An efficient strategy to isolate full-length
cDNAs based on an mRNA cap retention
procedure (CAPture).
I Edery, L L Chu, N Sonenberg and J Pelletier
Mol. Cell. Biol. 1995, 15(6):3363.
These include:
CONTENT ALERTS
Receive: RSS Feeds, eTOCs, free email alerts (when new articles
cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml
To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
Downloaded from http://mcb.asm.org/ on February 23, 2013 by PENN STATE UNIV
Updated information and services can be found at:
http://mcb.asm.org/content/15/6/3363
MOLECULAR AND CELLULAR BIOLOGY, June 1995, p. 3363–3371
0270-7306/95/$04.0010
Copyright q 1995, American Society for Microbiology
Vol. 15, No. 6
An Efficient Strategy To Isolate Full-Length cDNAs Based on
an mRNA Cap Retention Procedure (CAPture)
ISAAC EDERY,1 LEE LEE CHU,2 NAHUM SONENBERG,2
AND
JERRY PELLETIER2*
Rutgers University, Piscataway, New Jersey 08854,1 and Department of Biochemistry,
McGill University, Montreal, Quebec, Canada H3G 1Y62
Received 3 February 1995/Returned for modification 13 March 1995/Accepted 24 March 1995
ends, would clearly result in a significant advancement of the
current technology and its applicability.
A common structural feature of all cellular eukaryotic
mRNAs (except for organelle mRNAs) analyzed to date is the
presence of a 59-terminal m7GpppN (where N is any nucleotide) structure, termed the cap (5, 30). This structure is added
early during the transcription of RNA polymerase II genes in
the nucleus (4) and is required for several steps of mRNA
biogenesis which include (i) protecting the mRNA against 59
exonucleases, (ii) stimulating translation, (iii) stimulating precursor mRNA splicing, (iv) enhancing nucleocytoplasmic
transport, and (v) facilitating 39-end processing (for a review,
see reference 31). Consistent with the diverse role of the cap
during gene expression, a number of cap-binding proteins have
been identified in the cytoplasm and nucleus (15, 31). The first
described and best characterized of these is eukaryotic initiation factor 4E (eIF-4E), a 24-kDa polypeptide which has been
cloned and characterized from a number of species, including
Saccharomyces cerevisiae (1), mice (16), and humans (27). This
protein shows strong binding specificity for methylated cap
structures of eukaryotic mRNAs (31).
Using a protein A–eIF-4E bifunctional hybrid fusion, we
have developed an affinity selection scheme which allows eukaryotic mRNAs to be purified via the 59 cap structure. In
combination with the single-strand-specific nuclease, RNase A,
this method was used to purify full-length cDNA-RNA hybrids. Shorter duplexes are not selected, since the cap is removed from the RNA moiety by nuclease treatment. This
method, which we call the cap retention procedure (CAPture),
can be used during cDNA library synthesis to enrich for clones
containing the authentic mRNA 59 end, as well as to facilitate
identification of sites of transcription initiation (STIs).
The generation of a complete physical map of the human
genome should be achieved by the use of large segments of
DNA contained in yeast artificial chromosomes (18), P1 clones
(34), and cosmid or phage contigs (32, 33). Estimates of the
total number of genes in the human genome range from
;50,000 to 100,000 (7), indicating that a small percentage of
the total cell DNA actually serves as a template for mRNA.
The creation of a transcript map through the identification and
mapping of cDNAs will identify information content of significant biological relevance in the genome. Methods currently
employed to identify genes from genomic DNA include the
probing of cDNA libraries with evolutionarily conserved DNA
fragments (19), purification and analysis of CpG-rich islands
that reside near the 59 ends of many genes (10), exon trapping
(9), and direct cDNA selection with immobilized genomic
DNA (23). Ultimately, the detailed characterization of a gene
is dependent on the ability to obtain a faithful representation
of the mRNA under study in the form of a cDNA(s).
With the exception of the construction of uniform-abundance (normalized) cDNA libraries (25), the procedure for
generating cDNA libraries has not extensively deviated from
the original method of Gubler and Hoffman (14). The major
problem with current cDNA libraries is that the majority of
cDNAs present are not full-length, leading to underrepresentation of mRNA 59 sequences. This problem is accentuated for
long mRNAs which have been primed with oligo(dT) and/or
mRNAs with extensive secondary structure which inhibit the
progression of reverse transcriptase (RT). Thus, a significant
amount of biological information is lost. Incomplete cDNAs
are of limited value, since the genetic information required to
make a functional protein is often not present, and several
rounds of screening, involving the generation of new libraries,
are required to obtain the full coding sequence of the gene.
Thus, cDNA cloning can often be inefficient, costly, and timeconsuming, which can severely hamper the ability to quickly
characterize a given gene. A method which significantly increases the ability to isolate full-length cDNAs, or their 59
MATERIALS AND METHODS
Recombinant plasmids. Three recombinant plasmids were generated for highlevel expression of eIF-4E: pRIT/yeIF-4E (yeast eIF-4E), pRIT/l/yeIF-4E, and
pRIT/meIF-4E (murine eIF-4E) (Fig. 1). The construction of pRIT/yeIF-4E was
achieved as follows. The yeIF-4E initiator ATG (1) was targeted by site-directed
mutagenesis and converted to a BamHI site (59GGATCC39). This new clone was
digested with HindIII (which cleaves downstream of the stop codon), repaired
with the Klenow fragment of DNA polymerase I in the presence of all four
deoxynucleoside triphosphates, and ligated to BamHI linkers. Following digestion with BamHI, the yeast eIF-4E gene was gel purified and subcloned into the
* Corresponding author. Mailing address: Dept. of Biochemistry,
McIntyre Medical Sciences Building, McGill University, Rm. 902, 3655
Drummond St., Montreal, Quebec, Canada H3G 1Y6. Phone: (514)
398-2323. Fax: (514) 398-7384.
3363
Downloaded from http://mcb.asm.org/ on February 23, 2013 by PENN STATE UNIV
The ability to generate cDNA libraries is one of the most fundamental procedures in contemporary molecular
biology. One of the major drawbacks of current methods is that most cDNAs present in any given library are
incomplete, rendering the characterization of genes an inefficient and time-consuming task. We have developed
an affinity selection procedure using a fusion protein containing the murine cap-binding protein (eukaryotic
initiation factor 4E), coupled to a solid support matrix, that allows for the purification of mRNAs via the 5* cap
structure. When combined with a single-strand-specific RNase digestion step, specific retention of complete
cDNA-RNA duplexes following first-strand synthesis is achieved. This method can be used to generate cDNA
libraries in which polyadenylated and nonpolyadenylated mRNAs are equally represented and to enrich for
full-length or 5*-end clones, thus facilitating cDNA cloning and promoter mapping.
3364
EDERY ET AL.
