SUPPLEMENTAL DATA Bezzerri et al. Table S1: Candidate genes abbreviation gene name • Chemokines CXCL2 GRO – beta CXCL3 GRO – gamma CC chemokine L1 CCL1 CCL2 MCP-1 CCL3 MIP-1alpha CCL4 MIP-1beta CCL7 MCP-3 CCL8 MCP-2 CCL11 eotaxin CCL13 MCP-4 CCL23 MIP-3 CCL24 eotaxin-2 CCL26 eotaxin-3 CXCL10 IP-10 CXCL11 I-TAC CXCL13 Angie CXCL14 MIP-2gamma • Receptors for chemokines CXCR1 CXC 1 receptor (also IL-8 receptor) CXCR2 CXC 2 receptor (also IL-8/GRO-a receptor) CXCR7 CXC receptor 7 CCR1 C-C receptor 1 CCR3 C-C receptor 3 CCR6 C-C receptor 6 CCR7 C-C receptor 7 CCR9 C-C receptor 9 CCRL2 C-C receptor-like 2 FPRL1 FMLP-R-II or lipoxin A4-R • Adhesion molecules ICAM-1 Intercellular adhesion molecule 1 VCAM-1 Vascular adhesion protein 1 1 • Receptors involved in host – pathogen interactions TLR2 Toll-like Receptor 2 TLR4 Toll-like Receptor 4 TLR5 Toll-like Receptor 5 • Cytokines IL-1A Interleukin 1 alpha IL-1B Interleukin 1 beta IL-4 Interleukin 4 IL-6 Interleukin 6 IL-17C Interleukin 17C IL-18 Interleukin 18 TNFA Tumor Necrosis Factor alpha • Purinergic receptors P2RY1 P2Y receptor 1 P2RY2 P2Y receptor 2 • Antimicrobial peptides HNP4 Human Alpha defensin 4 HBD-1 Human Beta Defensin-1 CG Catepsin G AZU1 Azurocidin • System components generating reactive oxygen and nitrogen species p40Phox SH3 and PX domain-containing protein 4 p67Phox NADPH oxidase activator 2 NOX1 NADPH oxidase 1 variant NOH-1L NOX2 NADPH oxidase 2 NOX3 NADPH oxidase catalytic subunit-like 3 NOX4 Kidney superoxide-producing NADPH oxidase NOX5 NADPH oxidase 5 NOS1 Nitric oxide synthase 1 NOS2 Nitric oxide synthase 2 NOS3 Nitric oxide synthase 3 DUOX1 Flavoprotein NADPH oxidase 1 DUOX2 Flavoprotein NADPH oxidase 2 DUOXA1 Dual oxidase maturation factor 1 LPO Lactoperoxydase Transmembrane signaling in pro-inflammatory pathways: PI3K (PI3-K catalytic/regulatory subunits and AKT) PIK3R5 Phosphoinositide 3-kinase p101 class Ib regulatory subunit PIK3CA Phosphoinositide 3-kinase p110 alpha, class Ia catalytic subunit PIK3CB Phosphoinositide 3-kinase p110 beta, class Ia catalytic 2 PIK3CD PIK3R1 PI3K p85 alpha PI3K p85 beta PI3Kgamma AKT1 AKT2 AKT3 subunit Phosphoinositide 3-kinase p110 delta, class Ia catalytic subunit Phosphoinositide 3-Kinase p50 alpha regulatory subunit Phosphoinositide 3-Kinase p85 alpha regulatory subunit Phosphoinositide 3-Kinase p85 beta catalytic subunit Phosphoinositide 3-kinase gamma catalytic subunit RAC-alpha serine/threonine-protein kinase RAC-beta serine/threonine-protein kinase RAC-gamma serine/threonine-protein kinase • Transmembrane signaling in pro-inflammatory pathways: MAP kinases MAPK14 p38 alpha MAPK11 p38 beta MAPK13 p38 delta MAPK8 Jnk1 MAPK9 Jnk2 MAPK10 Jnk3 MAPK1 ERK2 • Transmembrane signaling in pro-inflammatory pathways: Cytoplasmatic Tyrosin Kinases SRC tyrosine-protein kinase SRC-1 FYN tyrosine-protein kinase Fyn YES proto-oncogene tyrosine-protein kinase YES LYN tyrosine-protein kinase Lyn