DEAMPLIFICATION OF SUPERNUMERARY
CENTROSOMES BY CENTROSOMAL CLUSTERING
By
Ezekiel Thomas
A Thesis Submitted to the Faculty of
The Wilkes Honors College
In Partial Fulfillment of the Requirements for the Degree of
Bachelor of Arts in Liberal Arts and Sciences
With a Concentration in Biology
Wilkes Honors College of
Florida Atlantic University
Jupiter, Florida
May 2012
Deamplification of Supernumerary
Centrosomes by Centrosomal Clustering
By
Ezekiel Thomas
This thesis was prepared under the direction of the candidate’s thesis advisor,
Dr. Nicholas Quintyne, and has been approved by the members of the supervisory
committee. It was submitted to the faculty of The Honors College and was accepted in
partial fulfillment of the requirements for the Degree of Bachelor of Arts in Liberal Arts
and Sciences.
SUPERVISORY COMMITTEE:
________________________
________________________
Dr. Nicholas Quintyne
Date
________________________
________________________
Dr. Michelle Ivey
Date
________________________
________________________
Dr. Jeffrey Buller
Date
Dean, Wilkes Honors College
ii
Acknowledgements
I would like to thank Dr. Quintyne for his mentoring, guidance, and patience;
April Schimmel for maintaining the lab and purchasing numerous antibodies; and Dr.
Ivey for her assistance as my second reader. I would also like to thank my family and
friends for their support.
iii
Abstract
Author: Ezekiel Thomas
Title: Deamplification of Supernumerary Centrosomes by Centrosomal Clustering
Institution: Wilkes Honors College of Florida Atlantic University
Thesis Advisor: Dr. Nicholas Quintyne
Degree: Bachelor of Arts in Liberal Arts and Sciences
Concentration: Biology
Year: 2012
Supernumerary centrosomes can arise in a cell through a variety of methods. The
presence of supernumerary centrosomes has been observed in nearly all types of cancer
and promotes chromosomal instability, with rates of incident increasing as the cancer
progresses. An oral squamous cell carcinoma line was treated with hydroxyurea to
induce supernumerary centrosomes in the cells. NuMA was then knocked down using
shRNA to promote centrosomal clustering and bipolar mitotic division in cells with
supernumerary centrosomes. Immunofluorescence with an antibody against SAS 6
accurately stained the centrioles for observation. The cells exhibiting supernumerary
centrosomes undergoing bipolar mitotic division were studied to look for a possible
pattern in centrosomal clustering where the majority of centrosomes are at one pole with
a single centrosome at the other pole. Initial results suggest the presence of such a
mechanism, which would describe a previously unknown mechanism for cells to
deamplify supernumerary centrosomes by centrosomal clustering.
iv
Table of Contents
List of Tables ..................................................................................................................... vi
List of Figures ................................................................................................................... vii
Introduction ......................................................................................................................... 1
The Centrosome: Function, Structure, and Lifecycle ............................................. 1
Development of Supernumerary Centrosomes ....................................................... 2
Supernumerary Centrosomes and Multipolarity ..................................................... 3
Centrosomal Deamplification ................................................................................. 4
Mechanisms for Centrosomal Clustering ................................................................6
Materials and Methods ........................................................................................................ 8
Cell Culture ............................................................................................................. 8
Immunofluorescence ............................................................................................... 8
Antibodies ............................................................................................................... 9
Transfection .......................................................................................................... 10
Drug Treatments ................................................................................................... 11
Microscopy ........................................................................................................... 11
Results ............................................................................................................................... 12
Induction of Supernumerary Centrosomes ........................................................... 12
Immunofluorescent Methods for Centriole Observation ...................................... 14
Induction of Centrosomal Clustering .................................................................... 17
Discussion ......................................................................................................................... 18
Colcemid and Hydroxyurea Treatments ............................................................... 19
Immunofluorescent Staining of Centrioles During Mitosis .................................. 20
A Mechanism Promoting Preferential Clustering ................................................. 21
Continuing Research ............................................................................................. 22
Conclusion ........................................................................................................................ 22
References ......................................................................................................................... 24
v
List of Tables
Table 1. Summary of 1° antibodies and successful methods for staining centrioles ........ 14
vi
List of Figures
Figure 1. Methods of dealing with supernumerary centrosomes ........................................ 6
Figure 2. Treatment to induce supernumerary centrosomes ............................................. 13
Figure 3. Microtubule differences in hydroxyurea and colcemid treated cells .................14
Figure 4. Staining of cells using SAS 6 antibody ............................................................. 16
Figure 5. Staining of cells using CEP 250 antibody ......................................................... 17
Figure 6. Preferential centrosomal clustering ................................................................... 18
vii
I. Introduction
The Centrosome: Function, Structure, and Lifecycle
The centrosome is the cellular organelle that acts as the microtubule organizing
center (MTOC) in most types of cells (Doxsey, 2001). Through the regulation of
microtubules (MTs), the centrosome controls cell shape, cell motility, intracellular
transport, and the positioning of organelles. The centrosome also plays a key role during
division and is responsible for the formation of the spindle poles, which are vital to
proper chromosomal segregation and cleavage plane localization (Nigg, 2002). The
structure of the centrosome is divided into two main components, the centrioles and the
pericentriolar material (PCM). The centrioles are two barrel-shaped objects aligned at
right angles to each other and function to anchor the MTs and recruit the PCM. There is
an older centriole having more associated proteins (the "mother centriole") and a newer
centriole that doesn't have as many associated proteins (the "daughter centriole"). The
PCM contains a variety of proteins, most notably the γ-tubulin ring complex, which acts
as a template for new MTs and serves as a site of MT nucleation (Doxsey, 2001).
The centrosome cycle is closely related to the chromosomal duplication cycle, and
can be divided into five main steps: centriole disorientation, centriole duplication,
centriole elongation, centrosome maturation, and centrosome separation (Nigg, 2002).
