Microbiology (2012), 158, 84–97
DOI 10.1099/mic.0.051854-0
Saprotrophic competitiveness and biocontrol
fitness of a genetically modified strain of the
plant-growth-promoting fungus Trichoderma
hamatum GD12
Lauren S. Ryder, Beverley D. Harris, Darren M. Soanes,
Michael J. Kershaw, Nicholas J. Talbot and Christopher R. Thornton
Correspondence
Christopher R. Thornton
Biosciences, College of Life and Environmental Sciences, University of Exeter, Geoffrey Pope
Building, Stocker Road, Exeter EX4 4QD, UK
[email protected]
Received 14 June 2011
Revised
18 July 2011
Accepted 7 August 2011
Trichoderma species are ubiquitous soil fungi that hold enormous potential for the development of
credible alternatives to agrochemicals and synthetic fertilizers in sustainable crop production. In
this paper, we show that substantial improvements in plant productivity can be met by genetic
modification of a plant-growth-promoting and biocontrol strain of Trichoderma hamatum, but that
these improvements are obtained in the absence of disease pressure only. Using a quantitative
monoclonal antibody-based ELISA, we show that an N-acetyl-b-D-glucosaminidase-deficient
mutant of T. hamatum, generated by insertional mutagenesis of the corresponding gene, has
impaired saprotrophic competitiveness during antagonistic interactions with Rhizoctonia solani in
soil. Furthermore, its fitness as a biocontrol agent of the pre-emergence damping-off pathogen
Sclerotinia sclerotiorum is significantly reduced, and its ability to promote plant growth is
constrained by the presence of both pathogens. This work shows that while gains in T. hamatummediated plant-growth-promotion can be met through genetic manipulation of a single beneficial
trait, such a modification has negative impacts on other aspects of its biology and ecology that
contribute to its success as a saprotrophic competitor and antagonist of soil-borne pathogens.
The work has important implications for fungal morphogenesis, demonstrating a clear link
between hyphal architecture and secretory potential. Furthermore, it highlights the need for a
holistic approach to the development of genetically modified Trichoderma strains for use as crop
stimulants and biocontrol agents in plant agriculture.
INTRODUCTION
Trichoderma species are ubiquitous soil saprotrophs that
have attracted sustained scientific interest as biological
control agents of plant disease. In addition to their
biocontrol properties, certain strains have been shown to
enhance crop productivity by stimulating plant growth
(Contreras-Cornejo et al., 2009; Harman et al., 2004; Ortı́zCastro et al., 2009; Vinale et al., 2008, 2009). While genetic
modification of Trichoderma strains by constitutive overexpression of chitinase, b-glucanase and proteinase genes
has allowed the development of strains with improved
Abbreviations: CSA, competitive saprotrophic ability; dH2O, distilled
water; P-G-P, plant-growth-promoting.
The GenBank/EMBL/DDBJ accession no. for the T. hamatum GD12
NAG gene and protein sequence is JN107809.
Three supplementary figures are available with the online version of this
paper.
84
biocontrol capabilities (Flores et al., 1997; Baek et al., 1999;
Limón et al., 1999; Viterbo et al., 2001; Djonović et al.,
2007), less attention has been paid to enhancing the plantgrowth-promoting (P-G-P) activities of these fungi via
genetic modification, and the impact that any such
modification might have on their saprotrophic competence
and fitness as biocontrol agents.
In a previous study, we showed that a naturally occurring
strain of Trichoderma hamatum was able to promote plant
growth in low pH, nutrient-poor peat soils (Thornton,
2008). These soils contain a significant pool of nitrogen
sequestered in chitin of insect and fungal origin (Kerley &
Read, 1998), and fungal N-acetyl-b-D-glucosaminidase has
been shown to be a key chitinolytic enzyme releasing
sequestered nitrogen for assimilation by plants in peat
ecosystems (Leake & Read, 1990; Kerley & Read, 1995,
1998; Read & Perez-Moreno, 2003; Lindahl & Taylor,
2004). We hypothesized that a similar mechanism might be
driving the T. hamatum P-G-P phenomenon, since T.
Downloaded from www.microbiologyresearch.org by
051854 G 2012 SGM
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
Printed in Great Britain
Saprotrophism and biocontrol fitness of GM T. hamatum
hamatum is a well-characterized producer of extracellular
chitinases including N-acetyl-b-D-glucosaminidase, an
enzyme also shown to be integral to the biocontrol of
root-infecting pathogens (Chet & Baker, 1981; Chet et al.,
1981; Lorito, 1998; Brunner et al., 2003; Harman et al.,
2004). To investigate the role of the enzyme in T. hamatum
P-G-P, we disrupted N-acetyl-b-D-glucosaminidase production in the fungus by insertional mutagenesis of the
corresponding gene and found, contrary to our expectations, that enzyme inactivity dramatically increased the
growth-promotional activity of the fungus in sterilized soil
systems.
The ability to manipulate the P-G-P properties of Trichoderma biocontrol strains holds enormous potential for the
development of sustainable alternatives to agrochemicals for
plant disease control and for the development of crop
growth stimulants. The dramatic increase in T. hamatum PG-P activity as a result of the genetic modification, and the
potential for use of the mutant strain as a genetically
engineered micro-organism with enhanced plant growth
stimulant properties, led us to determine whether the
mutation conferred an ecological advantage to the fungus
during antagonistic interactions with the saprotrophic
competitor Rhizoctonia solani in soil. Furthermore, we set
out to investigate whether its ability to control pre- and
post-emergence diseases of lettuce seedlings caused by
Sclerotinia sclerotiorum and R. solani, respectively, had been
modified. Using laboratory-based microcosms, we show
that while loss of N-acetyl-b-D-glucosaminidase activity
imparts a dramatic improvement in P-G-P activity in the
absence of plant disease pressure, the mutation has a
negative impact on its ability to compete saprotrophically
with R. solani in soil. Furthermore, the ability of the mutant
to promote seedling emergence and growth is constrained by
the presence of soil-borne pathogens.
This work demonstrates that trade-offs exist in the genetic
engineering of Trichoderma strains that exhibit the dual
beneficial traits of P-G-P and biocontrol. Genetic manipulation of a single attribute has consequences for other
aspects of the organism’s biology and ecology.
METHODS
Fungal strains, growth conditions and DNA analysis. All strains
of T. hamatum used in this study are derived from strain GD12
(GenBank accession no. AY247559) (Thornton et al., 2004; Thornton,
2005, 2008) and were maintained on potato dextrose agar (PDA) or
V8 agar as described previously. Strain GD12 is free-living and does
not form an association with plant roots. The anastomosis group 1
post-emergence lettuce pathogen R. solani (CBS323.84) and polyphagous plant pathogen S. sclerotiorum (GenBank accession no.
FJ984493) were grown on PDA. Gel electrophoresis, restriction
enzyme digests, gel blots and sequencing were performed according to
standard procedures (Sambrook et al., 1989).
PCR of N-acetyl-b-D-glucosaminidase genes and production of
enzyme-deficient mutant. The degenerate primers NagA [59-
GTCCTG(AC)(AG)5G(GC)5(CT)T5GA(AG)AC5TT(CT)(AT)(GC)5Chttp://mic.sgmjournals.org
A] and NagB [59-TTGAG(CT)TC(AG)TC5CC(AGCT)CC5GT(AG)TG(AG)AA(AG)TA] were designed based on multiple sequence alignments of known Trichoderma Nag proteins, and were used to amplify
a 575 bp fragment from GD12 genomic DNA. The 575 bp PCR
amplicon was used to probe restriction enzyme digests of genomic
DNA to determine N-acetyl-b-D-glucosaminidase gene copy number
and was subsequently cloned into pGEM-T. Positive clones were
identified by restriction enzyme digests with NcoI and NotI. To amplify
a larger fragment of the T. hamatum NAG gene for insertional
mutagenesis, primers were designed using the sequenced 575 bp
fragment and the Trichoderma harzianum EXC2Y nucleotide sequence
retrieved from the NCBI databases (www.ncbi.nlm.nih.gov). The primer
set 30.2 (59-CGTCATTATTCATTAATAGTTGCC) and M13.52 (59TCCTGTGTGAAATTGTTATCCGCTGCCAGCATCCAA), and primer
set 5.1 (59-TAGGCACATACTCCTCCCTCTCTC) and M13.32 (59GTCGTGACTGGGAAAACCCTGGCGGACGCCATACTC), were used
to amplify 1.0 kb and 919 bp of the target gene, respectively. Insertional
mutagenesis was performed using a fusion-based PCR method. The
HPH gene from Neurospora crassa under the N. crassa TRPC promoter,
conferring resistance to hygromycin, was cloned into pBluescript
(Stratagene) as a 1.4 kb EcoRI–XbaI fragment. To amplify the split
HPH templates, the primer set M13F (59-CGCCAGGGTTTTCCCAGTCACGAC) and HY (59-GGATGCCTCCGCTCGAAGTA), and
primer set M13R (59-AGCGGATAACAATTTCACACAGGA) and YG
(59-CGTTGCAAGACCTGCCTGAA), were used. A third round PCR
was performed using the nested primers 5.2 (59-TTGACCAGACGGTCCAGGTAACCT) and 30.1 (59-GCACATCAACCTGAGATGTGGTGT) to join the constructs together. T. hamatum GD12 protoplasts were
transformed with 2 mg DNA of the third round PCR product.
