TOXICOLOGICAL SCIENCES 85, 560–571 (2005)
doi:10.1093/toxsci/kfi106
Advance Access publication February 9, 2005
2,3,7,8-Tetrachlorodibenzo-p-Dioxin (TCDD) and
1,2,3,4,7,8-Hexachlorodibenzo-p-Dioxin (HxCDD) Alter Body Weight
by Decreasing Insulin-Like Growth Factor I (IGF-I) Signaling
Claire R. Croutch,* Margitta Lebofsky,* Karl-Werner Schramm,† Paul F. Terranova,‡ and Karl K. Rozman*,§,1
*Department of Pharmacology, Toxicology and Experimental Therapeutics; †GSF- Institute of Ecological Chemistry, Neuherberg, Germany; ‡Center for
Reproductive Sciences and Department of Molecular and Integrative Physiology, University of Kansas Medical Center, Kansas City, KS 66160 USA;
§Section of Environmental Toxicology, GSF-Institut für Toxikologie, Neuherberg, Germany
Received November 18, 2004; accepted January 27, 2005
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) affects glycemia
due to reduced gluconeogenesis; when combined with a reduction
in feed intake, this culminates in decreased body weight. We
investigated the effects of steady-state levels of TCDD (loading
dose rates of 0.0125, 0.05, 0.2, 0.8, and 3.2 mg/kg) or approximately isoeffective dose rates of 1,2,3,4,7,8-hexachlorodibenzo-pdioxin (HxCDD) (loading dose rates of 0.3125, 1.25, 5, 20, and
80 mg/kg) on body weight, phosphoenolpyruvate carboxykinase
(PEPCK) mRNA expression and activity, and circulating concentrations of insulin, glucose, and insulin-like growth factor-I
(IGF-I), and expression of hepatic phosphorylated AMP kinase-a
(p-AMPK) protein in female Sprague-Dawley rats (~250 gm) at 2,
4, 8, 16, 32, 64, and 128 days after commencement of treatment.
At the 0.05 and 1.25 mg/kg loading dose rates of TCDD and
HxCDD, respectively, there was a slight increase in body weight
as compared to controls, whereas at the 3.2 and 80 mg/kg loading
dose rates of TCDD and HxCDD, respectively, body weight
of the rats was significantly decreased. TCDD and HxCDD
also inhibited PEPCK activity in a dose-dependent fashion, as
demonstrated by reductions in PEPCK mRNA and protein.
Serum IGF-I levels of rats treated initially with 3.2 mg/kg TCDD
or 80 mg/kg HxCDD started to decline at day 4 and decreased
to about 40% of levels seen in controls after day 16, remaining
low for the duration of the study. Eight days after initial dosing,
hepatic p-AMPK protein was increased in a dose-dependent
manner with higher doses of TCDD and HxCDD. There was no
effect with any dose of TCDD or HxCDD on circulating insulin
or glucose levels. In conclusion, doses of TCDD or HxCDD
that began to inhibit body weight in female rats also started to
inhibit PEPCK, inhibited IGF-I, while at the same time inducing p-AMPK.
Key Words: TCDD; HxCDD; insulin-like growth factor I;
IGF-I.
1
To whom correspondence should be addressed at Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center,
3901 Rainbow Boulevard, Kansas City, KS 66160. Fax: (913) 588-7501.
E-mail: [email protected].
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) belongs to
the aromatic hydrocarbon family which includes polycyclic
dibenzo-p-dioxins (PCDDs), polychloro-dibenzofurans (PCDFs),
and polychlorinated biphenyls (PCBs). The PCDD class contains
75 congeners (Ryan et al., 1991). The most toxic of the PCDD
congeners is TCDD. Congeners with chlorines in addition to those
at the 2, 3, 7, and 8 positions are less toxic than TCDD, unless they
are administered at higher doses, in which case they display the
same spectrum of effects (Couture et al., 1990; McConnell et al.,
1978). PCDDs with three or fewer chlorine substituents are rapidly
metabolized and therefore are biologically much less potent
(Goldstein, 1980).
PCDDs are ubiquitously found in the environment (Podoll
et al., 1986) at low background levels (ppt or ppq) in air, water,
and soil (Pohl, 2000). TCDD in the environment usually occurs
together with other congeners of PCDDs and PCDFs. The
mixtures are highly persistent in animals as well as in soil. The
half-life of TCDD in animals ranges from weeks to years; its
half-life on the soil surface is estimated to be 9–15 years, while
the half-life in subsurface soil may range from 25 to 100 years
(Paustenbach et al., 1992).
Insulin-like growth factors (IGFs) are members of the family
of insulin-related peptides that include relaxin and several
peptides isolated from lower invertebrates (Blundell and
Humbel, 1980). IGF-I is a premier progression and survival
growth factor found in serum and all major tissues in mammals
(Bolander, 2004; Iatropoulos, 1994; Iatropoulos and Williams
1996, 2004). IGF-I mRNA has been detected in liver, kidney,
spleen, thymus, heart, brain, skeletal muscle, testes, and
epididymal (white) adipose tissue (WAT) from male rats
(Gosteli-Peter et al., 1994). IGF-I production is induced by
growth hormone (GH) in the liver; GH also regulates the
paracrine production of IGF-I in many other tissues. However,
IGF-I gene expression is also modified by other hormonal,
tissue-specific, and developmental factors (Daughaday et al.,
1989).
There are no reports of TCDD or related congeners affecting
circulating IGF-I, and reports are mixed regarding effects on
Toxicological Sciences vol. 85 no. 1 The Author 2005. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved.
For Permissions, please email: [email protected]
561
TCDD AND HXCDD EFFECTS ON INSULIN-LIKE GROWTH FACTOR I
circulating GH. Circulating GH levels are difficult to evaluate,
particularly in male rats because of its pulsatile release.
Probably as a result of this variability, there has been little
focus on GH in TCDD-treated rats. Gorski et al. (1988a)
reported that 4 days after the administration of a nonlethal dose
of TCDD to male Sprague Dawley rats there was a steep, but
insignificant, increase in serum GH. GH levels decreased to
levels below those of both pair-fed and ad libitum-fed controls
by day 8 and remained there throughout the remainder of the
32-day study. Moore et al. (1989) also evaluated plasma GH in
male rats 7 days after treatment with TCDD and found GH
levels to be higher than in pair-fed control rats after the
lowest dose; at higher doses GH concentrations were lower as
compared to pair-fed controls (Moore et al., 1989). This group
also found that these differences in GH were not statistically
significant due to variability in the results. However, both
studies show the same trend, indicating that TCDD administration probably has an impact on circulating GH levels.
Thus, if GH was reduced following TCDD administration,
then this would lead to decreased circulating IGF-I serum
levels.
AMP-activated protein kinase (AMPK) has been called the
‘‘metabolic master switch’’ of the cell monitoring cellular
energy charge (Hardie and Carling, 1997; Winder and Hardie,
1999). AMPK is activated by phosporylation when the
AMP:ATP ratio is elevated (Hardie, 1999). Phosphorylated
AMP kinase a (p-AMPK) is believed to be the ‘‘fuel gauge’’ of
the cell. AMPK is activated not only by treatments which
deplete cellular ATP levels such as heat shock or arsenite in
hepatocytes (Corton et al., 1994), exercise in skeletal muscle
(Winder and Hardie, 1996), ischemia in heart (Kudo et al.,
1995), and glucose deprivation in pancreatic b-cell lines (Salt
et al., 1998), but also by treatment with the nucleoside 5aminoimidazole-4-carboxamide riboside (AICAR) (Corton
et al., 1995; Henin et al., 1995). In tissues such as liver,
adipose, and muscle, AMPK phosphorylates key enzymes such
as acetyl-CoA carboxylase, 3-hydroxy-3-methylglutaryl-CoA
reductase, glycogen synthase, and creatine kinase (Hardie and
Carling, 1997; Kemp et al., 1999; Ponticos et al., 1998), which
control the synthesis of fatty acids, cholesterol, glycogen, and
phosphocreatine, respectively. AMPK also phosphorylates
adipose tissue hormone-sensitive lipase (Garton et al., 1989)
and phosphorylates and activates the endothelial isoform of
nitric oxide synthase (Chen et al., 1999).
