10662 • The Journal of Neuroscience, August 1, 2012 • 32(31):10662–10673
Development/Plasticity/Repair
The stat3/socs3a Pathway Is a Key Regulator of Hair Cell
Regeneration in Zebrafish stat3/socs3a Pathway: Regulator
of Hair Cell Regeneration
Jin Liang,1,3 Dongmei Wang,4 Gabriel Renaud,1 Tyra G. Wolfsberg,1 Alexander F. Wilson,2 and Shawn M. Burgess1
1
Genome Technology Branch, and 2Inherited Disease Research Branch, National Human Genome Research Institute, Bethesda, Maryland 20892,
Neuroscience and Cognitive Science Program, University of Maryland, College Park, Maryland 20742, and 4Qingdao Institute of BioEnergy and BioProcess
Technology, Chinese Academy of Sciences, Qingdao 266101, Shandong, People’s Republic of China
3
All nonmammalian vertebrates studied can regenerate inner ear mechanosensory receptors (i.e., hair cells) (Corwin and Cotanche, 1988;
Lombarte et al., 1993; Baird et al., 1996), but mammals possess only a very limited capacity for regeneration after birth (Roberson and
Rubel, 1994). As a result, mammals experience permanent deficiencies in hearing and balance once their inner ear hair cells are lost. The
mechanisms of hair cell regeneration are poorly understood. Because the inner ear sensory epithelium is highly conserved in all vertebrates (Fritzsch et al., 2007), we chose to study hair cell regeneration mechanism in adult zebrafish, hoping the results would be transferrable to inducing hair cell regeneration in mammals. We defined the comprehensive network of genes involved in hair cell regeneration
in the inner ear of adult zebrafish with the powerful transcriptional profiling technique digital gene expression, which leverages the power
of next-generation sequencing (‘t Hoen et al., 2008). We also identified a key pathway, stat3/socs3, and demonstrated its role in promoting
hair cell regeneration through stem cell activation, cell division, and differentiation. In addition, transient pharmacological inhibition of stat3
signaling accelerated hair cell regeneration without overproducing cells. Taking other published datasets into account (Sano et al., 1999; Schebestaetal.,2006;Dierssenetal.,2008;Riehleetal.,2008;Zhuetal.,2008;Qinetal.,2009),weproposethatthestat3/socs3pathwayisakeyresponse
in all tissue regeneration and thus an important therapeutic target for a broad application in tissue repair and injury healing.
Introduction
The sensory epithelium of the inner ear is mainly composed of
two types of cells: hair cells and supporting cells (Fritzsch et al.,
2006). Inner ear hair cells are the basic mechanosensory receptors
for hearing and balance (Vollrath et al., 2007), while supporting
cells provide a variety of functions including being the stem cells
for replacing hair cells in most vertebrates (Balak et al., 1990;
Baird et al., 1996; Jones and Corwin, 1996). All nonmammalian
vertebrates studied show the ability to regenerate their inner ear
hair cells (Cruz et al., 1987; Corwin and Cotanche, 1988; Lombarte et al., 1993; Baird et al., 1996). However, in mammals, loss
of inner ear hair cells caused by acoustic overexposure (McGill
and Schuknecht, 1976), otoxic drugs (Lim, 1976) or aging
(Soucek et al., 1986) is the major cause of permanent auditory
and vestibular deficiencies because mammals lose regenerative
Received Nov. 3, 2010; revised June 12, 2012; accepted June 13, 2012.
Author contributions: J.L., D.W., and S.M.B. designed research; J.L. and D.W. performed research; G.R. and T.G.W.
contributed unpublished reagents/analytic tools; J.L., D.W., G.R., T.G.W., A.F.W., and S.M.B. analyzed data; J.L. and
S.M.B. wrote the paper.
This research was supported by the Intramural Research Program of the National Human Genome Research
Institute, National Institutes of Health (S.M.B.). We thank A. Popper for use of the sound exposure equipment and
helpful discussions, and D. Bodine and W. Pavan for critical reading of the manuscript.
This article is freely available online through the J Neurosci Open Choice option.
The authors declare no competing financial interests.
Correspondence should be addressed to Shawn M. Burgess at the above address. E-mail: [email protected].
DOI:10.1523/JNEUROSCI.5785-10.2012
Copyright © 2012 the authors 0270-6474/12/3210662-12$15.00/0
ability after birth (Roberson and Rubel, 1994). Because the inner
ear sensory epithelium is highly conserved in all vertebrates
(Fritzsch et al., 2007), numerous studies have been done in nonmammalian vertebrates to understand the mechanism of hair cell
regeneration (Brignull et al., 2009). However, our understanding
of the mechanisms involved is still very limited because it is a
complex, multistaged process (Stone and Cotanche, 2007).
In this study, we used the powerful profiling technique digital
gene expression (DGE) (‘t Hoen et al., 2008; Morrissy et al., 2009)
to study the hair cell regeneration in zebrafish at high resolution
to get a more comprehensive view of the process. In zebrafish,
spontaneous and damage-induced hair cell production has been
demonstrated in both the inner ear (Bang et al., 2001; Higgs et al.,
2002; Schuck and Smith, 2009) and the neuromasts (Harris et al.,
2003), a mechanosensory structure highly similar to the sensory
epithelia of the inner ear (Nicolson, 2005) and thus an excellent
model for studying hair cell regeneration (Harris et al., 2003;
Hernández et al., 2007; Ma et al., 2008; Behra et al., 2009). In
addition, zebrafish are commonly used as a genetic/genomic
model organism, making zebrafish a valuable system for studying
the molecular mechanisms of hair cell regeneration in adult vertebrates in a systematic fashion.
By analyzing the expression profiles from inner ear tissues
during regeneration, we identified a key pathway, stat3/socs3, and
demonstrated its role in promoting regeneration. Signal transducer and activator of transcription 3 (stat3) is a transcription
Liang et al. • The stat3/socs3a Pathway and Hair Cell Regeneration
factor. Its downstream targets include stat3 itself and suppressor
of cytokine signaling 3 (socs3) (Leonard and O’Shea, 1998). Socs3
protein antagonizes the activation of Stat3 in the cytosol as a
negative feedback (Leonard and O’Shea, 1998). The selfrestrictive pathway is known to be involved in the following
various biological processes: cell proliferation, cell migration, immune responses, cell survival (Yoshimura, 2009; Yu et al., 2009),
as well as regeneration in skin (Sano et al., 1999; Zhu et al., 2008),
liver (Dierssen et al., 2008; Riehle et al., 2008), fins (Schebesta et
al., 2006), and retinas (Qin et al., 2009). Comparing our data with
those in other publications, we propose that the stat3/socs3 pathway is a key response in all tissue regeneration and thus a potential therapeutic target for tissue repair.
J. Neurosci., August 1, 2012 • 32(31):10662–10673 • 10663
Table 1. Sequences of primers and morpholinos
Experiment
Target gene Sequence
qRT-PCR
atoh1a
bactin1
bcl6
dld
gapdh
jak1
mmp2
Materials and Methods
Animal husbandry. Zebrafish were maintained under approved animal
protocols as previously described (Westerfield, 2000) and in compliance with guidelines for animal care from NIH and the University of
Maryland.
Noise exposure of adult zebrafish. Adult wild-type TAB-5 (Amsterdam
et al., 1999) mixed-sex zebrafish (⬃1 year old) were exposed to white
noise (100 –10,000 Hz, 150 –170 dB re 1 ␮Pa) for 48 h at 28 –29°C according to a protocol modified from Smith et al. (2006). After exposure,
the fish were maintained under regular husbandry conditions until
killed. The control fish were not exposed to noise.
Tag profiling and tag mapping. The tag profiling data of inner ear
tissues were generated by Illumina. Tags detected only once were discarded. The tag sequences were mapped against transcriptome and
genomic sequence databases: Refseq RNAs, UniGene, Ensembl RNAs,
Ensembl RNA ab initio, and the zebrafish genome (Zv.8). UniGene IDs
were used as the primary index (except for those Refseq RNAs without
corresponding UniGene IDs). The expression level of a certain gene
(identified by a unique UniGene ID) was the summation of counts of the
tags that were “unambiguously mapped” to the gene normalized by the
total counts of all tags obtained in the profile in the expression unit called
transcripts per million.
Analyses of expression profiling data. The sample clustering analysis was
done using Genesifter software (Geospiza). Candidate genes were identified for further analysis if they showed significant differences in expression level during regeneration compared with the control sample (i.e.,
ⱖ1.5-fold increase or ⱖ2-fold decrease in expression level with a p value
⬍0.01, as determined by ␹ 2 test or Fisher’s exact test. Pathway analysis
was done with MetaCore software (GeneGo).
Quantitative RT-PCR. Glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) and bactin1 were used as reference genes. The relative change
in expression level of a gene X in an experimental sample compared with
the control sample was calculated as 2 ⫻ (⌬CtEXPx ⫺ ⌬CtCONx), where
⌬CtEXPx ⫽ (CtEXPref ⫺ CtEXPx) and ⌬CtCONx ⫽ (CtCONref ⫺ CtCONx). Ct
is the cycle number at which amplification rises above the background
threshold. All primers are listed in Table 1.
