volume 14 Number 5 1986
Nucleic Acids Research
Footprinting reveals that nogalamycin and actinomydn shuffle between DNA binding sites
Keith R.Fox and Michael J.Waring
Department of Pharmacology, Medical School, University of Cambridge, Hills Road, Cambridge
CB2 2QD, UK
Received 17 December 1985; Revised and Accepted 10 February 1986
ABSTRACT
The hypothesis that sequence-selective DNA-binding antibiotics locate
their preferred binding s i t e s by a process involving migration from nonspecific sites has been tested by footprinting with DNAase I. Pootprinting
patterns on the tyrT DNA fragment produced by nogalamycin and actinomycin
change with time after mixing the a n t i b i o t i c with the DNA. Sites of
protection as well as enhanced cleavage are seen to develop in a fashion which
is both temperature and concentration-dependent. At certain sites cutting is
transiently enhanced, then blocked. Limited evidence for slow reaction with
echinomycin and mithramycin i s presented, but the kinetics of footprinting
with daunomycin and distamycin appear instantaneous. Thefeasibility of
adducing direct evidence for shuffling by footprinting seems to be governed by
slow dissociation of the antibiotic-DNA complex. I t may also be dependent
upon the mode of binding, be i t i n t e r c a l a t i v e or non-intercalative in
character.
INTRODUCTION
The biochemical target for many clinically important antitumour drugs is
DNA, which they recognize with varying degrees of specificity [1,2]. Among
them are several antibiotics such as actinomycin, which binds to the sequence
GpC [3,4], echinomycin which recognizes the step CpG [5,6] and nogalamycin
which binds preferentially to regions of mixed sequence containing alternating
purines and pyrimidines [7], For any ligand endowed with s e l e c t i v i t y for
binding to different nucleotide sequences the question a r i s e s as to how i t
locates i t s preferred binding s i t e ( s ) , discriminating against the more
abundant weaker sites.
We have previously suggested that this is achieved by a process in which
the a n t i b o t i c i n i t i a l l y binds to many sequences on the heterogeneous DNA
l a t t i c e and subsequently 'shuffles' between the available binding s i t e s , by
randomly dissociating and reattaching, until the optimal state of binding is
attained [8-10]. The main evidence for this hypothesis comes from studying
dissociation profiles of complexes formed between antibiotics and natural DNA
O IRL Press Limited, Oxford, England.
2001
Nucleic Acids Research
fragments, the time constants for which vary depending upon how long the
ligand and DNA have been in contact
[9,10].
By contrast, in identical
experiments with synthetic DNAs containing only one or two types of binding
sites the equilibrium state is quickly attained, and 'shuffling' cannot be
detected.
However, in order to confirm the shuffling hypothesis it would
clearly be desirable to adopt a more direct method for visualizing the
location of the ligand on the DNA lattice at various stages during the
approach to equilibrium.
Footprinting is a technique that has been expressly developed to identify
the precise binding sites of several ligands on DNA fragments of defined
sequence [4-7,11,12].
Sites to which the antibiotic is bound are protected
from enzymatic (or chemical) cleavage and are visualized at single bond
resolution as gaps in the autoradiograph of a denaturing polyacrylamide gel.
In this paper we set out to test the shuffling hypothesis with several
antibiotics, using the technique of DNAase I footprinting to locate the
position of the antibiotic molecules on a defined piece of DNA at various
times after mixing.
MATERIALS AND METBOOS
Antibiotics and enzymes
Nogalaraycin was a gift from Dr P.F. Wiley, the Upjohn Company, Kalamazco,
MI, USA. Actinomycin D was a product of Merck Sharp and Dohme. Daunomycin
and distamycin were g i f t s from Dr F. Arcamone, Farmitalia, Milan, I t a l y .