The process begins in late G1 of the cell cycle once the cell has committed to division,
and starts with the loss of orientation between the two centrioles. As the cell progresses
into S phase where DNA synthesis occurs, the centrioles undergo duplication as well in a
semi-conservative fashion from the perspective of the centrosome, while additional
1
pericentriolar material is also recruited (Balczon et al., 1999). This process continues into
G2 with centriole elongation. In G2, as elongation continues, centrosome maturation
begins to occur with the new daughter centrosome recruiting associated proteins. This
process does not fully complete until the following cell cycle, resulting in a mother
centrosome that contains the mother centriole, and a daughter centrosome that contains
the previously daughter centriole (Nigg and Stearns, 2011). Up through G2 in the cell
cycle both pairs of centrioles continue to act as one centrosome to allow for proper MT
organization. Once the cell enters mitosis, centrosome separation occurs to allow for the
formation of separate spindle poles. Each daughter cell then inherits one functional
centrosome.
Development of Supernumerary Centrosomes
When errors occur in the centrosome cycle, supernumerary centrosomes can
develop in cells. There are four accepted models for the origin of supernumerary
centrosomes (Nigg, 2002): 1) Overduplication of centrosomes can occur if there is a
disconnect between centrosome duplication and chromosomal duplication during S phase
of the cell cycle. Chromosomal damage can result in a halt of progression through S
phase until the DNA damage is repaired, but meanwhile centrosomal duplication will
occur again and again (Balczon et al., 1995). 2) If there is a failure during cellular
division, such as an aberrant mitotic exit or incomplete cytokinesis, a cell could return to
the cell cycle with twice the number of centrosomes it previously possessed (Millband et
al., 2002). 3) Cellular fusion could occur between two normal cells, and oncoviruses with
fusogenic properties have been shown to play a role in this occurrence (Shekhar et al.,
2
2002). 4) While previously only thought to occur in select cells, de novo formation of
centrosomes has been shown to occur in many vertebrate somatic cells after centrosomal
ablation with laser microsurgery (Khodjakov et al., 2002). The activation of this pathway
could contribute to the development of supernumerary centrosomes.
These models do not have to be mutually exclusive, and currently no research
exists that shows a preference for a particular model. One or more methods could occur
simultaneously to play a role in the production of supernumerary centrosomes (Nigg,
2002). Two methods that have been shown to induce supernumerary centrosomes in cells
are treatment with hydroxyurea or treatment with colcemid. Hydroxyurea follows the first
model for overduplication for centrosomes by causing a separation between centrosome
duplication and DNA synthesis in S phase (Balczon et al., 1995). Hydroxyurea acts as an
inhibitor for ribonucleotide reductase, which prevents the synthesis of
deoxyribonucleotide triphosphates at the replication forks for DNA synthesis, thus
halting DNA replication (Koç et al., 2004). While DNA synthesis is stopped, centrosome
duplication continues to occur. Colcemid follows the second model, resulting in an
aborted mitosis. Colcemid is a MT toxin that depolymerizes MTs and prevents the cell
from continuing through mitosis (Kleinfeld and Sisken, 1966). Eventually, the cell exits
mitosis with twice the number of centrosomes and re-enters the cell cycle.
Supernumerary Centrosomes and Multipolarity
When cellular division progresses correctly, the two centrosomes present form
two spindles and the chromosomes are correctly segregated to the two daughter cells.
However, each of the centrosomes present in the cell has the capability to act as a spindle
3
pole during division, so the presence of extra centrosomes can result in the formation of
extra spindle poles and multipolar divisions (Pihan and Doxsey, 1999; Saunders et al.,
1999). During multipolar divisions, the chromosomes attempt to align themselves
between the multiple poles, resulting in incorrect chromosomal segregation. Occurrences
of extra centrosomes have been observed in nearly all studied cancers, including brain,
breast, bile duct, colon, head and neck, lung, pancreas, and prostate cancers (Weber et al.,
1998; Lingle and Salisbury, 1999; Kuo et al., 2000; Gustafson et al., 2000; Pihan et al.,
1998; Sato et al., 2001; Pihan et al., 2001). The incorrect chromosomal segregation
causes increase genomic instability, and both genomic instability and centrosome
abnormalities have been shown to correlate with tumor progression (Pihan et al., 1998).
When taking into account multipolarity in cancer cells, out of the four models for
the origin of supernumerary centrosomes aborted mitosis should be the preferred method
owing to the increase in plodiy, which is the number of sets of chromosomes present in a
cell. When undergoing multipolar divisions, polyploidy increases the chances that
resulting daughter cells will contain a functional set of chromosomes. Furthermore, it has
been observed that tetraploidy frequently occurs before aneuploidy, which agrees with
aborted division simultaneously giving rise to supernumerary centrosomes and
tetraploidy (Galipeau et al., 1996; Southern et al., 1997).
Centrosomal Deamplification
The presence of supernumerary centrosomes does not necessitate the occurrence
of a multipolar division (Ring et al., 1982; Brinkley, 2001). Despite the potential benefits
for cancerous cells to pick up an advantageous mutation during incorrect chromosomal
4
segregation, the much more frequent occurrence is the death of the daughter cells. To
allow for the continued growth and proliferation of the cell line, there are three primary
strategies to deal with supernumerary centrosomes: the discarding of excess centrosomes
(Figure 1B), the inactivation of excess centrosomes (Figure 1C), or the coalescence of
centrosomes to form a functionally single centrosome (Figure 1D; Brinkley, 2001).
Illustrating the existence of a pathway to discard centrosomes, centrioles disappear during
the development of mouse oocytes and are not detected again until late preimplantation.
The remaining MTOC contains some similarities to centrosomes, such as centrosomal
antigens pericentrin and γ-tubulin, but lacks the normal centrosomal structure (Calarco,
2000). In Spisula solidissima, a type of clam, the fertilized oocyte results in a cell with
three active centrosomes, two maternal centrosomes and one paternal centrosome.
