Immunization with HSV-2 gB-CCL19 Fusion
Constructs Protects Mice against Lethal
Vaginal Challenge
This information is current as
of June 16, 2017.
Yan Yan, Kai Hu, Xu Deng, Xinmeng Guan, Sukun Luo,
Lina Tong, Tao Du, Ming Fu, Mudan Zhang, Yalan Liu and
Qinxue Hu
Supplementary
Material
References
Subscription
Permissions
Email Alerts
http://www.jimmunol.org/content/suppl/2015/05/20/jimmunol.150019
8.DCSupplemental
This article cites 61 articles, 28 of which you can access for free at:
http://www.jimmunol.org/content/195/1/329.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2015 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
J Immunol 2015; 195:329-338; Prepublished online 20 May
2015;
doi: 10.4049/jimmunol.1500198
http://www.jimmunol.org/content/195/1/329
The Journal of Immunology
Immunization with HSV-2 gB-CCL19 Fusion Constructs
Protects Mice against Lethal Vaginal Challenge
Yan Yan,*,† Kai Hu,* Xu Deng,*,† Xinmeng Guan,*,† Sukun Luo,*,† Lina Tong,*
Tao Du,* Ming Fu,*,† Mudan Zhang,*,† Yalan Liu,* and Qinxue Hu*,‡
H
erpes simplex virus-2, the major cause of genital herpes,
is one of the most prevalent pathogens. HSV-2 is transmitted primarily through sexual contact and can cause
ocular disease, long-term neonatal neurologic sequelae, or even
mortality (1, 2), resulting in a significant financial burden on
health systems worldwide. HSV-2 infection can also increase the
risk for HIV-1 acquisition by $3-fold (3, 4). Despite intensive
studies over the last two decades, an effective vaccine against
HSV-2 has yet to be developed (5, 6).
HSV-2 glycoprotein B (gB) and glycoprotein D (gD) are the two
commonly used immunogens in the development of HSV-2 subunit
vaccines (5, 7–9). However, most findings suggested that one
glycoprotein or several glycoproteins in combination are still not
sufficient to induce effective immune responses against HSV-2
infection. One major limitation to subunit protein vaccines or
plasmid (p)DNA vaccines encoding such proteins is their poor im-
*State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy
of Sciences, Wuhan 430071, China; †University of Chinese Academy of Sciences,
Beijing 100049, China; and ‡Institute for Infection and Immunity, St. George’s
University of London, London SW17 0RE, United Kingdom
Received for publication January 26, 2015. Accepted for publication April 20, 2015.
This work was supported by National Natural Science Foundation of China Grant
81273250, Ministry of Science and Technology of China Grants 2010CB530100,
2013ZX10001005-003-002, and 2012ZX10001006-002, and the Hotung Trust.
Address correspondence and reprint requests to Prof. Qinxue Hu, State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences,
44 Xiaohongshan Zhongqu, Wuhan 430071, China. E-mail address: [email protected].
The online version of this article contains supplemental material.
Abbreviations used in this article: ASC, Ab-secreting cell; CTX, cholera toxin; DC,
dendritic cell; gB, glycoprotein B; gD, glycoprotein D; (G4S)2, (Gly4Ser)2; IZ,
GCN4-based isoleucine zipper trimerization domain; i.vag., intravaginally; MLN,
mesenteric lymph node; MLNL, MLN lymphocyte; p, plasmid.
Copyright Ó 2015 by The American Association of Immunologists, Inc. 0022-1767/15/$25.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.1500198
munogenicity compared with live-attenuated and inactivated viral
vaccines (5, 10, 11). Adjuvantation is one of the simplest, but most
effective, ways to improve the immunogenicity of vaccine candidates (5, 12). Components from the host immune system, such
as cytokines, chemokines, and other costimulatory self-molecules,
have received much attention as novel molecular adjuvants because of their essential roles in immunocyte differentiation, proliferation, expansion, maturation, and migration (13, 14). Among
these components, chemokines have been widely investigated because they can bridge innate and adaptive immunity and/or direct
the migration of immunocytes (14–17).
CCL19, a CCR7 ligand, is one of the key molecules in establishing functional microenvironments for the initiation of immune
responses in secondary lymphoid tissues (17, 18). CCL19, through
interactions with its cognate receptor CCR7, plays a pivotal role in
recruiting immunocytes, including T cells (16), B cells (19, 20),
and mature dendritic cells (DCs) (21–26), to secondary lymphoid
organs, such as endothelial venules of lymph nodes and Peyer’s
patches, as well as the T cell zones of spleen and lymph nodes (18,
19, 21, 26–30). The CCL19-CCR7 pathway is also important in
mediating lymphocyte colocalization and Ag-specific T cell activation (26), as well as in directing the differentiation of DCassisted B cells into Ab-secreting cells (ASCs) (16, 31). CCL19
as a molecular adjuvant was proved to be useful in several immunization models and is capable of promoting Ag-specific humoral and cellular immune responses in combination with vaccine
candidates, including HSV-1 gB (14), HIV-1 Env (16), pseudorabies virus gB (32), and HCV core DNA (30).
Given that the main function of chemokines is to modulate the
migration of responsive immunocytes, we hypothesized that fusion
of an immunogen with a chemokine may represent an effective
approach in enhancing Ag immunogenicity through directing the
candidate immunogen to immunocytes. It is generally accepted that
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
There is a lack of an HSV-2 vaccine, in part as the result of various factors that limit robust and long-term memory immune
responses at the mucosal portals of viral entry. We previously demonstrated that chemokine CCL19 augmented mucosal and systemic immune responses to HIV-1 envelope glycoprotein. Whether such enhanced immunity can protect animals against virus infection remains to be addressed. We hypothesized that using CCL19 in a fusion form to direct an immunogen to responsive
immunocytes might have an advantage over CCL19 being used in combination with an immunogen. We designed two fusion constructs, plasmid (p)gBIZCCL19 and pCCL19IZgB, by fusing CCL19 to the C- or N-terminal end of the extracellular HSV-2
glycoprotein B (gB) with a linker containing two (Gly4Ser)2 repeats and a GCN4-based isoleucine zipper motif for selfoligomerization. Following immunization in mice, pgBIZCCL19 and pCCL19IZgB induced strong gB-specific IgG and IgA in sera
and vaginal fluids. The enhanced systemic and mucosal Abs showed increased neutralizing activity against HSV-2 in vitro. Measurement of gB-specific cytokines demonstrated that gB-CCL19 fusion constructs induced balanced Th1 and Th2 cellular immune
responses. Moreover, mice vaccinated with fusion constructs were well protected from intravaginal lethal challenge with HSV-2.
Compared with pgB and pCCL19 coimmunization, fusion constructs increased mucosal surface IgA+ cells, as well as CCL19responsive immunocytes in spleen and mesenteric lymph nodes. Our findings indicate that enhanced humoral and cellular immune
responses can be achieved by immunization with an immunogen fused to a chemokine, providing information for the design of vaccines
against mucosal infection by HSV-2 and other sexually transmitted viruses. The Journal of Immunology, 2015, 195: 329–338.
330
HSV-2 gB-CCL19 DNA PROTECTS MICE AGAINST GENITAL HERPES
Ags fused to ligands of target cell surface molecules can facilitate
Ag uptake and presentation and, consequently, induce the activation of responsive immunocytes (33–37). Fusion of HIV-1 Env
to several cytokines, including APRIL, BAFF, CD40L, IL-12, and
GM-CSF, demonstrated improved immunogenicity of the DNA
vaccines (33, 35, 36). However, whether such enhanced immunogenicity can protect immunized animals against virus infection
remains to be fully addressed.
In this study, by using mice as a vaccination and challenge
model, we designed and constructed two DNA constructs encoding
GCN4-based isoleucine zipper trimerization domain (IZ)-linked
CCL19 and HSV-2 gB and further investigated the ability of gBCCL19 fusion constructs to induce protective immune responses
against HSV-2 infection in mice.
Western blotting, whereas CCL19 concentration was measured by ELISA
using commercial mouse CCL19 DuoSet ELISA kits (R&D Systems),
according to the manufacturer’s instructions.
SDS-PAGE, native PAGE, and Western blotting
293T cells were transfected with pgB, pgBIZCCL19, or pCCL19IZgB
for 48 h, and culture supernatants were harvested and resolved by 12%
denaturing SDS-PAGE and 4–15% continuous gradient native PAGE,
respectively. Subsequently, separated proteins were transferred onto
a polyvinylidene difluoride membrane, and gB-specific bands were
detected by Western blotting, according to a protocol described previously (9). gB 1-G-10 mAb (1:1000 dilution; Santa Cruz, sc-52425)
and H126 mAb (1:1000 dilution; Santa Cruz, sc-69799) followed by
HRP-labeled donkey anti-sheep IgG (1:5000 dilution; Santa Cruz)
were used for gB detection in SDS-PAGE and native PAGE, respectively. The colorimetric reaction was developed as described previously
(16, 39).