Echinomycin was obtained from Drs H. Bickel and K. Scheibli of CIBA-Geigy
Ltd., Basel, Switzerland and mithramycin from Pfizer Inc., USA. Stock
solutions of each a n t i b i o t i c (except echinomycin) were prepared by d i r e c t
weighing and dissolved in lOmM tris-HCl, pH 7.5, containing lOmM NaCl. A
stock solution of echinomycin was prepared in methanol and diluted with the
above buffer immediately before use to give a final methanol concentration not
exceeding 10% (v/v). Deoxyribonuclease I (DNAase I) was obtained from Sigma
and prepared as a 7200 units/ml stock solution in 0.15M NaCl containing lmM
MgCl2- Ifc w a s stored at -20°C and diluted to working concentrations
immediately before use. Dilution was effected in the digestion buffer which
contained 20mM NaCl, 2mM MgCl2 and 2mM HnCl2- Controls were performed to
verify that the presence of 10% (v/v) methanol had no perceptible effect on
the digestion pattern [5].
DNA substrate
The 160 base-pair tyrT DNA fragment (Figure 1) was isolated and labelled
2002
Nucleic Acids Research
3'-TTAAGGCCAATGQAAATTAGGCAATGCCTACTTTTAATGCaTTaGTCAAGTAAAAAGAGTTGCATTQTGAAATGTCGCCQCQCA
CATTTGATATGATGCGCCCCGCTTCCCGATAAGGGAGCAGGCCAGTAAAAAGCATTACCCCGTGGTGGGGGTTCCCG
M
•
tO
•
100
•
I 10
•
|M
•
1»
•
140
•
ISO
- 3'
•
GTAAACTATACTACGCGGGQCGAAGGGCTATTCCCTCGTCCGQTCATTTTTCGTAATGGGGCACCACCCCCAAGGQCT-5'
Figure 1.
Sequence and numbering scheme for the tyrT DMA fragment.
as previously described [4,5,13]. Incubation with reverse transcriptase, dTTP
and a-[32p]dATP led to selective labelling of the 3'-end at the EcoRI s i t e on
the lower ("Crick", non-transcribed) strand.
ENAase 2. footprinting
Samples (lul) of the labelled tyrT ENA fragment (3 pmoles in base pairs)
were incubated for various periods of time with 1.5ul of a n t i b i o t i c solution
then d i g e s t e d with l u l of a s u i t a b l e c o n c e n t r a t i o n of DNAase I for b r i e f
p e r i o d s as i n d i c a t e d in the t e x t . When d i g e s t i o n was c a r r i e d out for 15
seconds or longer the r e a c t i o n was stopped by adding 3ul of80% formamide
c o n t a i n i n g 0.1% bromophenol blue and lOmM EDTA. In experiments r e q u i r i n g
s h o r t e r d i g e s t i o n t i m e s (5 seconds) the r e a c t i o n was stopped by f r e e z i n g on
dry i c e . Samples were heated a t 100°C for a t l e a s t 3 minutes p r i o r t o
electrophoresis.
Gel electrophoresis
The products of tyrT d i g e s t i o n were analysed on 0.3mm 8% (w/v)
polyacrylamide g e l s c o n t a i n i n g 7M urea and t r i s - b o r a t e EDTA b u f f e r , pH 8.3.
After 2 hours electrophoresis at 1500V the gel was soaked in 10% acetic acid
for 10 minutes, transferred to Whatman 3MM paper, dried under vacuum a t 80°C
and subjected to autoradiography a t -70°C with an intensifying screen. Bands
in the digestion pattern were assigned by using d i m e t h y l s u l p h a t e - p i p e r i d i n e
markers specific for guanine.
RESULTS
Nogalamycin
Nogalamycin (Fig 2) i s an unusual anthracycline a n t i b i o t i c which bears
bulky sugar substituents at both ends of i t s aromatic chromophore [14]. Like
the-simpler anthracyclines i t binds to DNA via the mechanism of intercalation
[15,16], yet the reaction i s peculiar in that the a n t i b i o t i c molecule comes to
l i e with sugar residues in both ENA grooves and the chromophore spanning the
h e l i x [14,17], I t seems c l e a r t h a t t h e mechanism of binding must r e q u i r e a
t r a n s i e n t l o c a l d e n a t u r a t i o n of t h e DNA h e l i x [17,18] and we have suggested
2003
Nucleic Acids Research
OCH3
L-fro
L
V
L-lf
o-v.i
M.V.I o-v«i
M.V.I
V vH
CO
N
CO
NH,
B
•o^V^o
CH,
CH,
O M . OMe
/
L-AU
N' DIM*
\ L-Cyl
CHj
'
'
I
V
/
L-N-M.V»I
\
\
r
"»
N-M.