Through differential regulation of the maternal and paternal centrosomes, the paternal
centrosome's ability to nucleate MTs during meiosis I is selectively inhibited to allow for
bipolar division to occur (Wu and Palazzo, 1998). While these two strategies are possible,
there has been no evidence for their utilization in tumor cells with supernumerary
centrosomes (Brinkley, 2001). Instead, experimental and observational data favor the
method of centrosomal clustering (Ring et al., 1982; Lingle and Salisbury, 1999;
Quintyne et al., 2005).
5
Figure 1: Methods of dealing with supernumerary centrosomes. (A) A tripolar mitotic
cell that is not experiencing any centrosomal deamplification. (B) A cell that is
undergoing a bipolar division because it discarded the extra centrosome. (C) A cell that is
undergoing a bipolar division because it silenced the extra centrosome. The centrosome is
present, but has lost its ability to nucleate MTs. (D) A cell displaying centrosomal
clustering to allow for a bipolar division.
Mechanisms for Centrosomal Clustering
Cancer cells deal with supernumerary centrosome by centrosomal clustering that
allows for the creation of two functional spindle poles, which can consist of multiple
individual centrosomes. This occurs through the functions of MT associated proteins and
MT motors that help organize the spindle poles. For example, dynein and HSET, MT
motors, nuclear mitotic apparatus protein (NuMA), and actin organization have been
6
shown to play an important role in centrosomal clustering (Quintyne et al., 2005; Kwon
et al., 2008). Also, the presence of spindle assembly checkpoint associated proteins are
required, possibly signaled by an abnormal kinetochore attachment, allowing the time for
clustering mechanisms to form two functional poles (Kwon et al., 2008).
Previous research shows that NuMA specifically is critical for spindle formation,
and its gene maps to one of the most frequently amplified chromosome segments in
cancerous cells (Gaglio et al., 1995; Huang et al., 2002) . NuMA is responsible for
providing the cohesive force to maintain spindle MTs around a single centrosome, with
overexpression of NuMA inhibiting centrosomal clustering (Gaglio et al., 1996; Quintyne
et al., 2005). Oral squamous cell carcinoma cell line 103 (UPCI:SCC103) has been
shown to express high levels of NuMA as well as a high rate of multipolarity. Through
knockdown of NuMA by transfection with siRNA, centrosomal clustering can be
reestablished in UPCI:SCC103, and the rate of multipolarity is reduced significantly
(Quintyne et al., 2005). An analysis of the resulting transfected cells can reveal whether
or not there is a pattern in centrosomal clustering resulting in a pair of centrioles placed at
one pole and the remaining centrioles placed at the opposite pole to form two separate
functional centrosomes. The presence of such a mechanism would allow for one daughter
cell to return to a normal centrosome cycle.
7
II. Materials and Methods
Cell Culture
Oral squamous cell carcinoma, UPCI:SCC103 (gift of S. Gollin, University of
Pittsburgh, Pittsburgh, PA), was grown in MEM (Sigma, St. Louis, MO), supplemented
with 10% FBS (Sigma), L-glutamine, non-essential amino acids (Sigma), and gentamicin
sulfate (MP Biomedicals, Solon, OH). They were incubated at 37°C in an environment
with 5% CO2 and atmospheric O2 conditions.
Immunofluorescence
To seed cover slips, the cells were washed with Phosphate Buffered Saline (PBS)
and then treated with 3 mL of 0.05% of Trypsin-EDTA (MP Biomedicals) and allowed to
incubate for 5 minutes at 37°C. The total volume was then brought to 10mL with media
and pipetted up and down several times to break clumps. Cells were then placed on cover
slips at a 2.0 x 105 cells per mL density and incubated overnight to allow them to adhere.
To fix the cells, the media was aspirated and the cells were washed with PBS. For
methanol fixation, cells were treated with -20°C methanol for 5 minutes at -20°C and
then the methanol was aspirated. If cells were undergoing extraction with detergent, they
were treated with a 0.05% dilution of Triton X-100 solution in PBS before methanol
fixation for pre-extraction and after methanol fixation for post-extraction. For
paraformaldehyde fixation, the cells were treated with 4% paraformaldehyde diluted in
PBS for 30 minutes at room temperature. Then the cells were washed three times with
PBS for 5 minutes each wash, treated with a 0.2% dilution of Triton X-100 solution in
8
PBS for 30 minutes at room temperature, and again washed three times with PBS for 5
minutes each wash.
After fixation, the cover slips were treated with Phosphate Buffer Saline Tween20/Bovine Serum Albumin (PBST/BSA) for 15 minutes. 150 µL of 1° antibody was
given to each cover slip, and the cover slips were incubated at room temperature for 30
minutes, overnight at 4°C, or for 2 hours at 37°C. The 1° antibody was then aspirated,
and each cover slip was washed with PBS three times for 3 minutes each wash. 150 µL of
2° antibody was added to each cover slip and left to incubate for 15 minutes at room
temperature or 2 hours at 37°C. The 2° antibody was then aspirated, and each cover slip
was again washed three times with PBS for 3 minutes each wash. 100 µL of 4’,6diamidino-2-phenylindole, dihydrochloride (DAPI, Roche, Nutley, NJ) was then added
for 30 seconds and aspirated, followed by three washes of H2O for 30 seconds each wash
with the final wash left on the cover slips. Each cover slip was then mounted on to a slide
with one drop of 1 g/L p-Phenylene diamine in 90% glycerol (mounting media), dried,
and sealed with nail polish. Slides were stored at -20°C.
