Microbiology (2012), 158, 84–97 DOI 10.1099/mic.0.051854-0 Saprotrophic competitiveness and biocontrol fitness of a genetically modified strain of the plant-growth-promoting fungus Trichoderma hamatum GD12 Lauren S. Ryder, Beverley D. Harris, Darren M. Soanes, Michael J. Kershaw, Nicholas J. Talbot and Christopher R. Thornton Correspondence Christopher R. Thornton Biosciences, College of Life and Environmental Sciences, University of Exeter, Geoffrey Pope Building, Stocker Road, Exeter EX4 4QD, UK [email protected] Received 14 June 2011 Revised 18 July 2011 Accepted 7 August 2011 Trichoderma species are ubiquitous soil fungi that hold enormous potential for the development of credible alternatives to agrochemicals and synthetic fertilizers in sustainable crop production. In this paper, we show that substantial improvements in plant productivity can be met by genetic modification of a plant-growth-promoting and biocontrol strain of Trichoderma hamatum, but that these improvements are obtained in the absence of disease pressure only. Using a quantitative monoclonal antibody-based ELISA, we show that an N-acetyl-b-D-glucosaminidase-deficient mutant of T. hamatum, generated by insertional mutagenesis of the corresponding gene, has impaired saprotrophic competitiveness during antagonistic interactions with Rhizoctonia solani in soil. Furthermore, its fitness as a biocontrol agent of the pre-emergence damping-off pathogen Sclerotinia sclerotiorum is significantly reduced, and its ability to promote plant growth is constrained by the presence of both pathogens. This work shows that while gains in T. hamatummediated plant-growth-promotion can be met through genetic manipulation of a single beneficial trait, such a modification has negative impacts on other aspects of its biology and ecology that contribute to its success as a saprotrophic competitor and antagonist of soil-borne pathogens. The work has important implications for fungal morphogenesis, demonstrating a clear link between hyphal architecture and secretory potential. Furthermore, it highlights the need for a holistic approach to the development of genetically modified Trichoderma strains for use as crop stimulants and biocontrol agents in plant agriculture. INTRODUCTION Trichoderma species are ubiquitous soil saprotrophs that have attracted sustained scientific interest as biological control agents of plant disease. In addition to their biocontrol properties, certain strains have been shown to enhance crop productivity by stimulating plant growth (Contreras-Cornejo et al., 2009; Harman et al., 2004; Ortı́zCastro et al., 2009; Vinale et al., 2008, 2009). While genetic modification of Trichoderma strains by constitutive overexpression of chitinase, b-glucanase and proteinase genes has allowed the development of strains with improved Abbreviations: CSA, competitive saprotrophic ability; dH2O, distilled water; P-G-P, plant-growth-promoting. The GenBank/EMBL/DDBJ accession no. for the T. hamatum GD12 NAG gene and protein sequence is JN107809. Three supplementary figures are available with the online version of this paper. 84 biocontrol capabilities (Flores et al., 1997; Baek et al., 1999; Limón et al., 1999; Viterbo et al., 2001; Djonović et al., 2007), less attention has been paid to enhancing the plantgrowth-promoting (P-G-P) activities of these fungi via genetic modification, and the impact that any such modification might have on their saprotrophic competence and fitness as biocontrol agents. In a previous study, we showed that a naturally occurring strain of Trichoderma hamatum was able to promote plant growth in low pH, nutrient-poor peat soils (Thornton, 2008). These soils contain a significant pool of nitrogen sequestered in chitin of insect and fungal origin (Kerley & Read, 1998), and fungal N-acetyl-b-D-glucosaminidase has been shown to be a key chitinolytic enzyme releasing sequestered nitrogen for assimilation by plants in peat ecosystems (Leake & Read, 1990; Kerley & Read, 1995, 1998; Read & Perez-Moreno, 2003; Lindahl & Taylor, 2004). We hypothesized that a similar mechanism might be driving the T. hamatum P-G-P phenomenon, since T. Downloaded from www.microbiologyresearch.org by 051854 G 2012 SGM IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 Printed in Great Britain Saprotrophism and biocontrol fitness of GM T. hamatum hamatum is a well-characterized producer of extracellular chitinases including N-acetyl-b-D-glucosaminidase, an enzyme also shown to be integral to the biocontrol of root-infecting pathogens (Chet & Baker, 1981; Chet et al., 1981; Lorito, 1998; Brunner et al., 2003; Harman et al., 2004). To investigate the role of the enzyme in T. hamatum P-G-P, we disrupted N-acetyl-b-D-glucosaminidase production in the fungus by insertional mutagenesis of the corresponding gene and found, contrary to our expectations, that enzyme inactivity dramatically increased the growth-promotional activity of the fungus in sterilized soil systems. The ability to manipulate the P-G-P properties of Trichoderma biocontrol strains holds enormous potential for the development of sustainable alternatives to agrochemicals for plant disease control and for the development of crop growth stimulants. The dramatic increase in T. hamatum PG-P activity as a result of the genetic modification, and the potential for use of the mutant strain as a genetically engineered micro-organism with enhanced plant growth stimulant properties, led us to determine whether the mutation conferred an ecological advantage to the fungus during antagonistic interactions with the saprotrophic competitor Rhizoctonia solani in soil. Furthermore, we set out to investigate whether its ability to control pre- and post-emergence diseases of lettuce seedlings caused by Sclerotinia sclerotiorum and R. solani, respectively, had been modified. Using laboratory-based microcosms, we show that while loss of N-acetyl-b-D-glucosaminidase activity imparts a dramatic improvement in P-G-P activity in the absence of plant disease pressure, the mutation has a negative impact on its ability to compete saprotrophically with R. solani in soil. Furthermore, the ability of the mutant to promote seedling emergence and growth is constrained by the presence of soil-borne pathogens. This work demonstrates that trade-offs exist in the genetic engineering of Trichoderma strains that exhibit the dual beneficial traits of P-G-P and biocontrol. Genetic manipulation of a single attribute has consequences for other aspects of the organism’s biology and ecology. METHODS Fungal strains, growth conditions and DNA analysis. All strains of T. hamatum used in this study are derived from strain GD12 (GenBank accession no. AY247559) (Thornton et al., 2004; Thornton, 2005, 2008) and were maintained on potato dextrose agar (PDA) or V8 agar as described previously. Strain GD12 is free-living and does not form an association with plant roots. The anastomosis group 1 post-emergence lettuce pathogen R. solani (CBS323.84) and polyphagous plant pathogen S. sclerotiorum (GenBank accession no. FJ984493) were grown on PDA. Gel electrophoresis, restriction enzyme digests, gel blots and sequencing were performed according to standard procedures (Sambrook et al., 1989). PCR of N-acetyl-b-D-glucosaminidase genes and production of enzyme-deficient mutant. The degenerate primers NagA [59- GTCCTG(AC)(AG)5G(GC)5(CT)T5GA(AG)AC5TT(CT)(AT)(GC)5Chttp://mic.sgmjournals.org A] and NagB [59-TTGAG(CT)TC(AG)TC5CC(AGCT)CC5GT(AG)TG(AG)AA(AG)TA] were designed based on multiple sequence alignments of known Trichoderma Nag proteins, and were used to amplify a 575 bp fragment from GD12 genomic DNA. The 575 bp PCR amplicon was used to probe restriction enzyme digests of genomic DNA to determine N-acetyl-b-D-glucosaminidase gene copy number and was subsequently cloned into pGEM-T. Positive clones were identified by restriction enzyme digests with NcoI and NotI. To amplify a larger fragment