DThnag : : hph mutants were selected for resistance to 300 mg hygromycin
ml21. The T. hamatum GD12 NAG gene and protein sequence were
submitted to GenBank under accession no. JN107809.
Complementation of the N-acetyl-b-D-glucosaminidase-deficient mutant. A 4.29 kb amplicon consisting of the 1.86 kb Thnag
ORF, 1.93 kb of the promoter region and 0.5 kb of the 39
untranslated region was amplified from genomic DNA. The complete
gene sequence was obtained from in-house sequencing of the T.
hamatum GD12 genome using an Illumina GA2 sequencer. Primer
sequences for amplification were NagC (59-AGGGATGAGAGCCTTGATGTATTT) and NagD (59-TTTCTTATAAGAGCGATCTG).
PCR was performed in an Applied Biosystems GeneAmp PCR system
2400 cycler using Herculase polymerase in Herculase 610 buffer
(Stratagene). An initial Hot Start and denaturation step was carried
out at 94 uC for 5 min followed by PCR cycling parameters of 94 uC
for 30 s, 50 uC for 30 s, 72 uC for 5 min (10 cycles), 94 uC for 30 s,
55 uC for 30 s, 72 uC for 5 min, and 72 uC for 10 min (20 cycles).
The resulting 4.29 kb PCR fragment was gel purified using a Wizard
(Promega) kit and cloned into the 3 kb pGEM-T vector. Positive
clones were confirmed by restriction digest with ApaI and SpeI. The
4.29 kb Thnag fragment was subsequently liberated from pGEM-T
using ApaI and SpeI, and ligated into the pCB1532 vector containing
the ILVI gene encoding resistance to sulfonylurea (Sweigard et al.,
1997). The resulting plasmid was used to transform the N-acetylb-D-glucosaminidase mutant DThnag : : hph. Putative DThnag : :
hph:NAG retransformants were selected for resistance to 1 mg
sulfonylurea ml21.
Determination of hyphal chitin contents and chitinase activities. For enzyme activity assays, fungal strains were grown for 4 days
at 26 uC in multiple 250 ml flasks containing sterile autoclaved wheat
bran mix [10 g wheat bran and 30 ml distilled water (dH2O)] and 1.0 %
(w/v) chitin from shrimp shells (Sigma C7170). Flasks were inoculated
with five 5 mm diameter plugs of mycelium taken from the growing
edge of 4-day-old PDA plate cultures. Under these conditions, the bran–
chitin mixture was fully colonized by both fungi by day 4. Extracts were
prepared by mixing the contents of flasks with 50 ml dH2O for 1 h at
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
85
L. S. Ryder and others
23 uC, followed by centrifugation at 16000 g to remove bran and
fungal biomass. N-Acetyl-b-D-glucosaminidase activity in polyacrylamide gels was determined according to the method of Tronsmo &
Harman (1993) using the substrate 4-methylumbelliferyl-N-acetyl-bD-glucosaminide, the fluorescent substrate of this enzyme (DuoChuan, 2006). For colorimetric estimations of enzyme activities, a
commercial chitinase assay kit (Sigma CS0980) was used. Chitin
contents of hyphae were determined by colorimetric estimations of
N-acetylglucosamine released by alkaline digestion. Three replicate
250 ml flasks containing 100 ml autoclaved potato dextrose broth
(Fluka P6685) were inoculated with five 5 mm diameter plugs of
mycelium taken from the growing edge of 4-day-old PDA plate
cultures. The flasks were incubated at 26 uC with shaking for 3 days
and 100 mg samples of fresh hyphal biomass assayed for chitin
content according to the nitrous acid – 3-methyl-2-benzothiazolinone hydrazone hydrochloride – ferric chloride assay (Kaminskyj &
Heath, 1982; Thornton et al., 1991). Chitin concentrations were
expressed as mg glucosamine (g fresh mycelium)21. A Student’s t-test
was used to determine statistical significance.
Spore production and sensitivities to antibiotics. Mycelium
from GD12 and DThnag : : hph were inoculated onto PDA, onto PDA
containing 200 mg calcofluor white ml21 or PDA containing 200 mg
caspofungin ml21. Colony diameters were measured over a 4 day
growth period at 26 uC, except for caspofungin plates which were
measured over 14 days. Spore production was quantified after
21 days using a haemocytometer following suspension of spores in
20 ml dH2O and filtration through Miracloth (Thornton, 2008).
P-G-P and soil nutrient analysis. One litre of sieved (500–
1000 mm) Sphagnum moss peat (Shamrock) was mixed with 400 ml
dH2O and sterilized by autoclaving at 121 uC for 15 min. T. hamatum
inoculum was prepared by inoculating sterile autoclaved wheat bran
mix (10 g wheat bran and 30 ml dH2O) with five 5 mm diameter plugs
of mycelium taken from the growing edge of 4-day-old PDA plate
cultures of the fungus. After incubation at 26 uC for 5 days under a
16 h fluorescent light regime to allow complete colonization of the
bran by mycelium, microcosms (1206120612 mm) were constructed
with 8 g bran inoculum and 300 g sterilized peat (1 : 37.5 w/w), and
were sown with 25 seeds of lettuce (Lactuca sativa cultivar Webb’s
Wonderful). Microcosms were placed in a fully randomized design
in a growth cabinet (Sanyo) at 24 uC with a relative humidity of 95 %
and a 16 h fluorescent light regime. After 21 days growth, plants
were harvested and dry weights of shoots and roots were obtained.
Differences in dry weights were analysed by one-way analysis of
variance (ANOVA) and post-hoc Tukey tests were used to determine
significance.
Water extracts from bran inoculum were also used to determine
whether P-G-P could be achieved in the absence of the fungus. Fiveday-old bran inoculum (10 g) was mixed thoroughly for 1 h with
50 ml dH2O and extracts were centrifuged at 12 000 g for 5 min.
Clarified extracts were filtered through Miracloth (Calbiochem) and
then filter-sterilized by passing through a 0.2 mm membrane
(Millipore). Microcosms were constructed with 300 g sterilized peat
and 30 ml sterile extract, and were sown with 25 lettuce seeds.
Thereafter, conditions were as described above. After 7 days growth,
dry weights of shoots and roots were obtained.
For soil nutrient analysis, replicate microcosms consisting of the
peat and bran inoculum mix were assayed by NRM Laboratories
after 21 days incubation under the conditions described. Control
microcosms consisted of sterilized peat with uncolonized autoclaved bran only. Student’s t-tests were used to determine statistical
significance.