Antibodies
Primary antibodies were diluted in PBST/BSA and prepared as follows: rabbit γtubulin (Sigma) in a 1:500 dilution (30 min at room temperature), mouse α-tubulin
(Sigma) in a 1:250 dilution (30 min at room temperature), rabbit Centrin (Sigma) in a
dilution range of 1:50 – 1:1000 (various fixations and incubations), goat Centrin 2 (Santa
Cruz Biotechnology, Santa Cruz, CA) in a dilution range of 1:50 – 1:1000 (various
fixations and incubations), mouse Centrin 3 (Abnova, Taipei, Taiwan) in a 1:250 dilution
9
(2h at 37°C and 2° antibody for 1h at 37°C), rabbit Ninein (Abcam, Cambridge, MA) in a
1:250 dilution (overnight at 4°C), mouse Protein 4.1 (Abnova) in a dilution range of 1:50
– 1:1000 (various fixations and incubations), mouse ε-tubulin (Sigma) in a dilution range
of 1:50 – 1:1000 (various fixations and incubations), rabbit EB-1 (Sigma) in a dilution
range of 1:50 – 1:1000 (various fixations and incubations), rabbit NINL (Sigma) in a
dilution range of 1:50 – 1:1000 (various fixations and incubations), mouse MPM2
(Millipore, Temecula, CA) in a dilution range of 1:50 – 1:1000 (various fixations and
incubations), rabbit Cyclin E (US Biological, Swampscott, MA) in a dilution range of
1:50 – 1:1000 (various fixations and incubations), rabbit CEP 170 (Invitrogen, Camarillo,
CA) in a dilution range of 1:50 – 1:1000 (various fixations and incubations), mouse CEP
250 (Sigma) in a 1:250 dilution (overnight at 4°C), and rabbit SAS 6 (Santa Cruz) in a
1:250 dilution (overnight at 4°C). Secondary antibodies were prepared by diluting Texas
Red anti-rabbit (Invitrogen) and Alexa 488 anti-mouse (Invitrogen) in PBST/BSA in a
1:250 dilution.
Transfection
Cells were seeded and allowed to incubate overnight until approximate 70%
confluency, the amount of an area that is covered with cells, was obtained. In a 1.5 mL
conical tube, 3 µL of FuGene6 (Roche Diagnostics, Indianapolis, IN) was added directly
into 100 µL of OPTIMEM (Sigma) and tapped to mix. After 5 minutes at room
temperature, NuMA shRNA (Sigma) was added directly to the solution and tapped to mix.
Four different NuMA shRNA variations were used: A2 (sequence CCGGGCCTTGAAG
AGAAGAACGAAACTCGAGTTTCGTTCTTCTCTTCAAGGCTTTTTG) at 0.6 µL,
10
1.2 µL, or 2.4 µL; F1 (sequence CCGGCTTCTCCATCACAACCAGATTCTCGAGAA
TCTGGTTGTGATGGAGAAGTTTTTG) at 0.5 µL, 1.0 µL, or 2.0 µL; G1 (sequence
CCGGCCACATCTGAAGACCTGCTATCTCGAGATAGCAGGTCTTCAGATGTGG
TTTTTG) at 0.5 µL, 1.0 µL, or 2.0 µL; and H1 (sequence CCGGCCTTGAAGAGAAGA
ACGAAATCTCGAGATTTCGTTCTTCCTCTTCAAGGTTTTTG) at 0.75 µL, 1.5 µL,
or 3 µL. After 15 minutes at room temperature, approximately 100 µL was added to each
cover slip.
Drug Treatments
Colcemid Treatment: To induce extra centrosomes with colcemid, cells were first
seeded and allowed to incubate overnight. When confluency reached approximately 80%
the cells were treated with 27 nM colcemid (Irvine Scientific, Santa Ana, CA) diluted in
media. Colcemid-containing media was replaced after 24 hours. After 24 or 48 hours, the
cells were prepared according to the immunofluorescence procedure.
Hydroxyurea Treatment: To induce extra centrosomes with hydroxyurea, cells
were first seeded and allowed to incubate overnight. When confluency reached
approximately 70% the cells were treated with 20 mM hydroxyurea (MP Biomedicals)
diluted in media. After 24 or 48 hours, the cells were prepared according to the
immunofluorescence procedure.
NuMA Knockdown: After treatment with hydroxyurea for 48 hours, each cover
slip was transfected as described above and given 3 mL of fresh media. Cells were then
prepared at 24, 36, 48, or 52 hours according to the immunofluorescence procedure.
11
Microscopy
Slides were viewed on an Olympus IX81 Inverted Fluorescence Microscope
(Olympus America Inc., Center Valley, PA) with DAPI, FITC, and TRITC filters. The
microscope has a 100X objective and a numerical aperture of 1.65. Images were captured
using a Hamamatsu C4742-95 CCD camera (Hamamatsu Corporation, Bridgewater, NJ)
and recorded using Slidebook version 5.0 (Intelligent Imaging Innocation Inc., Denver,
CO).
III. Results
The cell line UPCI:SCC103 was chosen because it has been shown to have high
levels of NuMA, which promotes high rates of multipolarity (Quintyne et al., 2005).
UPCI:SCC103 had an observed mitotic index of 5 ± 0.5% and rate of multipolarity of
11 ± 4%. Mitotic index is calculated by counting the number of cells undergoing mitosis
out of the total number of cells, and rate of multipolarity is calculated by counting the
number of mitotic cells with more than two poles out of the total number of mitotic cells.
The rate of multipolarity was lower than previously found, but is still relatively high
compared to normal cell lines (Quintyne et al., 2005). Because of the high rate of
multipolarity, UPCI:SCC103 is a viable candidate to induce supernumerary centrosomes,
promote centrosomal clustering through NuMA knockdown, and observe for any patterns
in centrosomal clustering.
Induction of Supernumerary Centrosomes
To induce supernumerary centrosomes, cells were treated with two different drugs,
colcemid and hydroxyurea, that induce supernumerary centrosomes through different
12
methods. In the first method, cells were exposed to 20 mM hydroxyurea for 24 or 48
hours. Treatments of both 24 and 48 hours showed a significant increase of
supernumerary centrosomes from the control, with an increase also seen from 24 hours to
48 hours (Figure 2). For the second method, cells were exposed to 27 nM colcemid for 24
or 48 hours. Results obtained were similar to treatment with hydroxyurea, again showing
a significant increase from the control, and again 48 hours showing a greater increase
(Figure 2).
Figure 2: Treatment to induce supernumerary centrosomes. Both hydroxyurea and
colcemid treatments show a significant increase in the number of excess centrosomes,
with a greater increase at 48 hours than at 24 hours. Error bars indicate standard deviation.