Whole-mount in situ hybridization. Regular whole-mount in situ hybridization (ISH) of zebrafish embryos was done as previously described (Oxtoby and Jowett, 1993). Fluorescent whole-mount in situ hybridization was
performed according to the regular in situ hybridization protocol, except
that the TSA Cyanine 3 system (PerkinElmer) was used for developing fluorescent signals. All primers for probe synthesis are listed in Table 1.
Morpholino and mature mRNA injection. The injections were done in
fertilized eggs of TAB-5 (Amsterdam et al., 1999) or Tg(cldnb:GFP) (Haas
and Gilmour, 2006) lines. Morpholinos (MOs) against stat3, socs3a, and
tp53 (Table 1) were injected at a concentration of 500 ␮M. The mature
mRNA of socs3a was injected at a concentration of 37.8 ng/␮l.
Induction of lateral line hair cell death in larval zebrafish. The 5 d postfertilization (dpf)-old larval fish were treated with 10 ␮M CuSO4 for 2 h at
28.5°C as previously described (Hernández et al., 2007) to induce complete lateral line hair cell loss.
Quantification of hair cell numbers and mitotic events during lateral line
hair cell regeneration. After CuSO4 treatment to induce lateral line hair
mmp9
socs3a
socs3b
stat3
In situ hybridization probe stat3
synthesis
socs3a
Morpholino
socs3a
stat3
tp53
F: 5⬘-GCG AAG AAT GCA CGG ATT GAA CCA-3⬘
R: 5⬘-TGC AGG GTT TCG TAC TTG GAG AGT-3⬘
F: 5⬘-GAC CCA GAC ATC AGG GAG TGA TGG-3⬘
R: 5⬘-AGG TGT GAT GCC AGA TCT TCT CCA TG-3⬘
F: 5⬘-TGT TCT GCT CAA CCT GAA CCG ACT-3⬘
R: 5⬘-TAG AAG AGC CCA CTG CAT GCC ATA-3⬘
F: 5⬘-TCC AAC CCT TGC TCG AAT GAT GCT-3⬘
R: 5⬘-TCG ATG TTG TCT TCG CAG TGC GTT-3⬘
F: 5⬘-ACT CCA CTC ATG GCC GTT AC-3⬘
R: 5⬘- TGA GCT GAG GCC TTC TCA AT-3⬘
F: 5⬘-ACG AGT GCT TGG GAA TGG CTG TTT-3⬘
R: 5⬘-AGT TGC GTT GCT TAA TGG TGC GGT-3⬘
F: 5⬘-GCT GGT GTG CAA CCA CTG AAG ATT-3⬘
R: 5⬘-AAG ACA CAG GGT GCT CCA TCT GAA-3⬘
F: 5⬘-AAA TCG AGA AGC TCG GCC TAC CAA-3⬘
R: 5⬘- TCC TCT GTC AAT CAG CTG AGC CTT-3⬘
F: 5⬘-TAA AGC AGG GAA GAC AAG AGC CGA-3⬘
R: 5⬘-TGG AGA AAC AGT GAG AGA GCT GGT-3⬘
F: 5⬘-CGG ATA ACG CTT TGA AGC TGC CTT-3⬘
R: 5⬘-TAC TAT GCG TTA CCA TGG CGC TCT-3⬘
F: 5⬘-AGT GAA AGC AGC AAA GAG GGA GGA-3⬘
R: 5⬘-TGA GCT GCT GCT TAG TGT ACG GTT-3⬘
F: 5⬘-ATT AAC CCT CAC TAA AGG GAC GCA AGT TCA
ACA TCC TTG GCA CT-3⬘
R: 5⬘-TAA TAC GAC TCA CTA TAG GGA GAT TTG
GCT CGG AGA GAG AAA GCA GT-3⬘
F: 5⬘-ATT AAC CCT CAC TAA AGG GAA AGA CTG
TGA ACG GAC ACA CGG AT-3⬘
R: 5⬘-TAA TAC GAC TCA CTA TAG GGA GAA GTG
TCT GGC ATG AGA AGG CTG AA-3⬘
MO1: CCCTGAGCTGCCGGGAAGCAGATCT
MO2: CGTGTAATATACAGAGTGTCGAGTC
MO1: GCCATGTTGACCCCTTAATGTGTCG
MO1: GCGCCATTGCTTTGCAAGAATTG
A list of primers for qRT-PCR and in situ hybridization probe synthesis are listed. The bold sequences are T3 关forward
(F)兴 and T7 关reverse (R)兴 promoters included in the primers for probe synthesis. Both morpholinos targeting socs3a
gave rise to similar phenotypes. Results in the article are from embryos injected with MO1. stat3 MO was synthesized
based on sequences from Yamashita et al. (2002), which was also used by Sepich et al. (2005) and Kassen et al.
(2009) for knocking down stat3 expression in zebrafish embryos. tp53 MO was synthesized based on sequences from
Kratz et al. (2006).
cell death, 5-dpf-old Tg( pou4f3:GFP) larvae (Xiao et al., 2005) were then
raised at 28.5°C in the Holtfreter’s buffer containing S3I-201 (400 ␮M,
EMD Biosciences) or DMSO (40 ␮l/10 ml buffer, Sigma). Lateral line
hair cells (GFP-positive cells) in living larvae were quantified at 24, 48,
and 72 h post-treatment (hpt). The mitotic events during lateral line hair
cell regeneration were quantified by a bromodeoxyuridine (BrdU) incorporation assay (Ma et al., 2008).
Immunohistochemistry. The primary and secondary antibodies used
include the rabbit myosin VI and myosin VIIa antibodies (1:200 dilution,
Proteus Biosciences), rabbit anti-stat3 pS727 (1:50 dilution, Abcam),
mouse anti-BrdU with Alexa Fluor 546 conjugate (1:200 dilution, Invitrogen), goat GFP antibody (FITC conjugated, 1:200 dilution, Abcam),
and Alexa Fluor 568 (or 488) goat anti-rabbit IgG (1:1000 dilution, Invitrogen). The inner ear sensory epithelia were dissected as previously
described (Liang and Burgess, 2009).
Microscopy and image analysis. To capture images of the entire saccular
epithelia, several overlapping pictures were taken for each epithelium
with Zeiss Vision software and tiled with Photoshop 7.0 software
(Adobe). The imaging in the living larvae was done using an
Axiovert200M and an Apotome Grid Confocal (Zeiss). The antibody
staining and fluorescent in situ hybridization results of embryos/larvae
were visualized under AxiovertNLO confocal microscope (Zeiss) with
Zeiss AIM software. The regular in situ hybridization results were captured using a Leica MZ16F microscope with Leica FireCam software.
Statistical analysis. ␹ 2 tests (genes with tag count ⬎5) and Fisher’s
exact tests (genes with tag count ⱕ5) were used to compare the expres-
10664 • J. Neurosci., August 1, 2012 • 32(31):10662–10673
Liang et al. • The stat3/socs3a Pathway and Hair Cell Regeneration
sion levels of the genes quantified by tag profiling. The calculation was
done using R software. Expression data from inner ear samples collected
at different time points during regeneration were compared with those
from the control sample. One-way ANOVA, post hoc test, and Student’s
t test were used to compare hair cell numbers. The calculations were done
using Excel software (Microsoft).
Results
Inner ear hair cell regeneration in adult zebrafish
We induced inner ear hair cell loss in adult zebrafish by modifying a previously published noise exposure protocol (Smith et al.,
2006) (Fig. 1A). Using this setup, we could consistently induce
hair cell loss in the anterior-medial region of the saccular macula
(Fig. 1 B), but not in the utricular or lagenar macula (data not
shown), which is consistent with the proposed function of saccule as the major auditory end organ in otophysians (Fay, 1978).
We confirmed complete elimination of the hair cells (as opposed
to hair cell bundle damage) with phalloidin (staining hair cell
bundles) and myosin VI/VIIa antibodies (staining hair cell bodies) (Fig. 1C). When we quantified the hair cells in a 20 ⫻ 20 ␮m
area at 40% of the total length of the anterior–posterior axis of the
epithelium at 24 h intervals from 0 to 120 h postexposure (hpe),
we found that the hair cells regrew rapidly and returned to control levels in 96 h (Fig. 1C,D), consistent with a previous publication (Schuck and Smith, 2009).
Candidate gene/pathway identification by DGE
Based on the time line of hair cell regeneration in adult fish (Fig.