HCK tyrosine-protein kinase HCK FGR proto-oncogene tyrosine-protein kinase FGR LCK tyrosine-protein kinase Lck ABL tyrosine-protein kinase ABL1 BMX epithelial and endothelial tyrosine kinase TEC tyrosine-protein kinase Tec ZAP-70 zeta-chain associated protein kinase, 70kD FAK1 protein-tyrosine kinase 2 FAK2 protein tyrosine kinase 2 beta CSK tyrosine-protein kinase CSK • Transmembrane signaling in pro-inflammatory pathways: nuclear transcription factor NF-kB TRAF1 TNF receptor-associated factor 1 TRAF2 TNF receptor-associated factor 2 TRAF3 TNF receptor-associated factor 3 TRAF4 TNF receptor-associated factor 4 TRAF5 TNF receptor-associated factor 5 TRAF6 TNF receptor-associated factor 6 IRAK1 Interleukin-1 Receptor Associated Kinase 1 3 IRAK2 IRAK4 NFKBIA NFKBIB NFKBIE CHUK IKBKB Interleukin-1 Receptor Associated Kinase 2 Interleukin-1 Receptor Associated Kinase 4 Nuclear Factor of kappa light polypeptide gene enhancer in B cell - inhibitor alpha Nuclear Factor of kappa light polypeptide gene enhancer in B cell - inhibitor beta Nuclear Factor of kappa light polypeptide gene enhancer in B cell - inhibitor epsilon Conserved helix-loop-helix ubiquitous kinase Inhibitor of k light polypeptide gene enhancer in B cell kinase beta • Transmembrane signaling in pro-inflammatory pathways: Small GTPases with their molecular targets HRAS V-Ha-RAS (Harvey rat sarcoma viral oncogene homolog) NRAS Neuroblastoma RAS viral (V-RAS) ncogène homolog RHOA RAS Homolog gene family member A RHOC RAS Homolog gene family member C RHOG RAS Homolog gene family member G RAC1 RAS-related C3 botulinum toxin substrate 1 RAC2 RAS-related C3 botulinum toxin substrate 2 CDC42 Cell division cycle 42 ROCK1 Rho-Associated coiled-call containing protein K1 ROCK2 Rho-Associated coiled-call containing protein K2 PAK1 P21 protein-activated kinase 1 PAK2 P21 protein-activated kinase 2 • Transmembrane signaling in pro-inflammatory pathways: Phospholipases PLA2G2A Phospholipase A2, group IIA PLA2G2D Phospholipase A2, group IId PLA2G2E Phospholipase A2, group IIe PLA2G2F Phospholipase A2, group IIf PLA2G3 Phospholipase A2, group III PLA2G4A Phospholipase A2, group IVa PLA2G4B Phospholipase A2, group IVB PLA2G4C Phospholipase A2, group IVC PLCB1 Phospholipase C beta1 PLCB2 Phospholipase C beta2 PLCB3 Phospholipase C beta3 PLCB4 Phospholipase C beta4 PLCD1 Phospholipase C delta1 PLCD3 Phospholipase C delta3 PLCD4 Phospholipase C delta4 PLCE Phospholipase C epsilon PLCG1 Phospholipase C gamma1 PLCG2 Phospholipase C gamma2 4 Table S2 Single Nucleotide Polymorphisms (SNPs) selected Chr 1 Gene_symbol (Gene_ID) AKT3 (10000) CDC42 (998) FGR (2268) LCK (3932) NCF2 (4688) / p67 Phox NRAS (4893) PIK3CD (5293) PLA2G2A (5320) PLA2G2D (26279) PLA2G2E (30814) PLA2G2F (64600) PLA2G4A (5321) RHOC (389) TLR5 (7100) SNP_Name rs4518884 rs1538773 rs9428576 rs1121276 rs2268177 rs2231878 rs35334091 rs11576032 rs11567841 rs695161 rs35012521 rs13306575 