Hawley et al. (2002) reported that the antidiabetic drug
metformin activated the AMPK cascade via an adenine
nucleotide-independent mechanism. Similarities between metformin (Fulgencio et al., 2001; Minassian et al., 1998) and
TCDD (Viluksela et al., 1999b; Weber et al., 1995) include
inhibition of phosphoenolpyruvate carboxykinase (PEPCK)
and glucose 6-phosphatase (G6Pase), resulting in a reduced
gluconeogenesis leading to a lowering of blood glucose,
reduction in plasma insulin and free IGF-I levels, in addition
to activation of AMPK. The evaluation of p-AMPK expression
was also included in this study, because PEPCK gene expression has been shown to be repressed following activation
of AMPK by AICAR in a similar manner to repression of
PEPCK by insulin (Hubert et al., 2000; Lochhead et al., 2000).
Lochhead et al. (2000) found that AMPK did not link the
insulin receptor to the PEPCK and glucose-6-phosphatase
(G6Pase) gene promoters; instead, they proposed that AMPK
and insulin more likely lie on distinct pathways that converge at
a point upstream of these two aforementioned gene promoters
(Lochhead et al., 2000). Thus activation of AMPK could
inhibit hepatic gluconeogenesis in an insulin-independent
manner and help to reverse the hyperglycemia associated with
type 2 diabetes (Lochhead et al., 2000).
At higher doses, TCDD induces a wasting syndrome in rats
with associated changes in energy metabolism including
effects on gluconeogenesis, de novo fatty acid synthesis, serum
free fatty acids and triglycerides, as well as glycogen and fat
storage in liver and adipose tissue, respectively (Gorski et al.,
1988b, 1990; Muzi et al., 1989; Tuomisto et al., 1999; Weber
et al., 1991a,b). It was of interest to determine if metabolic
effects also occurred at low doses of TCDD or iso-equivalent
doses of 1,2,3,4,7,8-hexachlorodibenzo-p-dioxin (HxCDD)
under conditions of kinetic steady state. Therefore, the effect
of TCDD and HxCDD was investigated on body weight,
serum insulin, serum IGF-I, serum glucose, and hepatic PEPCK
and p-AMPK.
MATERIALS AND METHODS
Test chemicals. TCDD (CAS 1746–01–6; MW 321.9; purity >99%) and
1,2,3,4,7,8-hexachlorodibenzo-p-dioxin (HxCDD; CAS 39227–28–6; MW
390.9; purity >98.5%) were obtained from Cambridge Isotope Laboratories
Inc. (Woburn, MA). TCDD or HxCDD were dissolved in corn oil (Sigma, St.
Louis, MO).
Animals. A total of 375 female Sprague-Dawley rats (~250 gm) were
obtained from Harlan (Indianapolis, IN) and adapted to stainless steel wire
bottom cages and a light/dark cycle (6:00 to 18:00 h lights on) for at least 2
weeks prior to treatment. The animal room was maintained at an ambient
temperature of 21–22C and a relative humidity of 40–60%. Rats had free
access to tap water and 8604 Rodent Diet (Harlan Teklad, Madison, WI).
Dosing regimen. The half-life of TCDD in female Sprague-Dawley rats is
approximately 20 days (Geyer et al., 2002; Li et al., 1995b), whereas that of
HxCDD is about 60 days (Viluksela et al., 1998). Loading dose rate and
maintenance dose rates were calculated according to Gibaldi and Perrier
(1982), and similar dosing regimens have been used previously in our
laboratory (Rozman et al., in press; Viluksela et al., 1997, 1998):
*
x0 ¼ x0
1
1 eks
where x*0 is the loading dose rate, x0 is the maintenance dose rate, k is the
elimination rate constant, and s is the time interval between maintenance dose
rates.
Experimental design. Rats were randomly allocated into experimental
groups of five. Body weights were recorded every 3 days in the morning. Five
iso-effective loading dose rates of TCDD/HxCDD in corn oil via oral gavage
(0.0125/0.3125, 0.05/1.25, 0.2/5, 0.8/20, or 3.2/80 lg/kg, respectively) were
562
CROUTCH ET AL.
TABLE 1
Oligonucleotide Probes Generated for Analysis of PEPCK Expression by bDNA Signal Amplification
PEPCK
Accession #
Target sequence
NM198780
NM198780
NM198780
NM198780
NM198780
NM198780
NM198780
NM198780
NM198780
NM198780
NM198780
NM198780
NM198780
NM198780
NM198780
NM198780
1848–1869
1978–2002
2025–2049
2067–2085
1828–1847
1891–1911
1932–1955
1956–1977
2003–2024
2086–2110
2129–2153
2154–2172
1870–1890
1912–1931
2050–2066
2111–2128
Function*
CE
CE
CE
CE
LE
LE
LE
LE
LE
LE
LE
LE
BL
BL
BL
BL
Sequence
tcatatttcttcagcttgcggaTTTTTctcttggaaagaaagt
gtctggattctgactgatctcctaaTTTTTctcttggaaagaaagt
catggctatctggaatctagaagctTTTTTctcttggaaagaaagt
agccatgagctggccctagTTTTTctcttggaaagaaagt
tgacaccctcctcctgcatgTTTTTaggcataggacccgtgtct
gcctgtaggcagagactttggTTTTTaggcataggacccgtgtct
caagggtctttattctccagactcTTTTTaggcataggacccgtgtct
gcttctcaggcgtttgctactgTTTTTaggcataggacccgtgtct
ggctatgctaacctcacagggtTTTTTaggcataggacccgtgtct
aacttgaccaggtagacatttgctaTTTTTaggcataggacccgtgtct
gacgttgaccgtgttacttaggtatTTTTTaggcataggacccgtgtct
ccggccttgcagacacaagTTTTTaggcataggacccgtgtct
gctgaagggactcaccagttg
cgagaaggtagagctgggga
ggaaaggggccgccttg
ggaagccaagccaacggg
*
CE ¼ capture extender, LE ¼ label extender, and BL ¼ blocker.
given to the animals; doses (loading dose rate plus the sum of maintenance dose
rates) were selected based on their toxic equivalence. Controls were dosed with
vehicle alone (4 ml/kg). Maintenance dose rates were one tenth of the loading
dose rate. Animals were administered maintenance dose rates of TCDD or
HxCDD every third or ninth day, respectively, to maintain pharmacokinetic
steady state throughout the entire study (Viluksela et al., 1997). HxCDD
animals were dosed with corn oil alone on every third and sixth day to provide
them with an equal number of vehicle dose rates as those administered
maintenance dose rates of TCDD every third day.
After 2, 4, 8, 16, 32, 64, or 128 days of initial dosing, animals were sacrificed
via decapitation, trunk blood was collected, and livers were removed, weighed,
and snap frozen in liquid nitrogen. Aliquots of liver tissue were stored at 80C
until subsequent biochemical analysis. Blood was centrifuged, and serum was
aliquoted and frozen at 80C for future analyses. Day 2 serum samples from
HxCDD-treated rats were not collected, and therefore IGF-I, insulin, and
glucose values are not reported for this time point.
Analysis of TCDD in liver. About 0.2 gm of liver from rats treated with
0.05 lg/kg TCDD loading dose rate were lyophilized and analyzed for TCDD
by the GSF-Institute of Ecological Chemistry as previously described (Rozman
et al., 1995).
Glucose assay. Serum samples were assayed for glucose content using
a glucose hexokinase assay from Sigma (St. Louis, MO).
IGF-I and insulin radioimmunoassays (RIA). Rat serum samples were
assayed for IGF-I with kits purchased from Diagnostic Systems Laboratories
(Webster, TX). Serum samples were extracted with an ethanolic hydrochloric
acid solution prior to assaying by IGF-I RIA in order to remove insulin-like
growth factor-binding proteins (IGFBPs). Serum samples were also assayed
for insulin using a commercially available rat RIA kit purchased from LINCO
Research Inc (St. Louis, MO).