MOL. CELL. BIOL.
BamHI site of pRIT2T (Pharmacia) in frame with the protein A open reading
frame.
The construction of pRIT/l/yeIF-4E was achieved as follows. The l repressor
linker region (amino acids 92 to 132) (28) was amplified by PCR with two
oligonucleotides which bracket this region and contained SmaI sites A (59CC
CCGGGGAAGTATGCAGCCGTCACTTAGA39) and B (59CCCCGGGATG
CGGTCATGGAATTACC39). The PCR product was digested with SmaI and
cloned into the SmaI site of pRIT/yeIF-4E.
The construction of pRIT/meIF-4E was achieved by digesting murine eIF-4E
cDNA (16) in the 59 untranslated region (UTR) with EcoRI, rendering this site
blunt with the Klenow fragment of DNA polymerase I, and performing a partial
digest with PstI (which cleaves within the 39 UTR). pRIT2T was digested with
BamHI, repaired with the Klenow fragment, digested with PstI, and ligated to the
gel-purified meIF-4E fragment. Nucleotide sequencing confirmed the integrity
and reading frame of all the above clones.
Overexpression and purification of protein A–eIF-4E hybrid proteins. Escherichia coli N4830-1 (Pharmacia), containing the temperature-sensitive repressor
cI857, was transformed with the appropriate pRIT-based expression vectors.
Fusion proteins were purified essentially as previously described (13). An overnight culture of E. coli cells (grown at 308C) was diluted (1:62.5) into four 2-liter
flasks each containing 750 ml of LB medium supplemented with 100 mg of
ampicillin per ml. The culture was incubated at 308C until an A600 of approximately 0.8 was achieved. The temperature of the culture was then rapidly shifted
to 428C by changing incubators and adding an equal volume of LB-ampicillin
preequilibrated to 548C. The culture was induced for 2 h, cooled on ice for 15
min, and then harvested by centrifugation.
All subsequent steps were performed at 48C. E. coli cells producing the protein
A–eIF-4E fusions were resuspended in LCB (0.1 M KCl, 20 mM HEPES [N-2hydroxyethylpiperazine-N9-2-ethanesulfonic acid; pH 7.5], 0.2 mM EDTA, 0.5
mM phenylmethylsulfonyl fluoride), with 1/22 the volume used for the initial LB
culture medium (3 liters). After resuspension, Nonidet P-40 was added to a final
concentration of 0.5%. Cells were sonicated four times for 30 s each. The
homogenate was clarified by centrifugation for 10 min at 10,000 3 g. The
resulting supernatant was carefully removed and recentrifuged in a Ti60 rotor for
2.5 h at 40,000 rpm.
Protein A–eIF-4E fusion protein was purified from the supernatant of the
high-speed spin by m7GDP-agarose affinity chromatography as previously described (13). Essentially, aliquots (50 ml) of the supernatant were incubated with
0.5 ml of m7GDP-agarose at 48C overnight. The beads were sedimented at low
speed in a refrigerated tabletop centrifuge, and the supernatant was carefully
removed. Each aliquot was washed with 35 ml of LCB for 15 min, prior to a 20-ml
wash with LCB containing 50 mM GDP (Pharmacia). The m7GDP-agarose was
pooled, and specific elution of the hybrid protein was achieved by four successive
incubations at room temperature with 2 ml of LCB containing 100 mM m7GDP.
A final wash with 2 ml of LCB containing additional 0.9 M KCl was performed
to remove all adsorbed protein. Approximately 1 to 2 mg of protein was obtained
from a 3-liter starting culture. Typical purification results, obtained with protein
A–meIF-4E, are shown in Fig. 1C.
In vitro transcription and reverse transcription reactions. In vitro transcriptions were performed essentially as previously described (26). The use of the
dinucleotide m7GpppG or GpppG in the transcription reaction allowed the
generation of m7GpppG-terminated or GpppG-terminated mRNA. RNA was
internally radiolabelled by including [a-32P]GTP in the transcription reaction
mixture. All RNA species were gel purified on a 6% polyacrylamide–8 M urea gel
(acrylamide-bisacrylamide, 20:1) before use.
Reverse transcription reactions with Superscript II (Life Technologies) were
performed as suggested by the manufacturer. cDNA was internally labelled by
including [a-32P]dCTP in the reaction mixture, and synthesis was followed by
Downloaded from http://mcb.asm.org/ on February 23, 2013 by PENN STATE UNIV
FIG. 1. Expression of protein A–eIF-4E hybrid proteins in E. coli. (A) Schematic representation of the prokaryotic expression vector pRIT2T (Pharmacia)
demonstrating the cloning sites and reading frame. The IgG binding domain of protein A (Prot. A) is denoted by a solid arrow and the ampicillin resistance gene (Ampr)
is represented by a stippled arrow. The transcription terminator (T) is shown by a solid arrowhead, and the thermoinducible l right promoter (l Pr) is represented by
a stippled arrowhead. (B) Diagram depicting the three expression constructs used to produce the hybrid polypeptides in this study. The right-angled arrow denotes the
STI, the stippled box represents the l Pr promoter, the solid box denotes the IgG binding domain of protein A, the hatched box corresponds to the murine eIF-4E,
and the dotted box corresponds to the yeast eIF-4E gene. The l linker region is represented by a line. (C) Cap analog affinity purification of E. coli-expressed protein
A–meIF-4E. Recombinant protein was induced and affinity purified by m7GDP chromatography as described in Materials and Methods. Aliquots (10 ml) of the various
protein fractions representing 0.5% of the collected volume were analyzed by Coomassie blue staining following 0.1% SDS–10% polyacrylamide gel electrophoresis.
The sizes of the molecular weight markers are denoted on the left side of the gel. The following fractions were used: nonbound material (lane 1), LCB wash (lane 2),
GDP wash (lane 3), m7GDP elutions (lanes 4 to 7), and wash with LCB containing 0.9 M KCl (lane 8). (D) Purification profile of the three protein preparations used
in this study. Aliquots (10 ml) of the m7GDP elutions containing the fusion protein were analyzed by Coomassie blue staining following 0.1% SDS–10% polyacrylamide
gel electrophoresis. The sizes of the molecular weight markers are denoted on left side of the gel. The various fusion proteins used were protein A–yeIF-4E (lane 1),
protein A–meIF-4E (lane 2), and protein A–l–yeIF-4E (lane 3).