rs17849502 rs35937854 rs13306581 rs11578964 rs10911363 rs789185 rs969273 rs14804 rs28730673 rs4240910 rs1135427 rs4240896 rs9430220 rs6540991 rs34568801 rs1804275 rs584367 rs877064 rs11582551 rs12720588 rs2307198 rs2999156 rs12144044 rs7512943 rs5744176 rs5744175 rs5744171 rs5744168 rs4140966 rs5744167 Location intron intron flanking_3UTR intron intron coding coding coding coding intron coding coding coding coding coding intron intron intron intron 3UTR coding intron 3UTR intron intron intron coding coding coding intron intron coding coding intron intron coding coding coding coding coding coding coding 5 TRAF5 (7188) VCAM1 (7412) 2 CXCR7 (57007) IL1A (3552) IL1B (3553) IL8RA (3577) / CXCR1 IL8RB (3579) / CXCR2 PLCD4 (84812) ROCK2 (9475) 3 ZAP70 (7535) CCR1 (1230) 3 CCR3 (1232) 3 CCR9 (10803) rs5744166 rs764535 rs3946808 rs2271458 rs4951523 rs10494936 rs6672742 rs34228330 rs34708918 rs3783611 rs3783612 rs34199378 rs3783615 rs3917012 rs3176877 rs3176861 rs3181088 rs3176860 rs10183022 rs7585641 rs1045879 rs3783531 rs3783550 rs1143634 rs1143643 rs16858811 rs10201766 rs1126579 rs658378 rs34945852 rs35768389 rs9808232 rs13397757 rs10194620 rs6730673 rs4669702 rs4477886 rs3192177 rs6781048 rs41413045 rs41393844 rs41276533 rs9854776 rs6441948 rs9853223 rs3091309 rs12721497 rs9862611 coding coding coding coding intron intron intron coding coding coding coding coding coding intron intron intron intron intron intron intron coding coding intron coding intron coding coding 3UTR intron coding coding coding intron intron intron intron intron coding coding coding coding coding intron intron intron intron coding intron 6 3 3 CCRL2 (9034) CXCR6 (10663) 3 IRAK2 (3656) 3 3 P2RY1 (5028) PAK2 (5062) 3 PIK3CA (5290) 3 PIK3CB (5291) 3 PLCD1 (5333) rs7614342 rs6441977 rs2234355 rs2234356 rs2234357 rs2234358 rs936939 rs3774634 rs35060588 rs11465910 rs11465930 rs2302859 rs6442159 rs155266 rs1177614 rs11465897 rs11706450 rs11465853 rs263413 rs2619508 rs1642736 rs1169670 rs3844279 rs708030 rs776514 rs1144911 rs701265 rs9877495 rs2084382 rs7626440 rs6583177 rs11923075 rs9222 rs7649045 rs4916555 rs6583176 rs2686600 rs17849072 rs41273621 rs2699905 rs2677760 rs1607237 rs6443624 rs558905 rs10513055 rs9837637 rs933135 rs2268749 intron coding coding coding coding 3UTR intron intron coding coding coding intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron coding intron intron intron intron intron 3UTR intron intron intron intron coding coding intron intron intron intron intron intron coding coding intron 7 3 4 RHOA (387) CXCL10 (3627) CXCL11 (6373) CXCL13 (10563) CXCL2 (2920) CXCL3 (2921) MAPK10 (5602) / JNK3 SLAIN2 (57606) SPP1 (6696) TEC (7006) TLR2 (7097) rs9857730 rs11706370 rs1126858 rs4859586 rs4859596 rs7436646 rs355674 rs355686 rs355667 rs920666 rs355689 rs1500500 rs9131 rs6832638 rs370655 rs2904100 rs17451306 rs17417758 rs4487330 rs10516763 rs9884282 rs4693141 rs7665868 rs10009993 rs12507758 rs6815306 rs1460769 