I
\
HC-NH
II
O
L-N-MtV»l /
CH,
\
L-AI*
I
/
- - '
CONH
CONH-CH.-CH.-C +
CH,
Figure 2. Structures of (A) actinomycin D; (B) nogalainycin; (C) echinomycin;
(D) distaraycin; (E) mlthramycin.
20O4
Nucleic Acids Research
that this requirement is likely to favour initial binding to AT-rich regions
before the a n t i b i o t i c "shuffles" onto i t s preferred binding s i t e s [18].
Nogalamycin has also been shown to dissociate very slowly from DNA [19], which
is decidedly advantageous for footprinting studies since the rate of shuffling
must be limited by the rate of dissociation from non-specific s i t e s .
Accordingly we chose to investigate dynamic aspects of footprinting with this
ligand f i r s t .
Figure 3 displays the DNAase I digestion pattern observed for the tyrT
DNA fragment in the presence of IJJM nogalamycin after various times of mixing.
Looking first at the results obtained at 37°C i t is readily apparent that the
pattern of cleavage does indeed change with time after mixing. Short periods
of incubation (lanes i and j) yield cleavage patterns quite similar to that in
the absence of a n t i b i o t i c (lane h). The s i t e s of blockage (Table 1) around
positions 57 and 69 are not fully developed u n t i l 10 minutes after mixing
(lane 1). The other regions protected around positions 21, 34 and 89 are also
time-dependent, as too are the regions of enhanced cleavage seen around
positions 28 and 81. It is also worth noting that the observed changes do not
all develop at the same rate; generally enhancement effects are visible before
the blockages appear, presumably because they can be induced by ligand binding
anywhere within a local region whereas blockages require precise antibiotic
binding [7]. The behaviour of bands 67 and 75 i s unusual in that they both
appear enhanced after short mixing times, yet blocked at equilibrium.
Also included in Figure 3 are the r e s u l t s of similar experiments
performed at 20°C and 60°C, changing the enzyme concentration to maintain a
similar extent of digestion. At 20°C the entire footprinting pattern develops
more slowly; the blockages at positions 21, 57 and 70 are not fully apparent
until 1 hour after mixing. Protection at positions 34 and 89 is even slower
to develop, as too is the enhancement at position 28. The latter observation
may provide the first evidence that this enhancement is induced by antibiotic
binding at position 34 on i t s 5'side rather than position 21. The pattern
measured at60°Cis broadly similar to that at 37°C but develops much more
rapidly.
If these time-dependent changes in the pattern of cleavage are really due
to nogalamycin shuffling over the available DNA binding s i t e s , then the
results should be dependent on the concentration of the antibiotic. At high
ligand concentrations the DNA l a t t i c e should quickly become saturated and
shuffling will no longer be possible. We find that t h i s i s indeed the case.
As the nogalamycin concentration is raised the footprinting pattern changes,
2005
Nucleic Acids Research
1fiM nogalamycin
20°C
37°C 60°C
abcdefgl hi JklHclnopqrs
40^-
201
2006
Nucleic Acids Research
Table 1
Regions of tyrT fragment protected from DNAase I cleavage by actinomycin D and
nogalamycin.
Actinomycin D
Nogalamycin
34 - 38 (site 1)
16 - 22
68 - 75 (site 2)
30 - 36
91 - 102 (site 3)
54 - 59
112 - 119 (site 4)
65 - 70
128 - 135 (site 5)
86 - 93
114 - 118
consistent with our supposition that this antibiotic is not endowed with any
absolute sequence s p e c i f i c i t y . At 37°C with 25uM nogalamycin the final
equilibrium pattern is attained in less than 1 minute. Lowering the
antibiotic concentration to 7.5pM produces a footprinting pattern similar to
that seen at equilibrium with luM ligand, yet by 2 minutes the equilibrium
pattern is completely established.