Comparing hydroxyurea and colcemid treatment, both have the ability to induce
supernumerary centrosomes at 24 and 48 hours. Hydroxyurea produced a slightly higher
rate of extra centrosomes in both cases, but neither is significant. The primary difference
between the two was the effect on MTs, with colcemid interfering with MT formation
while hydroxyurea left the MTs intact (Figure 3).
13
Figure 3: Microtubule differences in hydroxyurea and colcemid treated cells. MT/αtubulin (green), Centrosomes/γ-tubulin (red), DNA (blue). (A) Treatment with
hydroxyurea leaves MT intact. Arrows denote several centrosomes. (B) Treatment with
colcemid disrupts MT nucleation. Bar = 10 µm.
Immunofluorescent Methods for Centriole Observation
Several variations to the indirect immunofluorescent procedure were used for a
number of different antibodies (Ab) against proteins associated with the centrosome in
attempt to accurately stain the centrioles (Table 1).
Table 1: Summary of 1° antibodies and successful methods for staining centrioles.
Proper staining of centrioles was not obtained for many antibodies, which instead stained
the whole centrosome or lacked a specific localization. SAS 6 provided the only adequate
centriole staining.
1° Ab
Characteristics of Protein
Centrin
Centrin 2
No success
No success
Family
of
calcium-binding
Intermittently
stains
phosphoproteins found in the centrioles
when
1°Ab
1
centriole and PCM
incubated for 2h at 37°C and
2°Ab incubated for 1h at
37°C
Centrin 3
14
Success Conditions
Ninein
Protein 4.1
ε-tubulin
EB-1
NINL
MPM2
Cyclin E
CEP 170
CEP 250
SAS 6
Poorly stains centrioles
Centrosome associated protein
when incubated overnight at
involved in centrosome maturation2
4°C
Structural protein associated with
No success
centriole and PCM3
Involved in centriole duplication,
associated with distal ends of the
No success
4
centrioles
Involved
in
centrosome
maturation, localized at distal cap of
No success
5
mother centriole
Ninein-like protein involved in
No success
centrosome maturation6
Mitotic protein that localizes at
the centrosome and assists in
No success
nucleation ability of centrosomes7
Cell cycle protein that localizes at
No success
the centrosome8
Centrosome associated protein,
preferentially
marking
mature
No success
9
centrioles
Clearly stains mother
Centrosome associated protein
centriole but dissociates from
preferentially
marking
mature
centriole during mitosis.
centrioles10
Incubated overnight at 4°C
Clearly stains centrioles
Required for proper daughter
when incubated overnight at
centriole formation11
4°C
1
Baron et al., 1992; 2Bouckson-Castaing et al., 1996; 3Krauss et al., 1997; 4Chang et al.,
2003; 5Louie et al., 2004; 6Wang and Zhan, 2007; 7Vandre et al., 2000; 8Matsumoto and
Maller, 2004; 9Guarguaglini et al., 2005; 10Mack et al., 1998; 11Leidel et al., 2005
15
Out of all the attempted antibodies, overnight incubation with the antibody against
SAS 6 at 4°C produced the only usable staining to properly observe centrioles (Figure 4).
Staining achieved by antibodies against Centrin 3 and Ninein produced results, but the
inconsistency of the staining was not overcome through variations in the procedure. The
antibody against CEP 250 produced clear stains, but the protein became dissociated with
the centrioles during mitosis (Figure 5).
Figure 4: Staining of cells using SAS 6 antibody. Centrioles/SAS 6 (green), DNA (blue).
(A) Quadpolar mitotic cell with two centrioles at each pole. Magnification of all zoom
boxes is 3x. (B) Bipolar mitotic cell with two centrioles at each pole. Magnification of
both zoom boxes is 2x. Bar = 10 µm.
16
Figure 5: Staining of cells using CEP 250 antibody. Centrioles/CEP250 (green),
Centrosomes/ γ-tubulin (red), DNA (blue). Lower right image is merging of all three
layers. (A) The centrioles can be clearly seen during interphase. Magnification of zoom
box is 4x. (B) CEP 250 dissociates during mitosis, and the centrioles can no longer be
observed. Bar = 10 µm.
Induction of Centrosomal Clustering
To induce centrosomal clustering, hydroxyurea treated cells were transfected with
shRNA to knockdown NuMA (Quintyne et al., 2005). Four different shRNA sequences
were used at varying concentrations, and the cells were allowed to recover for 24 to 60
hours. Lower recovery times prevented the cells from recovering enough NuMA to
undergo mitosis, but cells died off after transfection preventing an adequate recovery
time. To help reduce the recovery time required, smaller amounts of shRNA were used
for the transfection. The reduced amount of shRNA also resulted in a reduced
transfection efficiency, so not as many cells exhibited centrosomal clustering.
NuMA F1 shRNA resulted in the least amount of cell death, and out of a variety
of attempted combinations only five cells were identified that exhibited centrosomal
17
clustering. All five of these cells displayed preferential centrosomal clustering where one
pole's centrosome contained only two centrioles and the other pole contained the
remaining centrioles (Figure 6).
Figure 6: Preferential centrosomal clustering. Centrioles (green), DNA (blue). Both
zoom boxes are 3x magnification. The pole on the top left contains multiple centrioles
while the pole on the bottom right only has two centrioles. The bottom right centrioles are
located on top of each other making it difficult to see in a flat 2D image, but result in a
brighter foci in the flattened image. Bar = 10 µm.
IV. Discussion
Supernumerary centrosomes can arise in cells through overduplication during Sphase, aborted mitosis, cellular fusion, or de novo formation, none of which are mutually
exclusive (Nigg, 2002). Each centrosome possess the ability to create a mitotic spindle
during mitosis, so cells with supernumerary centrosomes can undergo multipolar
divisions, increasing chromosomal instability (Saunders et al., 1999; Pihan et al., 1998).