rs1436529 rs17418221 rs1460767 rs10938526 rs9138 rs35374286 rs2089511 rs17574847 rs17470919 rs2704425 rs7687704 rs17574371 rs4695356 rs2704421 rs12643804 rs11725773 rs2664019 rs2704423 rs5743699 rs5743702 rs5743703 coding intron coding intron coding 3UTR intron intron intron intron intron intron 3UTR coding intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron flanking_5UTR 3UTR coding intron flanking_5UTR intron intron intron coding intron intron flanking_5UTR intron intron intron coding coding coding 8 5 CXCL14 (9547) IL4 (3565) MAPK9 (5601) / JNK2 PIK3R1 (5295) 6 CCR6 (1235) FYN (2534) rs5743704 rs3804099 rs11938228 rs1898830 rs1016666 rs2237062 rs1148360 rs4986964 rs2227282 rs35693958 rs35421153 rs17627536 rs4481314 rs3111515 rs6868333 rs6863088 rs4147385 rs3730089 rs6863431 rs1819987 rs251409 rs34306 rs6881033 rs251408 rs1445760 rs251406 rs4122269 rs12652661 rs1823023 rs173702 rs17860852 rs1571878 rs3093012 rs3093009 rs2071171 rs1855025 rs3093010 rs28763975 rs6568704 rs6933144 rs804188 rs11963612 rs13192832 rs12910 rs804192 rs927010 rs13218316 rs1621289 coding coding intron intron intron intron intron coding intron coding coding intron intron intron intron intron intron coding intron intron intron intron intron intron intron intron intron intron intron intron coding intron intron intron coding intron intron coding intron intron intron intron intron UTR intron intron intron intron 9 MAPK13 (5603) / p38delta MAPK14 (1432) / p38alpha NFKBIE (4794) NOX3 (50508) TNF (7124) 7 CCL24 (6369) CCL26 (10344) IL6 (3569) NOS3 (4846) PIK3CG (5294) rs706862 rs1327200 rs7768046 rs706895 rs2071864 rs851010 rs3804454 rs851006 rs35500460 rs730775 rs3749930 rs13207865 rs231960 rs231955 rs231961 rs6935359 rs6557421 rs12196156 rs231944 rs231947 rs1016259 rs2235675 rs9371890 rs9478652 rs231948 rs438239 rs2235674 rs35131721 rs11574936 rs2302004 rs11465333 rs41341147 rs41463245 rs2302009 rs11544633 rs2069840 rs3918166 rs1799983 rs41508746 rs3918201 rs1800783 rs3918188 rs17847825 rs28763989 rs28763991 rs4730205 rs4460309 rs12536620 intron intron flanking_5UTR intron intron intron intron intron coding intron coding intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron coding coding intron coding coding coding 3UTR coding intron coding coding coding coding intron intron coding coding coding intron intron intron 10 RAC1 (5879) 8 DEFA4 (1669) DEFB1 (1672) IKBKB (3551) LYN (4067) PTK2 (5747) / FAK1 PTK2B (2185) / FAK2 9 ABL1 (25) rs3729790 rs702484 rs2239668 rs2977779 rs6991366 rs2272736 rs17875749 rs34309584 rs10958713 rs3747811 rs5029748 rs907424 rs2668015 rs16922502 rs2292419 rs4436100 rs2719245 rs1027990 rs7834615 rs10282821 rs7828258 rs2668021 rs7829816 rs333616 rs13249338 rs7005312 rs6983130 rs4563941 rs12156014 rs10109684 rs6993266 rs7839119 rs13270490 rs13257119 rs7827949 rs41276291 rs35174236 rs751019 rs41276293 rs7000615 rs11995441 rs1019832 rs17057051 rs2322599 rs10086852 rs10097861 