VOL. 15, 1995
CAP-AFFINITY SELECTION OF EUKARYOTIC mRNAs AND cDNAs
RESULTS
High-level expression and affinity purification of protein
A–eIF-4E. To purify mRNAs via the 59 cap structure, a hybrid
fusion with eIF-4E was generated by placing the yeast or murine eIF-4E coding sequence in frame, and downstream from,
the IgG binding domain of protein A (see Materials and Methods) (Fig. 1A and B). We chose to express the fusion proteins
in E. coli, since prokaryotes do not contain endogenous eIF-4E
and therefore homogeneously pure preparations of recombinant proteins could be obtained by using cap analog affinity
chromatography. Our main objective was to develop a simplified overexpression system that would result in the production
of a bifunctional hybrid protein, with one moiety capable of
binding mRNA cap structures and the other domain providing
a method to anchor the fusion protein to a solid support
matrix. The protein A–eIF-4E hybrid genes were placed under
control of the l right promoter (lPr), thus allowing thermoinduction of gene expression during propagation in an E. coli
host strain carrying the temperature-sensitive repressor cI857
(38). We used both the murine and yeast eIF-4E genes since a
priori we could not predict the relative efficiencies with which
the two fusion proteins would bind the cap structure. In addition, we produced a hybrid protein containing a flexible l
repressor linker region separating the protein A and eIF-4E
domains in the event that steric hindrance between the two
regions affected cap recognition. This 40-amino-acid linker
separates the amino- and carboxyl-terminal domains of the l
repressor and is believed to be relatively flexible (22). Following purification, only one prominent polypeptide of the expected molecular weight was specifically eluted with m7GDP.
For example, extracts containing protein A–meIF-4E resulted
in the specific elution of a prominent 54-kDa polypeptide (Fig.
1C, compare lanes 4 to 7 with lane 3). The Coomassie blue
staining of the three different fusion protein preparations used
in this study is depicted in Fig. 1D.
Relative efficiencies of cap recognition of the protein
A–eIF-4E recombinants. To assess the relative efficiencies with
which the three hybrid fusion proteins recognize the cap structure, we performed RNA mobility shift assays. Initially, the
specificity of complex formation was assessed by using capped,
methylated (m7GpppG-terminated) (Fig. 2A, lanes 1 and 3 to
5) and capped, unmethylated (GpppG-terminated) (Fig. 2A,
lane 2) mRNA. Previous studies have shown that a key determinant in the recognition of the cap structure by eIF-4E is the
presence of a methyl group at the N-7 position of the terminal
guanosine (30, 31). In the absence of protein, one prominent
band of the substrate RNA species was observed (Fig. 2A, lane
1). When capped, unmethylated mRNA was incubated with
protein A–yeIF-4E, no specific complexes were observed (Fig.
2A, lane 2). However, when capped, methylated mRNA was
incubated with the same protein preparation, a specific complex with slower mobility was clearly detectable (Fig. 2A, lane
3). Complexes of similar mobilities were observed when
capped, methylated mRNA was incubated with protein A–l–
yeIF-4E (Fig. 2A, lane 4) or protein A–meIF-4E (Fig. 2A, lane
5). On an equimolar basis, there was fivefold more protein
A–meIF-4E in complexes with RNA than either protein A–l–
yeIF-4E (lane 4) or protein A–yeIF-4E (lane 3) (as determined
by densitometric tracing of the autoradiograph). The results of
these experiments suggest either that protein A–meIF-4E
binds RNA cap structures with higher affinity and/or that the
resulting complexes are more stable than those formed with
protein A–l–yeIF-4E or protein A–yeIF-4E. The specificity of
complex formation was further assessed by competition experiments. Nonradiolabelled capped, unmethylated mRNA failed
to compete with the protein A–meIF-4E–mRNA complex
(Fig. 2B, lanes 2 to 5), but capped, methylated mRNA effectively competed for complex formation (Fig. 2B, lanes 6 to 9).
The relative affinities of protein A–meIF-4E and meIF-4E
for the cap structure were compared to determine whether the
fusion to the IgG binding domain of protein A had affected the
ability of eIF-4E to interact with the cap structure. RNAprotein complexes were formed in the presence of equimolar
amounts of protein and analyzed by polyacrylamide gel electrophoresis (Fig. 2C). Two mRNA species were visible in this
experiment (lane 1) and likely represent the ability of the input
RNA to assume two different secondary structures. Murine
eIF-4E was capable of forming complexes with both RNA
forms (lane 2); complex formation was inhibited with excess
m7GpppG-terminated mRNA (lane 4) but not GpppG-terminated mRNA (lane 3). The RNA-protein complexes formed
with protein A–meIF-4E are of slower mobility (lane 5) than
those formed with meIF-4E and are also specific for a methylated, capped 59 terminus (compare lane 7 with lane 6). The
amount of RNA bound by the fusion polypeptide is approximately threefold smaller than the amount bound by meIF-4E
(as assessed by phosphorimage analysis). On the basis of the
high degree of specificity and stability of cap recognition by the
protein A–meIF-4E hybrid fusion relative to the other fusion
proteins, we chose to use this protein to develop the cap affinity
selection procedure described below.
Affinity selection of mRNA by CAPture. We devised an
mRNA selection scheme to isolate RNA polymerase II transcripts based on the 59 cap structure, using protein A–meIF-4E
(Fig. 3A). In this procedure, which we call CAPture, the hybrid protein is bound to a solid support matrix (IgG-Sepharose) via the IgG binding domain of protein A. mRNA is then
Downloaded from http://mcb.asm.org/ on February 23, 2013 by PENN STATE UNIV
trichloroacetic acid precipitation of radiolabelled cDNA. To promote the generation of incomplete cDNA strands, ddATP was added to the reverse transcription mixture to a final concentration of 0.6 mM.
Prior to cap affinity selection, the reaction mixture containing cDNA was
treated with RNase A as follows. Following first-strand synthesis, the volume of
the reaction mixture was increased to 100 ml with water. RNase A was added to
a final concentration of 10 mg/ml and incubated at room temperature for 10 min,
at which point 5 mg of yeast tRNA and 100 ml of 23 PK buffer (20 mM Tris [pH
7.8], 10 mM EDTA, 1% sodium dodecyl sulfate [SDS]) containing 100 mg of
proteinase K (Boehringer) were added. The digestion was allowed to proceed at
room temperature for 5 min and was terminated by phenol-chloroform extraction and ethanol precipitation.
CAPture of mRNA and cDNA-RNA duplexes. To select mRNAs or cDNARNA duplexes, protein A–meIF-4E was first coupled to immunoglobulin G
(IgG)-Sepharose 6FF (Pharmacia) according to the manufacturer’s recommendations. (The binding capacity is ;2 mg/ml of drained resin.) All incubations
were performed at room temperature in a 1.5-ml Microfuge tube. End-over-end
incubations were performed with a Labquake shaker (Labindustries, Inc.) and
were carefully monitored to ensure that proper mixing was being achieved.
Centrifuge spins were performed for 3 to 5 s in a Nanofuge (Hoefer Scientific
Instruments).