Secretion assay and microscopy. Secretion was determined in shake
culture experiments by using an ELISA with a Trichoderma-specific
86
monoclonal antibody (mAb) MF2 that binds to an extracellular,
constitutively expressed, glycoprotein antigen secreted from the hyphal
tip (Thornton et al., 2002; Thornton, 2004). Potato dextrose broth in
250 ml flasks was sterilized by autoclaving and the flasks were
inoculated with five plugs (3 mm diameter) of mycelium taken from
the growing edge of PDA plate cultures of the fungi. The flasks were
incubated as shake cultures at 26 uC and at 3 day intervals culture
fluids were collected by straining contents through Miracloth. Fluids
were then centrifuged for 5 min at 16 000 g and 50 ml samples were
transferred to microtitre wells for assay by ELISA. There were three
replicates for each treatment. Absorbance values from ELISA were
converted to units of protein equivalents by using standard curves of
chromatographically purified antigen, prepared from doubling
dilutions of a PBS solution of the antigen in microtitre wells
(Thornton et al., 2002). Dry weights were obtained by drying the
collected mycelium to a constant weight at 80 uC. For immunofluorescence microscopy, fungi were grown on Teflon-coated glass
slides embedded in PDA (Thornton et al., 2002; Thornton, 2004),
were fixed and processed using mAb MF2 and FITC-conjugated
secondary antibody (Thornton et al., 2002; Thornton, 2004), or were
immersed in calcofluor white solution (50 mg ml21) without fixation
(Elorza et al., 1983). Fluorescence of samples was observed by using
either a Zeiss Axioskop 2 fluorescence microscope using 495 nm
excitation and 500–550 nm emission wavelengths or a Zeiss LSM
confocal microscope using 488 nm excitation and 505–570 nm
emission wavelengths.
Quantification of competitive saprotrophic abilities. The
competitive saprotrophic abilities of Trichoderma strains GD12 and
6.1 were quantified during antagonistic interactions with R. solani in
peat microcosms by using the immunological approach described by
Thornton (2004). Sieved (500–1000 mm) sphagnum moss peat (1 l;
Shamrock) was mixed with 400 ml dH2O and 0.5 % (w/v) wheat bran
in 2 l flasks and sterilized by autoclaving at 121 uC for 15 min. For
preparation of pathogen inoculum, 10 g white poppy seeds and 5 ml
dH2O were autoclaved at 121 uC for 15 min. The seeds were inoculated
with five 5 mm plugs of mycelium taken from the leading edge of PDA
culture plates, incubated for 15 days at 26 uC, and the colonized seeds
were air-dried at 23 uC under sterile conditions. Trichoderma strains
were incorporated as spore inoculum (Thornton, 2004). For the
generation of spores, strains GD12 and 6.1 were grown on PDA
containing 200 mg caspofungin ml21 and spore suspensions were
prepared from 3-week-old plates. Poppy seed inoculum of R. solani was
added to the sterilized peat at 0.1 % (w/v), while Trichoderma strains
were added as spore suspensions (1 ml) containing 104 conidia ml21 in
dH2O. The spores from both Trichoderma strains, and the R. solani
poppy seed inoculum, showed .95 % germinability when grown on
PDA. The contents of the flasks were mixed thoroughly and the
mixtures were used to construct microcosms for antigen extraction and
assay by R. solani-specific ELISA over a 21 day incubation period, using
the procedures described previously (Thornton & Gilligan, 1999;
Thornton, 2004).
Biocontrol assays. The fitness of T. hamatum strains GD12 and 6.1
as biocontrol agents was determined by their abilities to control preand post-emergence diseases of lettuce caused by the root-infecting
pathogens S. sclerotiorum and R. solani, respectively. Lettuce
microcosms (1206120612 mm) were constructed as described with
peat amended with Trichoderma strains only (8 g bran inoculum and
300 g peat), pathogen only (8 g poppy seed inoculum and 300 g peat)
or both. Plants were grown under the conditions described and
percentage emergence and dry weights of plants were determined
after 21 days. Differences in dry weights of shoot and root materials
were analysed by single-tailed t-test. Differences in percentage
emergence were determined by single-tailed t-test after transformation of data using the arc sin21 function.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
Microbiology 158
Saprotrophism and biocontrol fitness of GM T. hamatum
RESULTS
experiments (Fig. 1d), thus establishing that the effect was
due to enzyme loss-of-function.
Confirmation of N-acetyl-b-D-glucosaminidase
disruption and complementation
A targeted gene disruption of the T. hamatum NAG gene
(GenBank accession no. JN107809) was carried out by
insertion of a 1.4 kb gene cassette conferring hygromycin
resistance into the open reading frame. Southern blot
analysis showed that the hygromycin-resistant transformant
6.1 (hereafter referred to as DThnag : : hph) contained the
correct sized insertion (Supplementary Fig. S1, available
with the online version of this paper). Southern blot analysis
also confirmed complementation of mutant DThnag : : hph
(C17, hereafter referred to as DThnag : : hph:NAG) (Supplementary Fig. S1). To investigate the effect of the mutation on
enzyme activity, N-acetyl-b-D-glucosaminidase activities of
GD12, DThnag : : hph and the complemented strain were
determined colorimetrically, and by using an in-gel assay for
N-acetyl-b-D-glucosaminidase activity. In-gel activity assays
(Fig. 1a) and colorimetric assays showed disruption of Nacetyl-b-D-glucosaminidase activity in the DThnag : : hph
mutant and confirmed our initial findings that only a single
copy of the N-acetyl-b-D-glucosaminidase gene exists in T.
hamatum (Supplementary Fig. S2). Tests with DThnag : :
hph:NAG showed that the complementation had restored
enzyme activity using both the in-gel activity assay (Fig. 1b)
and colorimetric assay (Table 1). The chitin content of
mutant hyphae was significantly reduced (P,0.05, Student’s
t-test) compared with GD12. The mean hyphal chitin
concentration of DThnag : : hph was 6.9±0.9 mg glucosamine (g mycelium)21 compared with 17.9±2.6 mg glucosamine (g mycelium)21 for GD12.
N-acetyl-b-D-glucosaminidase disruption
enhances P-G-P but is not associated with
nutrient release
The enzyme-deficient mutant DThnag : : hph was tested for
its ability to enhance growth promotion of lettuce (L.
sativa). We originally hypothesized that disruption of Nacetyl-b-D-glucosaminidase, a key chitinolytic enzyme
implicated in the depolymerization of soil chitin and
release of nitrogen for plant growth (Leake & Read, 1990;
Kerley & Read, 1995, 1998; Read & Perez-Moreno, 2003;
Lindahl & Taylor, 2004), might decrease P-G-P by T.
hamatum. In contrast with our expectations, we found that
disruption of the NAG gene dramatically enhanced the
growth of lettuce seedlings as shown in Fig. 1c. Treatment
with GD12 resulted in a fourfold increase in leaf and
shoot dry weights (P50.05) and a fivefold increase in root
dry weights (P,0.001) compared with the control. The
increase in plant growth was more dramatic with the Nacetyl-b-D-glucosaminidase-deficient mutant. Treatment
with DThnag : : hph resulted in a 13-fold increase in shoot
and leaf dry weights (P,0.001) and an 11-fold increase in
root dry weights (P,0.001) (Fig. 1d). The complemented
strain essentially behaved like the wild-type strain in these
http://mic.sgmjournals.org
The P-G-P effects seen with certain Trichoderma strains
have been linked to the solubilization of phosphates and
micronutrients (Altomare et al., 1999), but the evidence
presented here shows that nutrient release as a consequence
of saprotrophic activity of the fungus could not account for
the observed P-G-P with GD12 or with the DThnag : : hph
mutant. Indeed, there were no significant increases in
the amounts of available nutrients as a consequence of
saprotrophic colonization of peat by the two strains of
fungi when compared with the uncolonized controls.
While concentrations of ammonia-nitrogen, nitrate-nitrogen and total soluble nitrogen were higher in DThnag : : hph
microcosms compared with GD12, the differences were not
significant (Student’s t-test, Table 2). Nevertheless, to test
whether the increase in nitrogen availability observed in the
DThnag : : hph microcosms might contribute to the increase
in P-G-P found with the mutant, we added ammonium
and nitrate in the form of soluble NH4Cl and NaNO3 to
identical levels found in DThnag : : hph-colonized microcosms. However, no increase in plant growth resulting
from these treatments was found (results not shown). A
number of elements (P, K, Mg, Ca, Na and sulphate)
showed a reduction in availability in the Trichodermatreated microcosms. The reasons for this are unclear, but
may be due to chelation by the fungi (Altomare et al.,
1999). We were able to discount the possibility that growth
promotion occurs in response to the control of minor root
pathogens, because our studies were conducted with
sterilized peat in the absence of disease pressure. This is
consistent with other studies showing growth promotion
by Trichoderma species in the absence of detectable disease
(Chang et al., 1986) and in sterile soil (Windham et al.,
1986). We therefore conclude that P-G-P by the fungus
does not occur through nutrient release or control of
minor root pathogens.