rs34549764 rs2229071 intron intron intron intron coding coding coding coding intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron coding coding coding coding intron intron intron intron intron intron intron coding coding 11 TLR4 (7099) TRAF1 (7185) TRAF2 (7186) 10 CHUK (1147) / IKKalpha MAPK8 (5599) / JNK1 PLCE1 (51196) rs10901275 rs2791738 rs2855172 rs12005009 rs10901285 rs11788639 rs2791743 rs2855171 rs5030718 rs5030719 rs34953464 rs5030720 rs5030722 rs5030723 rs5030724 rs5030728 rs1927911 rs36084135 rs34119250 rs7021049 rs10870140 rs2784081 rs4880073 rs10781522 rs2230804 rs36065428 rs11597086 rs7086275 rs12358297 rs10508901 rs17508082 rs17417407 rs11596200 rs12768416 rs11187829 rs2274224 rs41291138 rs3765524 rs2274223 rs7917353 rs10882416 rs7919320 rs2689698 rs11187820 rs9663362 rs1223635 rs11187792 rs11187851 intron intron intron intron intron intron intron intron coding coding coding coding coding coding coding intron intron coding coding intron intron intron intron intron coding coding intron intron intron intron coding coding coding coding coding coding coding coding coding intron intron intron intron intron intron intron intron intron 12 11 IL18 (3606) NOX4 (50507) P2RY2 (5029) PAK1 (5058) PLCB3 (5331) RHOG (391) TRAF6 (7189) 12 IRAK4 (51135) 12 KRAS (3845) 12 NOS1 (4842) rs2689694 rs17415514 rs17109869 rs2797992 rs12769135 rs2797986 rs17416616 rs4918082 rs1858608 rs2077218 rs5744258 rs549908 rs317139 rs10765208 rs317155 rs3793973 rs12799930 rs497279 rs3741156 rs1783596 rs35345144 rs2250647 rs478134 rs35169799 rs3815362 rs2244625 rs1451722 rs1349542 rs10835184 rs10835182 rs34320471 rs5030419 rs4251469 rs4251583 rs4251545 rs4251513 rs4368021 rs12226937 rs12579073 rs10842514 rs9658482 rs9658445 rs41356652 rs9658356 rs4519169 rs9658279 rs2291908 rs7977109 intron intron intron intron intron intron intron intron intron intron intron coding coding intron intron intron intron intron coding coding coding intron intron coding intron coding intron intron intron intron coding intron coding coding coding intron intron intron intron intron coding coding coding coding coding coding intron intron 13 14 AKT1 (207) CTSG (1511) / catepsin G NFKBIA (4792) TRAF3 (7187) 15 CSK (1445) DUOX1 (53905) DUOX2 (50506) DUOXA1 (90527) NOX5 (79400) PLA2G4B (8681) PLCB2 (5330) 16 IL17C (27189) PLCG2 (5336) rs3782218 rs816361 rs693534 rs3782221 rs1123425 rs12578547 rs547954 rs6490121 rs545654 rs1130214 rs11623400 rs696 rs7154305 rs12878111 rs10137035 rs34866753 rs34616395 rs35556162 rs2301249 rs1378942 rs1648305 rs16939752 rs2458236 rs269866 rs269868 rs1648281 rs34406284 rs12907196 rs2277553 rs2277552 rs7167318 rs7168025 rs12899318 rs371352 rs4777102 rs7174710 rs2290552 rs936212 rs9972332 rs8025153 rs2305650 rs936213 rs1123487 rs1869901 rs2254073 rs9936371 rs17537869 rs3935625 intron intron intron intron intron intron intron intron intron 5UTR intron 3UTR intron intron intron coding coding coding intron intron