RNA or cDNA-RNA duplexes were selected by using 50 ml of Sepharosecoupled protein A–eIF-4E, in a final volume of 300 ml. Affinity selection was
performed with 13 BB (10 mM KHPO4 [pH 8.0], 100 mM KCl, 2 mM EDTA,
5% glycerol) supplemented with 5 mg of calf liver tRNA, 6 mM dithiothreitol,
1.3% polyvinyl alcohol (Sigma), and 30 U of RNasin (Boehringer Mannheim).
After end-over-end incubation at room temperature for 1 h, the resin was washed
twice with 300 ml of 13 BB and once with 13 BB supplemented with 50 mM
GDP. The RNA was specifically eluted by two sequential washes of 13 BB
supplemented with 500 mM m7GDP. A final wash in LCB supplemented with 0.9
M KCl (called HCB) was used to strip the column.
Generation of cDNA libraries enriched for full-length clones. Total RNA was
purified from mouse embryos (12 to 13 days old), placenta, and uterus by the
LiCl method of Auffray and Rougeon (2). poly(A)1 mRNA was purified by two
successive passes on an oligo(dT) cellulose column (3). Approximately 100 mg of
mRNA was utilized for first-strand synthesis with Superscript II. The efficiency of
first-strand synthesis was ;30% (25a). CAPture of full-length cDNA was performed as described above and resulted in the recovery of ;0.5 mg of cDNA.
Second-strand synthesis and packaging into l ZAP was performed as detailed in
the ZAP-cDNA synthesis kit from Stratagene. The primary libraries consisted of
;2 3 106 recombinants, of which 500,000 were screened without amplification.
3365
3366
EDERY ET AL.
MOL. CELL. BIOL.
incubated with the resin, prior to several washes and specific
elution with the cap analog, m7GDP. To assess the efficiency
of this procedure, radiolabelled m7GpppG- or GpppG-terminated mRNA was synthesized in vitro with SP6 RNA polymerase and affinity selected. The elution profile obtained is
shown in Fig. 3B, demonstrating that approximately 65% of
the input m7GpppG-terminated mRNA is specifically retained
and eluted from the affinity column. No enrichment for GpppG-terminated mRNA was achieved, demonstrating the specificity of this procedure (Fig. 3B). RNA obtained from the
various fractions in this experiment was analyzed by polyacrylamide gel electrophoresis (Fig. 3C), and the results show that
no significant degradation of either the GpppG- or m7GpppGterminated mRNA occurred.
To demonstrate that cellular, capped mRNAs can be purified by this procedure, total RNA from mouse embryos (12 to
13 days old) was isolated and selected by CAPture. RNA from
the various elutions and washes was fractionated on a 1.5%
agarose–6% formaldehyde gel and transferred onto nitrocellulose paper. Hybridization with a murine b-actin probe revealed a single b-actin mRNA species (Fig. 3D). Approximately 70% of the b-actin was retained and specifically eluted
by CAPture (compare lanes 5 and 6 with the other lanes).
These results demonstrate the feasibility of using CAPture to
isolate RNA polymerase II transcripts via the m7GpppN cap
structure.
CAPture of full-length cDNAs. Having established the specificity of CAPture in retaining capped, methylated RNA, we
wished to determine if the protocol could be modified to enrich
for full-length cDNAs. The strategy we employed is depicted in
Fig. 4A. Following first-strand cDNA synthesis, duplexes consisting of full-length or incomplete cDNAs are treated with the
single-strand nuclease RNase A, which is pyrimidine (Py) spe-
cific and cleaves (Py)pN bonds to leave 39 phosphates. However, RNase A does not cleave RNA that is hybridized to
cDNA. Thus, a full-length cDNA should prevent cleavage of
the 59 cap structure from the 59 end of the mRNA. On the
other hand, the RNA moiety of duplexes containing incomplete cDNAs is digested between the cap structure and the 59
end of the cDNA, with a concomitant release of the cap structure. These truncated duplexes should no longer be retained by
CAPture. As a template for cDNA synthesis, m7GpppGcapped RNA was generated from the vector pKSII1 (Stratagene), linearized with PvuII, by using T7 RNA polymerase.
This produced an RNA species of 334 nucleotides containing a
T3 primer binding site 148 nucleotides from the 59 end of the
RNA. By using the T3 primer, cDNA synthesis was initiated
from this in vitro-synthesized RNA. To ensure the presence of
incomplete cDNAs, dideoxyadenosine was included in the reverse transcription reaction mixture. This inclusion resulted in
the production of several shortened cDNA fragments of discrete sizes (Fig. 4B). Following treatment with RNase A and
cap affinity selection, only full-length cDNA is specifically retained by CAPture (Fig. 4B, compare lane 6 with lane 1).
To evaluate the performance of CAPture under very stringent conditions, reverse transcription reactions were performed on an in vitro-transcribed 2.9-kb hybrid mRNA species
containing sequences from the trans-activating region (TAR)
of human immunodeficiency virus fused upstream of the chloramphenicol acetyltransferase (CAT) reporter gene (24). The
TAR-CAT hybrid was chosen because it contains substantial
secondary structure at the 59 terminus (Fig. 5A). An estimate
of the free energy of formation of the TAR structure at the 59
end of the CAT RNA, calculated by using the guidelines of
Tinoco et al. (36), is approximately 253 kcal/mol (approximately 2221 kJ/mol). In this experiment, the performance
Downloaded from http://mcb.asm.org/ on February 23, 2013 by PENN STATE UNIV
FIG. 2. Electrophoretic mobility shift assays assessing the relative efficiencies of protein-RNA complex formation. Electrophoretic mobility shift assays were
performed as previously described (15) with gel-purified in vitro-transcribed RNA synthesized from pSP65 linearized with EcoRI. This process generates a 53nucleotide fragment (53-RNA). Protein-RNA complexes were resolved on 6% nondenaturing polyacrylamide gels. The position of migration of free, uncomplexed
RNA is denoted by an open arrowhead, whereas the position of the protein-RNA complex is denoted by a filled arrowhead. (A) Relative efficiencies of complex
formation. In this assay, 105 cpm (;1 ng) of RNA containing either a methylated cap structure or an unmethylated cap structure was incubated with 200 ng of the
different fusion proteins. Lane 1, capped methylated RNA; lane 2, capped unmethylated RNA incubated with protein A–yeIF-4E; lane 3, capped methylated RNA
incubated with protein A–yeIF-4E; lane 4, capped methylated RNA incubated with protein A–l–eIF-4E; lane 5, capped methylated RNA incubated with protein
A–meIF-4E. Quantitation of labelled bands was performed by scanning autoradiograms with a model 1650 transmittance-reflectance scanning densitometer (Bio-Rad
Laboratories). (B) Specificity of complex formation between protein A–meIF-4E and capped, methylated RNA. An excess of 3H-labelled GpppG-terminated 53-RNA
(lanes 2 to 5) or 3H-labelled m7GpppG-terminated 53-RNA (lanes 6 to 9) was incubated during complex formation between protein A–meIF-4E and 32P-labelled
m7GpppG-terminated 53-RNA to assess the specificity of the complex observed in panel A. The amounts of competitor RNA (53-RNA) used were as follows: no
competitor (lane 1), 1.0 ng (lanes 2 and 6), 10 ng (lanes 3 and 7), 100 ng (lanes 4 and 8), and 1.0 mg (lanes 5 and 9). (C) Comparison of relative affinities between
meIF-4E and protein A–meIF-4E fusion protein. Protein-RNA complexes were generated with an equimolar amount of meIF-4E (0.125 mg) or protein A–meIF-4E
(0.25 mg) as indicated (top), and resolved as described above. Reactions were performed in the presence (1) or absence (2) of either 1.0 mg of GpppG- or
m7GpppG-3H-labelled RNA as the competitor. The position of mobility of the protein A–meIF-4E complex is denoted by an arrow, and that of the meIF-4E complex
is indicated by a solid arrowhead. The positions of migrations of the input RNA are denoted by open triangles and likely reflects RNA species differing in secondary
structure. The complexes were visualized by exposing the dried gel against a phosphorimaging screen. Quantitation of labelled bands was performed by direct analysis
on a phosphorimager (Fujix BAS 2000).