of the T. hamatum NAG gene for insertional mutagenesis, primers were designed using the sequenced 575 bp fragment and the Trichoderma harzianum EXC2Y nucleotide sequence retrieved from the NCBI databases (www.ncbi.nlm.nih.gov). The primer set 30.2 (59-CGTCATTATTCATTAATAGTTGCC) and M13.52 (59TCCTGTGTGAAATTGTTATCCGCTGCCAGCATCCAA), and primer set 5.1 (59-TAGGCACATACTCCTCCCTCTCTC) and M13.32 (59GTCGTGACTGGGAAAACCCTGGCGGACGCCATACTC), were used to amplify 1.0 kb and 919 bp of the target gene, respectively. Insertional mutagenesis was performed using a fusion-based PCR method. The HPH gene from Neurospora crassa under the N. crassa TRPC promoter, conferring resistance to hygromycin, was cloned into pBluescript (Stratagene) as a 1.4 kb EcoRI–XbaI fragment. To amplify the split HPH templates, the primer set M13F (59-CGCCAGGGTTTTCCCAGTCACGAC) and HY (59-GGATGCCTCCGCTCGAAGTA), and primer set M13R (59-AGCGGATAACAATTTCACACAGGA) and YG (59-CGTTGCAAGACCTGCCTGAA), were used. A third round PCR was performed using the nested primers 5.2 (59-TTGACCAGACGGTCCAGGTAACCT) and 30.1 (59-GCACATCAACCTGAGATGTGGTGT) to join the constructs together. T. hamatum GD12 protoplasts were transformed with 2 mg DNA of the third round PCR product. DThnag : : hph mutants were selected for resistance to 300 mg hygromycin ml21. The T. hamatum GD12 NAG gene and protein sequence were submitted to GenBank under accession no. JN107809. Complementation of the N-acetyl-b-D-glucosaminidase-deficient mutant. A 4.29 kb amplicon consisting of the 1.86 kb Thnag ORF, 1.93 kb of the promoter region and 0.5 kb of the 39 untranslated region was amplified from genomic DNA. The complete gene sequence was obtained from in-house sequencing of the T. hamatum GD12 genome using an Illumina GA2 sequencer. Primer sequences for amplification were NagC (59-AGGGATGAGAGCCTTGATGTATTT) and NagD (59-TTTCTTATAAGAGCGATCTG). PCR was performed in an Applied Biosystems GeneAmp PCR system 2400 cycler using Herculase polymerase in Herculase 610 buffer (Stratagene). An initial Hot Start and denaturation step was carried out at 94 uC for 5 min followed by PCR cycling parameters of 94 uC for 30 s, 50 uC for 30 s, 72 uC for 5 min (10 cycles), 94 uC for 30 s, 55 uC for 30 s, 72 uC for 5 min, and 72 uC for 10 min (20 cycles). The resulting 4.29 kb PCR fragment was gel purified using a Wizard (Promega) kit and cloned into the 3 kb pGEM-T vector. Positive clones were confirmed by restriction digest with ApaI and SpeI. The 4.29 kb Thnag fragment was subsequently liberated from pGEM-T using ApaI and SpeI, and ligated into the pCB1532 vector containing the ILVI gene encoding resistance to sulfonylurea (Sweigard et al., 1997). The resulting plasmid was used to transform the N-acetylb-D-glucosaminidase mutant DThnag : : hph. Putative DThnag : : hph:NAG retransformants were selected for resistance to 1 mg sulfonylurea ml21. Determination of hyphal chitin contents and chitinase activities. For enzyme activity assays, fungal strains were grown for 4 days at 26 uC in multiple 250 ml flasks containing sterile autoclaved wheat bran mix [10 g wheat bran and 30 ml distilled water (dH2O)] and 1.0 % (w/v) chitin from shrimp shells (Sigma C7170). Flasks were inoculated with five 5 mm diameter plugs of mycelium taken from the growing edge of 4-day-old PDA plate cultures. Under these conditions, the bran– chitin mixture was fully colonized by both fungi by day 4. Extracts were prepared by mixing the contents of flasks with 50 ml dH2O for 1 h at Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 85 L. S. Ryder and others 23 uC, followed by centrifugation at 16000 g to remove bran and fungal biomass. N-Acetyl-b-D-glucosaminidase activity in polyacrylamide gels was determined according to the method of Tronsmo & Harman (1993) using the substrate 4-methylumbelliferyl-N-acetyl-bD-glucosaminide, the fluorescent substrate of this enzyme (DuoChuan, 2006). For colorimetric estimations of enzyme activities, a commercial chitinase assay kit (Sigma CS0980) was used. Chitin contents of hyphae were determined by colorimetric estimations of N-acetylglucosamine released by alkaline digestion. Three replicate 250 ml flasks containing 100 ml autoclaved potato dextrose broth (Fluka P6685) were inoculated with five 5 mm diameter plugs of mycelium taken from the growing edge of 4-day-old PDA plate cultures. The flasks were incubated at 26 uC with shaking for 3 days and 100 mg samples of fresh hyphal biomass assayed for chitin content according to the nitrous acid – 3-methyl-2-benzothiazolinone hydrazone hydrochloride – ferric chloride assay (Kaminskyj & Heath, 1982; Thornton et al., 1991). Chitin concentrations were expressed as mg glucosamine (g fresh mycelium)21. A Student’s t-test was used to determine statistical significance. Spore production and sensitivities to antibiotics. Mycelium from GD12 and DThnag : : hph were inoculated onto PDA, onto PDA containing 200 mg calcofluor white ml21 or PDA containing 200 mg caspofungin ml21. Colony diameters were measured over a 4 day growth period at 26 uC, except for caspofungin plates which were measured over 14 days. Spore production was quantified after 21 days using a haemocytometer following suspension of spores in 20 ml dH2O and filtration through Miracloth (Thornton, 2008). P-G-P and soil nutrient analysis. One litre of sieved (500– 1000 mm) Sphagnum moss peat (Shamrock) was mixed with 400 ml dH2O and sterilized by autoclaving at 121 uC for 15 min. T. hamatum inoculum was prepared by inoculating sterile autoclaved wheat bran mix (10 g wheat bran and 30 ml dH2O) with five 5 mm diameter plugs of mycelium taken from the growing edge of 4-day-old PDA plate cultures of the fungus. After incubation at 26 uC for 5 days under a 16 h fluorescent light regime to allow complete colonization of the bran by mycelium, microcosms (1206120612 mm) were constructed with 8 g bran inoculum and 300 g sterilized peat (1 : 37.5 w/w), and were sown with 25 seeds of lettuce (Lactuca sativa cultivar Webb’s Wonderful). Microcosms were placed in a fully randomized design in a growth cabinet (Sanyo) at 24 uC with a relative humidity of 95 % and a 16 h fluorescent light regime. After 21 days growth, plants were harvested and dry weights of shoots and roots were obtained. Differences in dry weights were analysed by one-way analysis of variance (ANOVA) and post-hoc Tukey tests were used to determine significance. Water extracts from bran inoculum were also used to determine whether P-G-P could be achieved in the absence of the fungus. Fiveday-old bran inoculum (10 g) was mixed thoroughly for 1 h with 50 ml dH2O and extracts were centrifuged at 12 000 g for 5 min. Clarified extracts were filtered through Miracloth (Calbiochem) and then filter-sterilized by passing through a 0.2 mm membrane (Millipore). Microcosms were constructed with 300 g sterilized peat and 30 ml sterile extract, and were sown with 25 lettuce seeds. Thereafter, conditions were as described above. After 7 days growth, dry weights of shoots and roots were obtained. For soil nutrient analysis, replicate microcosms consisting of the peat and bran inoculum mix were assayed by NRM Laboratories after 21 days incubation under the conditions described. Control microcosms consisted of sterilized peat with uncolonized autoclaved bran only. Student’s t-tests were used to determine statistical significance. Secretion assay and microscopy. Secretion was determined in shake culture experiments by using an ELISA with a Trichoderma-specific 86 monoclonal antibody (mAb) MF2 that binds to an extracellular, constitutively expressed, glycoprotein antigen secreted from the hyphal tip (Thornton et al., 2002; Thornton, 2004). Potato dextrose broth in 250 ml flasks was sterilized by autoclaving and the flasks were inoculated with five plugs (3 mm diameter) of mycelium taken from the growing edge of PDA plate cultures of the fungi. The flasks were incubated as shake cultures at 26 uC and