1C,D), we collected inner ear tissue samples at 0, 24, 48, and 96
hpe and generated the expression profiles from the samples using the DGE tag-profiling technique (Morrissy et al., 2009). The
raw data from profiling included sequences of 944,347 unique tag
sequences (20 nt) and a “count” associated with each tag sequence (Table 2). The count is a direct quantification of the copy
number of the transcript that the tag represents. The total count
number of all the tag sequences was 15,744,948. After filtering the
raw data (see Materials and Methods), we mapped 303,342
unique tags from a total of 15,103,943 sequences to transcriptome and genome databases (Table 2). Approximately 60% of the
tags were mapped to at least one known/predicted transcript or at
least one location on the genome (Fig. 2A). Although ⬃40% of
the unique tag sequences failed to be mapped, the total proportion of unmapped tags only accounted for ⬃7.2% of the total tag
counts. When one mismatch was allowed during the mapping,
only ⬃7% of the tag sequences failed to be mapped, suggesting
that the failure in mapping most likely resulted from sequencing
errors and/or single-nucleotide polymorphisms. In this study, we
adopted conservative criteria, only analyzing tags with no mismatch in mapping and matching to a single UniGene entry.
A total of 80,604 unique tags were unambiguously mapped to
a known/predicted transcript (Fig. 2 A) (i.e., the tag could be
assigned to one and only one of the known/predicted transcripts). Those 80,640 tags were used for gene identification and
expression level calculations. Clustering analysis of the five expression profiles with Genesifter (Geospiza) software based on
the calculation of the overall differences between profiles showed
that the 96 hpe profile shared the highest similarity with the control profile, followed by the 24 hpe and the 48 hpe profiles, which
were highly similar to each other, and then by a 0 hpe profile that
differed the most from the control profile (Fig. 2C, top). Essentially the transcriptional profiles were most different immediately
after noise exposure and slowly returned to normal over the
course of 4 d.
Figure 1. Saccular hair cells were eliminated by noise exposure and subsequently regenerated. A, Hair cell loss in the saccule was consistently induced by the noise exposure apparatus. B,
Phalloidin staining of the saccular hair cells; hair cell loss occurred in the anterior-medial area of
the saccular sensory epithelium (red boxes; scale bar, 100 ␮m). C, Closer examination of the
damaged area with phalloidin (green channel) and anti-myosin VI/VIIa (red channel) staining
confirmed the complete elimination of hair cell bodies (middle; scale bar, 20 ␮m) as well as the
repopulation of hair cells to control level by 96 hpe in the damaged area (bottom). D, Quantification of hair cell number after sound exposure (one-way ANOVA and post hoc test, n ⫽ 3, *p ⬍
0.05; all error bars in this publication demonstrate SD). D, Dorsal; A, anterior.
Liang et al. • The stat3/socs3a Pathway and Hair Cell Regeneration
Table 2. Summary of tag profiling results
Total
Control
0 hpe
24 hpe
48 hpe
96 hpe
Total
J. Neurosci., August 1, 2012 • 32(31):10662–10673 • 10665
After filtration
Count
Unique tag
Count
Unique tag
3,339,753
2,758,836
3,615,956
3,476,027
2,554,376
15,744,948
327,240
279,532
317,505
331,687
289,177
944,347
3,199,598
2,646,064
3,486,384
3,337,409
2,434,488
15,103,943
187,085
166,760
187,933
193,069
169,289
303,342
The numbers of tag counts and unique tag sequences from each of the five expression profiles in raw data (under the
“Total” column) and after the removal of the tag sequences that were detected only once in five profiles (under the
“After filtration” column).
We used ␹ 2 tests and Fisher’s exact tests to compare the expression level of each gene during regeneration to the control
level. A total of 2269 genes with significant changes in their expression levels at one or more time points during regeneration
were identified as candidate genes (data available upon request).
Measureable changes in expression levels detected by DGE were
confirmed in several candidate genes (selected because of already
known functions in hair cell development or because of direct
interest in the genes) with quantitative RT-PCR (qRT-PCR) (Fig.
2 B). We performed a pathway analysis for the 2269 candidate
genes using the Metacore (GeneGo) software package. The functions of the most enriched interaction network calculated from
the candidate genes in each experimental time point are listed in
Figure 2C (bottom). While the enriched pathways identified by
Metacore were generally broad, the fact that the different collected time points had very different enrichment profiles, indicated distinct phases in the regeneration process. The results of
profile distance calculation and enrichment analysis corresponded nicely with the distinct morphological changes in the
saccular epithelium during regeneration, as well as with the
known cellular mechanisms during hair regeneration in other
nonmammalian vertebrates (Stone and Cotanche, 2007).
Because we were interested in identifying early signaling
events that trigger regeneration, we prioritized our candidates for
functional analysis from the highly enriched networks that were
apparent at the earliest measured time point (0 hpe, Fig. 2 D).
Metacore and Pathway Studio both identified a large interconnected pathway with the hub of that pathway centering on stat3
(Fig. 2 D). Confirming the potential importance, the gene socs3a
(a zebrafish homolog of human SOCS3), a downstream target of
stat3 (and a negative-feedback inhibitor for stat3 activity) was
one of the largest transcriptional changes at 0 hpe (⬇10-fold
increase). By 24 hpe, stat3 and socs3a signaling return to normal
levels, suggesting that this response is an important early regenerative response but is not necessary in later stages of regeneration. With the help of the analysis, we identified the stat3/socs3
pathway as the dominant signaling pathway to become activated
at the earliest time point of recovery with ⬎50 relevant genes in
the pathway responding to hair cell damage (Fig. 2 D). No other
known signaling pathway had as many connected nodes as the
stat3/socs3a node in the 0 hpe responses. Related genes in the
stat3/socs3 pathway, such as socs3b (a paralog of socs3a in zebrafish), Janus kinase 1 ( jak1), and matrix metalloproteinase 9
(mmp9), also showed significant changes in their expression levels (Fig. 2 B; data available on request).
Self-restrictive feedback between stat3 and socs3a in zebrafish
In mammals, there is a self-restrictive feedback mechanism between stat3 and socs3: stat3 activates the transcription of socs3,
which in turn, antagonizes stat3 activation (Leonard and O’Shea,
1998). To test whether there is a similar feedback mechanism
between stat3 and socs3a in zebrafish, we temporarily knocked
down stat3 or socs3a in zebrafish embryos using MO injection.
We detected a decrease in the mRNA levels of both stat3 and
socs3a in stat3 morphants but an increase in the mRNA levels of
both genes in socs3a morphants (Table 3). This is the expected
result for a negative-feedback loop. To further confirm the
knock-down studies, we injected mature mRNA of socs3a to zebrafish embryos and found a reduction in stat3 expression level,
mimicking the effects of stat3-MO injection (Table 3). These data
demonstrate that the self-restrictive feedback relation between
stat3 and socs3a in mammals is maintained in zebrafish.
The stat3/socs3a pathway is involved in hair cell production
in zebrafish development
In addition to the hair cells in their inner ears, zebrafish, like other
fishes and amphibians, also possess the mechanosensory lateral
line organ for detecting water movement over the body (Montgomery et al., 2000; McHenry et al., 2009). The neuromasts in the
lateral line are composed of hair cells and supporting cells that are
highly similar to those in the inner ear sensory epithelium (Nicolson, 2005). In addition, the hair cell regeneration in the lateral
line neuromasts shares a similar molecular mechanism to that in
the inner ear (Harris et al., 2003; Ma et al., 2008; Behra et al.,
2009).
Both stat3 (Oates et al., 1999; Thisse and Thisse, 2004) and
socs3a (Fig. 3A) are expressed in the neuromasts at 5 dpf, implying a normal function in those tissues for either development or
homeostasis. In addition, stat3 is known to be expressed in the
anterior region of the otic vesicle at earlier developmental stages
(Oates et al., 1999; Thisse and Thisse, 2004). As an initial test of
the roles for stat3 and socs3 in hair cell regeneration, we tested the
effects of morpholino inhibition of each gene on normal inner ear
development. Testing two different morpholinos for socs3a and a
previously published and verified one for stat3 (Yamashita et al.,
2002), knocking down stat3 or socs3a had a clear inhibitory effect
on hair cell production (Fig. 3B–E). In stat3 morphants, the
anterior otolith in the otic vesicles was often missing while the
posterior otolith appeared approximately normal (Fig. 3B). Correspondingly, a closer examination of the maculae in the otic
vesicle revealed a significantly decreased number of hair cells in
the anterior macula in those morphants while the hair cell number in the posterior macula remained normal (Fig. 3C,D). Coinjection with tp53 MO resulted in an identical phenotype (data not
shown), suggesting that the hair cell-related phenotypes are gene
specific. The phenotypes of the morphants corresponded nicely
with the expression pattern of both genes detected by in situ
hybridization (Oates et al., 1999; Thisse and Thisse, 2004) (Fig.
3A). The phenotypes also serve as an indirect confirmation of the
involvement stat3/socs3 pathway in hair cell regeneration, as hair
cell production during development and regeneration will, to
some extent, share similar genetic programs (Stone and Rubel,
1999; Cafaro et al., 2007; Ma et al., 2008; Daudet et al., 2009).