Immunizations and sampling
Plasmid construction
Mice (n = 10/group) were immunized using a “prime and boost” strategy
twice in a 2-wk interval, according to the immunization procedures shown
in Fig. 1D. For test groups, mice were immunized i.m. with 5 mg
pgBIZCCL19 or pCCL19IZgB. For control groups, mice were immunized
with 5 mg pgB or pgB plus pCCL19 at a 1:1 ratio. For the negative control
group, mice were immunized with 5 mg pcDNA3.1. Immunization was
carried out as described previously (16, 40). In brief, pDNAs were dissolved and mixed well in sterile saline solution in a total volume of 40 ml/
mouse and injected into the quadriceps muscles of one rear leg of each
mouse, followed by electroporation. Fourteen days postboost, peripheral
blood samples and vaginal fluids were collected. Forty-nine days postboost
(i.e., the day before virus challenge), peripheral blood samples also were
collected from fundus oculi. Sera were obtained from coagulated whole
blood by centrifugation (800 3 g, 15 min at room temperature). The
vaginal fluids were collected by washing the vagina three times with sterile
PBS plus protease inhibitors (Roche) in a total volume of 100 ml/mouse.
Vaginal fluids were centrifuged (12,000 3 g, 15 min at 4˚C), and supernatants were harvested. Supernatants of sera and vaginal fluids were aliquoted and stored at 280˚C until use.
pcDNA3.1 (+) (Invitrogen, Groningen, the Netherlands) was used as vector
for p construction, unless otherwise indicated. Murine pCCL19 was described previously (16). Truncated gB (730t; pgB) was amplified from the
HSV-2 genome (G strain; LGC Standards), as described previously (9),
and subcloned into pcDNA3.1 (+) (16). Truncated gB also was subcloned
into pET28a (Novagen; pET-gB) for prokaryotic expression. A linker
composed of IZ and (Gly4Ser)2 [(G4S)2] hydrophobic polypeptides
[(G4S)2-IZ-(G4S)2] was used in fusion constructs to promote gB trimerization (35), which was introduced between CCL19 and gB by splicing
overlap extension PCR (9). Two gB-CCL19 fusion constructs were generated, with CCL19 at the C- or N-terminal end (pgBIZCCL19 and
pCCL19IZgB, respectively) (Fig. 1A).
Mice, HSV-2, and cell lines
Six- to eight-week-old female BALB/c mice were purchased from Beijing
HFK Biotechnology (Beijing, China) and housed in specific pathogen–free
conditions, with sterile food and water supplied. All experimental procedures involving mice were approved by the Institutional Animal Care and
Use Committee and performed according to the guidelines of the Hubei
Laboratory Animal Science Association (Wuhan, China, Approval ID:
WIVA11201301). HSV-2 (G strain) was propagated and titrated on Vero
cells, as described previously (38). Virus stocks were aliquoted and stored
at 280˚C until use. Vero and 293T cells were purchased from the
American Type Culture Collection and cultured in DMEM (Invitrogen)
supplemented with 10% FBS (Invitrogen), penicillin (100 U/ml), and
streptomycin (100 mg/ml).
Prokaryotic expression and purification of gB
pET-gB was expressed in an Escherichia coli system (Rosetta strain;
Novagen) and purified as described previously with modifications (39).
Briefly, bacteria bearing pET-gB were induced for 4 h with isopropylb-D-thiogalactoside, and gB proteins were harvested from the insoluble
fraction of ultrasonic-treated bacteria by centrifugation (1200 3 g, 30 min at
4˚C). Insoluble gB proteins were subsequently denatured in denaturing
buffer (10 mM Tris, 500 mM NaCl, 6 M GuHCl, 5 mM DTT [pH 8]) for
14 h and refolded in refolding buffer (20 mM Tris·Cl, 500 mM NaCl, 3 mM
glutathione, 0.3 mM glutathione disulfide, 10% glycerol [pH 8]) for 24–48 h.
After refolding, the refolded gB in supernatants was loaded onto a preequilibrated nickel-charged chelating Sepharose Fast Flow column (GE
Healthcare). A six-His tag on the C-terminal end of gB facilitated the
purification of the complexes, followed by elution with imidazole buffer
(20 mM Tris·Cl, 500 mM NaCl, 3 mM glutathione, 0.3 mM glutathione
disulfide, 300 mM imidazole, 10% glycerol [pH 8]). Subsequently, purified gB was dialyzed against PBS and concentrated. Protein concentration was determined using a BCA Assay Kit (Pierce, Thermo
Scientific). The quality of purified gB was determined by SDS-PAGE and
Western blotting analysis. Purified products were aliquoted and stored
at 280˚C until use.
Expression analysis of fusion constructs
293T cells were transiently transfected with endotoxin-free pcDNA3.1,
pgB, pgB plus pCCL19, pgBIZCCL19, and pCCL19IZgB using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s instructions.
Forty-eight hours posttransfection, the protein-containing supernatants
were harvested for gB and CCL19 quantification. gB was detected by
Tissue harvesting
Mice were sacrificed by cervical dislocation at day 14 postboost. Spleens
and mesenteric lymph nodes (MLNs) were excised under sterile conditions,
and single-cell suspensions were obtained by passing tissue through a
70-mm Falcon cell strainer (BD Biosciences). Immunocytes were isolated
using Mouse 13 Lymphocyte Separation Medium, according to the
manufacturer’s instructions (Dakewe Biotech). RBCs were lysed using
RBC lysis buffer (Sigma-Aldrich). Purified viable cells were suspended in
complete RPMI 1640 medium and counted by a Bio-Rad Automated Cell
Counter.
Ag-specific and isotype Ig ELISAs
gB-specific IgG and IgA end point titers in sera and vaginal fluids were
measured by Ag-specific direct ELISA. Briefly, 96-well plates (Nunc
MaxiSorp; Thermo Scientific) were coated with purified gB (2 mg/ml,
50 ml/well) overnight at 4˚C, washed with wash buffer (PBS plus 0.05%
Tween-20), and blocked with blocking buffer (PBS plus 1% BSA).
Thereafter, plates were incubated with 3-fold serially diluted samples in
assay buffer (PBS plus 1% BSA and 0.05% Tween-20) at 37˚C for 1 h.
For IgG detection, plates were incubated with HRP-conjugated goat antimouse IgG at a dilution of 1:5000 (Abcam) at 37˚C for 1 h. For IgA
detection, plates were incubated with biotin-conjugated goat anti-mouse
IgA at a dilution of 1:5000 (Southern Biotechnology) and streptavidinHRP (R&D System) at a dilution of 1:200 at 37˚C for 1 and 0.5 h, respectively. After extensive washes, bound HRP conjugates were detected
by TMB-based colorimetric reaction for 5 min at room temperature and
stopped with 2 N H2SO4. The color intensity was read by an automated
ELISA reader (Tecan) at a test wavelength of 450 nm and a reference
wavelength of 570 nm. End point titers were calculated using GraphPad
Prism 6.0 software. Sample dilutions with an OD450 higher than the
OD450 of the negative control at the same dilution were considered
positive.
The subclasses of gB-specific Abs in immunized murine sera were
measured by HRP-conjugated anti-mouse IgG1, IgG2a, IgG2b, IgG3, and
IgM (Southern Biotechnology; 1:500 dilution in PBS plus 0.05% Tween20), according to the manufacturer’s instructions. Ab concentrations
were calculated based on standard curves.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
Materials and Methods
The Journal of Immunology
331
Virus-neutralization assay
The neutralizing activities of sera and vaginal fluids were tested using
a plaque assay, as described previously with modifications (41). Briefly,
heat-inactivated sera (56˚C for 1 h) were prepared in 2-fold serial dilutions
from 1:5 to 1:640 (post boost) or from 1:20 to 1:2560 (postchallenge) in
DMEM (without FBS). Vaginal fluids were prepared in 2-fold serial
dilutions from 1:5 to 1:40 (postboost) in DMEM (without FBS). The diluted samples in triplicates were subsequently incubated with 100 PFU/ml
HSV-2 for 1 h at 37˚C. Following incubation, sample–virus mixture was
applied to Vero cell monolayers grown in 48-well culture plate (preseeded
at 1.2 3 105/well 1 d before the assay). Cells receiving HSV-2 alone served
as positive controls, whereas cells in the absence of sample–virus mixture
were used as background controls. Sera from pcDNA3.1-immunized mice
at the same dilution were considered as controls of nonspecific backgrounds in inhibiting plaque formation. After incubation for 48 h, cells
were stained with crystal violet, and the plaques were counted for HSV-2
titration. The Ab-mediated neutralization activity was determined based on
the dilution titer that reduced the numbers of plaques by 50% compared
with the positive control and is expressed as the log10 of the dilution titer.