at 3 day intervals culture fluids were collected by straining contents through Miracloth. Fluids were then centrifuged for 5 min at 16 000 g and 50 ml samples were transferred to microtitre wells for assay by ELISA. There were three replicates for each treatment. Absorbance values from ELISA were converted to units of protein equivalents by using standard curves of chromatographically purified antigen, prepared from doubling dilutions of a PBS solution of the antigen in microtitre wells (Thornton et al., 2002). Dry weights were obtained by drying the collected mycelium to a constant weight at 80 uC. For immunofluorescence microscopy, fungi were grown on Teflon-coated glass slides embedded in PDA (Thornton et al., 2002; Thornton, 2004), were fixed and processed using mAb MF2 and FITC-conjugated secondary antibody (Thornton et al., 2002; Thornton, 2004), or were immersed in calcofluor white solution (50 mg ml21) without fixation (Elorza et al., 1983). Fluorescence of samples was observed by using either a Zeiss Axioskop 2 fluorescence microscope using 495 nm excitation and 500–550 nm emission wavelengths or a Zeiss LSM confocal microscope using 488 nm excitation and 505–570 nm emission wavelengths. Quantification of competitive saprotrophic abilities. The competitive saprotrophic abilities of Trichoderma strains GD12 and 6.1 were quantified during antagonistic interactions with R. solani in peat microcosms by using the immunological approach described by Thornton (2004). Sieved (500–1000 mm) sphagnum moss peat (1 l; Shamrock) was mixed with 400 ml dH2O and 0.5 % (w/v) wheat bran in 2 l flasks and sterilized by autoclaving at 121 uC for 15 min. For preparation of pathogen inoculum, 10 g white poppy seeds and 5 ml dH2O were autoclaved at 121 uC for 15 min. The seeds were inoculated with five 5 mm plugs of mycelium taken from the leading edge of PDA culture plates, incubated for 15 days at 26 uC, and the colonized seeds were air-dried at 23 uC under sterile conditions. Trichoderma strains were incorporated as spore inoculum (Thornton, 2004). For the generation of spores, strains GD12 and 6.1 were grown on PDA containing 200 mg caspofungin ml21 and spore suspensions were prepared from 3-week-old plates. Poppy seed inoculum of R. solani was added to the sterilized peat at 0.1 % (w/v), while Trichoderma strains were added as spore suspensions (1 ml) containing 104 conidia ml21 in dH2O. The spores from both Trichoderma strains, and the R. solani poppy seed inoculum, showed .95 % germinability when grown on PDA. The contents of the flasks were mixed thoroughly and the mixtures were used to construct microcosms for antigen extraction and assay by R. solani-specific ELISA over a 21 day incubation period, using the procedures described previously (Thornton & Gilligan, 1999; Thornton, 2004). Biocontrol assays. The fitness of T. hamatum strains GD12 and 6.1 as biocontrol agents was determined by their abilities to control preand post-emergence diseases of lettuce caused by the root-infecting pathogens S. sclerotiorum and R. solani, respectively. Lettuce microcosms (1206120612 mm) were constructed as described with peat amended with Trichoderma strains only (8 g bran inoculum and 300 g peat), pathogen only (8 g poppy seed inoculum and 300 g peat) or both. Plants were grown under the conditions described and percentage emergence and dry weights of plants were determined after 21 days. Differences in dry weights of shoot and root materials were analysed by single-tailed t-test. Differences in percentage emergence were determined by single-tailed t-test after transformation of data using the arc sin21 function. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 Microbiology 158 Saprotrophism and biocontrol fitness of GM T. hamatum RESULTS experiments (Fig. 1d), thus establishing that the effect was due to enzyme loss-of-function. Confirmation of N-acetyl-b-D-glucosaminidase disruption and complementation A targeted gene disruption of the T. hamatum NAG gene (GenBank accession no. JN107809) was carried out by insertion of a 1.4 kb gene cassette conferring hygromycin resistance into the open reading frame. Southern blot analysis showed that the hygromycin-resistant transformant 6.1 (hereafter referred to as DThnag : : hph) contained the correct sized insertion (Supplementary Fig. S1, available with the online version of this paper). Southern blot analysis also confirmed complementation of mutant DThnag : : hph (C17, hereafter referred to as DThnag : : hph:NAG) (Supplementary Fig. S1). To investigate the effect of the mutation on enzyme activity, N-acetyl-b-D-glucosaminidase activities of GD12, DThnag : : hph and the complemented strain were determined colorimetrically, and by using an in-gel assay for N-acetyl-b-D-glucosaminidase activity. In-gel activity assays (Fig. 1a) and colorimetric assays showed disruption of Nacetyl-b-D-glucosaminidase activity in the DThnag : : hph mutant and confirmed our initial findings that only a single copy of the N-acetyl-b-D-glucosaminidase gene exists in T. hamatum (Supplementary Fig. S2). Tests with DThnag : : hph:NAG showed that the complementation had restored enzyme activity using both the in-gel activity assay (Fig. 1b) and colorimetric assay (Table 1). The chitin content of mutant hyphae was significantly reduced (P,0.05, Student’s t-test) compared with GD12. The mean hyphal chitin concentration of DThnag : : hph was 6.9±0.9 mg glucosamine (g mycelium)21 compared with 17.9±2.6 mg glucosamine (g mycelium)21 for GD12. N-acetyl-b-D-glucosaminidase disruption enhances P-G-P but is not associated with nutrient release The enzyme-deficient mutant DThnag : : hph was tested for its ability to enhance growth promotion of lettuce (L. sativa). We originally hypothesized that disruption of Nacetyl-b-D-glucosaminidase, a key chitinolytic enzyme implicated in the depolymerization of soil chitin and release of nitrogen for plant growth (Leake & Read, 1990; Kerley & Read, 1995, 1998; Read & Perez-Moreno, 2003; Lindahl & Taylor, 2004), might decrease P-G-P by T. hamatum. In contrast with our expectations, we found that disruption of the NAG gene dramatically enhanced the growth of lettuce seedlings as shown in Fig. 1c. Treatment with GD12 resulted in a fourfold increase in leaf and shoot dry weights (P50.05) and a fivefold increase in root dry weights (P,0.001) compared with the control. The increase in plant growth was more dramatic with the Nacetyl-b-D-glucosaminidase-deficient mutant. Treatment with DThnag : : hph resulted in a 13-fold increase in shoot and leaf dry weights (P,0.001) and an 11-fold increase in root dry weights (P,0.001) (Fig. 1d). The complemented strain essentially behaved like the wild-type strain in these http://mic.sgmjournals.org The P-G-P effects seen with certain Trichoderma strains have been linked to the solubilization of phosphates and micronutrients (Altomare et al., 1999), but the evidence presented here shows that nutrient release as a consequence of saprotrophic activity of the fungus could not account for the observed P-G-P with GD12 or with the DThnag : : hph mutant. Indeed, there were no significant increases in the amounts of available nutrients as a consequence of saprotrophic colonization of peat by the two strains of fungi when compared with the uncolonized controls. While concentrations of ammonia-nitrogen, nitrate-nitrogen and total soluble nitrogen were higher in DThnag : : hph microcosms compared with GD12, the differences were not significant (Student’s t-test, Table 2). Nevertheless, to test whether the increase in nitrogen availability observed in the DThnag : : hph microcosms might contribute to the increase in P-G-P found with the mutant, we added ammonium and nitrate in the form of soluble NH4Cl and NaNO3 to identical levels found in DThnag : : hph-colonized microcosms. However, no increase in plant growth resulting from these treatments was found (results not shown). A number