Development of rat PEPCK oligonucleotide probe sets for branched DNA
(bDNA) analysis. The rat PEPCK gene sequences were accessed from
GenBank (GenBank No.NM198780, Target 1828–2172). The target sequences
were then analyzed by Probe-Designer Software Version 1.0 (Bayer Diagnostics, East Walpole, MA). The oligonucleotide probes designed were specific
to a single mRNA transcript (Table 1). All oligonucleotide probes were
designed with a Tm of approximately 63C, enabling hybridization conditions
to be held constant (i.e., 53C) during each hybridization step and for the
oligonucleotide probe set. The probe developed in ProbeDesigner was
submitted to the National Center for Biotechnological Information for
nucleotide comparison by the basic logarithmic alignment search tool
(BLASTn; http://www.ncbi.nlm.nih.gov/BLAST/), to ensure minimal crossreactivity with other known rat sequences and expressed sequence tags.
PEPCK mRNA analysis using branched DNA (bDNA) assay. Total RNA
was isolated from liver samples using TRIzol Reagent (Invitrogen, Carlsbad,
CA) according to the manufacturer’s instructions. The specific oligonucleotide
probe set for PEPCK was diluted in 10 mM Tris–1 mM EDTA (TE) buffer
according to manufacturer’s instructions provided by Quantigene High
Volume Kit (Bayer Diagnostics, East Walpole, MA). Total RNA (1 lg/ml;
10 ll) was added to each well of a 96-well plate which contained 50 ll of
capture hybridization buffer and 50 ll of each diluted probe set. Hybridization
of the PEPCK probe set to the liver RNA took place overnight at 53C. The
following day the plate was processed according to protocol supplied by the
manufacturer. Luminescence was measured with a Quantiplex 320 bDNA
luminometer interfaced with a Quantiplex Data Management Software
Version 5.02 for analysis of results.
Western blot. Protein was isolated from liver samples, fractionated on
SDS–polyacrylamide gels, and transferred to a PVDF membrane. After
blocking with 5% nonfat dry milk in Tris-buffered saline Tween-20 (TBST),
blots were incubated with a polyclonal goat anti-rat PEPCK antibody (kindly
provided by Dr. D. Granner, Vanderbilt University School of Medicine) or
rabbit polyclonal antibody against p-AMPK (Cell Signaling Technology,
Beverly, MA) at 1:1000 in 1% nonfat dry milk in TBST. Following washing,
PEPCK blots were incubated with anti-goat-HRP conjugated secondary
antibody (Santa Cruz Biotechnology, Santa Cruz, CA) diluted 1:1000 in 1% nonfat dry milk in TBST; p-AMPK blots were incubated with goat anti-rabbit-HRP
conjugated secondary antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at
1:1000 in 1% nonfat dry milk in TBST. Bands were visualized by enhanced
chemiluminescence (Santa Cruz Biotechnology, Santa Cruz, CA). Western
blots were then stripped and reprobed with a primary antibody against b-actin
(Santa Cruz Biotechnology, Santa Cruz, CA). Blots were quantitated using Gel
Pro Software Image Analysis.
PEPCK (E.C 4.1.1.32) activity. PEPCK activity was measured according
to Wimmer, using a bioluminescent method previously described by our
laboratory (Viluksela et al., 1995; Wimmer, 1988).
TCDD AND HXCDD EFFECTS ON INSULIN-LIKE GROWTH FACTOR I
563
FIG. 1. Effect of TCDD and HxCDD on body weight. (A) Effects of 0, 0.0125, 0.05, 0.2, 0.8, and 3.2 lg/kg loading dose rates of TCDD on body weight (n ¼
5). Body weight was measured every 3 days for ~20 weeks. Data points on this figure are an average of body weights for the week; a indicates statistically
significant difference versus corn oil treated rats at p 0.05. (B) Effects of 0, 0.05, and 3.2 lg/kg loading dose rates of TCDD on body weight (n ¼ 5). Body weight
was measured every 3 days for ~20 weeks. Data points on this figure are an average of body weights for the week. (C) Effects of 0, 0.3125, 1.25, 5, 20, and 80 lg/kg
loading dose rates of HxCDD on body weight (n ¼ 5). Body weight was measured every 3 days for ~20 weeks. Data points on this figure are an average of body
weights for the week; b indicates statistically significant difference of 0.3125 versus 80 lg/kg loading dose rates at p 0.05; c indicates statistically significant
difference of 5 versus 80 lg/kg loading dose rates at p 0.05. (D) Effects of 0, 1.25, and 80 lg/kg loading dose rates of HxCDD on body weight (n ¼ 5). Body
weight was measured every 3 days for ~20 weeks. Data points on this figure are an average of body weights for the week.
Statistical analysis. Data on Figures 1–4 are presented as mean ± SEM.
Error bars on graphs represent the standard error of the mean. Results for
bDNA were analyzed by two-tailed Student’s t-test. For body weight, PEPCK
activity, glucose, insulin, and IGF-I assays, comparisons between all groups
were performed by two-way ANOVA. Subsequent to analysis of variance, the
significant differences between experimental groups were determined by
Student-Newman-Keuls multiple comparisons. A p value of 0.05 was
considered statistically significant.
slightly lower than those of day 2 and day 32. However, these
animals received their last maintenance dose rate two days
earlier, in contrast to the day 2 and 32 animals that had received
the loading dose rate or the last maintenance dose rate only one
day prior to collecting the liver samples. Finally, it is important
to note that, in agreement with expectations, the hepatic
concentration of TCDD remained quite constant between day
8 and 32, even though 8 maintenance dose rates had been
administered during this time period (Table 2).
RESULTS
Analysis of TCDD in Liver
Livers from rats treated with 0.05 lg/kg TCDD loading
dose rate were analyzed on days 2, 8, and 32 for TCDD
concentration by GC-MS. Table 2 shows the concentration (pg/
gm dry weight) of TCDD in each group of five samples. The
concentration of TCDD in liver samples from day 8 were
Effects of TCDD or HxCDD on Body Weight under
Conditions of Kinetic Steady State
All animals were weighed every 3 days throughout the 128day study. The effect of TCDD or HxCDD administration on
body weight of rats is shown in Figures 1A/1B and 1C/1D,
respectively. Body weight was decreased after the second week
of the 3.2 lg/kg TCDD loading dose rate; two-way ANOVA
564
CROUTCH ET AL.
FIG. 2. Hepatic PEPCK activity and mRNA in TCDD- and HxCDD-treated rats. (A) Effects of 0, 0.0125, 0.05, 0.2, 0.8, and 3.2 lg/kg loading dose rates of
TCDD (n ¼ 5) on PEPCK activity on days 2–128 after initiation of dosing; a indicates statistically significant difference as compared to 0.2 lg/kg loading dose rate
(p 0.05); b indicates statistically significant difference as compared to corn oil (p 0.05). (B) Effects of 0, 0.0125, 0.05, 0.2, 0.8, and 3.2 lg/kg loading dose rates
of TCDD (n ¼ 5) on PEPCK mRNA on days 2–128 after initiation of dosing. (C) Effects of 0, 0.3125, 1.25, 5, 20, and 80 lg/kg loading dose rates of HxCDD (n ¼
5) on PEPCK activity on days 2–128 after initiation of dosing. (D) Effects of 0, 0.3125, 1.25, 5, 20, and 80 lg/kg loading dose rates of HxCDD (n ¼ 5) on PEPCK
mRNA on days 2–128 after initiation of dosing; * indicates statistically significant difference versus rats administered a loading dose rate of 5 lg/kg HxCDD at
p 0.05.
indicated an overall effect of TCDD on body weight, and
Student-Newman-Keuls showed a significant difference beginning at week 9 after the administration of the 3.2 lg/kg TCDD
loading dose rate as compared to controls. There was also
a statistically significant difference (p 0.05) in body weight at
weeks 10, 11, 13, 18, and 19 in the 3.2 lg/kg TCDD loading
dose rate group.
The pattern was similar for the 80 lg/kg HxCDD dosage
group, although the decrease in body weight was statistically
not significant at any of the time points as compared to
controls. However, body weight was decreased after the second
week of the 80 lg/kg HxCDD loading dose rate as compared to
the 0.3125 lg/kg HxCDD loading dose rate at weeks 7, 8, and
9; Student-Newman-Keuls also indicated a significant differ-
ence between the 5 and 80 lg/kg HxCDD loading dose rates at
weeks 14, 15, and 18. There was an apparent trend in the lowdose animals, especially in the 0.05 lg/kg TCDD dosage
group, showing a slight but consistent increase in body weight
as compared to controls. There was a less pronounced but also
persistent trend toward higher body weights than controls in
other dosage groups.