Cytokine assay
Splenocytes (1 3 107/well) were added to duplicate wells in 24-well plates
in a total volume of 1 ml complete RPMI 1640, with purified gB (1 mg/ml)
as stimuli, and cultured at 37˚C for 5 d. After incubation, cell culture
supernatants were filtrated and used for the detection of Th1/Th2 cytokines
(IL-2, IL-4, IL-5, IFN-g, and TNF). Analysis was performed with a BD
Cytometric Bead Array Mouse Th1/Th2 cytokine Kit (BD Biosciences),
according to the manufacturer’s instructions. Data acquisition was conducted on a BD FACSAria III platform and analyzed by FCAP Array
software 1.0.
Immunohistochemistry assay
Fourteen days postboost, murine colorectal samples were collected and
analyzed for IgA+ cell number by immunohistochemistry, in accordance
with the procedures described previously, with modifications (16). In brief,
an ∼2-cm segment from the anus end of each mouse was isolated, cut open
longitudinally, and fixed in neutral buffered formalin (diluted 1:10 in PBS)
for 24 h. After fixation, tissue was embedded and sectioned. Ag retrieval
was performed with Ag Retrieval Reagent Basic (R&D Systems),
according to the manufacturer’s instructions. For the detection of IgA+
cells, the slides were stained with goat anti-mouse IgA Ab (AbD Serotec)
at a dilution of 1:400 overnight at 4˚C, followed by incubation with the
Polink-2 Plus Polymer HRP Detection System for Goat Primary Ab (GBI),
according to the manufacturer’s instructions. Color reaction was developed
with the addition of 3, 39-diaminobenzidine free base, followed by counterstaining with hematoxylin.
Chemotaxis assay
A chemotaxis assay was performed using a microchamber Transwell system
with 3-mm pores (Corning Costar). Purified splenocytes and MLN lymphocytes (MLNLs; 2 3 106/well in 100 ml complete RPMI 1640 medium)
were plated in triplicates in the upper chambers, whereas 600 ml complete
RPMI 1640 medium, with or without (negative control) 30 ng/ml CCL19
(R&D Systems), was added to the lower chambers. Plates were incubated
for 2 h in a 5% CO2 incubator at 37˚C, and the number of migrated cells
was counted by a Bio-Rad Automated Cell Counter. Data were expressed
as fold change in migration (migrated cell number in testing wells/
migrated cell number in negative control wells).
Challenge, scoring, and virus DNA quantification
Five to seven days prior to challenge, vaccinated mice were injected s.c. in
the neck ruff with Depo-Provera (medroxyprogesterone acetate, 2 mg/
mouse). Forty-nine days postboost, mice (n = 10/group) were anesthetized with pentobarbital sodium and challenged intravaginally (i.vag.) with
10 ml/mouse HSV-2 (G strain) at a concentration of 2.4 3 107 PFU/ml.
The sera were collected on days 5, 9, and 11 postchallenge for virusneutralization assays, and vaginal fluids were collected on days 1, 3, 5, 7,
9, 11, and 15 postchallenge for detection of virus shedding. Virus titers of
vaginal fluids were determined by plaque assay on Vero cell monolayers,
as described previously (42). Infected mice were monitored daily for
weight loss, vaginal inflammation, and death and scored according to the
5-point scale reported by Toka et al. (14): 0, no apparent infection; 1, mild
inflammation of the external genitals; 2, redness and moderate swelling of
external genitals; 3, severe redness and inflammation; 4, genital ulceration
and severe inflammation; and 5, hind limb paralysis and death. Thirty days
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 1. Design and expression of HSV-2 gB-CCL19 fusion constructs and immunization schedule. (A) Schematic representation of the pgBIZCCL19
and pCCL19IZgB constructs. The fusion linker contains an IZ and two (G4S)2 motifs for trimerization and stabilization. (B) Expression analysis of gB.
Supernatants from 293T cells transfected with the indicated constructs were collected and resolved by denatured SDS-PAGE and native PAGE, followed by
Western blotting. (C) Expression analysis of CCL19. Supernatants from 293T cells transfected with the indicated constructs were collected and analyzed by
ELISA. Culture supernatants from pcDNA3.1 transfected cells were used as negative controls. Data are mean 6 SEM of at least three independent
experiments, performed in triplicate for each condition. (D) Intramuscular immunization and i.vag. challenge schedule. Mice were immunized twice with
pcDNA3.1, pgB, pgB plus pCCL19, or gB-CCL19 fusion constructs in saline solution at days 0 and 14. Fourteen days postboost, all mice were sampled.
Forty-nine days postboost, some mice were sacrificed for tissue collection, whereas the rest were used for the challenge experiments. Postchallenge, the
weight and clinical symptoms of all mice were monitored every day for 15 d. Sera, vaginal fluids, and sacral ganglia were collected for subsequent tests.
332
HSV-2 gB-CCL19 DNA PROTECTS MICE AGAINST GENITAL HERPES
postchallenge or on the day of animal death, the sacral ganglia of each
mouse was collected for the detection of latent viral DNA load using
a quantitative real-time PCR assay. DNA was isolated with DNeasy blood
and tissue kits (QIAGEN) and stored at 220˚C until analysis. Copies of the
HSV-2 genome were quantified by probe quantitative PCR with Premix
Ex Taq (TaKaRa) on a Roche LightCycler 480, according to the manufacturer’s instructions. The following primers were used for the amplification reactions: 59gG-356 (59-GCCTGCCGTCAGCCCATCCTCCT-39),
39gG-508 (59-TCGGCACCAGCAGGGAAGCATTT-39), and probe 59(FAM) CCTTCGGCAGTATGGAGGGTGTCGC (TAMRA)-39. A standard DNA was used to determine copy numbers, as described previously
(41). All samples were tested in triplicates.
Statistical analysis
Data are presented as mean 6 SEM. Comparisons between two groups
were analyzed by the Student t test, whereas comparisons among more
than three groups were analyzed by one-way ANOVA with Newman–Keuls
multiple comparison analysis. The p values , 0.05 were considered statistically significant.
Results
Design and expression of gB-CCL19 fusion constructs
FIGURE 2. Induction of systemic and mucosal
Ab responses against gB. Mice were immunized
i.m. at days 0 and 14 with electroporation. At day 14
postboost, sera and vaginal fluids were collected,
and end point titration of gB-specific IgG and IgA
was determined by direct ELISA. Data are mean 6
SEM (n = 10 mice/group) of three independent
experiments, performed in duplicate for each condition. *p , 0.05, **p , 0.01, ***p , 0.001. NS,
not statistically significant.
gB-CCL19 fusion constructs enhance gB-specific systemic and
mucosal Ab responses
To investigate whether CCL19 in gB-encoding fusion constructs
could augment gB-specific humoral immune responses, mice were
immunized with pgB, pgBIZCCL19, or pCCL19IZgB or coimmunized with pgB and pCCL19, using the “prime and boost”
strategy, at 2-wk intervals. Sera and vaginal fluids were collected
for gB-specific IgG and IgA titration. As shown in Fig. 2, coimmunization of pgB with pCCL19 enhanced the levels of gB-specific
serum IgA and vaginal IgG and IgA, but not serum IgG, whereas
immunization with gB-CCL19 fusion constructs pgBIZCCL19 and
pCCL19IZgB further elevated gB-specific IgG and IgA levels in both
sera and vaginal fluids. In general, pgBIZCCL19 and pCCL19IZgB
showed a comparable ability to enhance gB-specific immune responses in serum and mucosal sites.