However, because multipolar divisions most frequently result in cell death, cells
primarily exhibit centrosomal clustering to form two functional poles to allow bipolar
18
division (Ring et al., 1982; Lingle and Salisbury, 1999; Quintyne et al., 2005). If a
mechanism existed that preferentially clustered the majority of centrosomes at one pole
with a single centrosome at the other, one of the daughter cells could return to a normal
centrosomal cycle. In this fashion, deamplification of excess centrosomes could be
accomplished through centrosomal clustering.
Colcemid and Hydroxyurea Treatments
Cells normally have one or two centrosomes, depending on what stage of the cell
cycle they are in, so cells were considered to have supernumerary centrosomes when they
possessed more than two centrosomes. Both hydroxyurea and colcemid were successful
in the production of supernumerary centrosomes, showing a significant increase
compared to the control. Looking at the differences between treatment times, there was
an increase in supernumerary cells from 24 hours to 48 hours as expected due to the
increased exposure time. After 48 hours, both hydroxyurea and colcemid displayed
similar efficiency at producing supernumerary centrosomes. The percent of cells with
supernumerary centrosomes increased from 6.0 ± 1.4% to 41 ± 4% for hydroxyurea
treated cells and to 38 ± 4% for colcemid treated cells.
While ability to produce supernumerary centrosomes is similar, a noticeable
difference between the two treatments was the confluency of the cells after treatment.
While the number of cells that were present did not significantly drop during treatment
with hydroxyurea, treatment with colcemid resulted in cell death that increased with
exposure time. This difference results from the different mechanisms by which the
supernumerary centrosomes are produced. Hydroxyurea induces extra centrosomes by
19
interfering with DNA synthesis, decoupling DNA synthesis from centrosome synthesis
allowing centrosome duplication to occur over and over again (Balczon et al., 1995).
Colcemid on the other hand is a MT depolymerizing drug that results in failed mitosis
and the production of extra centrosomes (Kleinfeld and Sisken, 1966). While
hydroxyurea only causes a delay in S phase, colcemid disrupts MTs which interferes with
vital cellular functions, such as intracellular transport. Because both produced similar
results but hydroxyurea did not cause cell death, hydroxyurea was used for the remainder
of the experiment.
Immunofluorescent Staining of Centrioles During Mitosis
A common and easy way to stain the centrosomes is through the use of antibodies
to γ-tubulin, which is a vital component of the PCM (Doxsey, 2001). During centrosomal
clustering however, tagging the PCM does not always correctly reflect the number of
centrosomes that are present. Instead, the individual centrioles must be observed to
accurately tell the number of centrosomes present at each pole. Observation of the
centriole is more difficult than observation of the centrosome because of the small size of
the centriole as well as the level of specificity required to distinguish it from the PCM.
Because of this, a large number of antibodies had to be tested before an antibody and
method was found that sufficiently stained the centrioles.
While many of these antibodies are adequate for other scientific procedures such
as Western Blots, they produce poor stains during immunofluorescence and stain the
whole centrosome instead of specifically the centrioles. Centrin 3 and Ninein were able to
stain the centrioles specifically, but both were unreliable and varied in staining quality
20
from cell to cell. CEP 250 produced very clear stains during interphase, but this clarity
was lost during mitosis as a result of CEP 250 dissociating from the centrioles. SAS 6
was the only antibody that resulted in clear labeling of the centriole during mitosis.
A Mechanism Promoting Preferential Clustering
NuMA was knocked down in cells with shRNA to promote centrosomal
clustering. As expected, cells observed shortly after transfection were unable to undergo
mitosis. NuMA is involved in providing the cohesive force maintaining spindle MTs
around a single centrosome, so low levels of NuMA prevent the cell from forming
spindle poles required for division (Compton and Cleveland, 1993; Merdes et al., 1996;
Quintyne et al., 2005). Recovery time allows for the cells to once again undergo mitosis,
but unexpectedly a large number of cells died as time progressed. The reason for this
occurrence is unknown, as knockdown of NuMA has not previously been shown to result
in cell death. The fact that control cells also experienced some cell death suggest that
there is an error in transfection methodology, but repeated transfections all produced
similar occurrences of cell death during recovery. There were differences in the amount
of cell death depending on which variation of NuMA shRNA was used though, with
NuMA F1 shRNA transfected cells not experiencing as much cell death relative to the
cells transfected with other shRNA variations. This trend suggests that even if a flaw in
methodology is to blame, the knockdown of NuMA itself does play a small role in
contributing to the amount of cell death.
As a result of these complications, only five cells were observed that displayed
centrosomal clustering. However, all five of the observed cells displayed preferential
21
clustering with one pole containing two centrioles (one centrosome) with the remaining
centrioles at the other pole. These initial results favor the existence of a mechanism that
promotes the deamplification of excess centrosomes by centrosomal clustering.
Continuing Research
More data must be obtained to confirm the existence of a mechanism for
preferential clustering. To most easily accomplish this, the reason behind the amount of
cell death during transfection recovery should be identified. If further results confirm the
existence of preferential clustering, the mechanism by which this occurs should be more
closely examined. The pole with the singular centrosome should be observed to
determine if it is preferentially a mother centrosome, daughter centrosome, or the process
is random. The daughter centrosome could be desired because it is newer, or the mother
centrosome could be preferred in an attempt to avoid any errors that could be in the
daughter centrosome, possibly related to the reason for the existence of supernumerary
centrosomes in the first place.
