donnell, M. E., Mocarski, E. S. & Lehman, I. R. (1986). A
DNA binding protein specific for an origin of replication of herpes
simplex virus type 1. Proceedings of the National Academy of Sciences, USA
83, 6322–6326.
Fukuchi, K., Sudo, M., Lee, Y., Tanaka, A. & Nonoyama, M. (1984).
Structure of Marek’s disease virus DNA : detailed restriction enzyme
map. Journal of Virology 51, 102–109.
Gruffat, H., Moreno, N. & Sergeant, A. (1990). The Epstein–Barr virus
(EBV) ORIlyt enhancer is not B-cell specific and does not respond
synergistically to the EBV transcription factors R and Z. Journal of
Virology 64, 2810–2818.
Hammerschmidt, W. & Sugden, B. (1988). Identification and characterization of oriLyt, a lytic origin of DNA replication of Epstein–Barr virus.
Cell 55, 427–433.
Hamzeh, F. M., Lietman, P. S., Gibson, W. & Hayward, G. S. (1990).
Identification of the lytic origin of DNA replication in human cytomegalovirus by a novel approach utilizing ganciclovir-induced chain
termination. Journal of Virology 64, 6184–6195.
Hirt, B. (1967). Selective extraction of polyoma DNA from infected
mouse cell cultures. Journal of Molecular Biology 26, 365–369.
Iwata, A., Ueda, S., Ishihama, A. & Hirai, K. (1992). Sequence
determination of cDNA clones of transcripts from the tumor-associated
region of the Marek’s disease virus genome. Virology 187, 805–808.
Kato, S. & Hirai, K. (1988). Marek’s disease virus. Advances in Virus
Research 30, 225–277.
Koff, A. & Tegtmeyer, P. (1988). Characterization of major recognition
sequences for a herpes simplex virus type 1 origin-binding protein.
Journal of Virology 62, 4096–4103.
Maotani, K., Kanamori, A., Ikuta, K., Ueda, S., Kato, S. & Hirai, K.
(1986). Amplification of a tandem direct repeat within inverted repeats
DABI
of Marek’s disease virus DNA during serial in vitro passage. Journal of
Virology 58, 657–660.
Payne, L. N. & Rennie, M. (1973). Pathogenesis of Marek’s disease in
chicks with and without maternal antibodies. Journal of the National Cancer
Institute 51, 1559–1573.
Peng, F., Bradley, G., Tanaka, A., Lancz, G. & Nonoyama, M. (1992).
Isolation and characterization of cDNAs from BamHI-H gene family
RNAs associated with the tumorigenicity of Marek’s disease virus.
Journal of Virology 66, 7389–7396.
Schepers, A., Pich, D., Mankertz, J. & Hammerschmidt, W. (1993). Cisacting elements in the lytic origin of DNA replication of Epstein–Barr
virus. Journal of Virology 67, 4237–4245.
Shek, W. R., Calnek, B. W., Schat, K. A. & Chen, C. H. (1983).
Characterization of Marek’s disease virus-infected lymphocytes : discrimination between cytolytically and latently infected cells. Journal of the
National Cancer Institute 70, 485–491.
Smith, C. A., Marchetti, M. E., Edmonson, P. & Schaffer, P. A. (1989).
Herpes simplex virus type 2 mutants with deletions in the intergenic
region between ICP4 and ICP22}47 : identification of nonessential cisacting elements in the context of the viral genome. Journal of Virology 63,
2036–2047.
Smith, G. D., Zelnik, V. & Ross, L. J. N. (1995). Gene organization in
herpesvirus of turkey : identification of a novel open reading frame in the
long unique region and a truncated homologue of pp38 in the internal
repeat. Virology 207, 205–216.
Stow, N. D. (1982). Localization of an origin of DNA replication within
the TRS}IRS repeated region of the herpes simplex virus type 1 genome.
EMBO Journal 7, 863–867.
Stow, N. D. & Davison, A. J. (1986). Identification of a varicella-zoster
virus origin of DNA replication and its activation by herpes simplex virus
type 1 gene products. Journal of General Virology 67, 1613–1623.
Stow, N. D. & McMonagle, E. C. (1983). Characterization of the TR }IR
S
S
origin of DNA replication of herpes simplex virus type 1. Virology 130,
427–438.
Tanaka, A., Silver, S. & Nonoyama, M. (1978). Biochemical evidence of
the nonintegrated status of Marek’s disease virus DNA in virustransformed lymphoblastoid cells of chicken. Virology 88, 19–24.
Wong, S. W. & Schaffer, P. A. (1991). Elements in the transcriptional
regulatory region flanking herpes simplex virus type 1 oriS stimulate
origin function. Journal of Virology 65, 2601–2611.
Yates, J. L., Warren, N., Reisman, D. & Sugden, B. (1984). A cis-acting
element from the Epstein–Barr viral genome that permits stable
replication of recombinant plasmids in latently infected cells. Proceedings
of the National Academy of Sciences, USA 81, 3806–3810.
Received 28 May 1998 ; Accepted 19 August 1998
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 09:30:58