gB-CCL19 fusion constructs augment a Th1-biased gB-specific
Ab response
It was described that DNA vaccines tend to induce a Th2-biased Ab
response (43), with IgG1, but not IgG2a or IgG2b, predominant in
HSV-2 gB-vaccinated mice (44). To test whether CCL19 in fusion
constructs was functional in modulating the isotypes of Ab
responses, four gB-specific IgG subtypes (IgG1, IgG2a, IgG2b,
IgG3) and IgM subtype in sera collected at 2 wk postboost were
examined. Among the four IgG subtypes in mice, IgG1 is associated with a Th2 profile, whereas the other subtypes are associated with a Th1 profile (45). As shown in Fig. 3, coimmunization of
pgB with pCCL19 augmented IgG2a, whereas the levels of IgG1,
IgG3, IgG2b, and IgM were similar to those in mice immunized
with pgB alone. However, immunization with the two gB-CCL19
fusion constructs elicited robust Ab responses to gB compared with
coimmunization of pgB with pCCL19, and it significantly enhanced
the levels of gB-specific IgG2a, IgG2b, IgG3, and IgM but did not
show an apparent impact on the levels of IgG1. Taken together,
these results indicate that CCL19 is capable of regulating the gBinduced Ab response to a Th1-biased profile, and such regulation
can be enhanced when CCL19 is fused to gB.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
We constructed two fusion constructs, pgBIZCCL19 and
pCCL19IZgB, by fusing CCL19 to the C- and N-terminal ends of
HSV-2 gB (730t), respectively, with a flexible GCN4-based isoleucine zipper linker being used to facilitate protein folding and
trimerization. Expression analysis of these two constructs was
performed by Western blotting (gB) and ELISA (CCL19). Western
blotting results showed that pgBIZCCL19 and pCCL19IZgB were
successfully secreted in the culture medium to a similar level. SDSPAGE analysis demonstrated that denatured gB and gB-CCL19
fusion proteins (expressed by pgBIZCCL19 and pCCL19IZgB)
migrated at the expected apparent molecular masses ∼94 and ∼108
kDa, respectively (Fig. 1B). Native PAGE analysis demonstrated
that gB-CCL19 fusion proteins appeared to be oligomeric, similar
to gB protein (9) (Fig. 1B). ELISA results showed that CCL19
was successfully expressed by both fusion constructs, although the
expression levels of the fusion constructs appeared to be slightly
lower than those in cells transfected with pgB plus pCCL19
(Fig. 1C). The expression difference detected in CCL19 ELISA was
likely due to the possibility that the CCL19 Ab is not able to access
some of the epitopes in the gB-CCL19 fusion proteins. Neverthe-
less, altogether, our results indicate that the flexible linker between
gB and CCL19 can enable the correct expression of both moieties.
The Journal of Immunology
333
indicate that fusion of gB to CCL19 can enhance neutralizing
systemic and mucosal Ab responses; such enhancement is sustainable and can be immediately recalled upon HSV-2 infection.
gB-CCL19 fusion constructs induce balanced Th1 and Th2
cellular immune responses
FIGURE 3. gB-specific Ig subclasses in murine sera. The distribution of
gB-specific IgG1, IgG2a, IgG2b, IgG3, and IgM isotypes in immunized
murine sera was quantified by ELISA. The titer of each Ig subclass was
calculated according to the standard curve obtained using the corresponding standard Ig subclass. Data are mean 6 SEM (n = 10 mice/group)
of three independent experiments, performed in duplicate for each condition. *p , 0.05, **p , 0.01, ***p , 0.001. NS, not statistically significant.
It was well documented in animal models that an efficacious
prophylactic HSV-2 vaccine will most likely induce a robust
neutralizing-Ab response (11, 41, 46). Having demonstrated that
fusion of CCL19 to gB at either end could significantly augment
systemic and mucosal Ab responses to gB, we assessed the neutralizing activity of sera collected at days 14 and 49 postboost and
at days 5, 9, and 11 postchallenge, as well as vaginal fluids tested
at day 14 postboost. As shown in Fig. 4, the neutralizing activities
of sera and vaginal fluids against HSV-2 were significantly enhanced at day 14 in all CCL19-immunized mice postboost, with
gB-CCL19 fusion constructs demonstrating a significantly stronger ability to induce anti–HSV-2–neutralizing activity in both sera
and vaginal fluids compared with pgB plus pCCL19. The neutralizing activity of sera remained apparent until at least day 49
postboost, suggesting that a sustained neutralizing-Ab response
was elicited by vaccination with gB-CCL19 fusion constructs,
with pCCL19IZgB exhibiting slightly stronger neutralizing activity than pgBIZCCL19. In addition, the neutralizing activity
was rapidly recalled at day 5 postchallenge, peaked at day 9, and
remained constant until at least day 11. In contrast, the neutralizing activity of sera from pgB- or pgB plus pCCL19–immunized
mice was lower than that of mice immunized with fusion constructs and declined at day 11 postchallenge. Moreover, the neutralizing activity of sera postchallenge declined sharply in mice
immunized with pgB plus pCCL19. Taken together, our results
gB-CCL19 fusion constructs increase responsive immunocytes
in secondary lymph nodes and mucosal sites
The results above revealed that CCL19 could enhance gB-specific
systemic and mucosal Ab responses, as well as balanced Th1- and
Th2-like cellular responses. Furthermore, the enhanced immune
response could be increased when CCL19 was fused to gB at either
terminal. We further investigated the potential mechanisms underlying such immune enhancement. It is known that CCL19 can
chemoattract CCR7-expressing immunocytes into certain effector
sites or recruit IgA+ cells to colorectal mucosal sites (16, 31).
Given that IgA constitutes the main Ab immune response against
pathogens at mucosal sites and that a significant Ab increase was
observed in our study when gB-CCL19 fusion constructs were
used to immunize mice, we examined whether the CCL19induced Ab elevation at mucosal sites correlated with the increased number of IgA+ cells. Immunohistochemical analysis of
colorectal samples revealed that, compared with those in pgB-
FIGURE 4. Anti–HSV-2–neutralizing activity of murine sera and vaginal fluids. Anti–HSV-2–neutralizing activity of sera collected at the indicated times
was tested at the dilution starting with 1:5 (at days 14 and 49 postboost) and 1:20 (at days 5, 9, and 11 postchallenge), whereas that of vaginal fluids
collected at day 14 postboost was tested at the dilution starting with 1:5. Plaque numbers were determined for each sample and plotted as the percentage of
inhibition. Data are mean 6 SEM (n = 10 mice/group) of three independent experiments, performed in duplicate for each condition. *p , 0.05, **p , 0.01,
***p , 0.001. NS, not statistically significant.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
gB-CCL19 fusion constructs promote an enhanced virusneutralizing response
In vivo, CCL19 functions as a key regulator on the migration of
T cells and DCs. In this regard, following CCL19 immunization,
T cell–mediated immune responses might be upregulated more
directly than humoral responses (16, 30). Given the central roles
of cytokines secreted by activated immunocytes in defining the
subsequent immune response, we evaluated gB-specific Th1- and
Th2-like cellular immune responses by measuring the production
of Th1-associated (IL-2, TNF, IFN-g) and Th2-associated (IL-4,
IL-5) cytokines. Splenocytes collected from immunized mice at
day 14 postboost were analyzed. As shown in Fig. 5, gB seemed to
induce a Th1-dominant cellular response, with the levels of IFN-g
and TNF being significantly higher than those of the other three
cytokines. Notably, pgB coimmunization with pCCL19 significantly elevated the production of IL-4, IL-5, IFN-g, and TNF,
and the production of these cytokines was further increased in
pgBIZCCL19- or pCCL19IZgB-immunized mice. In contrast,
samples from the control group (pcDNA3.1) demonstrated very
low levels of cytokine background, with IL-2, IL-4, and IL-5
below the limits of detection. In general, these results indicate
that CCL19 enhances balanced Th1- and Th2-like gB-specific
T cell responses, and the enhancement can be strengthened when
CCL19 and gB are used in a fusion form.
334
HSV-2 gB-CCL19 DNA PROTECTS MICE AGAINST GENITAL HERPES
immunized mice, IgA+ cells were significantly increased in mice
coimmunized with pgB and pCCL19, whereas the cell number
was further increased almost 1.8-fold in mice immunized with
pgBIZCCL19 or pCCL19IZgB compared with pgB-immunized
mice (Fig. 6A, 6B). Notably, these results were in agreement
with the difference in gB-specific Ab levels at mucosal sites, with
both gB-CCL19 fusion constructs showing a comparable ability to
increase IgA+ cells in colorectal mucosal sites, reflecting an enhanced mucosal immune response.
The interaction between CCL19 and CCR7 is an essential
process controlling the migration of CCR7+ immunocytes into
lymph nodes where immune responses are initiated (24). We
conducted assays to determine whether CCL19 fused to gB was
gB-CCL19 fusion constructs protect mice against lethal HSV-2
infection
Mucosal responses against HSV-2 are likely to be critical for protection because mucosal sites are the principal portals of HSV-2
sexual transmission. To test whether the gB-CCL19 fusion constructs can establish efficient immune defense against HSV-2 mucosal infection, immunized mice were challenged i.vag. with a
lethal dose of HSV-2 at day 49 postboost. Thereafter, virus shedding, latent virus DNA load, development of clinical symptoms,
and weight change were monitored.
Virus shedding. As shown in Fig. 7A, virus loads in vaginal fluids
were detectable but dropped sharply on a daily basis in all groups.