Increases in the growth of lettuce plants in response
to water extracts from bran inoculum of GD12 and
DThnag : : hph showed that growth promotion was due, at
least in part, to the production of a water-soluble growth
enhancing compound(s) (Supplementary Fig. S3). Growth
promotion was more pronounced with extracts from the
N-acetyl-b-D-glucosaminidase-deficient mutant than with
extracts from GD12, indicating increased production of the
stimulatory compound(s) by DThnag : : hph.
The N-acetyl-b-D-glucosaminidase-deficient
mutant has altered chitin deposition at the hyphal
tip
Growth tests of the DThnag : : hph mutant revealed no
significant reduction in hyphal growth in vitro compared
with GD12 (Fig. 2a, b). However, spore production was
completely absent in the mutant in both axenic culture and
soil (Figs 1e and 2a). The spore concentration of axenic
cultures of the wild-type strain was 2.76107 spores ml21.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
87
L. S. Ryder and others
Fig. 1. (a) In-gel activity assay showing loss of N-acetyl-b-D-glucosaminidase activity in the DThnag : : hph mutant 6.1. (b)
Zymograms showing restoration of N-acetyl-b-D-glucosaminidase activity in the DThnag : : hph:NAG complemented strain C17.
No other fluorescent products were visible on the gels. (c) Lettuce plants grown for 3 weeks in peat microcosms containing the
T. hamatum strain GD12 and the N-acetyl-b-D-glucosaminidase-deficient mutant DThnag : : hph. Bar, 18 mm. (d) Histogram
showing dry weights of lettuce leaf (black bars) and root (white bars) material after 3 weeks growth in peat microcosms with
GD12, DThnag : : hph and the complemented strain C17. Data shown are the mean±SEM of three replicate trays, each
containing 25 plants. Bars with different letters are significantly different at 95 % confidence level. (e) Sporulation of GD12
(production of spore masses, indicated by arrow) and lack of sporulation (absence of spore masses) of DThnag : : hph in peat
following incorporation of bran inoculum.
Chitin is a structural component of the cell wall of
Trichoderma species and N-acetyl-b-D-glucosaminidase is
one of a number of chitinase enzymes that are believed to
play a role in cell wall turn-over and remodelling during
88
hyphal development (Reyes et al., 1989a, b; Rast et al.,
1991; Sahai & Manocha, 1993; Horsch et al., 1997; White
et al., 2002). To test whether N-acetyl-b-D-glucosaminidase
functions in cell wall biogenesis of this fungus, GD12 and
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
Microbiology 158
Saprotrophism and biocontrol fitness of GM T. hamatum
Table 1. Chitinase activities of T. hamatum GD12 and the mutant strains DThnag : : hph and DThnag : : hph:NAG
Data are the mean±SEM of triplicate values.
Enzyme activity (units ml”1)
Strain
GD12
DThnag : : hph
DThnag : : hph:NAG
Chitobiosidase
Endochitinase
N-acetyl-b-D-glucosaminidase
0.70±0.04
0.04±0.01
0.68±0.12
1.40±0.30
0.06±0.01
1.08±0.41
10.80±0.90
0.04±0.02
9.03±0.40
DThnag : : hph mycelia were inoculated onto standard
medium containing calcofluor white, and sensitivity was
assessed over a 4 day period. Calcofluor white preferentially binds to polysaccharides containing 1,4-linked Dglucopyranosyl units and alters the assembly of chitin
microfibrils in fungi (Elorza et al., 1983). Sensitivity to this
Table 2. Peat nutrient analysis following saprotrophic colonization by T. hamatum GD12 and the N-acetyl-b-Dglucosaminidase-deficient mutant DThnag : : hph
The units of measurement are mg l21 for all analytes except
conductivity (mS cm21), dry matter (%; converted to degrees using
arc sin21 transformation), and density and dry density (kg m3). No
units for pH.
Analyte
Conductivity
pH
Dry matter
Density
Dry density
Chloride
Phosphorus
Potassium
Magnesium
Calcium
Sodium
Ammonianitrogen*
Nitratenitrogen*
Total soluble
nitrogen*
Sulphate
Boron
Copper
Manganese
Zinc
Iron
Strain
Control
GD12
DThnag : : hph
169±7
4.40±0.01
25.1±0.0
557±7
99±1
29±2
240±14
231±10
21±1
6.4±0.1
30±3
22±1
69±1
4.86±0.03
23.3±0.3
565±15
87±2
21±1
79±2
36±1
0.70±0.09
1.4±0.3
21±1
33±3
72±1
4.90±0.03
23.1±0.3
559±24
87±3
22±2
82±2
39±1
0.76±0.09
1.4±0.2
15±1
37±4
1.43±0.03
1.03±0.33
2.53±0.21
24±3
34±3
39±4
33±1
0.137±0.007
,0.006
0.167±0.009
0.067±0.007
0.130±0.02
22±1
0.117±0.009
,0.006
,0.006
,0.006
0.100±0.006
21±2
0.120±0.015
,0.006
,0.006
,0.006
0.113±0.023
*Differences between means of GD12 and DThnag : : hph not
significant at 95 % confidence level (Student’s t-test).
http://mic.sgmjournals.org
compound is therefore closely related to the chitin content
of cell walls. After 4 days growth, there was no significant
difference in growth of the mutant compared to the wildtype strain (Fig. 2a, b). However, when calcofluor white
was used in microscopy staining tests, intense fluorescence
was observed at the tips of mutant hyphae, whereas no
such pattern was observed in GD12 (Fig. 3a). This is
consistent with a defect involving incorrect deposition of
chitin polymers at the hyphal tip of the DThnag : : hph
mutant.
The significant (P,0.05, Student’s t-test) decrease in
growth of DThnag : : hph during exposure to caspofungin
(Fig. 2a, b), an echinocandin antifungal drug that inhibits
b-1,3-glucan synthases (Lesage et al., 2004; Walker et al.,
2008; Fuchs & Mylonakis, 2009), was not unexpected since
chitin in the fungal cell wall is covalently linked via a
peptide linkage to b-glucan. Chitin and b-glucan are
extruded at the hyphal apex and, following modification,
result in the formation of chitin microfibrils cross-linked
to a glucan matrix (Wessels, 1994). Consequently, the
combination of incorrect chitin deposition at the hyphal
tip due to N-acetyl-b-D-glucosaminidase deficiency and
inhibition of b-1,3-glucan synthesis by caspofungin would
be predicted to further significantly inhibit cell wall
biosynthesis and growth of the mutant compared with
the wild-type strain. Despite this, after 3 weeks growth,
sporulation had been partially restored in the DThnag : :
hph mutant (Fig. 2c), so that spore concentrations for
GD12 and DThnag : : hph were 16107 ml21 (±0.26107
ml21) and 6.46104 ml21 (±16104 ml21), respectively.
Furthermore, the DThnag : : hph spores were viable. Single
spore isolates germinated on PDA to produce nonsporulating colonies (Fig. 2d). This showed that sporulation in the N-acetyl-b-D-glucosaminidase mutant can be
induced by exposure to caspofungin, but that the ability to
produce spores is lost following release from the drug.
Little is known about b-1,3-glucan synthases and sporulation in filamentous fungi, but in the human pathogen
Aspergillus fumigatus, exposure to the drug results in
upregulation of chitin biosynthetic genes and stimulation
of chitin synthesis (Fortwendel et al., 2010). It is reasonable
to speculate that a similar process occurs in DThnag : : hph
during caspofungin exposure, leading to improved cell wall
integrity which supports transient and partial restoration
of sporulation.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
89
L. S. Ryder and others
Fig. 2. Growth of T. hamatum GD12 and DThnag : : hph on PDA amended with calcofluor white and caspofungin. (a)
Photographs showing growth of GD12 and DThnag : : hph after 4 days (PDA only, PDA+calcofluor white) or after 14 days
(PDA+caspofungin). Bar, 15 mm. (b) Colony diameters of GD12 (h) and DThnag : : hph (#) measured over 4 days (PDA only,
PDA+calcofluor white) or over 14 days (PDA+caspofungin). Each point is the mean±SEM of three replicate values. (c)
Sporulation of T. hamatum GD12 and DThnag : : hph after 3 weeks growth on PDA amended with caspofungin, and (d)
subsequent colony morphologies of single spore isolates after subculture to PDA only. Note lack of green spore masses in
DThnag : : hph cultures grown in the absence of caspofungin.