V. Conclusion
There are four models explaining how supernumerary centrosomes can arise in
cells: overduplication, mitotic failure, cellular fusion, and de novo formation (Nigg,
2002). Treatment of cells with hydroxyurea or colcemid successfully produces
supernumerary centrosomes in cells through the first two models, respectively. Extra
centrosomes possess the ability to produce extra mitotic spindles during mitosis, which
can lead to chromosomal instability or cell death (Pihan and Doxsey, 1999; Saunders et
al., 1999). Cells are known to overcome the presence of supernumerary centrosomes by
22
deamplifying centrosomes through the discarding of excess centrosomes, silencing the
excess centrosomes, or clustering the centrosomes into two functional poles (Brinkley,
2001). Centrosomal clustering is the most commonly observed method by which cells
cope with supernumerary centrosomes (Ring et al., 1982; Lingle and Salisbury, 1999;
Quintyne et al., 2005). By observing centrosomal clustering through inducing
supernumerary centrosomes with hydroxyurea and then promoting clustering by the
knockdown of NuMA, initial results suggest that a method of preferential centrosomal
clustering occurs. Further study is required for certainty, but all observed cells
preferentially formed one pole containing a single centrosome and clustered the
remaining centrosomes at the other pole. This clustering pattern would allow one
daughter cell to return to a normal centrosome count, and illustrates a previously
undescribed mechanism for cells to cope with supernumerary centrosomes by undergoing
centrosomal deamplification through centrosomal clustering.
23
VI. References
Balczon, R., L. Bao, W.E. Zimmer, K. Brown, R.P. Zinkowski, B.R.Brinkley. 1995.
Dissociation of Centrosome Replication Events from Cycles of DNA Synthesis
and Mitotic Division in Hydroxyurea-arrested Chinese Hamster Ovary Cells. J.
Cell Biol. 130: 105-115.
Balczon, R., C.E. Varden, T.A. Schroer. 1999. Role for Microtubules in Centrosome
Doubling in Chinese Hamster Ovary Cells. Cell Motil. Cytoskeleton 42: 60-72.
Baron, A.T., T.M. Greenwood, C.W. Bazinet, J.L. Salisbury. 1992. Centrin is a
Component of the Pericentriolar Lattice. Biol. Cell 76: 383-8.
Bouckson-Castaing, V., M. Moudjou, D.J.P. Ferguson, S. Mucklow, Y. Belkaid, G.
Milon, P.R. Crocker. 1996. Molecular Characterisation of Ninein, a New CoiledCoil Protein of the Centrosome. J. Cell Sci. 109: 179-90.
Brinkley, B.R. 2001. Managing the Centrosome Numbers Game: From Chaos to Stability
in Cancer Cell Division. Trends Cell Biol. 11: 18-21.
Calarco, P.G. 2000. Centrosome Precursors in the Acentriolar Mouse Oocyte. Microsc.
Res. Tech. 49: 428-34.
Chang, P., T.H. Giddings Jr., M. Winey, T. Stearns. 2003. ε-Tubulin is Required for
Centriole Duplication and Microtubule Organization. Nature Cell Biol. 5: 71-6.
Compton, D.A. and D.W. Cleveland. 1993. NuMA is Required for the Proper
Completion of Mitosis. J. Cell Biol. 120: 947-57.
Doxsey, S. 2001. Re-evaluating Centrosome Function. Nature Rev. Mol. Cell Biol.
2: 688-98.
24
Gaglio, T., A. Saredi, and D.A. Compton. 1995. NuMA Is Required for the Organization
of Microtubules into Aster-Like Mitotic Arrays. J. Cell Biol. 131: 693-708.
Gaglio, T., A. Saredi, J.B. Bingham, M.J. Hasbani, S.R. Gill, T.A. Schroer,
D.A. Compton. 1996. Opposing Motor Activities Are Required for the
Organization of the Mammalian Mitotic Spindle Pole. J. Cell Biol. 135: 399-414.
Galipeau, P.C., D.S. Cowan, C.A. Sanchez, M.T. Barrett, M.J. Emond, D.S. Levine,
P.S. Rabinovitch, B.J. Reid. 1996. 17p (p53) Allelic Losses, 4N (G2/tetraploid)
Populations, and Progression to Aneuploidy in Barrett's Esophagus. Proc. Natl.
Acad. Sci. U.S.A. 93: 7081-4.
Guarguaglini, G., P.I. Duncan, Y.D. Stierhof, T. Holmström, S. Duensing, E.A. Nigg.
2005. The Forkhead-associated Domain Protein Cep170 Interacts with Polo-like
Kinase 1 and Serves as a Marker for Mature Centrioles. Mol. Biol. Cell
16: 1095-107.
Gustafson, L.M., L.L. Gleich, K. Fukasawa, J. Chadwell, M.A. Miller, P.J. Stambrook,
J.L. Gluckman. 2000. Centrosome Hyperamplification in Head and Neck
Squamous Cell Carcinoma: A Potential Phenotypic Marker of Tumor
Aggressiveness. Laryngoscope 110: 1798-1801.
Huang, X., S.M. Gollin, S. Raja, T.E. Godfrey. 2002. High-resolution Mapping of the
11q13 Amplicon and Identification of a gene, TAOS1, That Is Amplified and
Overexpressed in Oral Cancer Cells. Proc. Natl. Acad. Sci. U.S.A. 99: 11369-74.
25
Khodjakov, A., C.L. Rieder, G. Sluder, G. Cassels, O. Sibon, C.L. Wang. 2002. De novo
Formation of Centrosomes in Vertebrate Cells Arrested During S Phase. J. Cell
Biol. 158: 1171-81.
Kleinfeld, R.G. and J.E. Sisken. 1966. Morphological and Kinetic Aspects of Mitotic
Arrests by and Recovery from Colcemid. J. Cell Biol. 31: 369-79.
Koç, A., L.J. Wheeler, C.K. Mathews, G.F. Merrill. 2004. Hydroxyurea Arrests DNA
Replication by a Mechanism That Preserves Basal dNTP Pools. J. Biochemical
Chem. 279: 223-30.
Krauss, S.W., J.A. Chasis, C. Rogers, N. Mohandas, G. Krockmalnic, S. Penman. 1997.
Structural Protein 4.1 is Located in Mammalian Centrosomes. Proc. Natl. Acad.
Sci. U.S.A. 94: 7297-302.
Kuo, K.K., N. Sato, K. Mizumoto, N. Maehara, H. Yonemasu, C.G. Ker, P.C. Sheen,
M. Tanaka. 2000. Centrosome Abnormalities in Human Carcinomas of the
Gallbladder and Intrahepatic and Extrahepatic Bile Ducts. Hepatology 31: 59-64.