At the same tested time points, virus shedding was highest in the
negative control group and moderate in the pgB group and the
pgB plus pCCL19 group, whereas the lowest virus load was
detected in the pgBIZCCL19 and pCCL19IZgB groups. Moreover, mice in the negative control group were all dead before
day 13 postchallenge, whereas those from other groups survived, and virus loads in vaginal fluids dropped to levels under
FIGURE 6. The chemotactic activity of CCL19. (A and B) IgA+ cell number at the colorectal mucosal sites of immunized mice. Mouse colorectal
samples were collected at day 14 postboost, and IgA+ cells were detected by immunohistochemistry. The colorimetric reaction was developed with the
addition of diaminobenzidine and counterstained with H&E. (A) Representative results (original magnification 3200). (B) Quantification of IgA+ cells by
counting five high-power fields for each mouse. Data are mean 6 SEM. (C) Migration of splenocytes and MLNLs from immunized mice in response to
murine CCL19. Single cells were prepared and counted to assess chemotactic response to CCL19 using a Transwell system. The migrated cells in lower
chamber were counted after a 2-h incubation. Fold change was calculated compared with the cell number in the lower chamber without CCL19. Data in (B)
and (C) are mean 6 SEM for each group (n = 5 mice/group). **p , 0.01, ***p , 0.001.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 5. gB-specific Th1/Th2-associated cytokine production.
Splenocytes (1 3 107 cells) isolated from all groups were stimulated with
purified gB (1 mg/ml) and cocultivated for 5 d. After incubation, the
production of Th1-associated (IL-2, IFN-g, TNF) and Th2-associated (IL4, IL-5) cytokines was quantified by CBA. Data are mean cytokine concentration (pg/ml) 6 SEM (n = 5 mice/group). *p , 0.05, ***p , 0.001.
NS, not statistically significant,
functional in directing the migration of CCR7+ immunocytes to
spleen and mucosa-related draining lymph nodes (MLNs). Freshly
isolated splenocytes and MLNLs from immunized mice were
examined to assess their ability to migrate to murine CCL19
protein. As shown in Fig. 6C, compared with pgB alone, immunization with pgB plus pCCL19, pgBIZCCL19, or pCCL19IZgB
resulted in ∼1.5-, 2.1-, and 1.8-fold increases, respectively, in
CCR7+ immunocytes in spleen, as well as ∼2.1-, 2.6-, and 3.1-fold
increases, respectively, in MLNs. In general, coimmunization with
pgB and pCCL19 consistently resulted in a significantly higher
level of CCR7+ immunocyte influx into spleen compared with pgB
alone but a significantly lower level of influx into spleen and MLNs
compared with fusion constructs (Fig. 6C). These results were
consistent with the findings that gB fused to CCL19 enhanced the
numbers of IgA+ plasma cells in colorectal mucosal sites.
The Journal of Immunology
335
FIGURE 7. Protection of immunized mice against
lethal vaginal HSV-2 challenge. Forty-nine days postboost, mice were challenged i.vag. with a lethal dose of
HSV-2. (A) Virus shedding at the indicated time points
in vaginal fluids was tested by plaque assay. The
dashed line represents the detection limit. (B) Latent
virus DNA load was quantified in sacral ganglia by
real-time PCR at day 30 after challenge or on the day
of death. Number 3 ND indicates that the number of
mice in which no virus was detected or was below the
detection limit. Weight loss (C) and disease severity
(D) were monitored on a daily basis for 15 d. Data are
mean 6 SEM (n = 9–14 mice/group) of results pooled
from three independent experiments. *p , 0.05, **p ,
0.01, ***p , 0.001. NS, not statistically significant.
acute symptoms began to appear on day 5. Mice with pcDNA3.1
immunization developed severe symptoms rapidly and were dead
by day 13. All mice with pgB immunization also developed severe,
but relatively milder, symptoms, whereas approximately half of the
mice coimmunized with pgB and pCCL19 demonstrated mild
disease symptoms. Of note, mice immunized with pgBIZCCL19 or
pCCL19IZgB, unlike other groups, did not show any apparent
symptoms postchallenge (Fig. 7D).
Overall, our study indicated that CCL19 as adjuvant promoted humoral and cellular responses against HSV-2 gB in a balanced Th1/Th2 cellular response fashion, as well as enhanced the
clearance of latent virus load. Moreover, the adjuvant activity of
CCL19 was enhanced significantly when fused to gB at either
terminal. Our results further strengthen the notion that the adjuvant
activity of CCL19 is likely due to its ability to target immunogen to
immunocytes through the promotion of the migration of responsive
immunocytes.
Discussion
Given that several HSV-2 glycoprotein-based subunit vaccines
failed to show enough protection against viral infection in largescale clinical trials (47, 48), there is a need to develop new
immunization strategies. Among various means of improving
vaccine efficacy, the adoption of adjuvants to promote Ag immunogenicity is one of the simple, yet most effective, ways (5,
12). CCL19 was shown to potentiate both cellular and humoral
Table I. HSV-2 shedding incidences in HSV-2–challenged mice
No. (%) of Mice Challenged with HSV-2 and Virus Shedding Incidences
Group
Total No. Animals
pcDNA3.1
pgB
pgB + pCCL19
pgBIZCCL19
pCCL19IZgB
14
12
11
12
12
Day 1
14
12
11
12
12
(100)
(100.0)
(100)
(100)
(100)
Day 3
14 (100)
12 (100)
11(100)
11 (91.7)
11 (91.7)
Day 5
14
10
3
4
6
(100)
(83.3)
(27.3)
(33.3)
(50.0)
Day 7
Day 9
Day 11
Day 15
–
2 (16.7)
ND
3 (25.0)
ND
–
ND
ND
ND
ND
–
ND
ND
ND
ND
–
2 (16.7)
2 (18.2)
ND
ND
HSV-2 shedding incidences in vaginal fluids were detected by real-time PCR. Data shown are pooled from three independent experiments.
HSV-2 shedding incidence = (no. vaginal fluids from which viral DNA was detected/total number of vaginal fluids analyzed) 3 100.
ND, no virus detected; –, severe disease or death.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
the detection limit from days 7 to 9. Of note, virus reshedding
was observed at day 15 in the pgB group and mice coimmunized with pgB and pCCL19 (Fig. 7A). HSV-2 shedding incidences in vaginal fluids are summarized in Table I, and similar
tendencies were observed. From day 9 postchallenge, there was
no detectable viral DNA in mice immunized with gB-CCL19
fusion constructs.
Latent virus DNA load. The copies of latent HSV-2 genomes in
sacral ganglia of mice were quantified by real-time PCR at day 30
postchallenge or at the time of death. Latent HSV-2 genome copies
from high to low were pcDNA3.1, pgB, pgB plus pCCL19,
pgBIZCCL19 and pCCL19IZgB groups, indicating that CCL19enhanced gB-specific responses could, to some extent, prevent
HSV-2 from establishing latent infection and/or clear established
infection (Fig. 7B).
Weight change. Upon HSV-2 challenge, mouse weight was
monitored every day for a total period of 15 d. Mice immunized
with pcDNA3.1 exhibited considerable weight loss after day 1
postchallenge, and an even sharper loss was observed from day 5
on. Mice immunized with pgB or pgB plus pCCL19 also demonstrated mild weight loss. In contrast, mice immunized with
pgBIZCCL19 or pCCL19IZgB exhibited no apparent weight loss
postchallenge. Rather, a slight weight gain was observed in mice
immunized with pCCL19IZgB (Fig. 7C).
Acute disease severity. Upon viral challenge, the symptoms in
mice were scored every day for a total period of 15 d. For all mice,
336
HSV-2 gB-CCL19 DNA PROTECTS MICE AGAINST GENITAL HERPES
against mucosally transmitted viruses like HSV-2, a strong and
rapid mucosal response, especially an Ab response, is required,
which can be achieved by a good memory B cell response (47,
55). Findings from the study of gD-specific immune response in
guinea pigs demonstrated that IgG2a contributed to a potent
neutralizing ability against HSV-2 (46). However, it was reported
that only a small number of HSV-2 patients had IgG2 compared
with IgG1 and IgG3 (56, 57). Therefore, a novel means is needed
to enhance an IgG2 Ab response. In our study, we found that gBCCL19 fusion constructs consistently induced an IgG2-biased
immune profile better than did pgB alone. In agreement, a humoral immune response with relatively potent neutralization activity was achieved by immunization with the fusion constructs.
Such an immune response was sustained and rapidly recalled
postchallenge, likely reflecting the increase in B cell differentiation. In contrast, we observed that the neutralizing activity of sera
declined rapidly in mice coimmunized with pgB and pCCL19
compared with that in mice immunized with gB-CCL19 fusion
constructs. Likewise, gB-CCL19 fusion constructs demonstrated
an advantage over pgB plus pCCL19 in protecting mice from
HSV-2 challenge.