of elements (P, K, Mg, Ca, Na and sulphate) showed a reduction in availability in the Trichodermatreated microcosms. The reasons for this are unclear, but may be due to chelation by the fungi (Altomare et al., 1999). We were able to discount the possibility that growth promotion occurs in response to the control of minor root pathogens, because our studies were conducted with sterilized peat in the absence of disease pressure. This is consistent with other studies showing growth promotion by Trichoderma species in the absence of detectable disease (Chang et al., 1986) and in sterile soil (Windham et al., 1986). We therefore conclude that P-G-P by the fungus does not occur through nutrient release or control of minor root pathogens. Increases in the growth of lettuce plants in response to water extracts from bran inoculum of GD12 and DThnag : : hph showed that growth promotion was due, at least in part, to the production of a water-soluble growth enhancing compound(s) (Supplementary Fig. S3). Growth promotion was more pronounced with extracts from the N-acetyl-b-D-glucosaminidase-deficient mutant than with extracts from GD12, indicating increased production of the stimulatory compound(s) by DThnag : : hph. The N-acetyl-b-D-glucosaminidase-deficient mutant has altered chitin deposition at the hyphal tip Growth tests of the DThnag : : hph mutant revealed no significant reduction in hyphal growth in vitro compared with GD12 (Fig. 2a, b). However, spore production was completely absent in the mutant in both axenic culture and soil (Figs 1e and 2a). The spore concentration of axenic cultures of the wild-type strain was 2.76107 spores ml21. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 87 L. S. Ryder and others Fig. 1. (a) In-gel activity assay showing loss of N-acetyl-b-D-glucosaminidase activity in the DThnag : : hph mutant 6.1. (b) Zymograms showing restoration of N-acetyl-b-D-glucosaminidase activity in the DThnag : : hph:NAG complemented strain C17. No other fluorescent products were visible on the gels. (c) Lettuce plants grown for 3 weeks in peat microcosms containing the T. hamatum strain GD12 and the N-acetyl-b-D-glucosaminidase-deficient mutant DThnag : : hph. Bar, 18 mm. (d) Histogram showing dry weights of lettuce leaf (black bars) and root (white bars) material after 3 weeks growth in peat microcosms with GD12, DThnag : : hph and the complemented strain C17. Data shown are the mean±SEM of three replicate trays, each containing 25 plants. Bars with different letters are significantly different at 95 % confidence level. (e) Sporulation of GD12 (production of spore masses, indicated by arrow) and lack of sporulation (absence of spore masses) of DThnag : : hph in peat following incorporation of bran inoculum. Chitin is a structural component of the cell wall of Trichoderma species and N-acetyl-b-D-glucosaminidase is one of a number of chitinase enzymes that are believed to play a role in cell wall turn-over and remodelling during 88 hyphal development (Reyes et al., 1989a, b; Rast et al., 1991; Sahai & Manocha, 1993; Horsch et al., 1997; White et al., 2002). To test whether N-acetyl-b-D-glucosaminidase functions in cell wall biogenesis of this fungus, GD12 and Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 Microbiology 158 Saprotrophism and biocontrol fitness of GM T. hamatum Table 1. Chitinase activities of T. hamatum GD12 and the mutant strains DThnag : : hph and DThnag : : hph:NAG Data are the mean±SEM of triplicate values. Enzyme activity (units ml”1) Strain GD12 DThnag : : hph DThnag : : hph:NAG Chitobiosidase Endochitinase N-acetyl-b-D-glucosaminidase 0.70±0.04 0.04±0.01 0.68±0.12 1.40±0.30 0.06±0.01 1.08±0.41 10.80±0.90 0.04±0.02 9.03±0.40 DThnag : : hph mycelia were inoculated onto standard medium containing calcofluor white, and sensitivity was assessed over a 4 day period. Calcofluor white preferentially binds to polysaccharides containing 1,4-linked Dglucopyranosyl units and alters the assembly of chitin microfibrils in fungi (Elorza et al., 1983). Sensitivity to this Table 2. Peat nutrient analysis following saprotrophic colonization by T. hamatum GD12 and the N-acetyl-b-Dglucosaminidase-deficient mutant DThnag : : hph The units of measurement are mg l21 for all analytes except conductivity (mS cm21), dry matter (%; converted to degrees using arc sin21 transformation), and density and dry density (kg m3). No units for pH. Analyte Conductivity pH Dry matter Density Dry density Chloride Phosphorus Potassium Magnesium Calcium Sodium Ammonianitrogen* Nitratenitrogen* Total soluble nitrogen* Sulphate Boron Copper Manganese Zinc Iron Strain Control GD12 DThnag : : hph 169±7 4.40±0.01 25.1±0.0 557±7 99±1 29±2 240±14 231±10 21±1 6.4±0.1 30±3 22±1 69±1 4.86±0.03 23.3±0.3 565±15 87±2 21±1 79±2 36±1 0.70±0.09 1.4±0.3 21±1 33±3 72±1 4.90±0.03 23.1±0.3 559±24 87±3 22±2 82±2 39±1 0.76±0.09 1.4±0.2 15±1 37±4 1.43±0.03 1.03±0.33 2.53±0.21 24±3 34±3 39±4 33±1 0.137±0.007 ,0.006 0.167±0.009 0.067±0.007 0.130±0.02 22±1 0.117±0.009 ,0.006 ,0.006 ,0.006 0.100±0.006 21±2 0.120±0.015 ,0.006 ,0.006 ,0.006 0.113±0.023 *Differences between means of GD12 and DThnag : : hph not significant at 95 % confidence level (Student’s t-test). http://mic.sgmjournals.org compound is therefore closely related to the chitin content of cell walls. After 4 days growth, there was no significant difference in growth of the mutant compared to the wildtype strain (Fig. 2a, b). However, when calcofluor white was used in microscopy staining tests, intense fluorescence was observed at the tips of mutant hyphae, whereas no such pattern was observed in GD12 (Fig. 3a). This is consistent with a defect involving incorrect deposition of chitin polymers at the hyphal tip of the DThnag : : hph mutant. The significant (P,0.05, Student’s t-test) decrease in growth of DThnag : : hph during exposure to caspofungin (Fig. 2a, b), an echinocandin antifungal drug that inhibits b-1,3-glucan synthases (Lesage et al., 2004; Walker et al., 2008; Fuchs & Mylonakis, 2009), was not unexpected since chitin in the fungal cell wall is covalently linked via a peptide linkage to b-glucan. Chitin and b-glucan are extruded at the hyphal apex and, following modification, result in the formation of chitin microfibrils cross-linked to a glucan matrix (Wessels, 1994). Consequently, the combination of incorrect chitin deposition at the hyphal tip due to N-acetyl-b-D-glucosaminidase deficiency and inhibition of b-1,3-glucan synthesis by caspofungin would be predicted to further significantly inhibit cell wall biosynthesis and growth of the mutant compared with the wild-type strain. Despite this, after 3 weeks growth, sporulation had been partially restored in the DThnag : : hph mutant (Fig. 2c), so that spore concentrations for GD12 and DThnag : : hph were 16107 ml21 (±0.26107 ml21) and 6.46104 ml21 (±16104 ml21), respectively. Furthermore, the DThnag : : hph spores were viable. Single spore isolates germinated on PDA to produce nonsporulating colonies (Fig. 2d). This showed that sporulation in the N-acetyl-b-D-glucosaminidase mutant can be induced by exposure to caspofungin, but that the ability to produce spores is lost following release from the drug. Little is known about b-1,3-glucan synthases and sporulation in filamentous fungi, but in the human pathogen Aspergillus fumigatus, exposure to the drug results in upregulation of chitin biosynthetic genes and stimulation of chitin synthesis (Fortwendel et al., 2010). It is reasonable to speculate that a similar process occurs in DThnag : : hph during caspofungin exposure, leading to improved cell wall integrity which supports transient and partial restoration of sporulation. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 89 L. S. Ryder and others Fig. 2. Growth of T. hamatum GD12 and DThnag : : hph on PDA amended with calcofluor white and caspofungin. (a) Photographs showing growth of GD12 and DThnag : : hph after 4 days (PDA only, PDA+calcofluor white) or after 14 days (PDA+caspofungin). Bar, 15 mm. (b) Colony diameters of GD12 (h) and DThnag : : hph (#) measured over 4 days (PDA only, PDA+calcofluor white) or over 14 days (PDA+caspofungin). Each point is the mean±SEM of three replicate values. (c) Sporulation of T. hamatum GD12 and DThnag : : hph after 3 weeks growth on PDA amended with caspofungin, and (d) subsequent colony morphologies of single spore isolates after subculture to PDA only. Note lack of green spore masses in DThnag : : hph cultures grown in the absence of caspofungin. 90 Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 Microbiology 158 Saprotrophism and biocontrol fitness of GM T. hamatum Fig. 3. Phenotypic analysis of the DThnag : : hph mutant. (a) Microscopic analysis of hyphae of GD12 and DThnag : : hph following exposure to calcofluor white and observation under UV light, showing intense fluorescence at hyphal tips of the Nacetyl-b-D-glucosaminidase-deficient mutant. Bar, 12 mm. (b) Immunofluorescence of GD12 and DThnag : : hph hyphae with mAb MF2, showing hyper-secretion of the glycoprotein antigen around the swollen tip of the mutant hypha. Bar, 10 mm. (d) Quantification of extracellular glycoprotein antigen concentrations in GD12 (#) and DThnag : : hph ($) shaking culture filtrates. Antigen concentrations in (d) were determined by converting absorbance values from ELISA with the Trichoderma-specific mAb MF2 to equivalents of glycoprotein concentration by using a calibration curve of purified Trichoderma antigen (c). Each point is the mean±SEM of three values. The N-acetyl-b-D-glucosaminidase-deficient mutant shows increased secretion of a Trichoderma-specific extracellular antigen Secretion by filamentous fungi is a process that occurs at the hyphal apex (Wösten et al., 1991; Wessels, 1994; Gordon et al., 2000; Thornton, 2004). The altered deposition of chitin at the hyphal tip of the mutant led us to investigate whether DThnag : : hph showed an altered pattern of secretion compared to GD12. To study secretion, we http://mic.sgmjournals.org examined production of an extracellular, constitutively expressed, glycoprotein antigen by immunofluorescence and by quantitative ELISA (Thornton et al., 2002). A Trichoderma-specific mAb MF2 raised against the antigen (Thornton et al., 2002) was used to determine glycoprotein contents in the culture filtrates. Because the antibody binds to antigen produced during active growth of the fungus (Thornton, 2004) we were able to quantify, using a standard curve of purified antigen (Fig. 3c), the protein concentration per unit biomass of the fungus. Using this procedure, MF2 Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 91 L. S. Ryder and others antigen production was found to be up to 35-fold higher in DThnag : : hph compared with the wild-type strain (Fig. 3d) showing hyper-secretion of the antigen by the mutant. Consistent with these data, immunofluorescence microscopy of the hyphal tips of wild-type and mutant strains with mAb MF2 showed the antigen was bound to the cell wall of GD12 but there was additional elevated production of the antigen in a halo surrounding the swollen tip of DThnag : : hph hyphae (Fig. 3b). The N-acetyl-b-D-glucosaminidase-deficient mutant has reduced competitive saprotrophic ability and impaired biocontrol fitness The competitive saprotrophic abilities of GD12 and DThnag : : hph were determined by quantitative ELISA and significantly increased seedling emergence and mean dry weights compared with the control. Furthermore, seedling emergence and mean root dry weight were significantly increased in the mixed species microcosms compared with the microcosms with GD12 treatment only (Fig. 4c, e). While treatment of S. sclerotiorum microcosms with the mutant DThnag : : hph significantly increased establishment of lettuce seedlings compared with S. sclerotiorum only (Fig. 4b, c), percentage emergence was significantly reduced compared with the control. Furthermore, mean dry weights of shoot and root materials in the S. sclerotiorum+ DThnag : : hph microcosms were significantly reduced compared with microcosms containing the pathogen and GD12 (Fig. 4c–e). The post-emergence lettuce pathogen R. solani had no significant effect on seedling emergence and mean root dry weight compared with control microcosms (Fig. 4c, e), but the mean shoot dry weight was significantly reduced (Fig. 4d). Mixed species microcosms containing R. solani and GD12 showed significant increases in emergence and mean dry weights compared with the control and the R. solani- and GD12-only microcosms (Fig. 4c–e). While similar trends were shown in microcosms containing the pathogen and DThnag : : hph, the increases in mean shoot and root dry weights compared with R. solani only were significantly less than those of the R. solani+GD12 microcosms and, in the case of shoot dry weight, microcosms containing DThnag : : hph only (Fig. 4c–e). during antagonistic interactions with the pathogen R. solani in soil-based microcosms. Because the mutant DThnag : : hph was shown in vitro to hyper-secrete the MF2 antigen used in a previous study to quantify Trichoderma saprotrophic growth dynamics in soil (Thornton, 2004), we used a Rhizoctoniaspecific ELISA (Thornton & Gilligan, 1999; Thornton, 2004) to quantify the effects of T. hamatum on the pathogen’s saprotrophic growth. Using this method, we were able to determine the competitive saprotrophic abilities of the two Trichoderma strains (Fig. 4a). The population dynamics of R. solani were determined in microcosms containing the pathogen only or in mixed species microcosms inoculated with the pathogen and GD12 or DThnag : : hph. In the absence of Trichoderma, active biomass of R. solani increased between days 2 and 3 followed by a decline between days 3 and 4 (#). From day 4 onwards, there was a rapid increase in active biomass production up to day 10, with a steady decline thereafter up to the last day of sampling (day 21). In the presence of T. hamatum GD12 (e), a similar trend in R. solani biomass production was shown up to day 4, but from days 4 to 21 no further active biomass of the pathogen was produced. In contrast, the mutant DThnag : : hph showed impaired interference competition, allowing saprotrophic growth of the pathogen throughout the 21 day sampling period (g). Specificity of the R. solani mAb EH2 was shown using extracts from microcosm containing GD12 only (h) or DThnag : : hph only ($), where no antigen was detected throughout the 21 day sampling period. With increasing demands for sustainable alternatives to agrochemicals and synthetic fertilizers in food production, there is renewed interest in exploiting the beneficial properties of soil micro-organisms. One such beneficial micro-organism is Trichoderma, a common soil fungus that has been shown to be a credible alternative to pesticides in the control of plant disease (Harman et al., 2004; Verma et al., 2007). In addition to disease control, certain strains also exhibit P-G-P activities (Bae et al., 2009; Contreras-Cornejo et al., 2009; Harman et al., 2004; Ortı́zCastro et al., 2009; Verma et al., 2007; Vinale et al., 2008, 2009). These dual attributes make Trichoderma species attractive as both biocontrol agents and plant growth stimulants. Biocontrol fitness of GD12 and DThnag : : hph was determined in lettuce microcosms inoculated with the lettuce pathogens S. sclerotiorum and R. solani (Fig. 4b). In the absence of disease pressure, GD12 increased the mean dry weights of shoot and root materials significantly compared with the control (lettuce plants with no treatment) (Fig. 4d, e). Additional further increases in mean dry weights of plant materials were shown in DThnag : : hph-treated microcosms in the absence of disease pressure (Fig. 4d, e). The preemergence damping-off pathogen S. sclerotiorum prevented emergence of all lettuce plants in the absence of Trichoderma (Fig. 4b–e). T. hamatum