Figure 4 displays the results of
experiments performed with 2.5pM nogalamycin. In general the pattern of
protected and enhanced bands is similar to that produced by lpM antibiotic but
the rate at which the pattern develops is considerably increased. For
example, consider the protection around position 57 which is now complete 2
minutes after mixing (lane i) as compared with 10 minutes with luM nogalamycin
(lane 1 in Figure 3). Also shown in Figure 4 are the r e s u l t s of mixing the
antibiotic and CNA at 4°C. In this case the pattern hardly changes even after
Figure3. ENAase I digestion patterns for tyrT ENA (labelled at the 3' end of
thebottom strand) in the presence of luM nogalamycin at various times after
mixing the a n t i b i o t i c and DNA. The digestion was performed under the
following conditions:
Lanes (a-g) 20°C, 1 minute digests, enzyme concentration 0.09 units/ml;
lanes (h-ro) 37°C, 1 minute digests, enzyme concentration 0.03 units/ml;
lanes (n-s) 60°C, 15 second digests, enzyme concentration 0.09 units/ml.
Lanes (a,h,n) represent controls performed in the absence of the antibiotic.
The a n t i b i o t i c and DNA were mixed for the following periods of time before
digestion: b, 2 minutes; c, 5 minutes; d, 10 minutes; e, 20 minutes; f, 60
minutes; g, 120 minutes; i , 1 minute; j , 2 minutes; k, 5 minutes; 1, 10
minutes; m, 30 minutes; o, 15 seconds; p, 30 seconds; q, 1 minute; r, 2
minutes; s, 5 minutes. The track labelled 'C shows a hydrazine-piperidine
marker specific for cytosine.
2007
Nucleic Acids Research
2.5JJM
4°C
nogalamycin
37°C
60°C
abcdeflGlghl J kljoinnopq rs
2008
Nucleic Acids Research
exposure of the DNA to the a n t i b i o t i c for 2 hours, although a weak blockage
around position 70 and enhancement at position 81 are detectable. If the same
experiment i s performed by mixing the a n t i b i o t i c and DNA at 37°C and then
cooling to 4°C before adding the enzyme, a clear footprinting pattern i s
obtained. Thus the apparent lack of effect of nogalamycin at 4°C must be a
kinetic phenomenon resulting from the very slow dissociation of the ligand
from the DNA, no doubt reflecting the slow rate of 'breathing' of the DNA
helix.
Actinomycin D
Previous footprinting experiments with actinomycin D using the tyrT DNA
fragment demonstrated that i t only binds to the dinucleotide step GpC [4]
(Table 1). However, quite detailed studies of the association reaction between
the antibiotic and DNA have revealed that i t is a complex process, requiring
no less than five exponentials for a complete description [9,20]. Although
this manifest complexity was originally interpreted as resulting from slow
conformational changes in the a n t i b i o t i c and/or DNA we recently suggested
that the slow components could represent ligand molecules shuffling from nonspecific to preferred binding s i t e s [9]. Since the dissociation of
actinomycin from mixed-sequence DNA [9] is generally faster than that of
nogalamycin [19] we anticipated that the shuffling process might occur
correspondingly faster. With this in mind all footprinting experiments aimed
at detecting shuffling of actinomycin were performed at 4°C
Figure 5 shows the DNAase I digestion pattern observed in the presence of
7.5uH actinomycin D a t various times after mixing the ligand and tyrT DNA.
Once again the antibiotic-induced footprinting pattern i s slow to develop.
For example the blockage around positions 36 (site 1), 74 (site 2) and 118
( s i t e 4) i s not complete u n t i l 10-30 minutes after mixing. The same timescale applies to the development of enhanced cleavage around positions 55 and
Figure 4. DNAase I digestion patterns for tyrT DNA incubated in the presence of
2.5(aM nogalamycin for various periods of time before adding the enzyme.