90
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
Microbiology 158
Saprotrophism and biocontrol fitness of GM T. hamatum
Fig. 3. Phenotypic analysis of the DThnag : : hph mutant. (a) Microscopic analysis of hyphae of GD12 and DThnag : : hph
following exposure to calcofluor white and observation under UV light, showing intense fluorescence at hyphal tips of the Nacetyl-b-D-glucosaminidase-deficient mutant. Bar, 12 mm. (b) Immunofluorescence of GD12 and DThnag : : hph hyphae with
mAb MF2, showing hyper-secretion of the glycoprotein antigen around the swollen tip of the mutant hypha. Bar, 10 mm. (d)
Quantification of extracellular glycoprotein antigen concentrations in GD12 (#) and DThnag : : hph ($) shaking culture filtrates.
Antigen concentrations in (d) were determined by converting absorbance values from ELISA with the Trichoderma-specific
mAb MF2 to equivalents of glycoprotein concentration by using a calibration curve of purified Trichoderma antigen (c). Each
point is the mean±SEM of three values.
The N-acetyl-b-D-glucosaminidase-deficient
mutant shows increased secretion of a
Trichoderma-specific extracellular antigen
Secretion by filamentous fungi is a process that occurs at
the hyphal apex (Wösten et al., 1991; Wessels, 1994; Gordon
et al., 2000; Thornton, 2004). The altered deposition of
chitin at the hyphal tip of the mutant led us to investigate whether DThnag : : hph showed an altered pattern of
secretion compared to GD12. To study secretion, we
http://mic.sgmjournals.org
examined production of an extracellular, constitutively
expressed, glycoprotein antigen by immunofluorescence
and by quantitative ELISA (Thornton et al., 2002). A
Trichoderma-specific mAb MF2 raised against the antigen
(Thornton et al., 2002) was used to determine glycoprotein
contents in the culture filtrates. Because the antibody binds
to antigen produced during active growth of the fungus
(Thornton, 2004) we were able to quantify, using a standard
curve of purified antigen (Fig. 3c), the protein concentration
per unit biomass of the fungus. Using this procedure, MF2
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
91
L. S. Ryder and others
antigen production was found to be up to 35-fold higher in
DThnag : : hph compared with the wild-type strain (Fig. 3d)
showing hyper-secretion of the antigen by the mutant.
Consistent with these data, immunofluorescence microscopy of the hyphal tips of wild-type and mutant strains
with mAb MF2 showed the antigen was bound to the cell
wall of GD12 but there was additional elevated production
of the antigen in a halo surrounding the swollen tip of
DThnag : : hph hyphae (Fig. 3b).
The N-acetyl-b-D-glucosaminidase-deficient
mutant has reduced competitive saprotrophic
ability and impaired biocontrol fitness
The competitive saprotrophic abilities of GD12 and
DThnag : : hph were determined by quantitative ELISA
and significantly increased seedling emergence and mean dry
weights compared with the control. Furthermore, seedling
emergence and mean root dry weight were significantly
increased in the mixed species microcosms compared with
the microcosms with GD12 treatment only (Fig. 4c, e).
While treatment of S. sclerotiorum microcosms with the
mutant DThnag : : hph significantly increased establishment
of lettuce seedlings compared with S. sclerotiorum only (Fig.
4b, c), percentage emergence was significantly reduced
compared with the control. Furthermore, mean dry weights
of shoot and root materials in the S. sclerotiorum+
DThnag : : hph microcosms were significantly reduced compared with microcosms containing the pathogen and GD12
(Fig. 4c–e). The post-emergence lettuce pathogen R. solani
had no significant effect on seedling emergence and mean
root dry weight compared with control microcosms (Fig. 4c,
e), but the mean shoot dry weight was significantly reduced
(Fig. 4d). Mixed species microcosms containing R. solani
and GD12 showed significant increases in emergence and
mean dry weights compared with the control and the R.
solani- and GD12-only microcosms (Fig. 4c–e). While
similar trends were shown in microcosms containing the
pathogen and DThnag : : hph, the increases in mean shoot
and root dry weights compared with R. solani only were
significantly less than those of the R. solani+GD12
microcosms and, in the case of shoot dry weight, microcosms containing DThnag : : hph only (Fig. 4c–e).
during antagonistic interactions with the pathogen R. solani
in soil-based microcosms. Because the mutant DThnag : : hph
was shown in vitro to hyper-secrete the MF2 antigen used in a
previous study to quantify Trichoderma saprotrophic growth
dynamics in soil (Thornton, 2004), we used a Rhizoctoniaspecific ELISA (Thornton & Gilligan, 1999; Thornton, 2004)
to quantify the effects of T. hamatum on the pathogen’s
saprotrophic growth. Using this method, we were able to
determine the competitive saprotrophic abilities of the two
Trichoderma strains (Fig. 4a). The population dynamics of
R. solani were determined in microcosms containing the
pathogen only or in mixed species microcosms inoculated
with the pathogen and GD12 or DThnag : : hph. In the
absence of Trichoderma, active biomass of R. solani increased
between days 2 and 3 followed by a decline between days 3
and 4 (#). From day 4 onwards, there was a rapid increase in
active biomass production up to day 10, with a steady decline
thereafter up to the last day of sampling (day 21). In the
presence of T. hamatum GD12 (e), a similar trend in R.
solani biomass production was shown up to day 4, but from
days 4 to 21 no further active biomass of the pathogen was
produced. In contrast, the mutant DThnag : : hph showed
impaired interference competition, allowing saprotrophic
growth of the pathogen throughout the 21 day sampling
period (g). Specificity of the R. solani mAb EH2 was shown
using extracts from microcosm containing GD12 only (h) or
DThnag : : hph only ($), where no antigen was detected
throughout the 21 day sampling period.
With increasing demands for sustainable alternatives to
agrochemicals and synthetic fertilizers in food production,
there is renewed interest in exploiting the beneficial
properties of soil micro-organisms. One such beneficial
micro-organism is Trichoderma, a common soil fungus
that has been shown to be a credible alternative to
pesticides in the control of plant disease (Harman et al.,
2004; Verma et al., 2007). In addition to disease control,
certain strains also exhibit P-G-P activities (Bae et al., 2009;
Contreras-Cornejo et al., 2009; Harman et al., 2004; Ortı́zCastro et al., 2009; Verma et al., 2007; Vinale et al., 2008,
2009). These dual attributes make Trichoderma species
attractive as both biocontrol agents and plant growth
stimulants.
Biocontrol fitness of GD12 and DThnag : : hph was determined in lettuce microcosms inoculated with the lettuce
pathogens S. sclerotiorum and R. solani (Fig. 4b). In the
absence of disease pressure, GD12 increased the mean dry
weights of shoot and root materials significantly compared
with the control (lettuce plants with no treatment) (Fig. 4d,
e). Additional further increases in mean dry weights of plant
materials were shown in DThnag : : hph-treated microcosms
in the absence of disease pressure (Fig. 4d, e). The preemergence damping-off pathogen S. sclerotiorum prevented
emergence of all lettuce plants in the absence of Trichoderma
(Fig. 4b–e). T. hamatum GD12 controlled pre-emergence
damping-off disease caused by S. sclerotiorum (Fig. 4c–e)
Currently, strict governmental regulations prevent the
deployment of genetically modified (GM) micro-organisms for use in human food production (Weaver et al.,
2005). One reason for this is the risk of escape of these
organisms from the site of application and the competitive
advantage any mutation might have on the biological and
ecological fitness of the organism. In this study, we aimed
to determine whether a genetic modification that enhances
the plant growth stimulant properties of T. hamatum
imparts additional advantages in terms of biocontrol
fitness and competitive saprotrophic ability (CSA). While
a previous study has examined genetic stability and
ecological persistence of Trichoderma virens genetically
92
DISCUSSION
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
Microbiology 158
Saprotrophism and biocontrol fitness of GM T. hamatum
Fig. 4. Competitive saprotrophic abilities and biocontrol efficacies of T. hamatum GD12 and DThnag : : hph. (a) Population
dynamics of R. solani in the presence of GD12 (e) and DThnag : : hph (g) and in the absence of Trichoderma (#). The
specificity of the R. solani-specific mAb EH2 was shown using extracts from microcosms containing T. hamatum GD12 (h) or
DThnag : : hph ($) only. Absorbance values were converted to biomass equivalents expressed as [mg lyophilized mycelium (2 g
peat-bran mix)”1] using a standard calibration curve of R. solani lyophilized mycelium. The mean±SEM (based on three replicate
values) was then calculated for each set of samples from the populations on each day of sampling. (b) Biological control of preemergence (S. sclerotiorum) and post-emergence (R. solani) disease of lettuce by T. hamatum GD12 and DThnag : : hph. Note
control of disease by the wild-type strain GD12, but sporadic control of disease by the mutant DThnag : : hph. (c) Histograms
showing mean emergence (as a percentage) and mean shoot and root dry weights of lettuce plants grown in single (pathogens
only or Trichoderma strains only) or mixed (pathogens and Trichoderma strains) species peat-based microcosms. Control
microcosms contained lettuce only. Data are the mean±SEM from triplicate microcosms each containing 25 lettuce seeds.