intron coding coding intron coding UTR coding coding coding coding coding coding intron intron intron coding coding coding coding coding intron intron intron intron intron coding coding coding 14 17 CCL1 (6346) CCL11 (6356) CCL13 (6357) CCL2 (6347) CCL23 (6368) CCL3 (6348) CCL4 (6351) CCL7 (6354) CCL8 (6355) CCR7 (1236) LPO (4025) NOS2A (4843) rs8063604 rs12716922 rs8054878 rs4405545 rs7189843 rs8043619 rs4077853 rs1143686 rs9928191 rs12444459 rs4580153 rs4889384 rs4243225 rs3936112 rs3934956 rs9938212 rs9932716 rs4580154 rs13333420 rs8055576 rs3922849 rs6564928 rs12444401 rs4888182 rs2282691 rs34262946 rs1860184 rs3136677 rs34566308 rs159313 rs4586 rs1003645 rs1130371 rs1719152 rs1634517 rs3091321 rs41362546 rs1133763 rs34202026 rs2023906 rs7219860 rs11868650 rs2301870 rs2314808 rs28944173 rs2297518 rs944725 rs9906835 intron intron intron intron intron intron intron coding intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron intron coding intron coding coding intron coding coding coding coding intron intron coding coding coding intron intron intron coding coding coding coding intron intron 15 PIK3R5 (23533) / p101 PLCD3 (113026) TRAF4 (9618) 18 ROCK1 (6093) YES1 (7525) 19 AKT2 (208) AZU1 (566) FPR1 (2357) / FMLP ICAM1 (3383) NFKBIB (4793) PLA2G4C (8605) rs4795067 rs8072199 rs3729508 rs419849 rs181531 rs12945251 rs394811 rs16957702 rs734921 rs34721135 rs3744760 rs1052169 rs713101 rs35932778 rs35100992 rs2070265 rs2663698 rs1045142 rs35881519 rs2292296 rs2271255 rs8085654 rs288980 rs2663695 rs1481280 rs35126906 rs34580680 rs1060922 rs3897601 rs8093865 rs35817154 rs12460555 rs12460890 rs5030878 rs5491 rs422429 rs1799969 rs34369517 rs5495 rs5497 rs5030400 rs281432 rs8108039 rs3136640 rs35229843 rs11564638 rs11564620 rs11564541 intron intron intron intron intron intron coding coding coding coding intron 3UTR coding coding coding coding coding coding coding coding coding intron intron intron intron coding coding 3UTR flanking_5UTR flanking_5UTR coding intron coding coding coding coding coding coding coding coding coding intron intron intron coding coding coding coding 16 20 HCK (3055) PLCB1 (23236) rs156631 rs11564538 rs6089165 rs6089166 rs17093828 rs13037181 rs13041270 rs13042803 rs6086575 rs28390202 rs6086672 rs6056072 rs6077418 rs2745784 rs3848832 rs6140583 rs6056094 rs6118283 rs2294259 rs708926 rs6055628 rs4399790 rs2745769 rs718986 rs6140770 rs6055697 rs4813865 rs2179137 rs12481262 rs6077404 rs6039215 rs1238231 rs2876140 rs6086506 rs708910 rs6039208 rs6108205 rs6133613 rs761042 rs2235947 rs6108195 rs1232779 rs11087811 rs6039209 rs2719795 rs2745787 rs2076685 rs2663004 coding coding coding coding coding coding coding coding coding coding intron intron intron intron intron intron intron intron intron flanking_3UTR intron intron intron intron intron intron flanking_5UTR intron intron intron intron flanking_3UTR intron flanking_5UTR 3UTR flanking_5UTR intron intron intron intron