To further understand the function of the stat3/socs3 pathway
in hair cell production, we measured the mRNA level of atonal
homolog 1a (atoh1a) in stat3 and socs3a morphants. atoh1a is one
of the zebrafish homologs of atoh1, an essential gene required for
hair cell fate commitment (Bermingham et al., 1999; Woods et
al., 2004; Millimaki et al., 2007). Both the knocking down of stat3
and the overexpression of socs3a resulted in a reduction in atoh1a
mRNA level (Table 3) but did not change the overall distribution
or timing of expression based on in situ hybridization (data not
shown). In contrast, a strong increase in atoh1a mRNA level was
10666 • J. Neurosci., August 1, 2012 • 32(31):10662–10673
Liang et al. • The stat3/socs3a Pathway and Hair Cell Regeneration
Figure 2. Analyses and confirmation of tag-profiling results from inner ear tissues collected during hair cell regeneration. A, A total number of 303,342 unique-sequence tag sequences from inner
ear tissues collected at five time points were mapped against transcriptome and genome databases. Approximately 34% of the tag sequences were mapped to one or more known/predicted
transcripts and ⬃17% to unique loci in genome (without a known transcript), leaving ⬃49% of the sequences without transcriptome or genome mapping. Among those tags mapped to
known/predicted transcripts, ⬃78% were unambiguously mapped. B, Some of the candidate genes (0 hpe) identified by tag profiling were confirmed by qRT-PCR using GAPDH (Figure legend continues.)
Liang et al. • The stat3/socs3a Pathway and Hair Cell Regeneration
J. Neurosci., August 1, 2012 • 32(31):10662–10673 • 10667
Table 3. Summary of qRT-PCR results in morpholino- and mRNA-injected embryos
Target gene
socs3a MO (36 hpf)
socs3a mRNA (12 hpf)
stat3 MO (32 hpf)
Atoh1a
Stat3
1.35 (9.91e-3)
0.615 (2.70e-3)
0.547 (0.0105)
1.76 (0.0284)
0.720 (0.0235)a
0.294 (1.77e-4)
Socs3a
8.37 (0.0324)
0.600 (0.041)
In developing embryos, stat3 and socs3a were knocked down respectively with MO injection, and socs3a was also
temporarily overexpressed with mRNA injection. Changes in mRNA levels of atoh1a, stat3, and socs3a in MO/mRNAinjected embryos compared to control embryos were determined with qRT-PCR. The numbers in each cell stand for
fold change and p value (in braces).
a
Data collected from a 6 hpf embryo.
observed in socs3a morphants where stat3 was hyperactivated
(Table 3), demonstrating that stat3/socs3a are positive/negative
regulators of atoh1a expression. In addition, the cross talk between stat3/socs3 and atoh1 was further confirmed by in situ hybridization of the socs3a morphants (Fig. 3E). At 24 and 36 hpf,
there is little detectable difference in atoh1a expression between
socs3a morphants and wild-type fish by in situ hybridization (data
not shown). But at 48 and 72 hpf, there is a clear expansion of
atoh1a expression in the otic vesicle (Fig. 3E, arrowhead), the
hindbrain, and the spinal chord (Fig. 3E, bracket), suggesting the
stat3–atoh1a regulatory relationship is not unique to the sensory
epithelia of the inner ear and lateral line, but is a more general
pathway for regulation. These results suggest that the stat3/socs3
pathway is involved in the hair cell differentiation process possibly by directly or indirectly expanding atoh1a expression.
Stat3 activation during hair cell regeneration and
development in lateral line neuromasts
Because the lateral line neuromasts are located on the surface of
the body, it makes the lateral line a convenient model for testing
hair cell regeneration. Expression of both stat3 (Thisse and
Thisse, 2004) and socs3a (Fig. 3A) was detected in the neuromasts
at 5 dpf, so we continued with additional functional studies of the
stat3/socs3a pathway during regeneration in larval neuromasts.
At 5 dpf, the number of hair cells in the lateral line neuromasts
reaches a relatively stable level (Ma et al., 2008; Behra et al., 2009),
which enables us to differentiate regeneration of hair cells from
normal growth and development.
We induced hair cell death in the lateral line neuromasts with
CuSO4, a protocol ensuring complete lateral line hair cell elimination within 2 h in 5 dpf larvae (Hernández et al., 2007), which
is followed subsequently by regeneration of hair cells to control
levels within 72 h (Behra et al., 2009). We performed in situ
hybridization in larval fish after 2 h of CuSO4 treatment and
found an increase in the level of stat3 expression in the lateral line
neuromasts when hair cell death was induced (Fig. 4 A). In addi4
(Figure legend continued.) as a reference gene (n ⫽ 3, one-tailed t test, *p ⫽ 1.81e-4,
3.78e-4, 9.41e-3, 8.76e-3, 0.0272, 1.578e-4). C, Clustering analysis of the five expression profiles with Genesifter showed the relationship between different profiles (top diagram). The
clustering results had the predicted relationship where the 0 hpe expression was the most
different from control and then the samples progressively returned to “normal” over time.
Pathway analysis showed cell signaling pathways represented by the candidate genes that are
critical for specific phases of regeneration [e.g., cell proliferation-related at 0 hpe and cell
differentiation-related at later time points (bottom boxes)]. D, Pathway analysis of the candidate genes (identified at 0 hpe) involved in inner ear hair cell regeneration highlighted the
interactions between stat3 and socs3 (dashed circles) with other identified candidate genes.
The known interactions (red: positive; green: negative; gray: unspecified) between the human
orthologs of the candidate genes were extracted in batches to predict the candidate pathways
involved in the hair cell regeneration. Different colors of the circles indicate those genes being
upregulated (red) or downregulated (blue) during hair cell regeneration.
tion, we also found changes in the location of stat3 expression
induced by CuSO4-triggered hair cell death (Fig. 4 A), which was
further confirmed by fluorescent whole-mount in situ hybridization in ET20 larvae that marks the mantle cells of the neuromasts
with GFP expression the outermost layer of nonsensory cells in
the neuromast (Parinov et al., 2004) (Fig. 4 B). RNA probes
against stat3 were mostly detected in the GFP-positive cells of the
neuromasts in untreated ET20 larvae (Fig. 4 B, top). When hair
cell death was induced, stat3 expression was no longer limited to
the mantle cells, but was expressed strongly throughout the supporting cells of the neuromasts. The in situ hybridization data
confirmed the activation of stat3 induced by hair cell death in the
lateral line neuromasts was in the supporting cell population,
matching expression increases observed by DGE during inner ear
hair cell regeneration.
The activation of mammalian stat3 protein is mostly characterized by the phosphorylation of either Y705 (Yoshimura, 2009;
Yu et al., 2009) or S727, which functions concurrently with Y705
(Wen et al., 1995) or independently (Liu et al., 2003; Qin et al.,
2008). The corresponding amino acid (S751) and the flanking
amino acid sequences are highly conserved in zebrafish stat3
when compared with the human protein, so we first tracked the
activation of stat3 in the neuromasts after CuSO4 treatment with
an antibody that recognizes STAT3 S727 phosphorylation
(STAT3 pS727). We found a significant increase in STAT3 pS727positive nuclei in the neuromasts at 12 hpt with CuSO4 in the
CuSO4-treated larvae relative to control (Fig. 4 A, B). Double labeling with GFP in Tg(scm1:GFP) (Behra et al., 2009) demonstrates that the cells with nuclear staining of STAT3 pS727 are the
supporting cells (Fig. 4 A). The activation and the nuclear import
of stat3 protein in the supporting cells subsequent to hair cell
death indicate the activation of stat3 signaling during hair cell
regeneration.
Hair cell production during development and regeneration
will, to some extent, share similar genetic programs (Stone and
Rubel, 1999; Cafaro et al., 2007; Ma et al., 2008; Daudet et al.,
2009), so we checked whether stat3 activation in the lateral line
neuromasts is similar during development and regeneration. In 3
dpf larvae, most cells in the neuromasts showed homogeneous
STAT3 pS727 labeling only in their nuclei (Fig. 5A⬘, top). Doublelabeling with scm1:GFP demonstrates that those cells are supporting cells (Fig. 5A⬘, top). In addition, in differentiating hair
cells, the nuclear labeling of STAT3 pS727 antibody decreased and
became spotty, with cytoplasmic labeling becoming predominant, suggesting that the stat3 was becoming inactive in these
cells (Fig. 5A⬘, top, close-ups). The nuclear import of stat3 in
supporting cells during hair cell regeneration in 5 dpf and
older larvae seems to be recapitulating the stat3 activation
during immature neuromast development in younger larvae.
It is noteworthy that in older larvae, a significant level of labeling was still detectable in a subgroup of mantle cells that are
marked by GFP in the ET20 transgenic line (Fig. 5A⬘, bottom).
The significance of this cell population having activated stat3 is
not yet clear, but it seems to represent a distinct cellular compartment in the lateral line neuromasts.
Inhibition of stat3-promoted hair cell regeneration
To further clarify the function of stat3, we compared the hair cell
regeneration processes with and without the presence of a stat3
inhibitor. The majority of the chemical inhibitors were ototoxic
and could not be used for regeneration studies (data not shown).