Digestion was performed under the following conditions:
Lanes (a-f) 4°C, 1 minute digests, enzyme concentration 0.18 units/ml;
lanes (g-1) 37°C, 1 minute digests, enzyme concentration 0.03 units/ml;
lanes (m-s) 60°C, 15 second digests, enzyme concentration 0.10 units/M.;
Lanes (a,g,m) represent controls performed in the absence of the antibiotic.
The antibiotic and ENA were mixed for the following times before digestion: b,
2 minutes; c, 5 minutes; d, 20 minutes; e, 60 minutes; f, 120 minutes; h, 1
minute; i , 2 minutes; j , 5 minutes; k, 10 minutes; 1, 30 minutes; n, 15
seconds; o, 30 seconds; p, 1 minute; q, 2 minutes; r, 5 minutes; s, 20
minutes. The tracks labelled 'G' represent dimethylsulphate-piperidine
markers specific for guanine.
2009
Nucleic Acids Research
actlnomycin D
Q a b c d e f
1401
1201
1001
80 *~
60
•
40 *~
2010
gh
i
Nucleic Acids Research
82. I t appears then that actinomycin i s also capable of shuffling between
various sites on the DNA until optimal binding is achieved.
Further experiments were performed to investigate the effect of
actinomycin concentration on the rate of appearance of the specific
footprinting pattern. Again we found that at higher antibiotic concentrations
the pattern develops much faster. For example, the blockage around position
118 (site 4) appears fully developed after 30 minutes, 10 minutes and 1 minute
at ligand concentrations of 5uM, 15uM and 50uH respectively. In each case the
protection afforded around position 74 (site 2) appears sooner than that at
site 4, but once more the rate is dependent on the antibiotic concentration.
Other Antibiotics (Fig 2)
For purposes of comparison we undertook a similar series of experiments
to examine the kinetics of appearance of footprinting patterns induced by
mithramycin, echinomycin, distamycin and daunomycin. With mithramycin, which
binds preferentially to the sequence GpG [21,22] and requires the presence of
magnesium ions [23, 24] the footprinting pattern develops rapidly (less than 5
seconds) even at 4°C provided the a n t i b i o t i c i s pre-equilibrated with
magnesium. If, however, the ligand is dissolved in a magnesium-free buffer so
that i t f i r s t encounters the divalent ion on addition of enzyme, the
footprinting pattern emerges slowly in a manner similar to that seen with
actinomycin. In t h i s instance we cannot be c e r t a i n that the slow onset is
genuinely a t t r i b u t a b l e to shuffling since i t might merely reflect the slow
interaction of the antibiotic with the low concentration of magnesium.
From a detailed examination of reaction kinetics we previously suggested
that the bifunctional intercalating peptide antibioticechinomycin shuffles
between available DNA binding s i t e s at a r a t e s i m i l a r to i t s observed
dissociation from putative non-specific binding sites [10]. In footprinting
experiments performed at 4°C we again observed that the c h a r a c t e r i s t i c
echinomycin pattern develops slowly in a fashion similar to that seen with
actinoraycin D, but faster. While we are of the opinion that t h i s probably
does represent the shuffling reaction some care must be exercised in
Figure5. DNAase I digestion pattern of tyrT DNA in the presence of 7.5pM
actinomycin D at various times after mixing at 4°C. All samples were digested
for 5 seconds with an enzyme concentration of 1.8 units/ml. Lane (a)
represents a control performed in the absence of antibiotic. Actinomycin and
ENA were left in contact for the following periods of time before digestion:
(b) 5 seconds; (c) 10 seconds; (d) 30 seconds; (e) 1 minute; (f) 2 minutes;
(g) 5 minutes; (h) 10 minutes; (i) 30 minutes. The track labelled 'G'
represents a dimethylsulphate-piperidine marker specific for guanine.