VOL. 15, 1995
CAP-AFFINITY SELECTION OF EUKARYOTIC mRNAs AND cDNAs
3367
levels of two RTs, Superscript II RT and avian myeloblastosis
virus (AMV) RT, were also compared. The enzyme from
AMV harbors RNase H activity and should generate cDNA
which cannot be retained by CAPture. On the other hand,
Superscript II is devoid of RNase H activity and should produce a cDNA-RNA duplex capable of being selected by CAPture. A complex mixture of cDNAs was obtained following
reverse transcription with both enzymes, demonstrating highly
inefficient synthesis of full-length transcripts (Fig. 5B, lanes 1
and 3). However, following selection by CAPture, only fulllength cDNA-RNA was obtained from the reverse transcription reaction performed with Superscript II (Fig. 5B, compare
lane 4 with lane 2). The amount of cDNA retained as fulllength molecules represents approximately 2 to 3% of the
input cDNA population (as estimated by Cerenkov counting of
the different fractions), indicating that CAPture is sufficiently
sensitive to purify full-length cDNA-RNA duplexes from a
large population of incomplete cDNAs. Although AMV RT
was capable of generating full-length cDNAs (the smear in
lane 1 extends into the full-length range), the cDNAs were not
selected probably because insufficient RNA remained bound
to the cDNA to allow cap retention (because of degradation by
the RNase H activity in AMV RT).
Generation of full-length and 5*-end cDNA libraries. The
murine eIF-4E gene encodes multiple mRNAs that are generated by differential polyadenylation in a tissue-dependent fashion (16). In addition, several closely spaced STIs have been
defined by primer extension (Fig. 6A) (16). The original cDNA
(2,360 bp) was first isolated from an amplified lgt 11 library
prepared from murine pre-B-cell line 70Z/3 (6). From this
initial screen, 59 positive clones were isolated and characterized by Southern blotting of the phage DNA prepared from the
Downloaded from http://mcb.asm.org/ on February 23, 2013 by PENN STATE UNIV
FIG. 3. Affinity selection of mRNA via the 59 cap structure. (A) Schematic representation of the selection procedure used to purify mRNAs via the cap structure.
An affinity matrix generated by binding protein A–meIF-4E to Sepharose-IgG was incubated with capped, methylated (m7GpppG) or capped, unmethylated (GpppG)
mRNA and processed as described in Materials and Methods. Specific elution of bound mRNAs was achieved by using saturating amounts of the cap analog m7GDP.
Prot. A, protein A. (B) Percent efficiency of binding of m7GpppG-terminated (solid box) or GpppG-terminated (stippled box) mRNA to immobilized protein
A–meIF-4E. Following cap selection, 300 ml of each fraction was collected and quantitated by Cerenkov counting. The GpppG-terminated mRNA (34 bases) was
generated from pKSII1 digested with BamHI, whereas the m7GpppG-terminated RNA (52 bases) was generated from pKSII1 digested with EcoRI. F.T., unbound
material; W.-1 and W.-2, first and second BB washes, respectively. (C) Polyacrylamide gel analysis of RNA eluted from immobilized protein A–meIF-4E. Fractions
collected in the binding efficiency experiment for panel B were ethanol precipitated in the presence of 10 mg of glycogen as the carrier, and resuspended in 15 ml of
formamide sample buffer. Aliquots (3 ml) were analyzed on a 6% polyacrylamide (acrylamide-bisacrylamide, 20:1)–6 M urea gel. The analyzed fractions were unbound
RNA (lanes 1 and 8), washes with 13 BB (lanes 2, 3, 9 and 10), a GDP wash (lanes 4 and 11), m7GDP washes (lanes 5, 6, 12, and 13), and an HCB wash (lanes 7 and
14). The arrowheads indicate the positions of migration of full-length RNA. (D) Affinity selection of RNA polymerase II transcripts from total mouse RNA. Four
hundred micrograms of total RNA was passed twice over 200 ml (packed resin volume) of IgG-Sepharose–protein A–meIF-4E in the presence of binding cocktail (see
Materials and Methods). The affinity resin was then washed twice with 13 BB and once with 13 BB containing 50 mM GDP. The capped RNA was specifically eluted
with two washes of 500 mM m7GDP. A final wash with HCB was performed to strip the column. The RNA fractions were ethanol precipitated in the presence of 10
mg of glycogen as the carrier, loaded onto a 1.5% agarose–6% formaldehyde gel, and processed for Northern (RNA) blotting as previously described (35) with
radiolabelled b-actin (5 3 108 cpm/mg) cDNA as a probe. b-Actin RNA (arrow) was visualized by autoradiography by exposing the blot to X-Omat film (Kodak) for
3.5 h at 2708C with an intensifying screen. Lane 1, flowthrough fraction; lanes 2 and 3, BB washes; lane 4, wash with BB containing 50 mM GDP; lanes 5 and 6, wash
with BB containing 500 mM m7GDP; lane 7, HCB wash.
3368
EDERY ET AL.
MOL. CELL. BIOL.
DISCUSSION
FIG. 4. CAPture of full-length cDNAs. (A) Schematic representation of the
affinity selection procedure used to enrich for full-length cDNAs. s.s.RNA, single-strand RNA; Prot. A, protein A; Rxn, reaction. (B) Polyacrylamide gel
analysis of cDNA fractions eluted from immobilized protein A–meIF-4E following CAPture. Capped, methylated RNA was generated with T7 RNA polymerase
from pKSII1 linearized with PvuII. cDNA was synthesized by the use of a T3
oligonucleotide primer positioned 148 nucleotides downstream from the cap
structure. The cDNA-RNA duplex was subjected to CAPture and processed for
analysis as described in Materials and Methods. The various fractions are identified above the lanes. The arrowhead denotes the position of migration of
full-length cDNA, whereas the small dots denote incomplete cDNAs. F.T., flowthrough fraction.