Effects of TCDD or HxCDD on PEPCK Activity, PEPCK
mRNA, and Protein in Liver
Hepatic PEPCK activity appeared to be inhibited dosedependently after TCDD or HxCDD administration beginning
at approximately day 16 (Figs. 2A and 2C, respectively). There
TCDD AND HXCDD EFFECTS ON INSULIN-LIKE GROWTH FACTOR I
565
FIG. 3. Serum IGF-I concentrations in TCDD- and HxCDD-treated rats. (A) Effects of various doses of TCDD on levels of circulating IGF-I on days 2–128
after treatment (n ¼ 5); a indicates statistically significant difference as compared to corn oil, 0.0125, 0.05, 0.2, or 0.8 lg/kg TCDD loading dose rate at p 0.01;
b indicates statistically significant difference as compared to 0.0125, 0.05, 0.2, or 0.8 lg/kg TCDD loading dose rate at p 0.01; c indicates statistically significant
difference as compared to corn oil, 0.0125, or 0.05 lg/kg TCDD loading dose rate at p 0.01. (B) Effects of various doses of TCDD on levels of circulating IGF-I
on days 2–128 after treatment (n ¼ 5). (C) Effects of various doses of HxCDD on levels of circulating IGF-I on days 2–128 after treatment (n ¼ 5); a indicates
statistically significant difference as compared to corn oil alone at p 0.05; b indicates statistically significant difference as compared to 0.3125, 1.25, or 5 lg/kg
HxCDD loading dose rate at p 0.01; c indicates statistically significant difference as compared to corn oil, 1.25, or 20 lg/kg HxCDD loading dose rate at p 0.01; d indicates statistically significant difference as compared to 0.3125, 1.25, 5, or 20 lg/kg HxCDD loading dose rate at p 0.01; e indicates statistically
significant difference as compared to corn oil, 0.3125, 1.25, 5, or 20 lg/kg HxCDD loading dose rate at p 0.01. (D) Effects of various doses of HxCDD on levels
of circulating IGF-I on days 2–128 after treatment (n ¼ 5).
was a statistically significant (p 0.05) inhibition of PEPCK
activity on day 4 in rats administered a loading dose rate of
0.8 or 3.2 lg/kg TCDD as compared to those given a loading
dose rate of 0.2 lg/kg TCDD. On day 16, there was a
statistically significant (p 0.05) inhibition of PEPCK activity
in rats administered a loading dose rate of 3.2 lg/kg TCDD as
compared to those given a loading dose rate of 0.2 lg/kg
TCDD or corn oil. However, inhibition of PEPCK activity at
other doses or time points for either TCDD or HxCDD was not
statistically significant (Fig. 2).
In TCDD-treated rats, there was a dose-dependent decrease
in PEPCK mRNA expression (Fig. 2B). Similarly, HxCDD-
treated rats also showed a dose-dependent decrease in PEPCK
mRNA expression, especially at the 32-day time point and at
64 and 128 days of treatment (Fig. 2D). At day 64, the decrease
in PEPCK mRNA expressed in rats treated with loading and
maintenance dose rates of HxCDD at 20 lg/kg and at 80 lg/kg
was statistically significant as compared to the level in rats
treated with 5 lg/kg HxCDD.
PEPCK protein (determined by Western blot) was dosedependently inhibited by both TCDD and HxCDD administration (data not shown). At the highest loading dose rate of
TCDD and HxCDD administered (3.2 or 80 lg/kg, respectively) there was a decrease in the amount of hepatic PEPCK
566
CROUTCH ET AL.
FIG. 4. Serum insulin and glucose concentrations in TCDD- and HxCDD-treated rats. (A) Effects of 0, 0.0125, 0.05, 0.2, 0.8, and 3.2 lg/kg loading dose rates
of TCDD (n ¼ 5) on circulating insulin on days 2–128 after initiation of dosing. (B) Effects of 0, 0.3125, 1.25, 5, 20, and 80 lg/kg loading dose rates of HxCDD
(n ¼ 5) on circulating insulin on days 2–128 after initiation of dosing. (C) Effects of 0, 0.0125, 0.05, 0.2, 0.8, and 3.2 lg/kg loading dose rates of TCDD (n ¼ 5) on
circulating glucose on days 2–128 after initiation of dosing. (D) Effects of 0, 0.3125, 1.25, 5, 20, and 80 lg/kg loading dose rates of HxCDD (n ¼ 5) on circulating
glucose on days 2–128 after initiation of dosing.
protein which paralleled that seen for its mRNA and its
activity.
Effects of TCDD or HxCDD on Circulating Levels
of IGF-I
Figures 3A and 3B show that, in rats initially treated with 3.2
lg/kg TCDD, there was a sharp decline in their circulating
IGF-I levels by day 8 as compared to corn oil- and lower-dose
TCDD-treated groups. In 3.2 lg/kg TCDD-treated rats, this
decrease in IGF-I continued to decline to 42% of controls by
day 16 of the study. The decrease in IGF-I remained at this
level (about 350 ng/ml) through day 128, a 66% decrease, on
average, as compared to IGF-I levels in controls. Beginning on
day 8 and at every time point throughout the remainder of
the 128-day study, the decrease in IGF-I was statistically
significant when compared to controls and also when compared
to 0.0125 or 0.05 lg/kg TCDD-treated groups. As shown in
Figures 3A and 3B, serum IGF-I concentrations of the 0.05 lg/
kg TCDD-treated rats remained either slightly higher than or
approximately the same as levels in controls.
In the 80 lg/kg HxCDD-treated rats, serum IGF-I levels
were also significantly lower than in controls by day 16 (Figs.
3C and 3D). IGF-I levels in the 80 lg/kg HxCDD-treated rats
remained at a concentration of about 470 ng/ml throughout
the remainder of the 128-day study. The concentration of IGF-I
in the 80 lg/kg HxCDD loading dose rate group initially
decreased by 37% on day 16 and further declined to about 45%
below control levels thereafter. On day 16, there was a statistically significant difference in IGF-1 levels in the 80 lg/kg
HxCDD loading dose rate group as compared to the 0.3125,
1.25, and 5 lg/kg HxCDD loading dose rate groups. The 80 lg/
kg HxCDD loading dose rate group was statistically different
from the controls and from the 1.25 and 20 lg/kg HxCDD
TCDD AND HXCDD EFFECTS ON INSULIN-LIKE GROWTH FACTOR I
TABLE 2
Analytical Results of Liver Concentrations in Rats Treated
with TCDD
Day after loading
dose rate
2
8
32
Day of maintenance
dose rate
TCDD concentration pg/g dry
liver ± SE
—
3
6
—
9
12
15
18
21
24
28
31
—
1,389 ± 190
—
—
1,183 ± 141
—
—
—
—
—
—
—
—
1,459 ± 139
Note. Rats treated with a loading dose rate of 0.05 lg/kg TCDD and
a maintenance dose rate of 0.005 lg/kg TCDD every third day; n ¼ 5 per group.
loading dose rate groups also on day 32. On days 64 and 128,
the decrease in IGF-I was statistically significant when
compared to controls and also when compared to all HxCDDtreated groups. Finally, although only statistically significant
at day 4, HxCDD loading dose rates of 5 lg/kg consistently
had IGF-I serum concentrations slightly higher than the
concentration found in controls.
Effects of TCDD or HxCDD on Insulin and
Glucose Concentrations
Circulating concentrations of insulin and glucose were
unaffected by either TCDD or HxCDD at any of the doses
administered (Fig. 4).
Active AMPK Protein Increases Following the
Administration of TCDD or HxCDD
Western blot analysis clearly demonstrates (Fig. 5) that the
active or phosphorylated form of AMPK-a protein increased in
a dose-dependent manner with both TCDD and HxCDD
administration. Blots were stripped and reprobed with antibody
against b-actin to show equal loading of protein in each lane.
DISCUSSION
As indicated by Table 2, the dosing regimen of TCDD with
a loading dose rate of 0.05 lg/kg followed every third day by
maintenance dose rates of 0.005 lg/kg resulted in a reasonably
good steady-state concentration for 32 days, which represents
about 2 half-lives of this compound. This implies that most
567
likely all other dosing regimens yielded similarly good steadystate concentrations for the entire duration of each study.