Kwon, M., S.A. Godinho, N.S. Chandhok, N.J. Ganem, A. Azioune, M. Thery, D.
Pellman. 2008. Mechanisms to Suppress Multipolar Divisions in Cancer Cells
with Extra Centrosomes. Genes & Dev. 22: 2189-203.
Leidel, S., M. Delattre, L. Cerutti, K. Baumer, P. Gönczy. 2005. SAS-6 Defines a Protein
Family Required for Centrosome Duplication in C. elegans and in Human Cells.
Nature Cell Biol. 7: 115-25.
Lingle, W.L. and J.L. Salisbury. 1999. Altered Centrosome Structure Is Associated with
Abnormal Mitoses in Human Breast Tumors. Am. J. Pathol. 155: 1941-51.
26
Louie, R.K., S. Bahmanyar, K.A. Siemers, V. Votin, P. Chang, T. Stearns, W.J. Nelson,
A.I.M. Barth. 2004. Adenomatous Polyposis Coli and EB1 Localize in Close
Proximity of the Mother Centriole and EB1 is a Functional Component of
Centrosomes. J. Cell Sci. 117: 1117-28.
Mack, G.J., J. Rees, O. Sandblom, R. Balczon, M.J. Fritzler, J.B. Rattner. 1998.
Autoantibodies to a Group of Centrosomal Proteins in Human Autoimmune Sera
Reactive with the Centrosome. Arthritis Rheumatism 41: 551-8.
Matsumoto, Y. and J.L. Maller. 2004. A Centrosomal Localization Signal in Cyclin E
Required for Cdk2-Independent S Phase Entry. Science 306: 885-8.
Merdes, A., K. Ramyar, J.D. Vechio, D.W. Cleveland. 1996. A Complex of NuMA and
Cytoplasmic Dynein is Essential for Mitotic Spindle Assembly. Cell 87: 447-58.
Millband, D.N., L. Campbell, and K.G. Hardwick. 2002. The Awesome Power of
Multiple Model Systems: Interpreting the Complex Nature of Spindle Checkpoint
Signaling. Trends Cell Biol. 12: 205-209.
Nigg, E.A. 2002. Centrosome Aberrations: Cause or Consequence of Cancer
Progression? Nature Rev. Cancer 2: 815-26.
Nigg, E.A. and T. Stearns. 2011. The Centrosome Cycle: Centriole Biogenesis,
Duplication and Inherent Asymmetries. Nature Cell Biol. 13: 1154-1160.
Pihan, G.A., A. Purohit, J. Wallace, H. Knecht, B. Woda, P. Quesenberry, S.J. Doxsey.
1998. Centrosome Defects and Genetic Instability in Malignant Tumors. Cancer
Res. 58: 3974-85.
27
Pihan, G.A., A. Purohit, J. Wallace, R. Malhotra, L. Liotta, S.J. Doxsey. 2001.
Centrosome Defects Can Account for Cellular and Genetic Changes That
Characterize Prostate Cancer Progression. Cancer Res. 61: 2212-9.
Pihan, G.A. and S.J. Doxsey. 1999 The Mitotic Machinery as a Source of Genetic
Instability in Cancer. Semin. Cancer Biol. 9: 289-302.
Quintyne, N.J., J.E. Reing, D.R. Hoffelder, S.M. Gollin, W.S. Saunders. 2005. Spindle
Multipolarity Is Prevented by Centrosomal Clustering. Science 307: 127-9.
Ring, D., R. Hubble, and M. Kirschner. 1982. Mitosis in a Cell with Multiple Centrioles.
J. Cell Biol. 94: 549-56.
Sato, N., K. Mizumoto, M. Nakamura, N. Maehara, Y.A. Minamishima, S. Nishio,
E. Nagai, M. Tanaka. 2001. Correlation Between Centrosome Abnormalities and
Chromosomal Instability in Human Pancreatic Cancer Cells. Cancer Genet.
Cytogenet. 126: 13-9.
Saunders, W.S., M. Shuster, X. Huang, B. Gharaibeh, A.H. Enyenihi, I. Petersen,
S.M. Gollin. 1999. Chromosomal Instability and Cytoskeletal Defects in Oral
Cancer Cells. Proc. Natl. Acad. Sci. U.S.A. 97: 303-8.
Shekhar, M.P., A. Lyakhovich, D.W. Visscher, H. Heng, N. Kondrat. 2002. Rad6
Overexpression Induces Multinucleation, Centrosome Amplification, Abnormal
Mitosis, Aneuploidy, and Transformation. Cancer Res. 62: 2115-124.
Southern, S.A., M.F. Evans, C.S. Herrington. 1997. Basal Cell Tetrasomy in Low-Grade
Cervical Squamous Intraepithelial Lesions Infected with High-Risk Human
Papillomaviruses. Cancer Res. 57: 4210-3.
28
Vandre, D.D., Y. Feng, and M. Ding. 2000. Cell Cycle-Dependent Phosphorylation of
Centrosomes: Localization of Phosphopeptide Specific Antibodies to the
Centrosome. Microsc. Res. Tech. 49: 458-66.
Wang, Y., and Q. Zhan. 2007. Cell Cycle-dependent Expression of Centrosomal Nineinlike Protein in Human Cells is Regulated by the Anaphase-promoting Complex.
J. Biological Chem. 282: 17712-9.
Weber, R.G., J.M. Bridger, A. Benner, D. Weisenberger, V. Ehemann, G. Reifenberger,
P. Lichter. 1998. Centrosome Amplification as a Possible Mechanism for
Numerical Chromosome Aberrations in Cerebral Primitive Neuroectodermal
Tumors with TP53 Mutations. Cytogenet. Cell Genet. 83: 266-9.
Wu X., and R.E. Palazzo. 1999. Differential Regulation of Maternal vs. Paternal
Centrosomes. Proc. Natl. Acad. Sci. U.S.A. 96: 1397-1402.
29