intron flanking_3UTR flanking_5UTR intron flanking_3UTR intron intron intron 17 PLCB4 (5332) rs6077428 rs6039051 rs1028370 rs17446441 rs6140561 rs6055652 rs17446308 rs6516403 rs2207306 rs6086518 rs13037679 rs6055991 rs6039109 rs1509116 rs6055928 rs6140546 rs1474937 rs6140549 rs6056037 rs6118083 rs13040543 rs6077332 rs6086403 rs6055562 rs4496390 rs2719775 rs4419296 rs1509117 rs2327044 rs4813853 rs2179138 rs1232784 rs6077510 rs6118603 rs8183759 rs6108299 rs16995736 rs6056596 rs6039432 rs984010 rs2072954 rs6118505 rs6108280 rs926395 rs725941 rs2208295 rs2179321 rs5011374 intron intron intron intron intron intron intron intron intron flanking_5UTR intron intron intron intron flanking_5UTR intron intron intron intron intron intron intron intron intron intron intron flanking_5UTR intron flanking_5UTR intron intron intron coding coding coding coding intron intron intron intron intron intron intron intron intron intron intron intron 18 PLCG1 (5335) SRC (6714) 22 MAPK1 (5594) / ERK2 MAPK11 (5600) / p38beta NCF4 (4689) / p40 PLA2G3 (50487) RAC2 (5880) rs3819579 rs6056522 rs6056437 rs4369940 rs6118591 rs6056519 rs2229348 rs2228246 rs7266677 rs6065316 rs34203315 rs753381 rs2235361 rs2076146 rs3795131 rs6093446 rs6018260 rs34881773 rs6017944 rs1547836 rs6018027 rs12106024 rs1063311 rs9610487 rs8136867 rs2298432 rs33932986 rs2076139 rs2066776 rs35396905 rs34422484 rs2272857 rs742184 rs13057803 rs9610595 rs35355915 rs3827352 rs738148 rs760519 rs2284027 rs746713 rs4821544 rs2232183 rs2074735 rs2074734 rs2232176 rs8135343 rs13058338 intron intron intron intron intron intron coding coding coding coding coding coding coding intron intron intron coding coding intron intron intron intron 3UTR intron intron intron coding coding coding coding coding coding intron coding coding coding intron intron intron intron intron intron coding coding coding coding intron intron 19 X BMX (660) IRAK1 (3654) NOX1 (27035) rs739041 rs6572 rs35353387 rs41300892 rs12860727 rs34688635 rs35242502 intron 3UTR coding coding coding coding coding 20 Table S3 Ranking of statistical significance of association of the SNPs analyzed Rank 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Gene PLCB3 NOS2 PAK2 CXCL13 CXCR6 PLCB1 LYN LYN NOS2 PLA2G4C PLCB1 CXCR6 PIK3R1 NOX3 YES1 FYN ABL1 MAPK8 ABL1 P2RY2 ABL1 PLCB1 PLCB4 PLCE1 MAPK11 IL17C SNP RS35169799 RS3729508 RS6583177 RS355689 RS2234355 RS6086479 RS7828258 RS13249338 RS8072199 RS11564538 RS6086403 RS3774634 RS6863431 RS1016259 RS3897601 RS13218316 RS2855171 RS12358297 RS2229071 RS1783596 RS2791738 RS2876140 RS5011374 RS2274223 RS2076139 RS2254073 P_Value 0.00465 0.01028 0.0169 0.01776 0.01938 0.01962 0.02039 0.02146 0.02172 0.02371 0.02664 0.02705 0.02926 0.03004 0.0305 0.03379 0.03413 0.03654 0.04079 0.04147 0.0416 0.04523 0.04545 0.04729 0.04762 0.04839 Table reports the ranking of significance of association with mild or severe phenotype for P values < 0.05, as calculated by permutation