We have developed a novel affinity method which allows the
isolation of mRNAs via the 59 cap structure. Several previous
studies have used antibodies directed against the cap structure
to select and purify eukaryotic mRNAs. Schwer et al. (29) and
de Magistris and Stunnenberg (12) used a polyclonal anti-m7G
antibody to demonstrate that vaccinia virus late mRNAs are
discontinuously synthesized. Muhlrad et al. (20) used this antibody to define an mRNA decay pathway in which polyadenylation leads to decapping. However, this antibody resource is
limiting and the efficiency of cap selection is not clear. In
related studies, a monoclonal antibody directed against 2,2,7trimethylguanosine was generated and used to purify small
nuclear RNAs (8) and to demonstrate the presence of a caplike structure at the 59 end of mutant b-globin transcripts (17).
Although the antibody is not limiting, its use in purifying
capped mRNAs is somewhat restricted because of its 15- to
20-fold-lower affinity for m7G cap structures relative to that for
trimethylated caps (8, 17). The use of a bifunctional cap-binding protein, such as protein A–meIF-4E, provides a highly
efficient and specific method for cap selection. An additional
advantage is the stability of the fusion polypeptide. We have
stored a preparation of protein A–meIF-4E for over a year at
48C without loss of cap binding activity (25a).
Although the most common method of eukaryotic mRNA
purification involves affinity selection with oligo(dT) cellulose
(3), our method is comparable in efficiency. One advantage of
using CAPture is that since the poly(A) tails of mRNAs undergo processing to different lengths, this may affect the efficiency of oligo(dT) selection; however, these same RNAs
should serve as equal substrates for purification by CAPture.
CAPture could thus be used to identify novel poly(A)2
mRNAs, a class of transcripts not very well characterized. As
far as we are aware, the use of RNA purified by CAPture is the
Downloaded from http://mcb.asm.org/ on February 23, 2013 by PENN STATE UNIV
primary plugs. The nonchimeric eIF-4E clones contained inserts ranging from ;560 bp to 2.3 kbp (25a). Two of the
longest clones that were plaque purified and characterized by
sequencing have the positions of their 59 ends indicated in Fig.
6A. In this initial screen, 1 of 59 clones had sequence information which extended into the 59 UTR of the mRNA.
To determine if a CAPture step could be incorporated into
cDNA library construction protocols to significantly enrich for
full-length or mRNA 59-end clones, two libraries were generated with RNA isolated from mouse embryos, placenta, and
uterus. RNA was primed either with degenerate hexamers or
with oligo(dT). Both libraries were screened with radiolabelled
eIF-4E cDNA, resulting in the identification of 13 and 19 l
ZAP clones from the oligo(dT) and random-primed libraries,
respectively. The 59 ends of eight randomly selected clones
[three from the oligo(dT) and five from the random-primed
cDNA libraries] were sequenced and found to map within 35
nucleotides of the previously defined 59 end of the eIF-4E gene
(Fig. 6B). Two of the new clones isolated from the CAPture
libraries extended beyond the longest known cDNA (Fig. 6A)
to the 59-most primer extension site (16).
Southern blot analysis of the clones obtained from the oligo(dT) library revealed that three clones from this library were
chimeric (data not shown). Of the nonchimeric clones, 7 of 10
were full-length or nearly full-length (i.e., within 100 bp of the
known 59 end). These results strongly suggest that CAPture
can be used during cDNA library construction to significantly
increase the representation of full-length or nearly full-length
clones.
VOL. 15, 1995
CAP-AFFINITY SELECTION OF EUKARYOTIC mRNAs AND cDNAs
3369
FIG. 5. CAPture efficiencies of cDNAs generated with either AMV or Superscript II RT. (A) Predicted secondary structure of the TAR element (24). An
RNA substrate (TAR-CAT) was generated by in vitro transcription of plasmid
pSP64(1111)/CAT linearized with PvuI by using SP6 RNA polymerase (24). The
numbers indicate the positions of bases relative to the cap structure. The RT
reaction was performed in the presence of [a-32P]dCTP with a cRNA oligonucleotide positioned 2.9 kb from the cap structure. (B) Analysis of the products of
first-strand cDNA synthesis analyzed on a 1.2% alkaline agarose gel. Lane 1,
cDNA synthesized with AMV RT; lane 2, RNase A treatment and CAPture of
the material analyzed in lane 1; lane 3, cDNA synthesized with Superscript II;
lane 4, RNase A treatment and CAPture of the material analyzed in lane 3. The
full-length cDNA is denoted by an arrowhead. cDNAs were visualized by autoradiography by exposing the dried gel to X-Omat film (Kodak) for 15 h at 2708C
with an intensifying screen.
first useful way to build a library in which nonpolyadenylated
mRNAs are equally represented.
A key requirement for CAPture to work is that the cap
structure be accessible for binding to protein A–meIF-4E. Secondary structure within the mRNA 59 UTR may prevent efficient cap recognition by sequestering the cap (26). Denaturation of the mRNA with methylmercury hydroxide before cap
selection should circumvent this potential problem. The presence of degraded RNA in the starting material will also decrease the yield of full-length material following CAPture.
One can guarantee that the input mRNA is full-length by cap
selecting the poly(A)1 mRNA before cDNA library construction. This preselection will maximize the amount of cDNARNA hybrids that can be purified by CAPture. RNA polymerase I and III transcripts are not capped and should not be
present in our cDNA libraries. However, small nuclear RNAs
should be retained by CAPture, albeit at reduced efficiency,
since the affinity of m2,2,7G-terminated RNAs for eIF-4E is
10-fold lower than that of m7G-terminated RNA (11). Thus,
this procedure could also be used to identify novel small nuclear RNAs.
There is a significant difference between the yeast and murine eIF-4E fusion proteins in their ability to form detectable
protein-RNA complexes (Fig. 2). We do not know what could
be responsible for this difference, but it is noteworthy that cap
structures in yeast cells are cap 0, whereas those in mammalian
cells include cap 1, 2, and 3 (5). Thus, evolutionary pressure to
evolve a factor which could effectively recognize these variants
of the cap may have resulted in a molecule with a higher
affinity and/or stability for cap 0. The creation of a fusion
protein with meIF-4E somewhat reduced the efficiency of cap
recognition (Fig. 2C). In our model system, 65% of capped
input RNA was specifically retained by CAPture (Fig. 3B). It is
possible that steric constraints imposed upon the cap binding
activity by the creation of a fusion molecule resulted in a hybrid
with lowered affinity and/or stability for the cap structure. The
introduction of the l repressor linker domain between the two
functional domains, or fusion to an alternative affinity tag, may
improve the preservation of cap recognition and result in a
molecule with higher affinity and/or stability.