Emergence percentages were converted to arc sin”1 values for statistical analysis by single-tailed t-test. Bars with different
letters are significantly different at 95 % confidence level.
modified with a hygromycin resistance gene and a gene
encoding an organophosphohydrolase (Weaver et al.,
2005), this is the first time, to our knowledge, that a study
has been undertaken to determine the saprotrophic
competitiveness and biocontrol fitness of a GM strain of
T. hamatum with biocontrol and P-G-P activities.
http://mic.sgmjournals.org
Mutagenesis of the gene (NAG) encoding N-acetyl-b-Dglucosaminidase, resulted in a non-sporulating mutant of
GD12 with altered secretion, as shown by increased
production of an extracellular Trichoderma glycoprotein
antigen. The cell walls of ascomycete fungi contain a
mixture of fibrillar components and amorphous or matrix
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
93
L. S. Ryder and others
materials (Horsch et al., 1997). The main fibrillar component is chitin, a straight-chain b(1,4)-linked polymer of
N-acetylglucosamine. Filamentous fungi grow by extension
at the flexible apex of the hypha, a process that requires
remodelling of the fibrillar chitin component of the cell
wall to allow extension at the growing tip. This remodelling
requires coordinated production of constitutive chitinase
enzymes such as N-acetyl-b-D-glucosaminidase and endochitinase, in addition to biosynthetic chitin synthases
(Horsch et al., 1997; Rast et al., 1991) and b-glucan synthases (Wessels, 1994). Consequently, a deficiency in Nacetyl-b-D-glucosaminidase in GD12 appears to result in
abnormal remodelling of the hyphal tip and would account
for the intense staining with calcofluor white found in the
swollen hyphal apices of the DThnag : : hph mutant,
indicative of aberrant chitin deposition. This was supported by colorimetric estimations of chitin contents,
which showed a significant reduction in concentration in
hyphae of the mutant strain.
Consistent with the results of Brunner et al. (2003), we
showed that loss of N-acetyl-b-D-glucosaminidase activity
in T. hamatum affected the formation of other chitinases.
However, unlike the work of Brunner et al. (2003), which
showed that disruption of N-acetyl-b-D-glucosaminidase
activity in T. atroviride did not affect sporulation of the
fungus, the DThnag : : hph mutant of T. hamatum lacked
conidiation. Similar reductions in sporulation efficiency
were found in Aspergillus mutants altered in chitin
deposition (Borgia et al., 1996; Horiuchi et al., 1999;
Müller et al., 2002). Alterations in chitin deposition could
also account for the increased secretion of the MF2 antigen
in DThnag : : hph, since secretion in fungi is a process that
occurs at the flexible growing tip (Wösten et al., 1991;
Wessels, 1994; Gordon et al., 2000; Thornton, 2004) and is
governed by the structure of the cell wall (Kruszewska et al.,
1999; Perlińska-Lenart et al., 2006). This is consistent with
the increased secretion of glycoproteins observed in
the related fungus Trichoderma reesei as a consequence of
mutations in chitin distribution in the hyphal cell wall
(Perlińska-Lenart et al., 2006).
Despite the abnormal morphology of DThnag : : hph, we
found, opposite to our expectations, that the mutation
increased the ability of the fungus to promote plant growth.
While we have yet to identify the stimulatory compound(s)
produced by the fungus, we have shown here that by altering
the architecture of the hyphal cell wall and the secretory
potential of a free-living strain of T. hamatum, significant
improvements can be made in its capacity to produce watersoluble P-G-P compounds. Studies with T. virens have
shown that enhanced biomass production and promotion of
lateral root growth in Arabidopsis occurs through an auxindependent mechanism mediated through the production of
auxin-related compounds by the fungus (Contreras-Cornejo
et al., 2009). It is possible that similar compounds are
produced by T. hamatum GD12 and future studies are
aimed at elucidating the P-G-P mechanism in this fungus.
94
The discovery that the mutation had resulted in a biocontrol
strain with improved P-G-P activity led us to investigate
whether the mutation also conferred increased fitness as a
soil saprotroph and as an antagonist of plant pathogens. We
found that exposing DThnag : : hph to the drug caspofungin
allowed us to switch-on spore production in an ordinarily
non-sporulating mutant. This allowed us to generate inoculum for incorporation into soil microcosms and to
undertake comparative studies of the competitive saprotrophic abilities of the two Trichoderma strains.
Saprotrophic competitiveness was investigated in soil
microcosms during antagonistic interactions with the
pathogen R. solani, an aggressive colonizer of nutrient
reserves in soil (Garrett, 1970). Because the mutant strain
was found to hyper-secrete the MF2 antigen, we were
unable to use the MF2 quantitative ELISA developed in a
previous study (Thornton, 2004) to track the population
dynamics of the Trichoderma strains. Instead, we used a
Rhizoctonia-specific mAb EH2 (Thornton et al., 1993) to
quantify the population dynamics of the pathogen in
mixed species microcosms (Thornton & Gilligan, 1999;
Thornton, 2004). This mAb binds to an extracellular
antigen secreted during hyphal growth of the pathogen
(Thornton et al., 1993). Estimations of active biomass of
the pathogen in microcosm samples required comparison
with calibration curves. In the absence of a source of
purified EH2 antigen, extracts from lyophilized mycelium
(LM) were used as a quantifiable and repeatable source of
antigen for the construction of a standard curve of R. solani
biomass (Thornton & Gilligan, 1999). This curve was used
to convert the absorbance values of microcosm extracts in
ELISA to LM biomass equivalents [expressed as mg LM
(2 g peat-bran mix)21], thereby allowing comparative
estimates to be made of the abilities of GD12 and
DThnag : : hph to limit the growth of R. solani. In doing
so, we were able to investigate the CSAs of GD12 and the
mutant strain in relation to R. solani proliferation in mixed
species microcosms. Using this procedure, we showed that
the mutant DThnag : : hph has reduced CSA compared with
GD12, thereby permitting saprotrophic growth of the
pathogen in soil. The interference competition of GD12 (as
defined by Wicklow, 1992) is unlikely to be mediated
through direct physical contact with the live host, since this
strain of the fungus does not display coiling of R. solani
hyphae in vitro, a property that has been demonstrated
with other antagonistic T. hamatum strains (Chet et al.,
1981). It is feasible that loss of overall chitinase activities
due to N-acetyl-b-D-glucosaminidase deficiency was a
contributing factor for the mutant’s inability to compete
with R. solani for nutrient reserves (bran) in mixed species
microcosms, since Trichoderma chitinolytic enzymes have
been shown to have substantial inhibitory effects on the
hyphal elongation of chitin-containing fungi such as R.
solani (Lorito, 1998).