Th1/Th2 cytokines, secreted by activated immunocytes postimmunization or challenge, play a pivotal role in controlling HSV-2
infection and disease progression in animal models (14, 46). In
this study, we found that CCL19 as adjuvant promoted a balanced
gB-specific Th1/Th2 response, including increased production of
IL-4, IL-5, IFN-g, and TNF. Moreover, gB-CCL19 fusion constructs demonstrated the ability to enhance the production of these
cytokines. Nevertheless, in all immunized mice, the levels of IL-2
and IL-4 appeared to be significantly lower than those of other
cytokines, whereas the levels of IFN-g and TNF were high. In
agreement with our findings, a previous study showed that the
expression of IL-2 was lower than that of IFN-g upon gB stimulation (58). As for IL-4, although the underlying mechanism
remains to be further elucidated, it was reported that types I and II
IFN can inhibit the expression of IL-4 (59). Previous studies by us
(16) and other investigators (19–25) showed that the adjuvant
effect of CCL19 is associated with its ability to recruit responsive
T cells, DCs, and IgA ASCs to secondary lymph nodes and mucosal tissues. In the current study, we revealed that gB-pCCL19
fusion constructs, in comparison with coimmunization with pgB
and pCCL19, exhibited a stronger ability to increase CCR7+
immunocytes in secondary lymph nodes and IgA+ cells in mucosal
sites and, consequently, resulted in enhanced immune responses.
We speculated that, although CCL19 in combination with gB
achieved an enhanced immune response over gB used alone, there
was no guarantee that the two moieties could act simultaneously
on immune cells. In contrast, fusion constructs have the advantage
that both moieties act on the same immune cells. We found that
the enhanced immune responses by gB-CCL19 fusion constructs
were associated with an enhanced protection against lethal HSV-2
infection, as well as an improved elimination of latent viruses. Our
findings highlight the application potential of gB-CCL19 fusion
forms over single agents being used in combination.
It is of interest that delivery of pCCL19 via the muscle surface
can attract immunocytes into remote secondary lymphoid organs,
such as spleen and MLNs. Previous studies by us (16) and other
groups (60, 61) demonstrated that intranasally and i.m. administered pDNAs are distributed throughout the body, probably via the
bloodstream. In the currently study, our data also showed that the
DNA, DNA-transcribed RNA, and protein forms of the immunized fusion constructs were detected in blood, spleen, and MLNs,
with CCL19 being elevated in mice vaccinated with gB-CCL19
fusion constructs (Supplemental Fig. 1), suggesting that the
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
responses to immunogens in mice (16, 49), representing a promising molecular adjuvant. In the current study, we designed
and evaluated a novel HSV-2 gB-CCL19 fusion construct using
CCL19 as the adjuvant, showing that immunization with the fusion constructs enhanced Ag-specific systemic and mucosal Ab
responses, as well as balanced Th1/Th2 cellular responses. Moreover, these enhanced responses protected mice against a lethal
dose of HSV-2. Such enhancement of Ag-specific immune responses appeared to be associated with the activation of an expanded pool of immune memory cells, likely resulting from the
migration of CCL19-responsive IgA ASCs into mucosal sites
and CCR7+ immunocytes into secondary lymph nodes and mucosal tissues.
It was reported that HSV-2 gD (1–23) peptide conjugated to
cholera toxin (CTX) enhanced Ab responses and elicited protective antiviral immunity (50). In agreement, covalent linkage of an
immunogen to CTX appeared to be more effective in enhancing
Ag-specific immune responses than was a simple mixture of the
immunogen and CTX (51). In addition, CCL19 fused to IgG2b
possesses a long-lasting potent chemotactic activity, as a result of
the extended half-life of the fusion protein (29). Together, these
findings suggest that an immunogen fused to an adjuvant may
offer better efficacy than an immunogen and an adjuvant being
used in combination. When designing such fusion constructs,
several factors should be taken into consideration. First of all, the
function and structure of both moieties in the fusion protein
should be maintained. To achieve this, a linker with proper length
and structure is essential. An IZ linker has been commonly used
for trimerization of fusion proteins, which has proven to be feasible in sustaining antigenic structure, thermal stability, and solubility (35, 36, 52, 53). Moreover, fusion proteins using an IZ
linker do not bind to FcRs, which could avoid the generation of
autoimmune Abs (54), whereas the G4S repeat is a linker with
flexibility to allow both moieties to fold properly. In the current
study, we found that some linkers favored the enhancement of
immune responses, whereas others hindered such enhancement
and sometimes even impaired Ag-induced immune responses. To
this end, we tested gB-CCL19 constructs without a linker, with
a (G4S)4 repeat linker, or with a linker containing two G4S repeats
and one IZ sequence [(G4S)2-IZ-(G4S)2]. Our results showed that
only gB-CCL19 constructs with the (G4S)2-IZ-(G4S)2 linker were
capable of enhancing immune responses (Fig. 2 and Y. Yan, K. Hu,
and Q. Hu, unpublished observations). In addition to the linker, the
construction order of the fusion proteins may affect protein activity (34, 54). We demonstrated that fusion constructs with
CCL19 at the N- or C- terminal end had comparable abilities to
enhance immune responses. Compared with the use of pgB and
pCCL19 in combination, fusion constructs (pgBIZCCL19 and
pCCL19IZgB) enhanced gB-specific responses, likely via the
following mechanisms. In contrast to gB and CCL19 being expressed in different vectors, construction of gB and CCL19 in the
same vector guaranteed their simultaneous expression in terms of
time and location. When responsive immunocytes were recruited
to the sites where CCL19 was expressed, a more efficient Ag–
immunocyte interaction might be achieved, consequently resulting
in enhanced immune responses.
It is generally accepted that an ideal HSV-2 vaccine should be
capable of protecting individuals against new infection, sterilizing
circulating viruses in infected individuals, and eliminating latent
viral reservoirs (11, 41, 46). We demonstrated that HSV-2 gBCCL19 fusion constructs were highly effective in inducing systematic immune responses, in particular a Th1-based Ab response,
which was different from the immune profile induced by HSV-2
gB alone (44). In addition, to function as a preventive vaccine
The Journal of Immunology
Acknowledgments
We thank Xuefang An and Jimei Tao (Core Facility and Technical Support
of Wuhan Institute of Virology) and Yan Wang (Institute of Hydrobiology)
for assistance with animal studies and flow cytometry analysis.
Disclosure
The authors have no financial conflicts of interest.
References
1. Kimberlin, D. W., and J. Baley, Committee on infectious diseases, Committee on
fetus and newborn. 2013. Guidance on management of asymptomatic neonates
born to women with active genital herpes lesions. Pediatrics 131: e635–e646.
2. Zhu, L., and H. Zhu. 2014. Ocular herpes: the pathophysiology, management and
treatment of herpetic eye diseases. Virol. Sin. 29: 327–342.
3. del Mar Pujades Rodrı́guez, M., A. Obasi, F. Mosha, J. Todd, D. Brown,
J. Changalucha, D. Mabey, D. Ross, H. Grosskurth, and R. Hayes. 2002. Herpes
simplex virus type 2 infection increases HIV incidence: a prospective study in
rural Tanzania. AIDS 16: 451–462.
4. Mahiane, S. G., C. Legeai, D. Taljaard, A. Latouche, A. Puren, A. Peillon,
J. Bretagnolle, P. Lissouba, E. P. Nguema, E. Gassiat, and B. Auvert. 2009.
Transmission probabilities of HIV and herpes simplex virus type 2, effect of male
circumcision and interaction: a longitudinal study in a township of South Africa.
AIDS 23: 377–383.
5. Zhu, X. P., Z. S. Muhammad, J. G. Wang, W. Lin, S. K. Guo, and W. Zhang.
2014. HSV-2 vaccine: current status and insight into factors for developing an
efficient vaccine. Viruses 6: 371–390.
6. Cohen, J. 2010. Immunology. Painful failure of promising genital herpes vaccine. Science 330: 304.
7. Awasthi, S., J. W. Balliet, J. A. Flynn, J. M. Lubinski, C. E. Shaw,
D. J. DiStefano, M. Cai, M. Brown, J. F. Smith, R. Kowalski, et al. 2014. Protection provided by a herpes simplex virus 2 (HSV-2) glycoprotein C and D
subunit antigen vaccine against genital HSV-2 infection in HSV-1-seropositive
guinea pigs. J. Virol. 88: 2000–2010.
8. Cairns, T. M., J. Fontana, Z. Y. Huang, J. C. Whitbeck, D. Atanasiu, S. Rao,
S. S. Shelly, H. Lou, M. Ponce de Leon, A. C. Steven, et al. 2014. Mechanism of
neutralization of herpes simplex virus by antibodies directed at the fusion domain of glycoprotein B. J. Virol. 88: 2677–2689.