The use of RNase A to degrade less-than-full-length cDNARNA duplexes following first-strand synthesis allowed us to
employ CAPture to enrich for full-length cDNAs. When we
generated cDNA libraries using CAPture and screened for
eIF-4E cDNAs, although most clones were within 45 bp of the
59 end, the majority did not extend completely to the 59-end
nucleotide (Fig. 6B). It is very likely that the RNase A treat-
Downloaded from http://mcb.asm.org/ on February 23, 2013 by PENN STATE UNIV
FIG. 6. Comparison of 59-terminal nucleotide sequences of putative fulllength cDNA clones. (A) Primer extension sites and 59 ends of eIF-4E cDNAs.
The downward arrows indicate the STIs, as previously defined by primer extension studies (16). The dots indicate the 59 ends of the longest cDNAs isolated
from a lgt 11 cDNA library screen (16). (B) 59 ends of cDNAs isolated from
libraries incorporating a CAPture step. The solid squares indicate the 59 ends of
clones isolated from the random-primed library, whereas the upward arrows
show the 59 ends of clones isolated from the oligo(dT) library. Note that two of
the clones extend the known eIF-4E sequence by 8 nucleotides to the 59-most
primer extension site. The initiator ATG codon is underlined.
3370
EDERY ET AL.
ACKNOWLEDGMENTS
We thank Arnim Pause for his kind gift of purified murine eIF-4E.
We thank Charles Goyer and Antony Blanc for helpful comments and
insights during some of the early stages of this project. We thank
Michael Altmann for the yeast eIF-4E cDNA clone and helpful insights.
J.P. is a Medical Research Council scholar. This work was supported
by grants from the Medical Research Council of Canada to N.S. and
from the Canadian Genome Analysis and Technology (CGAT) Program to J.P.
REFERENCES
1. Altmann, M., C. Handschin, and H. Trachsel. 1987. mRNA cap-binding
protein: cloning of the gene encoding protein synthesis initiation factor
eIF-4E from Saccharomyces cerevisiae. Mol. Cell. Biol. 7:998–1003.
2. Auffray, C., and F. Rougeon. 1980. Purification of mouse immunoglobulin
heavy-chain messenger RNAs from total myeloma tumor RNA. Eur. J.
Biochem. 107:303–314.
3. Aviv, H., and P. Leder. 1972. Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose. Proc.
Natl. Acad. Sci. USA 69:1408–1412.
4. Babich, A., J. R. Nevins, and J. E. Darnell. 1980. Early capping of transcripts
from the adenovirus major late transcription unit. Nature (London) 287:
246–248.
5. Banerjee, A. K. 1980. 59-terminal cap structure in eukaryotic messenger
ribonucleic acids. Microbiol. Rev. 44:175–205.
6. Ben-Neriah, Y., A. L. Bernards, M. Paskind, G. Q. Daley, and D. Baltimore.
1986. Alternative 59 exons in c-abl mRNA. Cell 44:577–586.
7. Bishop, J. O., J. G. Morton, M. Rosbash, and M. Richardson. 1974. Three
abundance classes in HeLa cell messenger RNA. Nature (London) 250:199–
204.
8. Bochnig, P., R. Reuter, P. Bringmann, and R. Lührmann. 1987. A monoclonal antibody against 2,2,7-trimethylguanosine that reacts with intact, class
U, small nuclear ribonucleoproteins as well as with 7-methylguanosinecapped RNAs. Eur. J. Biochem. 168:461–467.
9. Buckler, A. J., D. D. Chang, S. L. Graw, J. D. Brook, D. A. Haber, P. A.
Sharp, and D. E. Housman. 1991. Exon amplification: a strategy to isolate
mammalian genes based on RNA splicing. Proc. Natl. Acad. Sci. USA
88:4005–4009.
10. Cross, S. H., J. A. Charlton, X. Nan, and A. P. Bird. 1994. Purification of
CpG islands using a methylated DNA binding column. Nat. Genet. 6:236–
244.
11. Darzynkiewicz, E., J. Stepinski, I. Ekiel, Y. Jin, D. Haber, T. Sijuwade, and
S. M. Tahara. 1988. b-Globin mRNAs capped with m7G, m2,7(2)G or
m2,2,7(3)G differ in intrinsic translation efficiency. Nucleic Acids Res. 16:
8953–8962.
12. de Magistris, L., and H. G. Stunnenberg. 1988. Cis-acting sequences affecting the length of the poly (A) head of vaccinia virus late transcripts. Nucleic
Acids Res. 16:3141–3156.
13. Edery, I., M. Altmann, and N. Sonenberg. 1988. High-level synthesis in
Escherichia coli of functional cap-binding eukaryotic initiation factor eIF-4E
and affinity purification using a simplified cap-analog resin. Gene 74:517–525.
14. Gubler, U., and B. J. Hoffman. 1983. A simple and very efficient method for
generating cDNA libraries. Gene 25:263–269.
15. Izaurralde, E., J. Lewis, C. McGuigan, M. Jankowska, E. Darzynkiewicz, and
I. W. Mattaj. 1994. A nuclear cap binding protein complex is involved in
pre-mRNA splicing. Cell 78:657–669.
16. Jaramillo, M., J. Pelletier, I. Edery, P. J. Nielsen, and N. Sonenberg. 1991.
Multiple mRNAs encode the murine translation initiation factor eIF-4E. J.
Biol. Chem. 266:10446–10451.
17. Lim, S.-K., and L. E. Maquat. 1992. Human b-globin mRNAs that harbor a
nonsense codon are degraded in murine erythroid tissues to intermediates
lacking regions of exon I or exons I and II that have a cap-like structure at
the 59 termini. EMBO J. 11:3271–3278.
18. McCormick, M. K., J. H. Shero, M. C. Cheung, Y. W. Kan, P. A. Hieter, and
S. E. Anronarakis. 1989. Construction of human chromosome 21-specific
yeast artificial chromosomes. Proc. Natl. Acad. Sci. USA 86:9991–9995.
19. Monaco, A. P., R. L. Neve, C. Colletti-Feener, C. J. Bertelson, D. M. Kurnit,
and L. M. Kunkel. 1986. Isolation of candidate cDNAs for portions of the
Duchenne muscular dystrophy gene. Nature (London) 323:646–650.
20. Muhlrad, D., C. J. Decker, and R. Parker. 1994. Deadenylation of the
unstable mRNA encoded by the yeast MFA2 gene leads to decapping followed by 59-39 digestion of the transcript. Genes Dev. 8:855–866.