Saprotrophic competitiveness is an important aspect of
biological control, since it enables the biocontrol agent to
compete with pathogens for nutrient resources in soil. The
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
Microbiology 158
Saprotrophism and biocontrol fitness of GM T. hamatum
plurivorous necrotrophic fungus S. sclerotiorum is an
important pathogen of a diverse range of hosts including
lettuce (Malvárez et al., 2007). T. hamatum GD12 was
effective in not only preventing colonization of lettuce
seeds by the pathogen but also further stimulating seedling
emergence in mixed species microcosms. In contrast, the
mutant DThnag : : hph displayed a significant reduction in
its ability to stimulate emergence in the presence of the
pathogen. However, a loss of emergence was compensated
for by an increase in the weight of established plants. This
showed that in the presence of an aggressive pre-emergence
damping-off pathogen, loss of biocontrol fitness was
balanced by the improved P-G-P activity of the mutant.
A similar trend was apparent with R. solani. Significant
increases in the emergence and dry weights of plants were
found in mixed species microcosms containing GD12 and
the pathogen compared with microcosms containing GD12
only. However, the ability of DThnag : : hph to promote
plant growth was significantly impaired by the pathogen.
This work demonstrates that substantial improvements in
plant productivity can be gained by genetically manipulating the growth stimulant properties of a biocontrol and PG-P strain of Trichoderma. However, in the case of T.
hamatum DThnag : : hph, the genetic modification leading to
improved P-G-P activity in the absence of disease pressure,
does not confer ecological or biological advantages to the
antagonist. On the contrary, the mutation decreased the
saprotrophic competitiveness and biocontrol fitness of
the fungus, and its ability to promote plant growth was
constrained by the presence of soil-borne pathogens.
Chang, Y.-C., Baker, R., Kleifeld, O. & Chet, I. (1986). Increased
growth of plants in the presence of the biological control agent
Trichoderma harzianum. Plant Dis 70, 145–148.
Chet, I. & Baker, R. (1981). Isolation and biocontrol potential of
Trichoderma hamatum from soil naturally suppressive to Rhizoctonia
solani. Phytopathology 71, 286–290.
Chet, I., Harman, G. E. & Baker, R. (1981). Trichoderma hamatum: Its
hyphal interaction with Rhizoctonia solani and Pythium spp. Microb
Ecol 7, 29–38.
Contreras-Cornejo, H. A., Macı́as-Rodrı́guez, L., Cortés-Penagos, C.
& López-Bucio, J. (2009). Trichoderma virens, a plant beneficial
fungus, enhances biomass production and promotes lateral root
growth through an auxin-dependent mechanism in Arabidopsis.
Plant Physiol 149, 1579–1592.
Djonović, S., Vittone, G., Mendoza-Herrera, A. & Kenerley, C. M.
(2007). Enhanced biocontrol activity of Trichoderma virens transformants constitutively coexpressing b-1,3- and b-1,6-glucanase genes.
Mol Plant Pathol 8, 469–480.
Duo-Chuan, L. (2006). Review of fungal chitinases. Mycopathologia
161, 345–360.
Elorza, M. V., Rico, H. & Sentandreu, R. (1983). Calcofluor white
alters the assembly of chitin fibrils in Saccharomyces cerevisiae and
Candida albicans cells. J Gen Microbiol 129, 1577–1582.
Flores, A., Chet, I. & Herrera-Estrella, A. (1997). Improved biocontrol
activity of Trichoderma harzianum by over-expression of the
proteinase-encoding gene prb1. Curr Genet 31, 30–37.
Fortwendel, J. R., Juvvadi, P. R., Perfect, B. Z., Rogg, L. E., Perfect,
J. R. & Steinbach, W. J. (2010). Transcriptional regulation of chitin
synthases by calcineurin controls paradoxical growth of Aspergillus
fumigatus in response to caspofungin. Antimicrob Agents Chemother
54, 1555–1563.
Fuchs, B. B. & Mylonakis, E. (2009). Our paths might cross: the role
of the fungal cell wall integrity pathway in stress response and cross
talk with other stress response pathways. Eukaryot Cell 8, 1616–
1625.
ACKNOWLEDGEMENTS
The work was funded by the UK Biotechnology and Biological
Sciences Research Council, to whom we are grateful.
Garrett, S. D. (1970). Pathogenic Root Infecting Fungi. Cambridge:
Cambridge University Press.
Gordon, C. L., Khalaj, V., Ram, A. F., Archer, D. B., Brookman, J. L.,
Trinci, A. P. J., Jeenes, D. J., Doonan, J. H., Wells, B. & other authors
(2000). Glucoamylase:green fluorescent protein fusions to monitor
REFERENCES
protein secretion in Aspergillus niger. Microbiology 146, 415–426.
Altomare, C., Norvell, W. A., Björkman, T. & Harman, G. E. (1999).
Harman, G. E., Howell, C. R., Viterbo, A., Chet, I. & Lorito, M. (2004).
Solubilization of phosphates and micronutrients by the plant-growthpromoting and biocontrol fungus Trichoderma harzianum Rifai 129522. Appl Environ Microbiol 65, 2926–2933.
Bae, H., Sicher, R. C., Kim, M. S., Kim, S.-H., Strem, M. D., Melnick,
R. L. & Bailey, B. A. (2009). The beneficial endophyte Trichoderma
hamatum isolate DIS 219b promotes growth and delays the onset of
the drought response in Theobroma cacao. J Exp Bot 60, 3279–3295.
Baek, J.-M., Howell, C. R. & Kenerley, C. M. (1999). The role of an
extracellular chitinase from Trichoderma virens Gv29-8 in the
biocontrol of Rhizoctonia solani. Curr Genet 35, 41–50.
Borgia, P. T., Iartchouk, N., Riggle, P. J., Winter, K. R., Koltin, Y. &
Bulawa, C. E. (1996). The chsB gene of Aspergillus nidulans is
Trichoderma species – opportunistic, avirulent plant symbionts. Nat
Rev Microbiol 2, 43–56.
Horiuchi, H., Fujiwara, M., Yamashita, S., Ohta, A. & Takagi, M.
(1999). Proliferation of intrahyphal hyphae caused by disruption of
csmA, which encodes a class V chitin synthase with a myosin motorlike domain in Aspergillus nidulans. J Bacteriol 181, 3721–3729.
Horsch, M., Mayer, C., Sennhauser, U. & Rast, D. M. (1997). b-Nacetylhexosaminidase: a target for the design of antifungal agents.
Pharmacol Ther 76, 187–218.
Kaminskyj, S. G. W. & Heath, M. C. (1982). An evaluation of the
nitrous acid – 3-methyl-2-benzothiazolinone hydrazone hydrochloride – ferric chloride assay for chitin in rust fungi and rustinfected tissue. Can J Bot 60, 2575–2580.
necessary for normal hyphal growth and development. Fungal Genet
Biol 20, 193–203.
Kerley, S. J. & Read, D. J. (1995). The biology of mycorrhiza in the
Brunner, K., Peterbauer, C. K., Mach, R. L., Lorito, M., Zeilinger, S. &
Kubicek, C. P. (2003). The Nag1 N-acetylglucosaminidase of
Ericaceae. XV. Chitin degradation by Hymenoscyphus ericae and
transfer of chitin-nitrogen to the host plant. New Phytol 131, 369–375.
Trichoderma atroviride is essential for chitinase induction by chitin
and of major relevance to biocontrol. Curr Genet 43, 289–295.
http://mic.sgmjournals.org
Kerley, S. J. & Read, D. J. (1998). The biology of mycorrhiza in the
Ericaceae. XX. Plant and mycorrhizal necromass as nitrogenous
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
95
L. S. Ryder and others
substrates for the ericoid mycorrhizal fungus Hymenoscyphus ericae
and its host. New Phytol 139, 353–360.
Kruszewska, J. S., Butterweck, A. H., Kurzatkowski, W., Migdalski, A.,
Kubicek, C. P. & Palamarczyk, G. (1999). Overexpression of the
Thornton, C. R. (2004). An immunological approach to quantifying
the saprotrophic growth dynamics of Trichoderma species during
antagonistic interactions with Rhizoctonia solani in a soil-less mix.
Environ Microbiol 6, 323–334.
Saccharomyces cerevisiae mannosylphosphodolichol synthase-encoding
gene in Trichoderma reesei results in an increased level of protein
secretion and abnormal cell ultrastructure. Appl Environ Microbiol 65,
2382–2387.