9. Krawczyk, A., J. Krauss, A. M. Eis-H€ubinger, M. P. Däumer,
R. Schwarzenbacher, U. Dittmer, K. E. Schneweis, D. Jäger, M. Roggendorf, and
M. A. Arndt. 2011. Impact of valency of a glycoprotein B-specific monoclonal
antibody on neutralization of herpes simplex virus. J. Virol. 85: 1793–1803.
10. Marshak, J. O., L. Dong, and D. M. Koelle. 2014. The murine intravaginal HSV2 challenge model for investigation of DNA vaccines. Methods Mol. Biol. 1144:
305–327.
11. Görander, S., A. M. Harandi, M. Lindqvist, T. Bergström, and J. Å. Liljeqvist.
2012. Glycoprotein G of herpes simplex virus 2 as a novel vaccine antigen for
immunity to genital and neurological disease. J. Virol. 86: 7544–7553.
12. Johnston, C., D. M. Koelle, and A. Wald. 2011. HSV-2: in pursuit of a vaccine.
J. Clin. Invest. 121: 4600–4609.
13. Sin, J. I., J. J. Kim, R. L. Arnold, K. E. Shroff, D. McCallus, C. Pachuk,
S. P. McElhiney, M. W. Wolf, S. J. Pompa-de Bruin, T. J. Higgins, et al. 1999.
IL-12 gene as a DNA vaccine adjuvant in a herpes mouse model: IL-12 enhances
Th1-type CD4+ T cell-mediated protective immunity against herpes simplex
virus-2 challenge. J. Immunol. 162: 2912–2921.
14. Toka, F. N., M. Gierynska, and B. T. Rouse. 2003. Codelivery of CCR7 ligands
as molecular adjuvants enhances the protective immune response against herpes
simplex virus type 1. J. Virol. 77: 12742–12752.
15. Scandella, E., Y. Men, D. F. Legler, S. Gillessen, L. Prikler, B. Ludewig, and
M. Groettrup. 2004. CCL19/CCL21-triggered signal transduction and migration
of dendritic cells requires prostaglandin E2. Blood 103: 1595–1601.
16. Hu, K., S. Luo, L. Tong, X. Huang, W. Jin, W. Huang, T. Du, Y. Yan, S. He,
G. E. Griffin, et al. 2013. CCL19 and CCL28 augment mucosal and systemic
immune responses to HIV-1 gp140 by mobilizing responsive immunocytes into
secondary lymph nodes and mucosal tissue. J. Immunol. 191: 1935–1947.
17. Song, J. H., J. I. Kim, H. J. Kwon, D. H. Shim, N. Parajuli, N. Cuburu,
C. Czerkinsky, and M. N. Kweon. 2009. CCR7-CCL19/CCL21-regulated dendritic cells are responsible for effectiveness of sublingual vaccination. J.
Immunol. 182: 6851–6860.
18. Yoshida, R., M. Nagira, M. Kitaura, N. Imagawa, T. Imai, and O. Yoshie. 1998.
Secondary lymphoid-tissue chemokine is a functional ligand for the CC chemokine receptor CCR7. J. Biol. Chem. 273: 7118–7122.
19. Lee, Y., S. K. Eo, R. J. Rouse, and B. T. Rouse. 2003. Influence of CCR7 ligand
DNA preexposure on the magnitude and duration of immunity. Virology 312:
169–180.
20. Alt, C., M. Laschinger, and B. Engelhardt. 2002. Functional expression of the
lymphoid chemokines CCL19 (ELC) and CCL 21 (SLC) at the blood-brain
barrier suggests their involvement in G-protein-dependent lymphocyte recruitment into the central nervous system during experimental autoimmune encephalomyelitis. Eur. J. Immunol. 32: 2133–2144.
21. Yanagihara, S., E. Komura, J. Nagafune, H. Watarai, and Y. Yamaguchi. 1998.
EBI1/CCR7 is a new member of dendritic cell chemokine receptor that is upregulated upon maturation. J. Immunol. 161: 3096–3102.
22. Ohl, L., M. Mohaupt, N. Czeloth, G. Hintzen, Z. Kiafard, J. Zwirner,
T. Blankenstein, G. Henning, and R. Förster. 2004. CCR7 governs skin dendritic
cell migration under inflammatory and steady-state conditions. Immunity 21:
279–288.
23. Marsland, B. J., P. Bättig, M. Bauer, C. Ruedl, U. Lässing, R. R. Beerli,
K. Dietmeier, L. Ivanova, T. Pfister, L. Vogt, et al. 2005. CCL19 and CCL21
induce a potent proinflammatory differentiation program in licensed dendritic
cells. Immunity 22: 493–505.
24. Sánchez-Sánchez, N., L. Riol-Blanco, and J. L. Rodrı́guez-Fernández. 2006. The
multiple personalities of the chemokine receptor CCR7 in dendritic cells. J.
Immunol. 176: 5153–5159.
25. Yanagawa, Y., and K. Onoé. 2002. CCL19 induces rapid dendritic extension of
murine dendritic cells. Blood 100: 1948–1956.
26. Ramachandran, M., C. Jin, D. Yu, F. Eriksson, and M. Essand. 2014. Vectorencoded Helicobacter pylori neutrophil-activating protein promotes maturation
of dendritic cells with Th1 polarization and improved migration. J. Immunol.
193: 2287–2296.
27. Moser, B., M. Wolf, A. Walz, and P. Loetscher. 2004. Chemokines: multiple
levels of leukocyte migration control. Trends Immunol. 25: 75–84.
28. Ebert, L. M., P. Schaerli, and B. Moser. 2005. Chemokine-mediated control of
T cell traffic in lymphoid and peripheral tissues. Mol. Immunol. 42: 799–809.
29. Krautwald, S., E. Ziegler, R. Förster, L. Ohl, K. Amann, and U. Kunzendorf.
2004. Ectopic expression of CCL19 impairs alloimmune response in mice. Immunology 112: 301–309.
30. Hartoonian, C., Z. Sepehrizadeh, M. Tabatabai Yazdi, Y. S. Jang, L. Langroudi,
P. Amir Kalvanagh, B. Negahdari, A. Karami, M. Ebtekar, and K. Azadmanesh.
2014. Enhancement of immune responses by co-delivery of CCL19/MIP-3beta
chemokine plasmid with HCV core DNA/protein immunization. Hepat. Mon. 14:
e14611.
31. Mora, J. R., and U. H. von Andrian. 2008. Differentiation and homing of IgAsecreting cells. Mucosal Immunol. 1: 96–109.
32. Han, Y. W., A. G. Aleyas, J. A. George, S. J. Kim, H. K. Kim, D. J. Yoo,
S. H. Kang, and S. K. Eo. 2009. Genetic co-transfer of CCR7 ligands enhances
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
elevated CCL19 may enhance immune responses by attracting
CCL19-responsive cells into spleen and MLNs. Given that the
level of CCR7 on B cells increases rapidly upon AgR engagement
(62) and that CCL19–CCR7 interaction is involved in homing of
B cells to mucosal draining lymph nodes, where B cells can differentiate into ASCs (31), we conclude that enhanced ASC trafficking is likely responsible for the elevated IgA+ cells in the
mucosal sites in gB-CCL19–immunized mice. However, we cannot rule out the possibility that gB-CCL19 may be capable of
generating more IgA ASCs.
Despite the described favorable characteristics of gB-CCL19
fusion constructs, their optimal doses to trigger a maximum immune response warrant further investigation. It is well documented
that an appropriate immunogen density is required to prime for
a robust immune response, in particular a T cell response (61).
Although a low density of immunogen is not sufficient to trigger
an efficient response, an inappropriately high dose can inhibit the
immune response (61). Given that a fixed amount of gB was administered in the currently study, an optimal dose remains to be
determined in future studies. Moreover, we designed the constructs that express gB and CCL19 at a ratio of 1:1. If further
investigation reveals that appropriate doses of gB and CCL19 are
not equimolar, new constructs with a refined immunogen/adjuvant
ratio, which may require more than one linker or even more types
of linkers, need to be designed and tested. In addition, as a proofof-concept study, we adopted a DNA-immunization strategy via
i.m. delivery. Other delivery methods are worth testing for better
efficacy. Given that the mouse model of HSV-2 has some limitations (e.g., no reactivation from the reservoir), future work is
warranted to assess the fusion constructs in different animal
models.
In conclusion, our findings in mice indicate that genetic gBCCL19 fusion constructs have an attractive potential to promote
systematic and mucosal responses against HSV-2 infection. To our
knowledge, this is the first time that an immunogen–chemokine
fusion construct was demonstrated to protect animals from virus
challenge. Our study represents a promising approach when considering the development of an effective HSV-2 vaccine to induce
protective systematic and mucosal immunity.
337
338
33.
34.
35.
36.
37.
38.
39.
41.