The results of this study demonstrate that administration of
low doses of TCDD or HxCDD to female rats resulted in
metabolic changes which affected body weight. By day 8 after
initial treatment with TCDD, IGF-I serum levels were significantly reduced (Figs. 3A and 3B), with a trend to reduction in
HxCDD-treated rats as well (Figs. 3C and 3D). By day 21 into
TCDD treatment and day 28 into HxCDD treatment, body
weight started to decrease; however prior to that, on day 8 into
treatment, hepatic p-AMPK protein was dose-dependently
increased. Throughout the entire study, there was no evidence
of changes in circulating insulin or glucose levels after any of
the treatments, although both TCDD and HxCDD have been
shown to cause hypoinsulinemia as well as a paradoxical
hypoglycemia at higher doses (Gorski et al., 1988a; Viluksela
et al., 1995). Thus the herein-described body-weight effect
concomitant with effects on PEPCK, IGF-I, and p-AMPK
represent a group of dose responses which occur at lower doses
than the actual body weight loss which occurs at higher doses
and is due to toxicity (Stahl et al., 1992). The less pronounced
body weight effect in HxCDD-treated rats is also reflected in
a less pronounced effect on PEPCK, IGF-I, and p-AMPK. This
is the result of a slight (by a factor of 2) overestimation of the
relative potency of HxCDD in comparison to TCDD.
Inhibition of gluconeogenesis by TCDD (Gorski et al.,
1988a) as a result of a dose-dependent decrease in the activity
of PEPCK has been demonstrated previously (Cimbala et al.,
1981; Lamers et al., 1982; Loose et al., 1985; Stahl et al., 1993;
Viluksela et al., 1998, 1999a). Initial dose-response studies
suggested that this was a high-dose effect (Stahl et al., 1993),
although clearly nonlethal doses had already a significant
inhibitory effect (Viluksela et al., 1995). Figures 2B and 2D
show by a more sensitive method that PEPCK mRNA was
decreased at every time point after the 3.2 and 80 lg/kg loading
dose rates of TCDD and HxCDD, respectively, albeit only at
one time point significantly. This suggests that inhibition of
PEPCK begins well below doses causing acute toxicity.
Prior to this study, circulating IGF-I levels in TCDD- or
HxCDD-treated rats (Fig. 3) had not been evaluated. However
there was some in vitro evidence that TCDD could affect IGFI signaling pathways. Firstly, although variable, the trend in
serum GH was toward a decrease following the administration
of TCDD, which would lead to a decrease in circulating IGF-I
(Gorski et al., 1988a; Moore et al., 1989). Secondly, there were
some prior in vitro reports showing that TCDD affected IGF-I.
In the human mammary epithelial cell line, MCF-10A, under
insulin-deficient conditions for six days, both benzo[a]pyrene
and TCDD activated IGF-I signaling pathways (Tannheimer
et al., 1998). In MCF-7 human breast cancer cells, TCDD and
IGF-I coadministration for 72 h resulted in a significant decrease in mitogen-induced cell proliferation and 3H-thymidine
uptake as compared to treatment of the cells with IGF-I
alone (Liu et al., 1992). Although TCDD did not change the
568
CROUTCH ET AL.
FIG. 5. Hepatic phospho-AMPKa after TCDD or HxCDD administration
to rats; effects of TCDD and HxCDD on hepatic p-AMPK protein levels
evaluated by Western blot at the 8-day time point. Bars on graphs are a single
representation of each sample. Blots were stripped and reprobed with antibody
against b-actin to assess accuracy of loading of protein in each lane of the gels.
mRNA levels of the IGF-I receptor or the Kd values for binding
of 125I-IGF-I to the IGF-I receptor, there was a significant
decrease in the number of IGF-I-induced IGF-I receptor
binding sites after TCDD treatment (Liu et al., 1992).
There are many IGF-I actions which have been demonstrated
both in vitro and in vivo. IGF-I stimulates a mitogenic response
in fibroblasts, chrondrocytes, osteoblasts, keratinocytes, thyroid follicular cells, smooth muscle cells, skeletal muscle
cells, neuronal cells, mammary epithelial cells, mesangial
cells, erythroid progenitor cells, thymic epithelium, oocytes,
granulosa cells, spermatogonia, Sertoli cells, and several
cancer cell lines (Cohick et al., 1993; Giudice, 1992; Lowe,
1991; McCauley, 1992; Rechler, 1993 ). Additionally, IGF-I is
also able to inhibit cell death via apoptosis; this action has been
best characterized in hematopoietic cells (Williams et al.,
1990). Both IGF-I and IGF-II can promote differentiation in
myoblasts (Florini and Magri, 1989), osteoclasts (Mochizuki
et al., 1992), chondrocytes (Geduspan and Solursh, 1993),
neural cells (Pahlman et al., 1991), adipocytes, and osteoblasts
(Sara and Hall, 1990). Infusion of IGF-I in humans results in
effects comparable to those seen in rats (Jones and Clemmons,
1995). Some of the effects of IGF-I administration to humans
include an increase in glucose uptake, a decrease in hepatic
glucose production, an increase in protein synthesis, an
increase in body and organ weight, improved wound healing,
a decrease in circulating GH, and an increase in catecholamines
(Jones and Clemmons, 1995).
IGFs also regulate hormone secretion from many cell types.
In ovarian granulosa and theca cells, IGF-I and IGF-II
stimulate hormone synthesis and secretion; these effects are
synergized when the IGFs are combined with follicle stimulating hormone (FSH) and estrogen (Giudice, 1992). Hormone
secretion from Leydig and thyroid follicular cells is also
stimulated by IGF-I (Lowe, 1991). Conversely, IGF-I directly
inhibits growth hormone (GH) secretion in cultured pituitary
somatotrophes (Yamasaki et al., 1991).
The regulation of the biologically active free fraction of
IGF-I occurs by different IGF binding proteins (IGFBPs) in
serum and tissues. Currently, there are seven known IGFBPs,
some of which are characterized well, others not. IGFBPs act
as a reservoir for IGF-I, especially when bound to the
extracellular matrix, and can control IGF-I activity locally,
which is critically involved in the switching of energy signals
(Bolander, 2004). The energy supply process is stimulated in
mammals mainly by hypothermia, but also by hypoxia and in
primates by hypoglycemia (Himms-Hagen, 1995; Iatropoulos
and Williams, 2004). Normothermia, plasma catecholamines,
and erythroid component behavior (as previously mentioned)
are all modulated by IGF-I (Bolander, 2004). TCDD administration to rats causes hypothermia (Potter et al., 1983) and in
some distinct brain regions there are changes in catecholamines
(Rozman et al., 1991; Unkila et al., 1995). While the doses
of TCDD used for the aforementioned studies were higher
than those used for this study, these changes, in addition to
hypoglycemia induced by TCDD administration, may be due
to IGF-I signaling already having been turned off.
Activation of hepatic p-AMPK by TCDD and HxCDD has
not been reported previously (Fig. 5). In 2002, Hawley et al.
showed that the antidiabetic drug metformin activated the
AMPK cascade via an adenine nucleotide-independent mechanism (Hawley et al., 2002). Similarities between metformin
and TCDD (as previously mentioned) include reduced
TCDD AND HXCDD EFFECTS ON INSULIN-LIKE GROWTH FACTOR I
gluconeogenesis via inhibition of PEPCK and activation of
AMPK. It has been known for some time that AMPK controls
the regulation of glucose-responsive genes in mammals as well
as in yeast (Leclerc et al., 1998). Adiponectin (Acrp30), an
adipose-secreted hormone, has been shown to activate AMPK
in the liver, leading to an inhibition of PEPCK and G6Pase
activity, resulting in the inhibition of gluconeogenesis (Kamon
et al., 2003; Lochhead et al., 2000; Shklyaev et al., 2003).
Thus, it is quite possible that TCDD and HxCDD also activate
the AMPK cascade via an adenine-nucleotide-independent
mechanism, since TCDD did not seem to affect hepatic ATP
levels (Neal et al., 1979).