One published inhibitor, S3I-201, was not toxic on its own and
was used to test the role of stat3 in hair cell regeneration. S3I-201
Liang et al. • The stat3/socs3a Pathway and Hair Cell Regeneration
10668 • J. Neurosci., August 1, 2012 • 32(31):10662–10673
is a cell-permeable chemical that binds to
the SH2 domain of mammalian stat3
protein and reportedly blocks the
dimerization of phosphorylated (activated) stat3 molecules (Siddiquee et al.,
2007). After exposing Tg( pou4f3:GFP)
larvae (in which the hair cells are labeled
with GFP) (Xiao et al., 2005) to CuSO4, we
quantified the regenerating hair cells and
performed a BrdU incorporation assay
(Ma et al., 2008). The S3I-201-treated larvae showed a significant increase in BrdU
incorporation in the neuromasts compared with DMSO-treated larvae (control) at 24 hpt, but not at 48 or 72 hpt (Fig.
6 A). Accordingly, the S3I-201-treated larvae had more hair cells per neuromast at
48 hpt, but not at 24 or 72 hpt (Fig. 6 A),
which is consistent with an expected lag
between supporting cell division and
subsequent hair cell differentiation. In
essence, the hair cells regenerated faster
in the S3I-201-treated embryos than in
controls. Similar results were observed
when hair cell quantification was done by
myosin VI antibody staining (data not
shown). S3I-201 did not have a significant
impact on hair cell numbers in larvae that
had not been treated with CuSO4 (data not
shown).
To confirm the inhibitory function of
S3I-201 in hair cell regeneration triggered
by CuSO4 ototoxicity, we performed ISH
to examine the mRNA levels of stat3 and
socs3a in the lateral line neuromasts after
1 h of CuSO4 treatment with or without
the presence of S3I-201. The ISH data
demonstrated a reduction in both stat3
(Fig. 6 B) and socs3a (Fig. 6 B⬘) expression
in the neuromasts cotreated with both
CuSO4 and S3I-201 compared with those
treated only with CuSO4. Our qRT-PCR
results were in accordance with the ISH
results in that stat3 expression in larvae
treated with both CuSO4 and S3I-201 was
only 81% of the level in larvae treated only
with CuSO4 ( p ⫽ 0.0014, n ⫽ 3 for both
groups). Since stat3 activates its own expression, the data suggest that S3I-201
stimulated hair cell regeneration by moderately inhibiting stat3 activity.
Discussion
Figure 3. stat3 and socs3a are involved in hair cell production during zebrafish larval development. A, socs3a expression was
detected in anterior and posterior lateral line neuromasts in 5 dpf larvae by in situ hybridization; there is a close-up of one
neuromast in the top right corner (scale bars: top, 10 ␮m; bottom, 1 mm). Expression of socs3a is similar to stat3 expression (Oates
et al., 1999; Thisse and Thisse, 2004). B, The anterior otolith (arrows labeled with “A”) in stat3 morphants was typically missing,
while the posterior otolith (arrowheads labeled with “P”) appeared approximately normal (scale bars: left, 500 ␮m; right, 100
␮m). C, MyosinVI antibody staining (red channel) of the hair cells in the anterior sensory macula (arrows labeled with A) and
posterior macula (arrowheads labeled with P) in control larvae and stat3 morphants (scale bar, 20 ␮m) at 32 hpf. cldnb:GFP (green
channel) was used to outline the otic vesicle. D, The stat3 morphants showed a significant reduction in the number of hair cells in
the anterior macula, but not in the posterior macula at 32 hpf (n ⫽ 4 (control)/6 (MOs), one-tailed t test, *p ⫽ 2.79e-4). E, Both
stat3 and socs3a morphants possessed fewer posterior lateral line neuromasts (n ⫽ 10 in all groups, one-tailed t test, *p ⫽
2.52e-08, 2.41e-04) with a smaller number of hair cells per neuromast (n ⫽ 10 in all groups, one-tailed t test, *p ⫽ 1.10e-06,
1.56e-10) compared with control larvae at 2.5 dpf. In socs3a morphants (bottom), an expansion of atoh1a expression was detected
by in situ hybridization in the brain area (bracket) as well as the otic vesicle (arrow) compared with control (top) (scale bars: left, 1
mm; right, 500 ␮m). D, Dorsal; A, anterior; MO, morpholino.
Recent studies have demonstrated the
power of using the DGE platform for
measuring transcriptional changes (‘t Hoen et al., 2008; Morrissy et al., 2009). Using DGE, we generated a comprehensive list
of candidate genes involved in the inner ear hair cell regeneration
in adult zebrafish (data available upon request). One major pathway that is initiated in the earliest responses centers on stat3 and
socs3a. This pathway is broadly implicated in the initial signaling
responses of hair cell regeneration in the zebrafish inner ear. We
went on to show that stat3/socs3 signaling played an important
role in cell division and hair cell differentiation during both normal development and tissue regeneration.
Stat3 signaling: activated during development and
regeneration
To some extent, hair cell production during both development
and regeneration share similar genetic programs (Stone and
Rubel, 1999; Cafaro et al., 2007; Ma et al., 2008; Daudet et al.,
Liang et al. • The stat3/socs3a Pathway and Hair Cell Regeneration
J. Neurosci., August 1, 2012 • 32(31):10662–10673 • 10669
gest two types of stem cell-like cells in the
neuromasts, one type involved in longterm cell replacement (i.e., the true stem
cells), and the other in an amplification/
differentiation role (Williams and Holder,
2000; Ma et al., 2008). The role of the
ET20:GFP-labeled (and stat3-activated)
mantle cells may regulate the cell division
of adjacent stem cells through a nonautonomous mechanism similar to the role of
stat92E in escort cells for regulating the
stem cell division in the Drosophila ovary
(Decotto and Spradling, 2005). These
ET20:GFP and STAT3 pS721-positive cells
would represent part of the niche environment necessary to promote normal
cell turnover as well as tissue regeneration. Alternatively, the mantle cells
might directly divide asymmetrically to
repopulate the supporting cells of the
neuromasts after damage or cell turnover. The triggering of cell differentiation seemed to be achieved, at least in part,
through activation of atoh1 (Fig. 3E), a
key regulator of hair cell differentiation
(Fig. 7). This pathway seems to be used
in more than one tissue type as socs3a
inhibition results in an expansion of
atoh1a expression in both the otic vesicle and in the brain. It is noteworthy
that while atoh1a expression is expanded in the otic vesicle with a hyperactive stat3, the number of hair cells was
not (data not shown), suggesting that
Figure 4. Hair cell death in the lateral line system resulted in an increase in stat3 expression level in the nonsensory cells in the more factors are necessary for hair cell
neuromasts. A, The results of regular whole-mount in situ hybridization targeting stat3 mRNA in control (top) CuSO4-treated differentiation.
(bottom) larvae showed an increase in stat3 expression when hair cell death took place. Scale bar, 1 mm. B, Costaining of
A previous microarray study did show
neuromasts with fluorescent detection of probes targeting stat3 mRNA (red channel) and FITC-conjugated anti-GFP antibody basal-level expression of stat3 in newborn
(green channel) in ET20 transgenic larvae showed an increase in nonsensory cells in the neuromasts after hair cell death. Scale bar, rat cochlea that could be elevated by stress
20 ␮m.
in explant cultures (Gross et al., 2008). It
was also reported that stat3 showed a tem2009). In this study, we identified stat3 and socs3a as important
poral expression pattern similar to gata2 and C/EBP during the in
regulators in zebrafish hair cell regeneration in the inner ear (data
vitro differentiation of conditional cell lines derived from mouse
available upon request) and lateral line system (Fig. 5A). Correotocyst (Holley et al., 2007). Little is known about the functions
spondingly, we also found them required for normal hair cell
of stat3 and socs3 in the inner ear in mammals other than that
production during the larval development (Fig. 3B–E). The exactivated stat3 protein is detected in the outer hair cells in mouse
amination of stat3 activity in lateral line neuromasts during decochlea late in embryonic development (Hertzano et al., 2004).
velopment and regeneration further confirms the similarity
The persistence of stat3 expression in a subset of supporting cells
shared between the two processes. Activated, nuclear-localized
in zebrafish that is not detected in the mammalian cochlea might
stat3 protein was detected in a large number of supporting cells
represent a key difference that enables nonmammalian verteand differentiating hair cells in 3 dpf larvae (Fig. 5A⬘) and was
brates to regenerate hair cells. A more detailed comparison study
downregulated in those same cells in the neuromasts of more
focusing on the stat3/socs3 signaling pathway in the inner ears in
mature 5 dpf larvae (Fig. 5A). However, when hair cell death was
mice and zebrafish would help us further understand key regulatriggered in 5 dpf larvae, the stat3 protein was again activated and
tors of hair cell regeneration. In addition, it is also intriguing to
imported into the nuclei of the supporting cells (Fig. 5A), recaexplore whether cell cycle progression can be triggered in suppitulating the active stat3 observed during neuromast developporting cells by genetic and/or pharmacological enhancement of
ment (Fig. 5A⬘).
stat3 activity in damaged mammalian sensory epithelia.