42.
43.
44.
45.
immunity and prolongs survival against virulent challenge of pseudorabies virus.
Immunol. Cell Biol. 87: 91–99.
Rodrı́guez, A. M., M. F. Pascutti, C. Maeto, J. Falivene, M. P. Holgado, G. Turk,
and M. M. Gherardi. 2012. IL-12 and GM-CSF in DNA/MVA immunizations
against HIV-1 CRF12_BF Nef induced T-cell responses with an enhanced
magnitude, breadth and quality. PLoS ONE 7: e37801.
Isik, G., T. van Montfort, M. Boot, V. Cobos Jiménez, N. A. Kootstra, and
R. W. Sanders. 2013. Chimeric HIV-1 envelope glycoproteins with potent intrinsic granulocyte-macrophage colony-stimulating factor (GM-CSF) activity.
PLoS ONE 8: e60126.
Melchers, M., I. Bontjer, T. Tong, N. P. Chung, P. J. Klasse, D. Eggink,
D. C. Montefiori, M. Gentile, A. Cerutti, W. C. Olson, et al. 2012. Targeting
HIV-1 envelope glycoprotein trimers to B cells by using APRIL improves antibody responses. J. Virol. 86: 2488–2500.
Melchers, M., K. Matthews, R. P. de Vries, D. Eggink, T. van Montfort,
I. Bontjer, C. van de Sandt, K. David, B. Berkhout, J. P. Moore, and
R. W. Sanders. 2011. A stabilized HIV-1 envelope glycoprotein trimer fused to
CD40 ligand targets and activates dendritic cells. Retrovirology 8: 48.
Watzl, C. 2006. Production and use of trimeric isoleucine zipper fusion proteins
to study surface receptor ligand interactions. Curr. Protoc. Protein Sci, Chapter
19: Unit 19.11.
Milligan, G. N., K. L. Dudley-McClain, C. F. Chu, and C. G. Young. 2004.
Efficacy of genital T cell responses to herpes simplex virus type 2 resulting from
immunization of the nasal mucosa. Virology 318: 507–515.
Du, T., K. Hu, J. Yang, J. Jin, C. Li, D. Stieh, G. E. Griffin, R. J. Shattock, and
Q. Hu. 2012. Bifunctional CD4-DC-SIGN fusion proteins demonstrate enhanced
avidity to gp120 and inhibit HIV-1 infection and dissemination. Antimicrob.
Agents Chemother. 56: 4640–4649.
Huang, X., W. Jin, K. Hu, S. Luo, T. Du, G. E. Griffin, R. J. Shattock, and Q. Hu.
2012. Highly conserved HIV-1 gp120 glycans proximal to CD4-binding region
affect viral infectivity and neutralizing antibody induction. Virology 423: 97–
106.
Hoshino, Y., S. K. Dalai, K. Wang, L. Pesnicak, T. Y. Lau, D. M. Knipe,
J. I. Cohen, and S. E. Straus. 2005. Comparative efficacy and immunogenicity of
replication-defective, recombinant glycoprotein, and DNA vaccines for herpes
simplex virus 2 infections in mice and guinea pigs. J. Virol. 79: 410–418.
Wang, K., L. Pesnicak, and S. E. Straus. 1997. Mutations in the 59 end of the
herpes simplex virus type 2 latency-associated transcript (LAT) promoter affect
LAT expression in vivo but not the rate of spontaneous reactivation of genital
herpes. J. Virol. 71: 7903–7910.
Sin, J. I., M. Bagarazzi, C. Pachuk, and D. B. Weiner. 1999. DNA primingprotein boosting enhances both antigen-specific antibody and Th1-type cellular
immune responses in a murine herpes simplex virus-2 gD vaccine model. DNA
Cell Biol. 18: 771–779.
Liu, K., D. Jiang, L. Zhang, Z. Yao, Z. Chen, S. Yu, and X. Wang. 2012.
Identification of B- and T-cell epitopes from glycoprotein B of herpes simplex
virus 2 and evaluation of their immunogenicity and protection efficacy. Vaccine
30: 3034–3041.
Visciano, M. L., M. Tagliamonte, M. L. Tornesello, F. M. Buonaguro, and
L. Buonaguro. 2012. Effects of adjuvants on IgG subclasses elicited by virus-like
particles. J. Transl. Med. 10: 4.
46. Skoberne, M., R. Cardin, A. Lee, A. Kazimirova, V. Zielinski, D. Garvie,
A. Lundberg, S. Larson, F. J. Bravo, D. I. Bernstein, et al. 2013. An adjuvanted
herpes simplex virus 2 subunit vaccine elicits a T cell response in mice and is an
effective therapeutic vaccine in Guinea pigs. J. Virol. 87: 3930–3942.
47. Leroux-Roels, G., F. Clément, P. Vandepapelière, M. Fourneau, T. C. Heineman,
and G. Dubin. 2013. Immunogenicity and safety of different formulations of an
adjuvanted glycoprotein D genital herpes vaccine in healthy adults: a doubleblind randomized trial. Hum. Vaccin. Immunother. 9: 1254–1262.
48. Awasthi, S., and H. M. Friedman. 2014. Status of prophylactic and therapeutic
genital herpes vaccines. Curr Opin Virol 6: 6–12.
49. Nguyen-Hoai, T., O. Hohn, M. D. Vu, G. Baldenhofer, M. S. Sayed Ahmed,
B. Dörken, S. Norley, M. Lipp, A. Pezzutto, and J. Westermann. 2012. CCL19 as
an adjuvant for intradermal gene gun immunization in a Her2/neu mouse tumor
model: improved vaccine efficacy and a role for B cells as APC. Cancer Gene
Ther. 19: 880–887.
50. Drew, M. D., A. Estrada-Correa, B. J. Underdown, and M. R. McDermott. 1992.
Vaccination by cholera toxin conjugated to a herpes simplex virus type 2 glycoprotein D peptide. J. Gen. Virol. 73: 2357–2366.
51. McKenzie, S. J., and J. F. Halsey. 1984. Cholera toxin B subunit as a carrier
protein to stimulate a mucosal immune response. J. Immunol. 133: 1818–1824.
52. Harbury, P. B., P. S. Kim, and T. Alber. 1994. Crystal structure of an isoleucinezipper trimer. Nature 371: 80–83.
53. Morris, A. E., R. L. Remmele, Jr., R. Klinke, B. M. Macduff, W. C. Fanslow, and
R. J. Armitage. 1999. Incorporation of an isoleucine zipper motif enhances the
biological activity of soluble CD40L (CD154). J. Biol. Chem. 274: 418–423.
54. Chan, A. C., and P. J. Carter. 2010. Therapeutic antibodies for autoimmunity and
inflammation. Nat. Rev. Immunol. 10: 301–316.
55. Fening, S. W., F. Esper, D. Scholl, and Y. T. Huang. 2012. HSV IgG antibody
inhibits virus detection in CSF. J. Clin. Virol. 55: 164–167.
56. Hashido, M., and T. Kawana. 1997. Herpes simplex virus-specific IgM, IgA and
IgG subclass antibody responses in primary and nonprimary genital herpes
patients. Microbiol. Immunol. 41: 415–420.
57. Seppanen, M., S. Meri, I. L. Notkola, I. J. Seppala, E. Hiltunen-Back, H. Sarvas,
M. Lappalainen, H. Valimaa, A. Palikhe, V. V. Valtonen, and M. L. Lokki. 2006.
Subtly impaired humoral immunity predisposes to frequently recurring genital
herpes simplex virus type 2 infection and herpetic neuralgia. J. Infect. Dis. 194:
571–578.
58. Barcy, S., and L. Corey. 2001. Herpes simplex inhibits the capacity of lymphoblastoid B cell lines to stimulate CD4+ T cells. J. Immunol. 166: 6242–6249.
59. Dickensheets, H. L., and R. P. Donnelly. 1999. Inhibition of IL-4-inducible gene
expression in human monocytes by type I and type II interferons. J. Leukoc. Biol.
65: 307–312.
60. Chattergoon, M. A., T. M. Robinson, J. D. Boyer, and D. B. Weiner. 1998.
Specific immune induction following DNA-based immunization through in vivo
transfection and activation of macrophages/antigen-presenting cells. J. Immunol.
160: 5707–5718.
61. Chun, S., M. Daheshia, S. Lee, S. K. Eo, and B. T. Rouse. 1999. Distribution fate
and mechanism of immune modulation following mucosal delivery of plasmid
DNA encoding IL-10. J. Immunol. 163: 2393–2402.
62. Cyster, J. G. 2003. Homing of antibody secreting cells. Immunol. Rev. 194: 48–
60.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
40.
HSV-2 gB-CCL19 DNA PROTECTS MICE AGAINST GENITAL HERPES