It is important to note that equivalent doses of TCDD and
HxCDD, which decreased serum IGF-I and body weight in
these female rats, have been reported to reduce reproduction
in female rats. The ED50 for the inhibition of ovulation was
determined to be between 3.0 and 10.0 lg/kg TCDD by toxic
equivalents of other TCDD congeners (Gao et al., 1999, 2000;
Li et al., 1995a). It is well known that IGF-I has a major
role in regulating ovarian function by enhancing responses to
gonadotropins (Lowe, 1991). Recently, Rozman et al. (in press)
reported that an equivalent dose of 1,2,3,4,6,7,8-heptachlorodibenzo-p-dioxin (HpCDD; 1.0 mg/kg ¼ 8.0 lg/kg TCDD
equivalent; Viluksela et al., 1997) to female rats had a hormetic,
life-prolonging effect which was accompanied by a sustained
decrease in body weight very similar to that seen in Figure 1,
suggesting that the effects on reproduction and longevity
could be due to decreased circulating IGF-I levels in TCDD-,
HxCDD-, HpCDD- and possibly in all planar TCDD congenertreated rats.
Arking proposed that caloric restriction–induced changes
resulted in animals ‘‘shifting their energy resources from
growth and reproduction to somatic repair and maintenance’’
(Arking, 2003). Arking hypothesized that the IGF-I signaling
system functions as the switch for two sets of genes that direct
the animal to either undergo growth and reproduction, or repair
(fighting stress, such as reactive oxygen species or oxidative
stress) and ultimately increased longevity when IGF-I is ‘‘off’’
and reproduction is reduced (Arking, 2003). According to
Arking’s theory, conditions favorable to growth and successful
reproduction require the IGF-I signaling system to be ‘‘on,’’
which at the same time represses stress-resistance and other
maintenance genes, leading to successful reproduction but
premature aging. Conditions unfavorable to reproduction are
related to the IGF-I signaling systems being turned ‘‘off,’’
leading to the derepression of stress-resistance genes and the
repression of genes related to growth and reproduction,
resulting in increased longevity at the cost of reduced reproduction. This switch system for increased growth and
reproduction versus increased maintenance and longevity
describes very well the effects of low doses of TCDD and
congeners which tended to increase serum IGF-I levels,
possibly thereby enhancing reproduction, but shortening
life span, whereas higher (but still nontoxic) doses did reduce
569
IGF-I signaling, leading to decreased reproduction (Gao et al.,
1999, 2000) and prolongation of life (Rozman et al., in press).
Higher doses of TCDD and congeners approaching the toxicity
threshold would lead to a maximum and, hence, constant
response in terms of IGF. In that higher dose range, both
reduced life span and decreased reproduction would be due to
overt toxicity by mechanisms other than IGF-I signaling. It
is very likely that mixtures of TCDD congeners would exert
their effects on IGF-I signaling in accordance with their toxic
equivalents, as has been demonstrated for their effect on
reproduction (Gao et al., 1999, 2000) and energy metabolism
(Stahl et al., 1993; Viluksela et al., 1995, 1998, 1999).
REFERENCES
Arking, R. (2003). Aging: A biological perspective. Am. Sci. 91, 508–515.
Blundell, T. L., and Humbel, R. E. (1980). Hormone families: Pancreatic
hormones and homologous growth factors. Nature 287, 781–787.
Bolander, F. F. (2004). Nonclassical endocrinology. In Molecular Endocrinology (F. F. Bolander, Ed.), pp. 61–100. Elsevier Academic Press, Boston.
Chen, Z., Heierhorst, J., Mann, R. J., Mitchelhill, K. I., Michell, B. J.,
Witters, L. A., Lynch, G. S., Kemp, B. E., and Stapleton, D. (1999).
Expression of the AMP-activated protein kinase beta1 and beta2 subunits in
skeletal muscle. FEBS Lett. 460, 343–348.
Cimbala, M. E., Van Lelyveld, P., and Hanson, R. W. (1981). Regulation of
the levels of phosphoenolpyruvate carboxykinase (GTP) mRNA in rat liver
by insulin and glucagon. In Advances in Enzymatic Regulation (G. Weber,
Ed.), pp. 205–214. Pergamon Press, New York.
Cohick, W. S., and Clemmons, D. R. (1993). The insulin-like growth factors.
Annu. Rev. Physiol. 55, 131–153.
Corton, J. M., Gillespie, J. G., and Hardie, D. G. (1994). Role of the
AMP-activated protein kinase in the cellular stress response. Curr. Biol. 4,
315–324.
Corton, J. M., Gillespie, J. G., Hawley, S. A., and Hardie, D. G. (1995). 5Aminoimidazole-4-carboxamide ribonucleoside. A specific method for
activating AMP-activated protein kinase in intact cells? Eur. J. Biochem.
229, 558–565.
Couture, L. A., Abbott, B. D., and Birnbaum, L. S. (1990). A critical review of
the developmental toxicity and teratogenicity of 2,3,7,8-tetrachlorodibenzop-dioxin: Recent advances toward understanding the mechanism. Teratology
42, 619–627.
Daugherty, W. H., and Rotwein, P. (1989). Insulin-like growth factors I and II.
Peptide messenger ribonucleic acid and gene structures, serum, and tissue
concentrations. Endocr. Rev. 10, 68–91.
Florini, J. R., and Magri, K. A. (1989). Effects of growth factors on myogenic
differentiation. Am. J. Physiol. 256, C701–C711.
Fulgencio, J. P., Kohl, C., Girard, J., and Pegorier, J. P. (2001). Effect of
metformin on fatty acid and glucose metabolism in freshly isolated
hepatocytes and on specific gene expression in cultured hepatocytes.
Biochem. Pharmacol. 62, 439–446.
Gao, X., Son, D. S., Terranova, P. F., and Rozman, K. K. (1999). Toxic
equivalency factors of polychlorinated dibenzo-p-dioxins in an ovulation
model: Validation of the toxic equivalency concept for one aspect of
endocrine disruption. Toxicol. Appl. Pharmacol. 157, 107–116.
Gao, X., Terranova, P. F., and Rozman, K. K. (2000). Effects of polychlorinated
dibenzofurans, biphenyls, and their mixture with dibenzo-p-dioxins on
ovulation in the gonadotropin-primed immature rat: Support for the toxic
equivalency concept. Toxicol. Appl. Pharmacol. 163, 115–124.
570
CROUTCH ET AL.
Garton, A. J., Campbell, D. G., Carling, D., Hardie, D. G., Colbran, R. J.,
and Yeaman, S. J. (1989). Phosphorylation of bovine hormone-sensitive
lipase by the AMP-activated protein kinase. A possible antilipolytic
mechanism. Eur. J. Biochem. 179, 249–254.
Geduspan, J. S., and Solursh, M. (1993). Effects of the mesonephros and
insulin-like growth factor I on chondrogenesis of limb explants. Dev. Biol.
156, 500–508.
Geyer, H. J., Schramm, K. W., Feicht, E. A., Behechti, A., Steinberg, C.,
Bruggemann, R., Poiger, H., Henkelmann, B., and Kettrup, A. (2002).
Half-lives of tetra-, penta-, hexa-, hepta-, and octachlorodibenzo-p-dioxin in
rats, monkeys, and humans–a critical review. Chemosphere 48, 631–644.
Gibaldi, M., and Perrier, D. (1995). Multiple dosing. In Pharmacokinetics
(M. Gibaldi and D. Perrier, Eds.), pp. 97–128. Marcel Dekker, Inc., New
York, NY.
Giudice, L. C. (1992). Insulin-like growth factors and ovarian follicular
development. Endocr. Rev. 13, 641–669.
Goldstein, J. A. (1980). Structure-activity relationships for the biochemical
effects and the relationship to toxicity. In Halogenated Biphenyls,
Terphenyls, Naphthalenes, Dibenzodioxins and Related Products (R. D.
Kimrough, Ed.), p. 154. Elsevier/North-Holland Biochemical Press, New
York.
Gorski, J. R., Muzi, G., Weber, L. W., Pereira, D. W., Arceo, R. J., Iatropoulos,
M. J., and Rozman, K. (1988a). Some endocrine and morphological aspects
of the acute toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD).
Toxicol. Pathol. 16, 313–320.
Gorski, J. R., Weber, L. W., and Rozman, K. (1988b). Tissue-specific
alterations of de novo fatty acid synthesis in 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD)-treated rats. Arch. Toxicol. 62, 146–151.