test 21 Table S4 Primers for quantification of gene transcripts Primer IL 8-F Sequence (5′–3′) GACCACACTGCGCCAACA GCTCTCTTCCATCAGAAAGTTACATAAT IL 8-R TT PLCb1-F CAGCTCTTCTGGAATGCAGGT PLCb1-R TTTATTTGCATAGCCAGGTCC PLCb2-F ATGTTCTGGAATGCTGGA PLCb2-R TGCTGCATGGGCAAGTC PLCb3-F TCTTCTGGAACGTAGGG PLCb3-R AGCTGCATCGCCACATC PLCb4-F CCTCAGATTTTCTGGAACGCTGGC PLCb4-R TTCAATTGCATCGCTAAATC PLCd1-F GGACGGAGGCTGGGCCTACA PLCd1-R GGAGCTGGCTGCCCTTCAGCAG PLCd3-F ACCCTGCCAGGTCAGCTCCC PLCd3-R AGCTGTTCCCTGCCTCCCGA PLCd4-F GGGGGACCAGCTTTGCGGC PLCd4-R CCCCGCTTCAGGGCCCGTAT PLCg1-F GACCTTCATCAAGAGCGCCA PLCg1-R CCCCTCGCCACCAGCCTCCC PLCg2-F GAGCTTCTGCCGTGGTGCCC PLCg2-R CTCCTTTCCACCAGCCCCCG PLCe1-F AGGCCAGTGTCCTCCCCTGTG PLCe1-R AGCCCATCCAGTGCTTGGAGC GAPDH-F GTGGAGTCCACTGGCGTCTT GAPDHGCAAATGAGCCCAGCCTTC R G6PD-F GCCAAGAAGAAGATCTACCCCA G6PD-R AAGGCCATCCCGGAACAG RPII-F TCGAGCAGATCAGCAAGGTG RPII-R TCTTGTTGTCTGTCTGTGGCAA eEF1g-F AAACTGTGTGAGAAGATGGCCC eEF1g-R GGGTCTCTGCAAACTTTTTAGCA CK 15-F GGCTGGCTGCGGACG CK 15-R GCAGGGCCAGCTCATTCTC Accession Number AF385628.2 mM 15 Calibrator gene GAPDH 15 NM_015192 2.5 15 NM_004573 15 15 NM_000932 15 2.5 NM_000933 15 2.5 NM_001130964 15 15 NM_133373 45 2.5 NM_032726 2.5 15 NM_002660 45 45 NM_002661 2.5 2.5 NM_016341 2.5 15 J04038 2.5 GAPDH GAPDH eEF1g eEF1g G6PD G6PD RPII G6PD CK-15 G6PD 15 NM_000402.2 NM_000937.2 NM_001404.3 NM_002275 15 2.5 2.5 2.5 15 2.5 15 15 22 Supplementary Table 5 - Genotype of the SNPs of the PLC family in the top rank of Major/minor aminoacid GENE SNP alleles change PLCB3 RS35169799 C/T S845L PLCB1 RS6086479 C/T no change PLCB1 RS6086403 A/C no change PLCB1 RS2876140 A/G no change PLCB4 RS5011374 A/C no change PLCE1 RS2274223 A/G H1619R association with severe or mild CF lung progression IB3-1 CuFi-1 Chromosome genotype genotype 11 C/C C/C 20 (intronic) C/T C/C 20 (intronic) A/C A/C 20 (intronic) A/G A/G 20 (intronic) A/C A/A 10 A/A A/A 23 GENE PLCB3 PLCB1 PLCB1 PLCB1 PLCB4 PLCE1 Forward GATACCACTACGTCTGCC CTTTCTGTGTATGAGGGAGGAA AGCCTCTGCTGGTGTATGCT GTCCGGTTGAATTTTGGGTA AAACCCTCTTGGAGAGAGCTG CAGAATGTGTGCCCCAGTAAT Reverse CCTGGTGGTCGTCAGGAATG CCCATAAATGCACCCCATAA CCAGTAGTGCCCAGGAGAAA TCCAATCAGTCTTGTCATTCAA ACAACGAGGCTAAGGAGCAC GCTTTCAGTGGAATGATTCTC Supplementary Table 6 – Sequencing primers for PLC family SNPs 24 Figure S1 Expression and silencing of phospholipase C beta (PLCB) isoforms in IB3-1 cells Expression of PLC mRNA of the PLC isoforms beta 1 to beta 4 was quantified by qRT-PCR relative to the levels of expression of the housekeeping gene cytokeratin (CK)-15 after transfection of siRNA PLCB3 or scrambled oligonucleotides 26 Figure S2 Relative transcript expression levels of PLC isoforms in CF bronchial epithelial IB3-1 and CuFi-1 cell lines Expression of PLC mRNA of the PLC isoforms beta, gamma, delta and epsilon was quantified by qRT-PCR relative to the levels of expression of the housekeeping gene cytokeratin (CK)-15. 27
© Copyright 2026 Paperzz