21. Okayama, H., and P. Berg. 1982. High-efficiency cloning of full-length
cDNA. Mol. Cell. Biol. 2:161–170.
22. Pabo, C. O., R. T. Sauer, J. M. Sturtevant, and M. Ptashne. 1979. The l
repressor contains two domains. Proc. Natl. Acad. Sci. USA 76:1608–1612.
23. Parimoo, S., S. R. Patanjali, H. Shukla, D. D. Chaplin, and S. M. Weissman.
1991. cDNA selection: efficient PCR approach for the selection of cDNAs
encoded in large chromosomal DNA fragments. Proc. Natl. Acad. Sci. USA
88:9623–9627.
24. Parkin, N. T., E. A. Cohen, A. Darveau, C. Rosen, W. Haseltine, and N.
Sonenberg. 1988. Mutational analysis of the 59 non-coding region of human
immunodeficiency virus type 1: effects of secondary structure on translation.
EMBO J. 7:2831–2837.
25. Patanjali, S., S. Parimoo, and S. M. Weissman. 1991. Construction of a
uniform-abundance (normalized) cDNA library. Proc. Natl. Acad. Sci. USA
88:1943–1947.
25a.Pelletier, J. Unpublished data.
26. Pelletier, J., and N. Sonenberg. 1985. Insertion mutagenesis to increase
secondary structure within the 59 noncoding region of a eukaryotic mRNA
reduces translational efficiency. Cell 40:515–526.
27. Rychlik, W., L. L. Domier, P. R. Gardner, G. M. Hellman, and R. E. Rhoads.
1987. Amino acid sequence of the mRNA cap-binding protein from human
tissues. Proc. Natl. Acad. Sci. USA 84:945–949.
28. Sauer, R. T. 1978. DNA sequence of the bacteriophage l cI gene. Nature
(London) 276:301–302.
Downloaded from http://mcb.asm.org/ on February 23, 2013 by PENN STATE UNIV
ment following cDNA synthesis occurred under limiting conditions. Careful titration of the nuclease is required to achieve
the greatest molar amounts of full-length cDNAs (a defined
internal control cDNA-RNA hybrid would be useful for this
purpose). Nevertheless, the power of this method is clearly
demonstrated by the ability to select full-length TAR-CAT
cDNAs from a large excess of incomplete cDNAs (Fig. 5B).
When an mRNA molecule is purine rich at the 59 end, cleavage
by RNase A will not occur because of the pyrimidine specificity
of the enzyme, resulting in the retention of incomplete cDNAs
by CAPture. A combination of RNases A and T1 (which
cleaves Gp-N) should qualitatively improve the procedure.
Furthermore, any RNA modifications which diminish the rate
of RT processivity, such as naturally occurring base methylation (37), will decrease the initial amounts of full-length starting material. During second-strand synthesis, a number of
bases may also be removed from the 59 end by RNase H
degradation of the RNA or by the 59-to-39 exonuclease activity
of DNA polymerase I. This last issue can be resolved by tailing
of the product of first-strand synthesis with terminal deoxynucleotidyl transferase, followed by annealing of a complementary-tailed linker, as previously described (21). During repair synthesis, the annealed linker DNA serves as a primer,
maintaining the integrity of the 59 end (21).
We have shown that CAPture can be used to improve the
quality of current cDNA libraries. This method substantially
enriches for complete or nearly complete cDNAs. We have
shown the feasibility of this procedure by probing a library
subjected to CAPture for eIF-4E cDNAs (Fig. 6) and significantly enriching it for full-length or nearly full-length cDNAs.
Random-primed libraries made by CAPture may prove a better resource than oligo(dT)-primed libraries for identifying the
59 ends of particularly difficult transcripts (e.g., those exceptionally long or with an extensive secondary structure), since
they challenge the limitations of the RT reaction.
The UTRs of many mRNAs contain cis-acting signals which
can quantitatively and qualitatively influence gene regulation.
However, current cDNA screens are often terminated once an
initiator codon of the gene of interest has been identified since
functional studies of a novel gene product require only the
coding region. Thus, an underrepresentation of mRNA 59
UTRs likely exists in the current catalogs of cloned genes. This
deficiency can lead to an underestimation of the importance of
59 UTRs in regulating gene expression. Libraries made by
using the CAPture technique have the potential to fill this void
and complement existing sequence information. The ability to
generate full-length and 59-end-enriched libraries should facilitate mapping of STIs and considerably reduce the amount of
time required to obtain functional clones of interest. This
method is easily adaptable to 59 rapid amplification of cDNA
ends and primer extension to allow the quick identification of
STIs.
MOL. CELL. BIOL.
VOL. 15, 1995
CAP-AFFINITY SELECTION OF EUKARYOTIC mRNAs AND cDNAs
29. Schwer, B., P. Visca, J. C. Vos, and H. G. Stunnenberg. 1987. Discontinuous
transcription or RNA processing of vaccinia virus late messengers results in
a 59 poly(A) leader. Cell 50:163–169.
30. Shatkin, A. J. 1985. mRNA cap binding proteins: essential factors for initiating translation. Cell 40:223–224.
31. Sonenberg, N. 1988. Cap-binding proteins of eukaryotic messenger RNA:
functions in initiation and control of translation. Prog. Nucleic Acid Res.
Mol. Biol. 35:173–207.
32. Spies, T., G. Blanck, M. Bresnahan, J. Sands, and J. L. Strominger. 1989. A
new cluster of genes within the human major histocompatibility complex.
Science 243:214–217.
33. Spies, T., M. Bresnahan, and J. L. Strominger. 1989. Human major histocompatibility complex contains a minimum of 19 genes between the complement cluster and HLA-B. Proc. Natl. Acad. Sci. USA 86:8955–8958.
34. Sternberg, N. 1990. A bacteriophage P1 cloning system for the isolation,
35.
36.
37.
38.
3371
amplification, and recovery of DNA fragments as large as 100 kb. Proc. Natl.
Acad. Sci. USA 87:103–107.
Thomas, P. 1980. Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77:5201–
5205.
Tinoco, I., P. N. Borer, B. Dengler, M. D. Levine, O. C. Uhlenbeck, D. M.
Crothers, and J. Gralla. 1973. Improved estimations of secondary structure
in ribonucleic acids. Nature (London) New Biol. 246:40–41.
Youvan, D. C., and J. E. Hearst. 1979. Reverse transcriptase pauses at
N2-methylguanine during in vitro transcription of Escherichia coli 16S ribosomal RNA. Proc. Natl. Acad. Sci. USA 76:3751–3754.
Zabeau, M., and K. K. Stanley. 1982. Enhanced expression of cro-b-galactosidase fusion proteins under the control of the Pr promoter of bacteriophage l. EMBO J. 1:1217–1224.
Downloaded from http://mcb.asm.org/ on February 23, 2013 by PENN STATE UNIV