Thornton, C. R. (2005). Use of monoclonal antibodies to quantify the
dynamics of a-galactosidase and endo-1,4-b-glucanase production by
Trichoderma hamatum during saprotrophic growth and sporulation
in peat. Environ Microbiol 7, 737–749.
Leake, J. R. & Read, D. J. (1990). Chitin as a nitrogen source for
Thornton, C. R. (2008). Tracking fungi in soil with monoclonal
mycorrhizal fungi. Mycol Res 94, 993–995.
antibodies. Eur J Plant Pathol 121, 347–353.
Lesage, G., Sdicu, A. M., Ménard, P., Shapiro, J., Hussein, S. &
Bussey, H. (2004). Analysis of beta-1,3-glucan assembly in
Thornton, C. R. & Gilligan, C. A. (1999). Quantification of the effect of
Saccharomyces cerevisiae using a synthetic interaction network and
altered sensitivity to caspofungin. Genetics 167, 35–49.
the hyperparasite Trichoderma harzianum on the saprotrophic growth
dynamics of Rhizoctonia solani in compost using a monoclonal
antibody-based ELISA. Mycol Res 103, 443–448.
Limón, M. C., Pintor-Toro, J. A. & Benı́tez, T. (1999). Increased
Thornton, C. R., Jarvis, B. C. & Cooke, R. C. (1991). A chitin assay for
antifungal activity of Trichoderma harzianum transformants that
overexpress a 33-kDa chitinase. Phytopathology 89, 254–261.
Lindahl, B. D. & Taylor, A. F. S. (2004). Occurrence of N-acetyl
hexosaminidase-encoding genes in ectomycorrhizal basidiomycetes.
New Phytol 164, 193–199.
Lorito, M. (1998). Chitinolytic enzymes and their genes. In
Trichoderma and Gliocladium: Enzymes, Biological Control and
Commercial Applications, pp. 73–99. Edited by G. E. Harman &
C. P. Kubicek. London, UK: Taylor and Francis Ltd.
Malvárez, G., Carbone, I., Grünwald, N. J., Subbarao, K. V., Schafer, M.
& Kohn, L. M. (2007). New populations of Sclerotinia sclerotiorum from
lettuce in California and peas and lentils in Washington.
Phytopathology 97, 470–483.
the enumeration of Plasmodiophora brassicae resting spores in
clubroot tissue. Mycol Res 95, 879–882.
Thornton, C. R., Dewey, F. M. & Gilligan, C. A. (1993). Development of
monoclonal antibody-based immunological assays for the detection
of live propagules of Rhizoctonia solani in soil. Plant Pathol 42, 763–
773.
Thornton, C. R., Pitt, D., Wakley, G. E. & Talbot, N. J. (2002). Production
of a monoclonal antibody specific to the genus Trichoderma and closely
related fungi, and its use to detect Trichoderma spp. in naturally
infested composts. Microbiology 148, 1263–1279.
Thornton, C. R., Groenhof, A. C., Forrest, R. & Lamotte, R. (2004). A
Müller, C., Hjort, C. M., Hansen, K. & Nielsen, J. (2002). Altering the
one-step, immunochromatographic lateral flow device specific to
Rhizoctonia solani and certain related species, and its use to detect and
quantify R. solani in soil. Phytopathology 94, 280–288.
expression of two chitin synthase genes differentially affects the
growth and morphology of Aspergillus oryzae. Microbiology 148,
4025–4033.
Tronsmo, A. & Harman, G. E. (1993). Detection and quantification of
N-acetyl-b-D-glucosaminidase, chitobiosidase, and endochitinase in
Ortı́z-Castro, R., Contreras-Cornejo, H. A., Macı́as-Rodrı́guez, L. &
López-Bucio, J. (2009). The role of microbial signals in plant growth
and development. Plant Signal Behav 4, 701–712.
Perlińska-Lenart, U., Orlowski, J., Laudy, A. E., Zdebska, E.,
Palamarczyk, G. & Kruszewska, J. S. (2006). Glycoprotein
hypersecretion alters the cell wall in Trichoderma reesei strains
expressing the Saccharomyces cerevisiae dolichylphosphate mannose
synthase gene. Appl Environ Microbiol 72, 7778–7784.
Rast, D. M., Horsch, M., Furter, R. & Gooday, G. W. (1991). A complex
chitinolytic system in exponentially growing mycelium of Mucor
rouxii: properties and function. J Gen Microbiol 137, 2797–2810.
Read, D. J. & Perez-Moreno, J. (2003). Mycorrhizas and nutrient
cycling in ecosystems – a journey towards relevance? New Phytol 157,
475–492.
Reyes, F., Calatayud, J., Vazquez, C. & Martı́nez, M. J. (1989a). Beta-
N-acetylglucosaminidase from Aspergillus nidulans which degrades
chitin oligomers during autolysis. FEMS Microbiol Lett 53, 83–87.
Reyes, F., Calatayud, J., Vazquez, C. & Martı́nez, M. J. (1989b). b-Nacetylglucosaminidase from Aspergillus nidulans implicated in the
autolysis of the cell wall. FEMS Microbiol Rev 11, 317–338.
solutions and on gels. Anal Biochem 208, 74–79.
Verma, M., Brar, S. K., Tyagi, R. D., Surampalli, R. Y. & Valero, J. R.
(2007). Antagonistic fungi, Trichoderma spp.: Panoply of biological
control. Biochem Eng J 37, 1–20.
Vinale, F., Sivasithamparam, K., Ghisalberti, E. L., Marra, R., Barbetti,
M. J., Li, H., Woo, S. L. & Lorito, M. (2008). A novel role for
Trichoderma secondary metabolites in the interactions with plants.
Physiol Mol Plant Pathol 72, 80–86.
Vinale, F., Flematti, G., Sivasithamparam, K., Lorito, M., Marra, R.,
Skelton, B. W. & Ghisalberti, E. L. (2009). Harzianic acid, an
antifungal and plant growth promoting metabolite from Trichoderma
harzianum. J Nat Prod 72, 2032–2035.
Viterbo, A., Haran, S., Friesem, D., Ramot, O. & Chet, I. (2001).
Antifungal activity of a novel endochitinase gene (chit36) from
Trichoderma harzianum Rifai TM. FEMS Microbiol Lett 200, 169–
174.
Walker, L. A., Munro, C. A., de Bruijn, I., Lenardon, M. D., McKinnon, A.
& Gow, N. A. (2008). Stimulation of chitin synthesis rescues Candida
albicans from echinocandins. PLoS Pathog 4, e1000040.
Weaver, M., Vedenyapina, E. & Kenerley, C. M. (2005). Fitness,
their involvement in morphogenesis and host-parasite interaction.
FEMS Microbiol Rev 11, 317–338.
persistence, and responsiveness of a genetically engineered strain
of Trichoderma virens in soil mesocosms. Appl Soil Ecol 29, 125–
134.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
Wessels, J. G. H. (1994). Developmental regulation of fungal cell wall
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory Press.
White, S., McIntyre, M., Berry, D. R. & McNeil, B. (2002). The autolysis
Sahai, A. S. & Manocha, M. S. (1993). Chitinases of fungi and plants:
formation. Annu Rev Phytopathol 32, 413–437.
Sweigard, J., Chumley, F., Carroll, A., Farrall, L. & Valent, B. (1997). A
of industrial filamentous fungi. Crit Rev Biotechnol 22, 1–14.
series of vectors for fungal transformation. Fungal Genet Newsl 44,
52–53.
Wicklow, D. T. (1992). Interference competition. In The Fungal
96
Community: its Organisation and Role in the Ecosystem, pp. 265–
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
Microbiology 158
Saprotrophism and biocontrol fitness of GM T. hamatum
274. Edited by G. C. Carroll & D. T. Wicklow. New York: Marcel
Dekker.
Wösten, H. A., Moukha, S. M., Sietsma, J. H. & Wessels, J. G. H.
(1991). Localization of growth and secretion of proteins in Aspergillus
Windham, M. T., Elad, Y. & Baker, R. (1986). A mechanism for
niger. J Gen Microbiol 137, 2017–2023.
increased plant growth induced by Trichoderma spp. Phytopathology
76, 518–521.
Edited by: B. A. Horwitz
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 07:12:29
97