2011
Nucleic Acids Research
i n t e r p r e t i n g these r e s u l t s . Echinomycin i s not r e a d i l y soluble in aqueous
buffers, so there i s consequently some r i s k t h a t the a n t i b i o t i c may
p r e c i p i t a t e from solution on d i l u t i n g from the methanol stock, with the
r e s u l t t h a t the slow k i n e t i c s could represent the r e d i s s o l u t i o n of the
antibiotic in the presence of DNA.
With neither daunomycin nor distamycin was any time-dependence detected
as regards the appearance of their footprinting patterns. Even at 4°C, where
both a n t i b i o t i c s produce s i g n i f i c a n t changes in the DNAase I d i g e s t i o n
p a t t e r n , the r e a c t i o n i s complete within 5 seconds. This observation i s
hardly s u r p r i s i n g for daunomycin which displays l i t t l e sequence-selectivity
and d i s s o c i a t e s r a p i d l y from DNA [19], f a c t o r s which must favour rapid
attainment of optimal binding equilibrium, but the finding with distamycin was
unexpected.Distamycin binds t i g h t l y t o AT-rich regions of DNA and produces
specific footprinting patterns at notably low concentrations (less than luM)
[4]. We therefore anticipated that i t s dissociation from DNA would be slow,
leading t o a r e a d i l y observable shuffling r e a c t i o n . Not so. I t s p e c u l i a r
behaviour will be considered below.
DISCUSSION
The results presented in this paper establish that CNAase I footprinting
patterns induced by nogalamycin and actinomycin develop slowly on mixing the
a n t i b i o t i c s with DNA. This i s e n t i r e l y c o n s i s t e n t with the shuffling
hypothesis which envisages t h a t ligands bind i n i t i a l l y to many nucleotide
sequences with l i t t l e or no s e l e c t i v i t y and subsequently l o c a t e t h e i r
preferred binding s i t e s by a process of migration. Shuffling must involve
random d i s s o c i a t i o n from the DNA h e l i x and w i l l in general occur a t a r a t e
determined by the r a t e of d i s s o c i a t i o n of the ligands from DNA. Previous
a t t e m p t s to demonstrate t h i s phenomenon have employed i n d i r e c t techniques
[9,10] which are open to alternative interpretation. In particular i t has been
d i f f i c u l t to dismiss the suggestion t h a t the slow k i n e t i c s r e s u l t from
conformational changes in the a n t i b i o t i c - D N A complex.
However, t h e
conformational hypothesis i s not c o n s i s t e n t with the f o o t p r i n t i n g r e s u l t s
presented above for s e v e r a l reasons. F i r s t l y , any conformational change
should be a f i r s t order process and therefore should occur a t a r a t e
independent of the a n t i b i o t i c c o n c e n t r a t i o n . This i s c l e a r l y not the case
since the footprinting pattern always develops much faster at higher ligand
concentrations. Secondly, i t i s difficult to see how conformational changes
might provoke short-lived enhancement of cleavage at certain bonds as observed
2012
Nucleic Acids Research
with nogalamycin at positions 67 and 75. Thirdly, the rate at which
protection develops is not constant at all antibiotic binding sites although
(for actinomycin) they each contain the same recognition sequence (GpC).
It is important to distinguish this shuffling hypothesis from an
alternative explanation that the protection pattern arises slowly because the
antibiotic remains free in solution until a melted region appears in the DNA.
The changes that we have observed here are much slower than the kinetic
profiles determined by stopped-flow measurement of changes in absorbance. The
optical changes which occur when nogalamycin binds to DNA are complete within
about 10 sees [18], yet i t now appears that the equilibrium distribution of
the antibiotic is not attained until much later.
Nogalamycin, actinomycin and possibly echinomycin can be observed to
shuffle at a slow rate, why then do daunomycin, distamycin and mithramycin
behave differently? Daunomycin dissociates from DNA much faster than does
nogalamycin [19] and should therefore be able to shuffle at a faster rate.