GD12 controlled pre-emergence damping-off disease caused by S. sclerotiorum (Fig. 4c–e) Currently, strict governmental regulations prevent the deployment of genetically modified (GM) micro-organisms for use in human food production (Weaver et al., 2005). One reason for this is the risk of escape of these organisms from the site of application and the competitive advantage any mutation might have on the biological and ecological fitness of the organism. In this study, we aimed to determine whether a genetic modification that enhances the plant growth stimulant properties of T. hamatum imparts additional advantages in terms of biocontrol fitness and competitive saprotrophic ability (CSA). While a previous study has examined genetic stability and ecological persistence of Trichoderma virens genetically 92 DISCUSSION Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 Microbiology 158 Saprotrophism and biocontrol fitness of GM T. hamatum Fig. 4. Competitive saprotrophic abilities and biocontrol efficacies of T. hamatum GD12 and DThnag : : hph. (a) Population dynamics of R. solani in the presence of GD12 (e) and DThnag : : hph (g) and in the absence of Trichoderma (#). The specificity of the R. solani-specific mAb EH2 was shown using extracts from microcosms containing T. hamatum GD12 (h) or DThnag : : hph ($) only. Absorbance values were converted to biomass equivalents expressed as [mg lyophilized mycelium (2 g peat-bran mix)”1] using a standard calibration curve of R. solani lyophilized mycelium. The mean±SEM (based on three replicate values) was then calculated for each set of samples from the populations on each day of sampling. (b) Biological control of preemergence (S. sclerotiorum) and post-emergence (R. solani) disease of lettuce by T. hamatum GD12 and DThnag : : hph. Note control of disease by the wild-type strain GD12, but sporadic control of disease by the mutant DThnag : : hph. (c) Histograms showing mean emergence (as a percentage) and mean shoot and root dry weights of lettuce plants grown in single (pathogens only or Trichoderma strains only) or mixed (pathogens and Trichoderma strains) species peat-based microcosms. Control microcosms contained lettuce only. Data are the mean±SEM from triplicate microcosms each containing 25 lettuce seeds. Emergence percentages were converted to arc sin”1 values for statistical analysis by single-tailed t-test. Bars with different letters are significantly different at 95 % confidence level. modified with a hygromycin resistance gene and a gene encoding an organophosphohydrolase (Weaver et al., 2005), this is the first time, to our knowledge, that a study has been undertaken to determine the saprotrophic competitiveness and biocontrol fitness of a GM strain of T. hamatum with biocontrol and P-G-P activities. http://mic.sgmjournals.org Mutagenesis of the gene (NAG) encoding N-acetyl-b-Dglucosaminidase, resulted in a non-sporulating mutant of GD12 with altered secretion, as shown by increased production of an extracellular Trichoderma glycoprotein antigen. The cell walls of ascomycete fungi contain a mixture of fibrillar components and amorphous or matrix Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 93 L. S. Ryder and others materials (Horsch et al., 1997). The main fibrillar component is chitin, a straight-chain b(1,4)-linked polymer of N-acetylglucosamine. Filamentous fungi grow by extension at the flexible apex of the hypha, a process that requires remodelling of the fibrillar chitin component of the cell wall to allow extension at the growing tip. This remodelling requires coordinated production of constitutive chitinase enzymes such as N-acetyl-b-D-glucosaminidase and endochitinase, in addition to biosynthetic chitin synthases (Horsch et al., 1997; Rast et al., 1991) and b-glucan synthases (Wessels, 1994). Consequently, a deficiency in Nacetyl-b-D-glucosaminidase in GD12 appears to result in abnormal remodelling of the hyphal tip and would account for the intense staining with calcofluor white found in the swollen hyphal apices of the DThnag : : hph mutant, indicative of aberrant chitin deposition. This was supported by colorimetric estimations of chitin contents, which showed a significant reduction in concentration in hyphae of the mutant strain. Consistent with the results of Brunner et al. (2003), we showed that loss of N-acetyl-b-D-glucosaminidase activity in T. hamatum affected the formation of other chitinases. However, unlike the work of Brunner et al. (2003), which showed that disruption of N-acetyl-b-D-glucosaminidase activity in T. atroviride did not affect sporulation of the fungus, the DThnag : : hph mutant of T. hamatum lacked conidiation. Similar reductions in sporulation efficiency were found in Aspergillus mutants altered in chitin deposition (Borgia et al., 1996; Horiuchi et al., 1999; Müller et al., 2002). Alterations in chitin deposition could also account for the increased secretion of the MF2 antigen in DThnag : : hph, since secretion in fungi is a process that occurs at the flexible growing tip (Wösten et al., 1991; Wessels, 1994; Gordon et al., 2000; Thornton, 2004) and is governed by the structure of the cell wall (Kruszewska et al., 1999; Perlińska-Lenart et al., 2006). This is consistent with the increased secretion of glycoproteins observed in the related fungus Trichoderma reesei as a consequence of mutations in chitin distribution in the hyphal cell wall (Perlińska-Lenart et al., 2006). Despite the abnormal morphology of DThnag : : hph, we found, opposite to our expectations, that the mutation increased the ability of the fungus to promote plant growth. While we have yet to identify the stimulatory compound(s) produced by the fungus, we have shown here that by altering the architecture of the hyphal cell wall and the secretory potential of a free-living strain of T. hamatum, significant improvements can be made in its capacity to produce watersoluble P-G-P compounds. Studies with T. virens have shown that enhanced biomass production and promotion of lateral root growth in Arabidopsis occurs through an auxindependent mechanism mediated through the production of auxin-related compounds by the fungus (Contreras-Cornejo et al., 2009). It is possible that similar compounds are produced by T. hamatum GD12 and future studies are aimed at elucidating the P-G-P mechanism in this fungus. 94 The discovery that the mutation had resulted in a biocontrol strain with improved P-G-P activity led us to investigate whether the mutation also conferred increased fitness as a soil saprotroph and as an antagonist of plant pathogens. We found that exposing DThnag : : hph to the drug caspofungin allowed us to switch-on spore production in an ordinarily non-sporulating mutant. This allowed us to generate inoculum for incorporation into soil microcosms and to undertake comparative studies of the competitive saprotrophic abilities of the two Trichoderma strains. Saprotrophic competitiveness was investigated in soil microcosms during antagonistic interactions with the pathogen R. solani, an aggressive colonizer of nutrient reserves in soil (Garrett, 1970). Because the mutant strain was found to hyper-secrete the MF2 antigen, we were unable to use the MF2 quantitative ELISA developed in a previous study (Thornton, 2004) to track the population dynamics of the Trichoderma strains. Instead, we used a Rhizoctonia-specific mAb EH2 (Thornton et al., 1993) to quantify the population dynamics of the pathogen in mixed species microcosms (Thornton & Gilligan, 1999; Thornton, 2004). This mAb binds to an extracellular antigen secreted during hyphal growth of the pathogen (Thornton et al., 1993). Estimations of active biomass of the pathogen in microcosm samples required comparison with calibration curves. In the absence of a source of purified EH2 antigen, extracts from lyophilized mycelium (LM) were used as a quantifiable and repeatable source of antigen for the construction of a