Another interesting observation is the specific overlap of
STAT3 pS727-positive cells and the GFP-positive mantle cells of
The stat3/socs3 pathway may serve as a common initiator in a
ET20 larvae (Fig. 5A⬘), which is further supported by the enrichvariety of regenerative processes
ment of stat3 mRNA in those GFP-positive cells (Fig. 4 A). This
The stat3/socs3 pathway is best known as the mediator of a wide
suggests that the mantle cells have a specific function in the neuvariety of biological processes, including cell proliferation, cell
romast that requires activated stat3. Previous publications sugmigration, immune response, and cell survival (Yoshimura,
10670 • J. Neurosci., August 1, 2012 • 32(31):10662–10673
Liang et al. • The stat3/socs3a Pathway and Hair Cell Regeneration
Figure 5. Phosphorylation and nuclear import of stat3 proteins were detected in the regenerating and developing neuromasts. A, Costaining of anti-STAT3 pS727 with DAPI in Tg(scm1:GFP) larvae
confirmed anti-STAT3 pS727 labeling mainly in the nuclei of supporting cells (GFP positive) at 12 hpt with copper compared with untreated controls. Scale bar, 20 ␮m. Aⴕ, In 3 dpf larvae, the majority
of the supporting cell nuclei (GFP-positive cells) were labeled with STAT3 pS727 antibody (top). Differentiating hair cells showed decreased STAT3 pS727 nuclear staining, but an increase of STAT3 pS727
labeling in the cytoplasm (top, close-ups; scale bar: close-ups, 5 ␮m). Nuclear anti-STAT3 pS727 labeling decreased dramatically in more mature neuromasts in 5 dpf larvae (bottom), except for a small
group of cells labeled with GFP (arrowheads) in ET20 transgenic larvae (scale bars, 20 ␮m). B, Quantification of activated phospho-STAT3. The increase in nuclear localized phospho-stat3 was
statistically significant (n ⫽ 10/9, one-tailed t test, p ⫽ 9.83e-4). S727 in human STAT3 corresponds to S751 in zebrafish STAT3 by sequence alignment.
2009; Yu et al., 2009). Studies in mouse skin (Sano et al., 1999;
Zhu et al., 2008) and liver (Dierssen et al., 2008; Riehle et al.,
2008) further confirm the importance of the stat3/socs3 pathway
for proper wound healing. For example, in microarray datasets
from other zebrafish regeneration experiments, a strong induction of socs3 expression was consistently observed during the regeneration of fins (Schebesta et al., 2006) and retinas (Qin et al.,
2009). stat3 expression was also found to be upregulated in dividing cells during zebrafish retinal photoreceptor regeneration
(Kassen et al., 2009). The early activation of stat3 in the supporting cells subsequent to hair cell death is consistent with these
previous studies and suggests that this is a common pathway for
healing. stat–jak signaling has been found to play a critical role in
the development and regeneration of the epithelial cells in the
Drosophila midgut by initiating cell division and inducing differentiation (Jiang et al., 2009), a dual process that is highly similar
to what we demonstrated during regeneration of the inner ear
sensory epithelia. In zebrafish inner ear and lateral line regeneration, the activation of stat3 signaling in supporting cells precedes
the cell division, suggesting that the gene is playing a role in cell
cycle progression of those cells. A recent study supports this idea
as it reported leukemia inhibitory factor promoted cell division in
a cochlea-derived cell line, HEI-OC1, through the stat3/jak2 signaling pathway (Chen et al., 2010). This suggests that stat signal-
Liang et al. • The stat3/socs3a Pathway and Hair Cell Regeneration
J. Neurosci., August 1, 2012 • 32(31):10662–10673 • 10671
Figure 7. The working model of the stat3/socs3 pathway and the interaction of stat3/socs3
with atoh1 during hair cell regeneration in zebrafish. stat3 positively regulates the function of
atoh1, a key player in promoting hair cell fate commitment, in a direct or indirect manner. In
addition, the balancing of the stat3/socs3 pathway is crucial to hair cell differentiation: either
hyperactivation or hypoactivation of stat3 inhibits hair cell differentiation. The self-restrictive
loop helps to balance the expression of stat3 spatially and temporally to ensure the appropriate
replenishment of the lost hair cells.
Figure 6. S3I-201 promoted lateral line hair cell regeneration by downregulating stat3/
socs3 signaling. A, Quantification of hair cells after lateral line hair cell loss induced by CuSO4
treatment; larvae incubated with S3I-201 had more hair cells [GFP-positive cells in Tg( pou4f3:
GFP)] per neuromast at 48 hpt with CuSO4 compared with the control larvae incubated with
DMSO (n ⫽ 12/9, one-tailed t test, *p ⫽ 5.34e-3), but not at 24 or 72 hpt (line graph). BrdU
incorporation assays showed a significantly higher number of BrdU-positive cells per neuromast
in larvae incubated with S3I-201 at 24 hpt (n ⫽ 16/10; one-tailed t test, *p ⫽ 9.24e-3), but not
at later time points (bar graph). B, Bⴕ, 5 dpf larvae fish were treated with CuSO4 with or without
the presence of S3I-201 for 1 h and examined with in situ hybridization. stat3 (B) and socs3a (Bⴕ)
expression levels were both reduced in larvae treated with both CuSO4 and S3I-201 (B and Bⴕ,
top) compared with those treated with only CuSO4 (B and Bⴕ, bottom). Scale bar, 1 mm. D,
Dorsal; A, anterior.
ing is a fundamental initiating mechanism of tissue regeneration
that operates through cell division and differentiation and has
been conserved for over the 300 million years of evolution from
invertebrates to vertebrates. Together, all these data strengthen
our hypothesis that stat3/socs3 is a central activating mechanism
of stem cell populations in most, if not all, forms of regeneration.
Although stat3 activation can be considered as a promoting
factor for a regenerative process, we showed that a mild inhibition of stat3 via a chemical antagonist (Fig. 6 B, B⬘) could accelerate hair cell regeneration by promoting supporting cell division
(Fig. 6 A). Because stat3 is also known to be required for the
maintenance of pluripotency of various types of stem cells (Raz et
al., 1999), and we did identify a small group of putative stem cells
in the neuromasts with persisting stat3 activity under quiescent/
undamaged conditions (Fig. 5A⬘), a possible explanation for the
observation that inhibiting stat3 modestly enhanced regeneration at early time points is that S3I-201 forced the premature
division and differentiation of these stem cells, resulting in an
increase in BrdU incorporation at 24 hpt and in hair cell number
at 48 hpt (Fig. 6 A). However, we do not believe such a mechanism contributed much, if any, to the difference between S3I201-treated larvae and control larvae during regeneration. First,
we observed an accelerated regeneration without overproduction
or underproduction of hair cells (Fig. 6 A), suggesting that we
were simply accelerating the normal process. Meanwhile, undamaged larvae raised with S3I-201 from 5 to 8 dpf did not show
any significant difference in the number of the lateral hair cells
compared with control, showing it was not the release of a cell
cycle block in the mantle (ET20-positive) cells that explains the
accelerated appearance of the hair cells. In addition, the damageinduced stat3 activation was observed in all of the supporting cells
(Fig. 4 B), the main source of new hair cells during regeneration
(Ma et al., 2008). While we cannot completely rule out the contribution of any other mechanism, the data here do support our
hypothesis that S3I-201 promoted the division of the supporting
cells through mild downregulation of the damage-induced stat3
activity in those cells. In essence, S3I-201 increased the rate of
stat3 inactivation that naturally occurs through socs3a activation,
allowing the cells to proceed to mitosis and cell differentiation
sooner.
We believe that our results emphasize the balance of stat3/
socs3 signaling as being crucial for a successful healing process.
Two examples in the literature demonstrated that excessive stat3
activity can block cell cycle progression and inhibit regeneration
similar to what we observed; prolonged overexpression of IL-6
and the resulting hyperactivation of stat3 inhibited regeneration
after hepatectomy in mice (Wüstefeld et al., 2000; Jin et al., 2006).
Moreover, excessive stat3 activity in fatty livers was associated
with the cell cycle arrest after hepatectomy (Torbenson et al.,
2002). Accordingly, keeping the cytokine signaling tempered by
the negative feedback of socs3 is known to be crucial for proper
regeneration (Taub, 2004). Tissue-specific knockout of socs3 in
mice led to an upregulation in stat3 activity but delayed skin
wound healing due to the increased neutrophil and macrophage
10672 • J. Neurosci., August 1, 2012 • 32(31):10662–10673
infiltration and elevated chemokine expression (Zhu et al., 2008).