Gorski, J. R., Weber, L. W., and Rozman, K. (1990). Reduced gluconeogenesis
in 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-treated rats. Arch. Toxicol.
64, 66–71.
Gosteli-Peter, M. A., Winterhalter, K. H., Schmid, C., Froesch, E. R., and
Zapf, J. (1994). Expression and regulation of insulin-like growth factor-I
(IGF-I) and IGF-binding protein messenger ribonucleic acid levels in tissues
of hypophysectomized rats infused with IGF-I and growth hormone.
Endocrinology 135, 2558–2567.
Hardie, D. G. (1999). Roles of the AMP-activated/SNF1 protein kinase family
in the response to cellular stress. Biochem. Soc. Symp. 64, 13–27.
Hardie, D. G., and Carling, D. (1997). The AMP-activated protein kinase–fuel
gauge of the mammalian cell? Eur. J. Biochem. 246, 259–273.
Hawley, S. A., Gadalla, A. E., Olsen, G. S., and Hardie, D. G. (2002). The
antidiabetic drug metformin activates the AMP-activated protein kinase
cascade via an adenine nucleotide-independent mechanism. Diabetes 51,
2420–2425.
Henin, N., Vincent, M. F., Gruber, H. E., and Van den, B. G. (1995). Inhibition
of fatty acid and cholesterol synthesis by stimulation of AMP-activated
protein kinase. FASEB J. 9, 541–546.
Himms-Hagen, J. (1995). Role of brown adipose tissue thermogenesis in
control of thermoregulatory feeding in rats: A new hypothesis that links
thermostatic and glucostatic hypotheses for control of food intake. Proc. Soc.
Exp. Biol. Med. 208, 159–169.
Hubert, A., Husson, A., Chedeville, A., and Lavoinne, A. (2000). AMPactivated protein kinase counteracted the inhibitory effect of glucose on the
phosphoenolpyruvate carboxykinase gene expression in rat hepatocytes.
FEBS Lett. 481, 209–212.
Iatropoulos, M. J., and Williams, G. M. (2004). The function and pathology of
brown adipose tissue in animals and humans. J. Toxicol. Pathol. 17, 147–153.
Iatropoulos, M. J. (1994). Endocrine considerations in toxicologic pathology.
Exp. Toxicol. Pathol. 45, 391–410.
Iatropoulos, M. J., and Williams, G. M. (1996). Proliferation markers. Exp.
Toxicol. Pathol. 48, 175–181.
Jones, J. I., and Clemmons, D. R. (1995). Insulin-like growth-factors and their
binding proteins: biological actions. Endocr. Rev., 16, 3–34.
Kamon, J., Yamauchi, T., Terauchi, Y., Kubota, N., and Kadowaki, T. (2003).
[The mechanisms by which PPARgamma and adiponectin regulate glucose
and lipid metabolism]. Nippon Yakurigaku Zasshi 122, 294–300.
Kemp, B. E., Mitchelhill, K. I., Stapleton, D., Michell, B. J., Chen, Z. P., and
Witters, L. A. (1999). Dealing with energy demand: The AMP-activated
protein kinase. Trends Biochem. Sci. 24, 22–25.
Kudo, N., Barr, A. J., Barr, R. L., Desai, S., and Lopaschuk, G. D. (1995). High
rates of fatty acid oxidation during reperfusion of ischemic hearts are
associated with a decrease in malonyl-CoA levels due to an increase in 5’AMP-activated protein kinase inhibition of acetyl-CoA carboxylase. J. Biol.
Chem. 270, 17513–17520.
Lamers, W. H., Hanson, R. W., and Meisner, H. M. (1982). cAMP stimulates
transcription of the gene for cytosolic phosphoenolpyruvate carboxykinase in
rat liver nuclei. Proc. Natl. Acad. Sci. U.S.A. 79, 5137–5141.
Leclerc, I., Kahn, A., and Doiron, B. (1998). The 5’-AMP-activated protein
kinase inhibits the transcriptional stimulation by glucose in liver cells, acting
through the glucose response complex. FEBS Lett. 431, 180–184.
Li, X., Johnson, D. C., and Rozman, K. K. (1995a). Reproductive effects of
2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in female rats: Ovulation,
hormonal regulation, and possible mechanism(s). Toxicol. Appl. Pharmacol.
133, 321–327.
Li, X., Weber, L. W., and Rozman, K. K. (1995b). Toxicokinetics of 2,3,7,8tetrachlorodibenzo-p-dioxin in female Sprague-Dawley rats including
placental and lactational transfer to fetuses and neonates. Fundam. Appl.
Toxicol. 27, 70–76.
Liu, H., Biegel, L., Narasimhan, T. R., Rowlands, C., and Safe, S. (1992).
Inhibition of insulin-like growth factor-I responses in MCF-7 cells by
2,3,7,8-tetrachlorodibenzo-p-dioxin and related compounds. Mol. Cell.
Endocrinol. 87, 19–28.
Lochhead, P. A., Salt, I. P., Walker, K. S., Hardie, D. G., and Sutherland, C.
(2000). 5-aminoimidazole-4-carboxamide riboside mimics the effects of
insulin on the expression of the 2 key gluconeogenic genes PEPCK and
glucose-6-phosphatase. Diabetes 49, 896–903.
Loose, D. S., Cameron, S. K., Short, H. P., and Hanson, R. W. (1985). Thyroid
hormone regulates trascription of the gene for cytosolic phosphoenolpyruvate carboxykinase (GTP) in rat liver. Biochemistry 24, 4509–4512.
Lowe, W. L. (1991). Biologic actions of the insulin-like growth factors. In
Insulin-Like Growth Factors: Molecular and Cellular Aspects (D. LeRoith,
Ed.), pp. 48–85. CRC Press, Boca Raton, FL.
McCauley, V. M. (1992). Insulin-like growth factors and cancer. Br. J. Cancer
65, 311–320.
McConnell, E. E., Moore, J. A., Haseman, J. K., and Harris, M. W. (1978). The
comparative toxicity of chlorinated dibenzo-p-dioxins in mice and guinea
pigs. Toxicol. Appl. Pharmacol. 44, 335–356.
Minassian, C., Tarpin, S., and Mithieux, G. (1998). Role of glucose-6
phosphatase, glucokinase, and glucose-6 phosphate in liver insulin resistance
and its correction by metformin. Biochem. Pharmacol. 55, 1213–1219.
Mochizuki, H., Hakeda, Y., Wakatsuki, N., Usui, N., Akashi, S., Sato, T.,
Tanaka, K., and Kumegawa, M. (1992). Insulin-like growth factor-I supports
formation and activation of osteoclasts. Endocrinology 131, 1075–1080.
Moore, R. W., Parsons, J. A., Bookstaff, R. C., and Peterson, R. E. (1989).
Plasma concentrations of pituitary hormones in 2,3,7,8-tetrachlorodibenzop-dioxin-treated male rats. J. Biochem. Toxicol. 4, 165–172.
Muzi, G., Gorski, J. R., and Rozman, K. (1989). Mode of metabolism is altered
in 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-treated rats. Toxicol. Lett.
47, 77–86.
Neal, R. A., Beatty, P. W., and Gasiewicz, T. A. (1979). Studies of the
mechanisms of toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD).
Ann. N.Y. Acad. Sci. 320, 204–213.
TCDD AND HXCDD EFFECTS ON INSULIN-LIKE GROWTH FACTOR I
Pahlman, S., Meyerson, G., Lindgren, E., Schalling, M., and Johansson, I.
(1991). Insulin-like growth factor I shifts from promoting cell division to
potentiating maturation during neuronal differentiation. Proc. Natl. Acad.
Sci. U.S.A. 88, 9994–9998.
Paustenbach, D. J., Wenning, R. J., Lau, V., et al. (1992). Recent developments
on the hazards posed by 2,3,7,8-tetrachlorodibenzo-p-dioxin in soil:
Implications for setting risk-based cleanup levels at residential and industrial
sites. J. Toxicol. Environ. Health 36, 103–150.
Podoll, R. T., Jaber, H. M., and Mill, T. (1986). Tetrachlorodibenzodioxin:
Rates of volatilization and photolysis in the environment. Environ. Sci.