standard curve of R. solani biomass (Thornton & Gilligan, 1999). This curve was used to convert the absorbance values of microcosm extracts in ELISA to LM biomass equivalents [expressed as mg LM (2 g peat-bran mix)21], thereby allowing comparative estimates to be made of the abilities of GD12 and DThnag : : hph to limit the growth of R. solani. In doing so, we were able to investigate the CSAs of GD12 and the mutant strain in relation to R. solani proliferation in mixed species microcosms. Using this procedure, we showed that the mutant DThnag : : hph has reduced CSA compared with GD12, thereby permitting saprotrophic growth of the pathogen in soil. The interference competition of GD12 (as defined by Wicklow, 1992) is unlikely to be mediated through direct physical contact with the live host, since this strain of the fungus does not display coiling of R. solani hyphae in vitro, a property that has been demonstrated with other antagonistic T. hamatum strains (Chet et al., 1981). It is feasible that loss of overall chitinase activities due to N-acetyl-b-D-glucosaminidase deficiency was a contributing factor for the mutant’s inability to compete with R. solani for nutrient reserves (bran) in mixed species microcosms, since Trichoderma chitinolytic enzymes have been shown to have substantial inhibitory effects on the hyphal elongation of chitin-containing fungi such as R. solani (Lorito, 1998). Saprotrophic competitiveness is an important aspect of biological control, since it enables the biocontrol agent to compete with pathogens for nutrient resources in soil. The Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 Microbiology 158 Saprotrophism and biocontrol fitness of GM T. hamatum plurivorous necrotrophic fungus S. sclerotiorum is an important pathogen of a diverse range of hosts including lettuce (Malvárez et al., 2007). T. hamatum GD12 was effective in not only preventing colonization of lettuce seeds by the pathogen but also further stimulating seedling emergence in mixed species microcosms. In contrast, the mutant DThnag : : hph displayed a significant reduction in its ability to stimulate emergence in the presence of the pathogen. However, a loss of emergence was compensated for by an increase in the weight of established plants. This showed that in the presence of an aggressive pre-emergence damping-off pathogen, loss of biocontrol fitness was balanced by the improved P-G-P activity of the mutant. A similar trend was apparent with R. solani. Significant increases in the emergence and dry weights of plants were found in mixed species microcosms containing GD12 and the pathogen compared with microcosms containing GD12 only. However, the ability of DThnag : : hph to promote plant growth was significantly impaired by the pathogen. This work demonstrates that substantial improvements in plant productivity can be gained by genetically manipulating the growth stimulant properties of a biocontrol and PG-P strain of Trichoderma. However, in the case of T. hamatum DThnag : : hph, the genetic modification leading to improved P-G-P activity in the absence of disease pressure, does not confer ecological or biological advantages to the antagonist. On the contrary, the mutation decreased the saprotrophic competitiveness and biocontrol fitness of the fungus, and its ability to promote plant growth was constrained by the presence of soil-borne pathogens. Chang, Y.-C., Baker, R., Kleifeld, O. & Chet, I. (1986). Increased growth of plants in the presence of the biological control agent Trichoderma harzianum. Plant Dis 70, 145–148. Chet, I. & Baker, R. (1981). Isolation and biocontrol potential of Trichoderma hamatum from soil naturally suppressive to Rhizoctonia solani. Phytopathology 71, 286–290. Chet, I., Harman, G. E. & Baker, R. (1981). Trichoderma hamatum: Its hyphal interaction with Rhizoctonia solani and Pythium spp. Microb Ecol 7, 29–38. Contreras-Cornejo, H. A., Macı́as-Rodrı́guez, L., Cortés-Penagos, C. & López-Bucio, J. (2009). Trichoderma virens, a plant beneficial fungus, enhances biomass production and promotes lateral root growth through an auxin-dependent mechanism in Arabidopsis. Plant Physiol 149, 1579–1592. Djonović, S., Vittone, G., Mendoza-Herrera, A. & Kenerley, C. M. (2007). Enhanced biocontrol activity of Trichoderma virens transformants constitutively coexpressing b-1,3- and b-1,6-glucanase genes. Mol Plant Pathol 8, 469–480. Duo-Chuan, L. (2006). Review of fungal chitinases. Mycopathologia 161, 345–360. Elorza, M. V., Rico, H. & Sentandreu, R. (1983). Calcofluor white alters the assembly of chitin fibrils in Saccharomyces cerevisiae and Candida albicans cells. J Gen Microbiol 129, 1577–1582. Flores, A., Chet, I. & Herrera-Estrella, A. (1997). Improved biocontrol activity of Trichoderma harzianum by over-expression of the proteinase-encoding gene prb1. Curr Genet 31, 30–37. Fortwendel, J. R., Juvvadi, P. R., Perfect, B. Z., Rogg, L. E., Perfect, J. R. & Steinbach, W. J. (2010). Transcriptional regulation of chitin synthases by calcineurin controls paradoxical growth of Aspergillus fumigatus in response to caspofungin. Antimicrob Agents Chemother 54, 1555–1563. Fuchs, B. B. & Mylonakis, E. (2009). Our paths might cross: the role of the fungal cell wall integrity pathway in stress response and cross talk with other stress response pathways. Eukaryot Cell 8, 1616– 1625. ACKNOWLEDGEMENTS The work was funded by the UK Biotechnology and Biological Sciences Research Council, to whom we are grateful. Garrett, S. D. (1970). Pathogenic Root Infecting Fungi. Cambridge: Cambridge University Press. Gordon, C. L., Khalaj, V., Ram, A. F., Archer, D. B., Brookman, J. L., Trinci, A. P. J., Jeenes, D. J., Doonan, J. H., Wells, B. & other authors (2000). Glucoamylase:green fluorescent protein fusions to monitor REFERENCES protein secretion in Aspergillus niger. Microbiology 146, 415–426. Altomare, C., Norvell, W. A., Björkman, T. & Harman, G. E. (1999). Harman, G. E., Howell, C. R., Viterbo, A., Chet, I. & Lorito, M. (2004). Solubilization of phosphates and micronutrients by the plant-growthpromoting and biocontrol fungus Trichoderma harzianum Rifai 129522. Appl Environ Microbiol 65, 2926–2933. Bae, H., Sicher, R. C., Kim, M. S., Kim, S.-H., Strem, M. D., Melnick, R. L. & Bailey, B. A. (2009). The beneficial endophyte Trichoderma hamatum isolate DIS 219b promotes growth and delays the onset of the drought response in Theobroma cacao. J Exp Bot 60, 3279–3295. Baek, J.-M., Howell, C. R. & Kenerley, C. M. (1999). The role of an extracellular chitinase from Trichoderma virens Gv29-8 in the biocontrol of Rhizoctonia solani. Curr Genet 35, 41–50. Borgia, P. T., Iartchouk, N., Riggle, P. J., Winter, K. R., Koltin, Y. & Bulawa, C. E. (1996). The chsB gene of Aspergillus nidulans is Trichoderma species – opportunistic, avirulent plant symbionts. Nat Rev Microbiol 2, 43–56. Horiuchi, H., Fujiwara, M., Yamashita, S., Ohta, A. & Takagi, M. (1999). Proliferation of intrahyphal hyphae caused by disruption of csmA, which encodes a class V chitin synthase with a myosin motorlike domain in Aspergillus nidulans. J Bacteriol 181, 3721–3729. Horsch, M., Mayer, C., Sennhauser, U. & Rast, D. M. (1997). b-Nacetylhexosaminidase: a target for the design of antifungal agents. Pharmacol Ther 76, 187–218. Kaminskyj, S. G. W. & Heath, M. C. (1982). An evaluation of the nitrous acid – 3-methyl-2-benzothiazolinone hydrazone hydrochloride – ferric chloride assay for chitin in rust fungi and rustinfected tissue. Can J Bot 60, 2575–2580. necessary for normal hyphal growth and development. Fungal Genet Biol 20, 193–203. Kerley, S. J. & Read, D. J. (1995). The biology of mycorrhiza in the Brunner, K., Peterbauer, C. K., Mach, R. L., Lorito, M., Zeilinger, S. & Kubicek, C. P. (2003). The Nag1 N-acetylglucosaminidase of Ericaceae. XV. Chitin degradation by Hymenoscyphus ericae and transfer of chitin-nitrogen to the host plant. New Phytol 131, 369–375. Trichoderma atroviride