In addition, we are not ruling out the possibility that stat3 may
play more than one role in more than one type of cell in tissue
regeneration. It is known that stat3 is activated in hepatocytes as
well as myeloid cells after hepatectomy (Wang et al., 2010). However, while knocking out stat3 in hepatocytes inhibits cell cycle
progression and regeneration, knocking out stat3 in myeloid cells
leads to the opposite results (Wang et al., 2010). Previous data
also suggest a complicated cross talk of stat3 signaling pathway in
different cell types during regeneration (Wang et al., 2010). Given
the known active involvement of myeloid cells in lateral line hair
cell death in zebrafish larvae (d’Alençon et al., 2010), it is very
likely that S3I-201 treatment disturbed the stat3 signaling in not
only supporting cells but also myeloid cells and even the cross talk
between these two types of cells. Our data together with data from
many others demonstrate crucial yet complicated roles of the
stat3/socs3 pathway during tissue regeneration. We have developed a model for stat3 that requires initial activation of stat3 with
a critical negative-feedback role for socs3a. Further studies are
necessary to work out the exact roles of each gene in this complex
and dynamic process. While stat3 activation could potentially be
therapeutic to injuries in a wide variety of tissues, caution needs
to be taken for such application, given the multifaceted functions
of stat3 in the injury and healing process.
References
Amsterdam A, Burgess S, Golling G, Chen W, Sun Z, Townsend K, Farrington
S, Haldi M, Hopkins N (1999) A large-scale insertional mutagenesis
screen in zebrafish. Gene Dev 13:2713–2724.
Baird RA, Steyger PS, Schuff NR (1996) Mitotic and nonmitotic hair cell
regeneration in the bullfrog vestibular otolith organs. Ann NY Acad Sci
781:59 –70.
Balak KJ, Corwin JT, Jones JE (1990) Regenerated hair cells can originate
from supporting cell progeny: evidence from phototoxicity and laser ablation experiments in the lateral line system. J Neurosci 10:2502–2512.
Bang PI, Sewell WF, Malicki JJ (2001) Morphology and cell type heterogeneities of the inner ear epithelia in adult and juvenile zebrafish (Danio
rerio). J Comp Neurol 438:173–190.
Behra M, Bradsher J, Sougrat R, Gallardo V, Allende ML, Burgess SM (2009)
Phoenix is required for mechanosensory hair cell regeneration in the
zebrafish lateral line. PLoS Genet 5:e1000455.
Bermingham NA, Hassan BA, Price SD, Vollrath MA, Ben-Arie N, Eatock RA,
Bellen HJ, Lysakowski A, Zoghbi HY (1999) Math1: an essential gene for
the generation of inner ear hair cells. Science 284:1837–1841.
Brignull HR, Raible DW, Stone JS (2009) Feathers and fins: nonmammalian models for hair cell regeneration. Brain Res 1277:12–23.
Cafaro J, Lee GS, Stone JS (2007) Atoh1 expression defines activated progenitors and differentiating hair cells during avian hair cell regeneration.
Dev Dyn 236:156 –170.
Chen HC, Ma HI, Sytwu HK, Wang HW, Chen CC, Liu SC, Chen CH, Chen
HK, Wang CH (2010) Neural stem cells secrete factors that promote
auditory cell proliferation via a leukemia inhibitory factor signaling pathway. J Neurosci Res 88:3308 –3318.
Corwin JT, Cotanche DA (1988) Regeneration of sensory hair cells after
acoustic trauma. Science 240:1772–1774.
Cruz RM, Lambert PR, Rubel EW (1987) Light microscopic evidence of hair
cell regeneration after gentamicin toxicity in chick cochlea. Arch Otolaryngol Head Neck Surg 113:1058 –1062.
d’Alençon CA, Pena OA, Wittmann C, Gallardo VE, Jones RA, Loosli F, Liebel
U, Grabher C, Allende ML (2010) A high-throughput chemically induced inflammation assay in zebrafish. BMC Biol 8:151.
Daudet N, Gibson R, Shang J, Bernard A, Lewis J, Stone J (2009) Notch
regulation of progenitor cell behavior in quiescent and regenerating auditory epithelium of mature birds. Dev Biol 326:86 –100.
Decotto E, Spradling AC (2005) The Drosophila ovarian and testis stem cell
niches: Similar somatic stem cells and signals. Dev Cell 9:501–510.
Dierssen U, Beraza N, Lutz HH, Liedtke C, Ernst M, Wasmuth HE, Trautwein
C (2008) Molecular dissection of gp130-dependent pathways in hepatocytes during liver regeneration. J Biol Chem 283:9886 –9895.
Liang et al. • The stat3/socs3a Pathway and Hair Cell Regeneration
Fay RR (1978) Phase-locking in goldfish saccular nerve fibres accounts for
frequency discrimination capacities. Nature 275:320 –322.
Fritzsch B, Pauley S, Beisel KW (2006) Cells, molecules and morphogenesis:
the making of the vertebrate ear. Brain Res 1091:151–171.
Fritzsch B, Beisel KW, Pauley S, Soukup G (2007) Molecular evolution of
the vertebrate mechanosensory cell and ear. Int J Dev Biol 51:663– 678.
Gross J, Machulik A, Moller R, Fuchs J, Amarjargal N, Ungethüm U, Kuban
RJ, Szczepek AJ, Haupt H, Mazurek B (2008) mRNA expression of
members of the IGF system in the organ of Corti, the modiolus and the
stria vascularis of newborn rats. Growth Factors 26:180 –191.
Haas P, Gilmour D (2006) Chemokine signaling mediates self-organizing
tissue migration in the zebrafish lateral line. Dev Cell 10:673– 680.
Harris JA, Cheng AG, Cunningham LL, MacDonald G, Raible DW, Rubel EW
(2003) Neomycin-Induced hair cell death and rapid regeneration in the
lateral line of zebrafish (Danio rerio). J Assoc Res Otolaryngol 4:219 –234.
Hernández PP, Olivari FA, Sarrazin AF, Sandoval PC, Allende ML (2007) Regeneration in zebrafish lateral line neuromasts: Expression of the neural progenitor cell marker sox2 and proliferation-dependent and-independent
mechanisms of hair cell renewal. Dev Neurobiol 67:637– 654.
Hertzano R, Montcouquiol M, Rashi-Elkeles S, Elkon R, Yücel R, Frankel WN,
Rechavi G, Möröy T, Friedman TB, Kelley MW, Avraham KB (2004) Transcription profiling of inner ears from Pou4f3ddl/ddl identifies Gfi1 as a target
of the Pou4f3 deafness gene. Hum Mol Genet 13:2143–2153.
Higgs DM, Souza MJ, Wilkins HR, Presson JC, Popper AN (2002) Age- and
size-related changes in the inner ear and hearing ability of the adult zebrafish (Danio rerio). J Assoc Res Otolaryngol 3:174 –184.
‘t Hoen PAC, Ariyurek Y, Thygesen HH, Vreugdenhil E, Vossen RHAM, de
Menezes RX, Boer JM, van Ommen GB, den Dunnen JT (2008) Deep
sequencing-based expression analysis shows major advances in robustness, resolution and inter-lab portability over five microarray platforms.
Nucleic Acids Res 36:e141.
Holley MC, Kneebone A, Milo M (2007) Information for gene networks in
inner ear development: a study centered on the transcription factor gata2.
Hear Res 227:32– 40.
Jiang H, Patel PH, Kohlmaier A, Grenley MO, McEwen DG, Edgar BA (2009)
Cytokine/Jak/Stat signaling mediates regeneration and homeostasis in the
Drosophila midgut. Cell 137:1343–1355.
Jin X, Zimmers TA, Perez EA, Pierce RH, Zhang Z, Koniaris LG (2006)
Paradoxical effects of short- and long-term interleukin-6 exposure on
liver injury and repair. Hepatology 43:474 – 484.
Jones JE, Corwin JT (1996) Regeneration of sensory cells after laser ablation
in the lateral line system: hair cell lineage and macrophage behavior revealed by time-lapse video microscopy. J Neurosci 16:649 – 662.
Kassen SC, Ramanan V, Montgomery JE, T Burket C, Liu CG, Vihtelic TS,
Hyde DR (2007) Time course analysis of gene expression during lightinduced photoreceptor cell death and regeneration in albino zebrafish.
Dev Neurobiol 67:1009 –1031.
Kassen SC, Thummel R, Campochiaro LA, Harding MJ, Bennett NA, Hyde
DR (2009) CNTF induces photoreceptor neuroprotection and Müller
glial cell proliferation through two different signaling pathways in the
adult zebrafish retina. Exp Eye Res 88:1051–1064.
Kratz E, Eimon PM, Mukhyala K, Stern H, Zha J, Strasser A, Hart R, Ashkenazi A (2006) Functional characterization of the Bcl-2 gene family in the
zebrafish. Cell Death Differ 13:1631–1640.
Leonard WJ, O’Shea JJ (1998) Jaks and STATs: biological implications.
Annu Rev Immunol 16:293–322.