Technol. 20, 490–492.
Pohl, H. R. (2000). ATSDR Toxicological Profile for Chlorinated Dibenzo-pDioxins. Toxicol. Ind. Health 16, 87–201.
Ponticos, M., Lu, Q. L., Morgan, J. E., Hardie, D. G., Partridge, T. A., and
Carling, D. (1998). Dual regulation of the AMP-activated protein kinase
provides a novel mechanism for the control of creatine kinase in skeletal
muscle. EMBO J. 17, 1688–1699.
Potter, C. L., Sipes, I. G., and Russell, D. H. (1983). Hypothyroxinemia and
hypothermia in rats in response to 2,3,7,8-tetrachlorodibenzo-p-dioxin
administration. Toxicol. Appl. Pharmacol. 69, 89–95.
Rechler, M. M. (1993). Insulin-like growth factors and their binding proteins.
Vitam. Horm. 47, 1–114.
Rozman, K., Lebofsky, M., and Pinson, D. M. (2005). Chronic toxicity and
carcinogenicity of 1,2,3,4,6,7,8-heptachlorodibenzo-p-dioxin displays a
distinct dose/time toxicity threshold (c3t ¼ k) and a life-prolonging
subthreshold effect. Food Chem. Toxicol. (in press).
Rozman, K., Pfeifer, B., Kerecsen, L., and Alper, R. H. (1991). Is a serotonergic
mechanism involved in 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)induced appetite suppression in the Sprague-Dawley rat? Arch. Toxicol.
65, 124–128.
Rozman, K. K., Stahl, B. U., Kerecsen, L., and Kettrup, A. (1995). Comparative
toxicity of four chlorinated dibenzo-p-dioxins (CDDs) and their mixture. IV.
Determination of liver concentrations. Arch. Toxicol. 69, 547–551.
Ryan, J. J., Conacher, H. B. S., Panopio, L. G. et al. (1991). Gas
chromatographic separations of all 136 tetra- to octa- polychlorinated
dibenzo-p-dioxins and polychlorinated dibenzofurans on nine stationary
phases. J. Chromatogr. 541, 131–183.
Salt, I. P., Johnson, G., Ashcroft, S. J., and Hardie, D. G. (1998). AMP-activated
protein kinase is activated by low glucose in cell lines derived from
pancreatic beta cells, and may regulate insulin release. Biochem. J. 335(3),
533–539.
Sara, V. R., and Hall, K. (1990). Insulin-like growth factors and their binding
proteins. Physiol. Rev. 70, 591–614.
Shklyaev, S., Aslanidi, G., Tennant, M., Prima, V., Kohlbrenner, E.,
Kroutov, V., Campbell-Thompson, M., Crawford, J., Shek, E. W.,
Scarpace, P. J., et al. (2003). Sustained peripheral expression of transgene
adiponectin offsets the development of diet-induced obesity in rats. Proc.
Natl. Acad. Sci. U.S.A. 100, 14217–14222.
Stahl, B. U., Beer, D. G., Weber, L. W., and Rozman, K. (1993). Reduction of
hepatic phosphoenolpyruvate carboxykinase (PEPCK) activity by 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD) is due to decreased mRNA levels.
Toxicology 79, 81–95.
Stahl, B. U., Beer, D. G., Weber, L. W., Lebofsky, M., and Rozman, K. (1992).
Decreased hepatic phosphoenolpyruvate carboxykinase gene expression
after 2,3,7,8-tetrachlorodiebenzo-p-dioxin treatment: implications for the
acute toxicity of chlorinated dibenzo-p-dioxins in the rat. Arch. Toxicol.
Suppl. 15, 151–155.
Tannheimer, S. L., Ethier, S. P., Caldwell, K. K., and Burchiel, S. W. (1998).
Benzo[a]pyrene- and TCDD-induced alterations in tyrosine phosphorylation
571
and insulin-like growth factor signaling pathways in the MCF-10A human
mammary epithelial cell line. Carcinogenesis 19, 1291–1297.
Tuomisto, J. T., Pohjanvirta, R., Unkila, M., and Tuomisto, J. (1999). TCDDinduced anorexia and wasting syndrome in rats: Effects of diet-induced
obesity and nutrition. Pharmacol. Biochem. Behav. 62, 735–742.
Unkila, M., Pohjanvirta, R., and Tuomisto, J. (1995). Biochemical effects of
2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related compounds on the
central nervous system. Int. J. Biochem. Cell Biol. 27, 443–455.
Viluksela, M., Stahl, B. U., Birnbaum, L. S., and Rozman, K. K. (1998).
Subchronic/chronic toxicity of a mixture of four chlorinated dibenzo-pdioxins in rats. II. Biochemical effects. Toxicol. Appl. Pharmacol. 151,
70–78.
Viluksela, M., Stahl, B. U., Birnbaum, L. S., Schramm, K. W., Kettrup, A.,
and Rozman, K. K. (1997). Subchronic/chronic toxicity of 1,2,3,4,6,7,8heptachlorodibenzo-p-dioxin (HpCDD) in rats. Part I. Design, general
observations, hematology, and liver concentrations. Toxicol. Appl. Pharmacol. 146, 207–216.
Viluksela, M., Stahl, B. U., and Rozman, K. K. (1995). Tissue-specific
effects of 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) on the activity of
phosphoenolpyruvate carboxykinase (PEPCK) in rats. Toxicol. Appl.
Pharmacol. 135, 308–315.
Viluksela, M., Unkila, M., Pohjanvirta, R., Tuomisto, J. T., Stahl, B. U., Rozman,
K. K., and Tuomisto, J. (1999a). Effects of 2,3,7,8-tetrachlorodibenzop-dioxin (TCDD) on liver phosphoenolpyruvate carboxykinase (PEPCK)
activity, glucose homeostasis and plasma amino acid concentrations in the
most TCDD-susceptible and the most TCDD-resistant rat strains. Arch.
Toxicol. 73, 323–336.
Viluksela, M., Unkila, M., Pohjanvirta, R., Tuomisto, J. T., Stahl, B. U.,
Rozman, K. K., and Tuomisto, J. (1999b). Effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on liver phosphoenolpyruvate carboxykinase
(PEPCK) activity, glucose homeostasis and plasma amino acid concentrations in the most TCDD-susceptible and the most TCDD-resistant rat
strains. Arch. Toxicol. 73, 323–336.
Weber, L. W., Lebofsky, M., Greim, H., and Rozman, K. (1991a). Key enzymes
of gluconeogenesis are dose-dependently reduced in 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-treated rats. Arch. Toxicol. 65, 119–123.
Weber, L. W., Lebofsky, M., Stahl, B. U., Gorski, J. R., Muzi, G., and
Rozman, K. (1991b). Reduced activities of key enzymes of gluconeogenesis
as possible cause of acute toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin
(TCDD) in rats. Toxicology 66, 133–144.
Weber, L. W., Lebofsky, M., Stahl, B. U., Smith, S., and Rozman, K. K. (1995).
Correlation between toxicity and effects on intermediary metabolism in
2,3,7,8-tetrachlorodibenzo-p-dioxin-treated male C57BL/6J and DBA/2J
mice. Toxicol. Appl. Pharmacol. 131, 155–162.
Williams, G. T., Smith, C. A., Spooncer, E., Dexter, T. M., and Taylor, D. R.
(1990). Haemopoietic colony stimulating factors promote cell survival by
suppressing apoptosis. Nature 343, 76–79.
Wimmer, M. (1988). A bioluminescent assay for the determination of
phophoenolpyruvate carboxykinase activity in nanogram-sized tissue
samples. Anal. Biochem. 170, 376–381.
Winder, W. W., and Hardie, D. G. (1996). Inactivation of acetyl-CoA carboxylase and activation of AMP-activated protein kinase in muscle during
exercise. Am. J. Physiol. 270, E299–E304.
Winder, W. W., and Hardie, D. G. (1999). AMP-activated protein kinase,
a metabolic master switch: Possible roles in type 2 diabetes. Am. J. Physiol.
277, E1–E10.
Yamasaki, H., Prager, D., Gebremedhin, S., Moise, L., and Melmed, S. (1991).
Binding and action of insulin-like growth factor I in pituitary tumor cells.
Endocrinology 128, 857–862.