is essential for chitinase induction by chitin and of major relevance to biocontrol. Curr Genet 43, 289–295. http://mic.sgmjournals.org Kerley, S. J. & Read, D. J. (1998). The biology of mycorrhiza in the Ericaceae. XX. Plant and mycorrhizal necromass as nitrogenous Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 95 L. S. Ryder and others substrates for the ericoid mycorrhizal fungus Hymenoscyphus ericae and its host. New Phytol 139, 353–360. Kruszewska, J. S., Butterweck, A. H., Kurzatkowski, W., Migdalski, A., Kubicek, C. P. & Palamarczyk, G. (1999). Overexpression of the Thornton, C. R. (2004). An immunological approach to quantifying the saprotrophic growth dynamics of Trichoderma species during antagonistic interactions with Rhizoctonia solani in a soil-less mix. Environ Microbiol 6, 323–334. Saccharomyces cerevisiae mannosylphosphodolichol synthase-encoding gene in Trichoderma reesei results in an increased level of protein secretion and abnormal cell ultrastructure. Appl Environ Microbiol 65, 2382–2387. Thornton, C. R. (2005). Use of monoclonal antibodies to quantify the dynamics of a-galactosidase and endo-1,4-b-glucanase production by Trichoderma hamatum during saprotrophic growth and sporulation in peat. Environ Microbiol 7, 737–749. Leake, J. R. & Read, D. J. (1990). Chitin as a nitrogen source for Thornton, C. R. (2008). Tracking fungi in soil with monoclonal mycorrhizal fungi. Mycol Res 94, 993–995. antibodies. Eur J Plant Pathol 121, 347–353. Lesage, G., Sdicu, A. M., Ménard, P., Shapiro, J., Hussein, S. & Bussey, H. (2004). Analysis of beta-1,3-glucan assembly in Thornton, C. R. & Gilligan, C. A. (1999). Quantification of the effect of Saccharomyces cerevisiae using a synthetic interaction network and altered sensitivity to caspofungin. Genetics 167, 35–49. the hyperparasite Trichoderma harzianum on the saprotrophic growth dynamics of Rhizoctonia solani in compost using a monoclonal antibody-based ELISA. Mycol Res 103, 443–448. Limón, M. C., Pintor-Toro, J. A. & Benı́tez, T. (1999). Increased Thornton, C. R., Jarvis, B. C. & Cooke, R. C. (1991). A chitin assay for antifungal activity of Trichoderma harzianum transformants that overexpress a 33-kDa chitinase. Phytopathology 89, 254–261. Lindahl, B. D. & Taylor, A. F. S. (2004). Occurrence of N-acetyl hexosaminidase-encoding genes in ectomycorrhizal basidiomycetes. New Phytol 164, 193–199. Lorito, M. (1998). Chitinolytic enzymes and their genes. In Trichoderma and Gliocladium: Enzymes, Biological Control and Commercial Applications, pp. 73–99. Edited by G. E. Harman & C. P. Kubicek. London, UK: Taylor and Francis Ltd. Malvárez, G., Carbone, I., Grünwald, N. J., Subbarao, K. V., Schafer, M. & Kohn, L. M. (2007). New populations of Sclerotinia sclerotiorum from lettuce in California and peas and lentils in Washington. Phytopathology 97, 470–483. the enumeration of Plasmodiophora brassicae resting spores in clubroot tissue. Mycol Res 95, 879–882. Thornton, C. R., Dewey, F. M. & Gilligan, C. A. (1993). Development of monoclonal antibody-based immunological assays for the detection of live propagules of Rhizoctonia solani in soil. Plant Pathol 42, 763– 773. Thornton, C. R., Pitt, D., Wakley, G. E. & Talbot, N. J. (2002). Production of a monoclonal antibody specific to the genus Trichoderma and closely related fungi, and its use to detect Trichoderma spp. in naturally infested composts. Microbiology 148, 1263–1279. Thornton, C. R., Groenhof, A. C., Forrest, R. & Lamotte, R. (2004). A Müller, C., Hjort, C. M., Hansen, K. & Nielsen, J. (2002). Altering the one-step, immunochromatographic lateral flow device specific to Rhizoctonia solani and certain related species, and its use to detect and quantify R. solani in soil. Phytopathology 94, 280–288. expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae. Microbiology 148, 4025–4033. Tronsmo, A. & Harman, G. E. (1993). Detection and quantification of N-acetyl-b-D-glucosaminidase, chitobiosidase, and endochitinase in Ortı́z-Castro, R., Contreras-Cornejo, H. A., Macı́as-Rodrı́guez, L. & López-Bucio, J. (2009). The role of microbial signals in plant growth and development. Plant Signal Behav 4, 701–712. Perlińska-Lenart, U., Orlowski, J., Laudy, A. E., Zdebska, E., Palamarczyk, G. & Kruszewska, J. S. (2006). Glycoprotein hypersecretion alters the cell wall in Trichoderma reesei strains expressing the Saccharomyces cerevisiae dolichylphosphate mannose synthase gene. Appl Environ Microbiol 72, 7778–7784. Rast, D. M., Horsch, M., Furter, R. & Gooday, G. W. (1991). A complex chitinolytic system in exponentially growing mycelium of Mucor rouxii: properties and function. J Gen Microbiol 137, 2797–2810. Read, D. J. & Perez-Moreno, J. (2003). Mycorrhizas and nutrient cycling in ecosystems – a journey towards relevance? New Phytol 157, 475–492. Reyes, F., Calatayud, J., Vazquez, C. & Martı́nez, M. J. (1989a). Beta- N-acetylglucosaminidase from Aspergillus nidulans which degrades chitin oligomers during autolysis. FEMS Microbiol Lett 53, 83–87. Reyes, F., Calatayud, J., Vazquez, C. & Martı́nez, M. J. (1989b). b-Nacetylglucosaminidase from Aspergillus nidulans implicated in the autolysis of the cell wall. FEMS Microbiol Rev 11, 317–338. solutions and on gels. Anal Biochem 208, 74–79. Verma, M., Brar, S. K., Tyagi, R. D., Surampalli, R. Y. & Valero, J. R. (2007). Antagonistic fungi, Trichoderma spp.: Panoply of biological control. Biochem Eng J 37, 1–20. Vinale, F., Sivasithamparam, K., Ghisalberti, E. L., Marra, R., Barbetti, M. J., Li, H., Woo, S. L. & Lorito, M. (2008). A novel role for Trichoderma secondary metabolites in the interactions with plants. Physiol Mol Plant Pathol 72, 80–86. Vinale, F., Flematti, G., Sivasithamparam, K., Lorito, M., Marra, R., Skelton, B. W. & Ghisalberti, E. L. (2009). Harzianic acid, an antifungal and plant growth promoting metabolite from Trichoderma harzianum. J Nat Prod 72, 2032–2035. Viterbo, A., Haran, S., Friesem, D., Ramot, O. & Chet, I. (2001). Antifungal activity of a novel endochitinase gene (chit36) from Trichoderma harzianum Rifai TM. FEMS Microbiol Lett 200, 169– 174. Walker, L. A., Munro, C. A., de Bruijn, I., Lenardon, M. D., McKinnon, A. & Gow, N. A. (2008). Stimulation of chitin synthesis rescues Candida albicans from echinocandins. PLoS Pathog 4, e1000040. Weaver, M., Vedenyapina, E. & Kenerley, C. M. (2005). Fitness, their involvement in morphogenesis and host-parasite interaction. FEMS Microbiol Rev 11, 317–338. persistence, and responsiveness of a genetically engineered strain of Trichoderma virens in soil mesocosms. Appl Soil Ecol 29, 125– 134. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: Wessels, J. G. H. (1994). Developmental regulation of fungal cell wall a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. White, S., McIntyre, M., Berry, D. R. & McNeil, B. (2002). The autolysis Sahai, A. S. & Manocha, M. S. (1993). Chitinases of fungi and plants: formation. Annu Rev Phytopathol 32, 413–437. Sweigard, J., Chumley, F., Carroll, A., Farrall, L. & Valent, B. (1997). A of industrial filamentous fungi. Crit Rev Biotechnol 22, 1–14. series of vectors for fungal transformation. Fungal Genet Newsl 44, 52–53. Wicklow, D. T. (1992). Interference competition. In The Fungal 96 Community: its Organisation and Role in the Ecosystem, pp. 265– Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 Microbiology 158 Saprotrophism and biocontrol fitness of GM T. hamatum 274. Edited by G. C. Carroll & D. T. Wicklow. New York: Marcel Dekker. Wösten, H. A., Moukha, S. M., Sietsma, J. H. & Wessels, J. G. H. (1991). Localization of growth and secretion of proteins in Aspergillus Windham, M. T., Elad, Y. & Baker, R. (1986). A mechanism for niger. J Gen Microbiol 137, 2017–2023. increased plant growth induced by Trichoderma spp. Phytopathology 76, 518–521. Edited by: B. A. Horwitz http://mic.sgmjournals.org Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 07:12:29 97
© Copyright 2025 Paperzz