Liang J, Burgess SM (2009) Gross and fine dissection of inner ear sensory
epithelia in adult zebrafish (Danio rerio). J Vis Exp 27:1211.
Lim DJ (1976) Ultrastructural cochlear changes following acoustic hyperstimulation and ototoxicity. Ann Otol Rhinol Laryngol 85:740 –751.
Liu H, Ma Y, Cole SM, Zander C, Chen KH, Karras J, Pope RM (2003)
Serine phosphorylation of STAT3 is essential for Mcl-1 expression and
macrophage survival. Blood 102:344 –352.
Lombarte A, Yan HY, Popper AN, Chang JS, Platt C (1993) Damage and
regeneration of hair cell ciliary bundles in a fish ear following treatment
with gentamicin. Hear Res 64:166 –174.
Ma EY, Rubel EW, Raible DW (2008) Notch signaling regulates the extent of
hair cell regeneration in the zebrafish lateral line. J Neurosci 28:2261–2273.
McGill TJ, Schuknecht HF (1976) Human cochlear changes in noise induced hearing loss. Laryngoscope 86:1293–1302.
McHenry MJ, Feitl KE, Strother JA, Van Trump WJ (2009) Larval zebrafish
rapidly sense the water flow of a predator’s strike. Biol Lett 5:477– 479.
Liang et al. • The stat3/socs3a Pathway and Hair Cell Regeneration
Millimaki BB, Sweet EM, Dhason MS, Riley BB (2007) Zebrafish atoh1
genes: classic proneural activity in the inner ear and regulation by Fgf and
Notch. Development 134:295–305.
Montgomery J, Carton G, Voigt R, Baker C, Diebel C (2000) Sensory processing of water currents by fishes. Philos Trans R Soc Lond B Biol Sci
355:1325–1327.
Morrissy AS, Morin RD, Delaney A, Zeng T, McDonald H, Jones S, Zhao Y,
Hirst M, Marra MA (2009) Next-generation tag sequencing for cancer
gene expression profiling. Genome Res 19:1825–1835.
Nicolson T (2005) The genetics of hearing and balance in zebrafish. Annu
Rev Genet 39:9 –22.
Oates AC, Wollberg P, Pratt SJ, Paw BH, Johnson SL, Ho RK, Postlethwait JH,
Zon LI, Wilks AF (1999) Zebrafish stat3 is expressed in restricted tissues
during embryogenesis and stat rescues cytokine signaling in a STAT1deficient human cell line. Dev Dyn 215:352–370.
Oxtoby E, Jowett T (1993) Cloning of the zebrafish krox-20 gene (krx-20)
and its expression during hindbrain development. Nucleic Acids Res
21:1087–1095.
Parinov S, Kondrichin I, Korzh V, Emelyanov A (2004) Tol2 transposonmediated enhancer trap to identify developmentally regulated zebrafish
genes in vivo. Dev Dyn 231:449 – 459.
Qin HR, Kim HJ, Kim JY, Hurt EM, Klarmann GJ, Kawasaki BT, Duhagon
Serrat MA, Farrar WL (2008) Activation of signal transducer and activator of transcription 3 through a phosphomimetic Serine 727 promotes
prostate tumorigenesis independent of Tyrosine 705 phosphorylation.
Cancer Res 68:7736 –7741.
Qin Z, Barthel LK, Raymond PA (2009) Genetic evidence for shared mechanisms of epimorphic regeneration in zebrafish. Proc Natl Acad Sci U S A
106:9310 –9315.
Raz R, Lee CK, Cannizzaro LA, d’Eustachio P, Levy DE (1999) Essential role
of STAT3 for embryonic stem cell pluripotency. Proc Natl Acad Sci U S A
96:2846 –2851.
Riehle KJ, Campbell JS, McMahan RS, Johnson MM, Beyer RP, Bammler TK,
Fausto N (2008) Regulation of liver regeneration and hepatocarcinogenesis by suppressor of cytokine signaling 3. J Exp Med 205:91–103.
Roberson DW, Rubel EW (1994) Cell division in the gerbil cochlea after
acoustic trauma. Am J Otol 15:28 –34.
Sano S, Itami S, Takeda K, Tarutani M, Yamaguchi Y, Miura H, Yoshikawa K,
Akira S, Takeda J (1999) Keratinocyte-specific ablation of Stat3 exhibits
impaired skin remodeling, but does not affect skin morphogenesis.
EMBO J 18:4657– 4668.
Schebesta M, Lien C, Engel FB, Keating MT (2006) Transcriptional profiling of caudal fin regeneration in zebrafish. ScientificWorldJournal 6
[Suppl 1]:38 –54.
Schuck JB, Smith ME (2009) Cell proliferation follows acoustically-induced
hair cell bundle loss in the zebrafish saccule. Hear Res 253:67–76.
Sepich DS, Calmelet C, Kiskowski M, Solnica-Krezel L (2005) Initiation of
convergence and extension movements of lateral mesoderm during zebrafish gastrulation. Dev Dyn 234:279 –292.
Siddiquee K, Zhang S, Guida WC, Blaskovich MA, Greedy B, Lawrence HR,
Yip ML, Jove R, McLaughlin MM, Lawrence NJ, Sebti SM, Turkson J
(2007) Selective chemical probe inhibitor of Stat3, identified through
J. Neurosci., August 1, 2012 • 32(31):10662–10673 • 10673
structure-based virtual screening, induces antitumor activity. Proc Natl
Acad Sci U S A 104:7391–7396.
Smith ME, Coffin AB, Miller DL, Popper AN (2006) Anatomical and functional recovery of the goldfish (Carassius auratus) ear following noise
exposure. J Exp Biol 209:4193– 4202.
Soucek S, Michaels L, Frohlich A (1986) Evidence for hair cell degeneration as
the primary lesion in hearing loss of the elderly. J Otolaryngol 15:175–183.
Stone JS, Rubel EW (1999) Delta1 expression during avian hair cell regeneration. Development 126:961–973.
Stone JS, Cotanche DA (2007) Hair cell regeneration in the avian auditory
epithelium. Int J Dev Biol 51:633– 647.
Taub R (2004) Liver regeneration: from myth to mechanism. Nat Rev Mol
Cell Biol 5:836 – 847.
Thisse B, Thisse C (2004) Fast release clones: a high throughput expression
analysis. ZFIN Direct Data Submission. Available at: http://zfin.org/
cgi-bin/webdriver?MIval⫽aa-pubview2.apg&OID⫽ZDB-PUB-040907-1.
Torbenson M, Yang SQ, Liu HZ, Huang J, Gage W, Diehl AM (2002)
STAT-3 overexpression and p21 up-regulation accompany impaired regeneration of fatty livers. Am J Pathol 161:155–161.
Vollrath MA, Kwan KY, Corey DP (2007) The micromachinery of mechanotransduction in hair cells. Annu Rev Neurosci 30:339 –365.
Wang H, Park O, Lafdil F, Shen K, Horiguchi N, Yin S, Fu XY, Kunos G, Gao
B (2010) Interplay of hepatic and myeloid signal transducer and activator of transcription 3 in facilitating liver regeneration via tempering innate immunity. Hepatology 51:1354 –1362.
Wen Z, Zhong Z, Darnell JE Jr (1995) Maximal activation of transcription
by statl and stat3 requires both tyrosine and serine phosphorylation. Cell
82:241–250.
Westerfield M (2000) The zebrafish book: a guide to the laboratory use of
the zebrafish (Danio Rerio), Ed 4. Eugene, OR: University of Oregon.
Williams JA, Holder N (2000) Cell turnover in neuromasts of zebrafish larvae. Hear Res 143:171–181.
Woods C, Montcouquiol M, Kelley MW (2004) Math1 regulates development of the sensory epithelium in the mammalian cochlea. Nat Neurosci
7:1310 –1318.
Wüstefeld T, Rakemann T, Kubicka S, Manns MP, Trautwein C (2000) Hyperstimulation with Interleukin 6 inhibits cell cycle progression after hepatectomy in mice. Hepatology 32:514 –522.
Xiao T, Roeser T, Staub W, Baier H (2005) A GFP-based genetic screen
reveals mutations that disrupt the architecture of the zebrafish retinotectal projection. Development 132:2955–2967.
Yamashita S, Miyagi C, Carmany-Rampey A, Shimizu T, Fujii R, Schier AF,
Hirano T (2002) Stat3 controls cell movements during zebrafish gastrulation. Dev Cell 2:363–375.
Yoshimura A (2009) Regulation of cytokine signaling by the SOCS and
Spred family proteins. Keio J Med 58:73– 83.
Yu H, Pardoll D, Jove R (2009) STATs in cancer inflammation and immunity: a leading role for STAT3. Nat Rev Cancer 9:798 – 809.
Zhu BM, Ishida Y, Robinson GW, Pacher-Zavisin M, Yoshimura A, Murphy
PM, Hennighausen L (2008) SOCS3 negatively regulates the gp130STAT3 pathway in mouse skin wound healing. J Invest Dermatol 128:
1821–1829.