Daunomycin is also endowed with l i t t l e or no sequence-selectivity so that the
distribution of the antibiotic over its potential binding sites is probably
largely determined by the various association rates. As a result the ligand
distribution at equilibrium may be virtually identical to that attained on
first contact between the antibiotic and DNA.
The situation is less clear for distamycin and mithramycin since both
these antibiotics possess considerable sequence selectivity [4,12,21] and
antibiotics of the mithramycin group are believed to dissociate from DNA at a
rate just as slow as does actinomycin [22]. It is conceivable that the fast
rate at which these antibiotics attain specific binding derives from the
mechanism by which they bind to DNA. Both antibiotics bind to one or other of
the helical grooves and have l i t t l e or no effect on DNA winding, in contrast
to the other ligands which are all intercalators and consequently provoke a
much greater perturbation of the DNA helix [1]. Possibly ligands which bind
to the helical grooves are able to 'creep' along the l a t t i c e and explore
potential binding sites much more efficiently than intercalators. If this
interpretation is correct i t has important implications for the future design
of sequence-selective drugs which can rapidly locate their specific binding
sites.
ACKNOWLEDGMENTS
This work was supported by grants from the Cancer Research Campaign, the
Medical Research Council and the Royal Society.
2013
Nucleic Acids Research
REFERENCES
IT] Waring, M.J. (1981) Ann. Rev. Biochem. 50, 159-192
[2] N e i d l e , S. and Waring, M.J. (eds) (1983) Molecular Aspects of Anti-cancer
Drug Action, Macmillan, London.
[3] S o b e l l , H.M. and J a i n , S.C. (1972) J . Mol. B i o l . 68, 21-34
[4] Fox, K.R. and Waring, M.J. (1984) Nucleic Acids Res. 12, 9271-9285
[5] Low, C.M.L., Drew, H.R. and W a r i n g , M.J. (1984) N u c l e i c Acids Res. 12,
4865-4879
[6] Van Dyke, M.W. and Dervan, P.B. (1984) Science 225, 1122-1127
[7] Fox, K.R. and Waring, M.J. (1986) Manuscript submitted for p u b l i c a t i o n
[8] Fox, K.R. and Waring, M.J. (1984) Biochemistry 12, 2627-2633
[9] Fox, K.R. and Waring, M.J. (1984) Eur. J . Biochem. 145, 579-586
[10] Fox, K.R. and Waring, M.J. (1985) Nucleic Acids Res. 13, 595-603
[11] Lane, M.J., Dabrowiak, J.C. and V o u r n a k i s , J.N. (1983) P r o c . N a t l . Acad.
S c i . LISA 80, 3260-3264
[12] Van Dyke, M.W. and Dervan, P.B. (1983) Biochemistry 22, 2373-2377
[13] Drew, H.R. and Travers, A.A. (1984) Cell 37, 491-502
[14] Arora, S.K. (1983) J . Am. Chem. See. 105, 1328-1332
[15] Waring, M.J. (1970) J . Mol. B i o l . 54, 247-279
[16] Plumbridge, R.W. and Brown, J.R. (1979) Biochem. Pharmacol. 28, 3231-3234
[17] C o l l i e r , D.A., N e i d l e , S. and Brown, J.R. (1984) Biochem. P h a r m a c o l .
33, 2877-2880
[18] Fox, K.R. and Waring, M.J. (1984) Biochim. Biophys. Acta. 802, 162-168
[19] Fox, K.R., B r a s s e t t , C. and Waring, M.J. (1985) Biochim. Biophys. Acta.
840, 383-392
[20] Bittman, R. and Blau, L. (1975) Biochemistry 14, 2138-2145
[21] Fox, K.R. and Howarth, N.R. (1985) Nucleic Acids Res. 13, in the press
[22] Behr, W., Bonikel, K. and Hartmann, G. (1969) Eur. J . Biochem. 9, 82-92
[23] Ward, D., Reich, E. and Goldberg, I.H. (1965) Science, 149, 1259-1263
[24] Kersten, W., Kersten, H. and Szybalski, W. (1966) Biochemistry 5_, 236-244
2014