From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
Factor XI Messenger RNA in Human Platelets
By Danko Martincic, Vladimir Kravtsov, and David Gailani
The bleeding diathesis associated with congenital deficiency
of factor XI (FXI) is variable and correlates poorly with
standard coagulation assays. Platelets are reported to contain FXI activity that may substitute for the plasma protein.
The presence of this platelet activity in some patients
deficient in plasma FXI could partly explain the variable
bleeding associated with the deficiency state. Polyclonal
antibodies to plasma FXI recognize a 220 kD platelet membrane protein distinct in structure from plasma FXI. The
messenger RNA (mRNA) coding for this protein has been
postulated to be an alternatively spliced FXI message lacking
the fifth exon found in the liver (wild type) message. We
analyzed RNA from platelets, leukocytes, and bone marrow
for FXI mRNA by reverse transcription polymerase chain
reaction (RT-PCR) technology. Single FXI mRNA species
were identified by RT-PCR in platelet and bone marrow RNA,
but not leukocyte RNA, that are the same size as the
message from liver RNA. Sequencing of PCR products confirmed that the FXI mRNA species in platelets is identical to
the one in liver. Wild-type FXI mRNA was also identified in
three leukemia cell lines with megakaryocyte features (MEG01, HEL 92.1.7, and CHRF-288-11). The data show that
platelets contain wild-type FXI mRNA. FXI protein, therefore,
may be present in platelets and may be released during
platelet activation. The data do not support the premise that
the 220 kD platelet protein that cross-reacts with FXI antibodies is a product of an alternatively spliced mRNA from the FXI
gene.
r 1999 by The American Society of Hematology.
F
megakaryocytic features, for the presence of FXI mRNA. The
results show that normal platelets and bone marrow, as well as
established megakaryoctye cell lines, contain FXI mRNA that is
identical to the mRNA found in liver, but failed to identify novel
splice products of the FXI gene.
ACTOR XI (FXI) IS THE zymogen of a plasma serine
protease produced primarily in the liver that contributes to
blood coagulation through activation of factor IX by limited
proteolysis.1-4 This activity is most important during major
hemostatic challenges such as trauma or surgery.5,6 Unlike
bleeding associated with classic hemophilia (deficiency of
factor VIII or factor IX), hemorrhage in FXI deficiency is highly
variable and correlates poorly with standard assays of blood
coagulation such as the activated partial thromboplastin time
(aPTT).7,8 Indeed, there are individuals with extremely low
plasma levels of FXI (⬍ 1% of normal) who do not experience
bleeding despite trauma or surgery.9,10 It has been suggested that
coinheritance of other coagulation abnormalities such as von
Willebrand disease exacerbates hemorrhage in FXI deficiency,11
although this premise has been challenged.12 Conceivably,
multiple factors contribute to the wide range of bleeding
symptoms observed in these patients.
It has been postulated that a mild phenotype in some patients
with severe FXI deficiency may be due to the presence of
FXI-like activity associated with platelets, which may bypass
the requirement for plasma FXI in certain situations.13 Platelets
may contain small amounts of FXI activity (⬍1% of plasma
activity)14 and three groups have reported on the partial
purification of a 220 kD polypeptide from platelet extracts that
is recognized by anti-FXI polyclonal antibodies.14-16 This
protein appears to have a substantially different structure than
plasma FXI (a 160 kD dimeric molecule consisting of two
identical 80 kD polypeptides).17,18 Based on polymerase chain
reaction (PCR) studies of platelet RNA, it has been proposed
that the 220 kD platelet protein is a tetramer of a 50 to 55 kD
polypeptide that is the product of an alternatively spliced FXI
messenger RNA (mRNA) lacking the fifth exon normally found
in the full-length message from liver.19,20 Consistent with this is
a recent report of a truncated FXI complementary DNA (cDNA)
lacking the fifth exon, isolated from a library for the human
megakaryoblastic leukemia cell line CHRF-288-11.20 To determine if FXI mRNA or related novel messages are present in
blood tissues, we used reverse transcription PCR (RT-PCR)
technology to analyze RNA from human platelets, leukocytes,
and bone marrow, as well as human leukemia cell lines with
Blood, Vol 94, No 10 (November 15), 1999: pp 3397-3404
MATERIALS AND METHODS
Materials and Reagents
Molecular biology. The human liver FXI cDNA was a gift from Dr
Dominic Chung (University of Washington, Seattle, WA). TaKaRa long
range DNA polymerase for PCR was from Pan Vera Corp (Madison,
WI). A Thermo-sequenase radiolabeled terminator sequencing system
for DNA sequencing was from Amersham Life Sciences (Arlington
Heights, IL). Guanidinium isothiocyanate extraction buffer was from
Promega Corporation (Madison, WI). A Ready-To-Go T-Primed Firststrand Kit for RT of RNA was from Pharmacia Biotech (Piscataway,
NJ). Omniscript RT for PCR with or without RT (Qiagen, Valencia,
CA). Oligonucleotide primers were prepared by the DNA core facility
of the Vanderbilt University Cancer Center. SeaKem LE agarose and
NuSieve agarose were from FMC Bioproducts (Rockland, ME).
Cell lines and tissue culture. The MEG-01 human megakaryoblastic cell line (ATCC CRL-2021)21 and the human erythroleukemia cells
line HEL 92.1.7 (ATCC TIB 175)22 were from the American Tissue
Type Collection (Rockville, MD). The CHRF-288-11 human megakaryoblastic cell line23 was a gift from Dr Michael Lieberman (University of
From the Departments of Pediatrics, Pathology, and Medicine,
Vanderbilt University, Nashville, TN.
Submitted October 22, 1998; accepted July 12, 1999.
Supported by National Institutes of Health Grants HL02917 and
HL58837. D.G. is an Established Investigator of the American Heart
Association.
Address correspondence to David Gailani, MD, Division of Hematology, Vanderbilt University, 538 MRB II, 2220 Pierce Ave, Nashville, TN
37232-6305; email: [email protected].
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to indicate
this fact.
r 1999 by The American Society of Hematology.
0006-4971/99/9410-0021$3.00/0
3397
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3398
Cincinnati, Cincinnati, OH). The 293 human fetal kidney fibroblast cell
line transfected with a full-length FXI cDNA derived from liver was
described previously.24,25 RPMI 1640 medium was from Mediatech
(Herndon, VA), and Dulbecco’s modified Eagle medium (DMEM) and
Fischer’s media were from Life Technologies (Grand Island, NY).
Purification of platelets and leukocytes. The procedure for obtaining human blood specimens was approved by the Institutional Review
Board of Vanderbilt University. Platelets were isolated either from
peripheral blood or expired platelet-pheresis products from the Vanderbilt Hospital blood bank by differential centrifugation. Briefly, blood
(120 mL) was obtained from the antecubital vein of healthy normal
individuals into a 1/10th volume of 3.8% sodium citrate anticoagulant.
Anticoagulated blood or the platelet-pheresis product was placed in 50
mL polypropylene centrifuge tubes and erythrocytes and leukocytes
were pelleted by centrifugation at 300g for 10 minutes in a Sorval RC5
Superspeed centrifuge fitted with an SS-34 rotor (Sorval, Inc, Wilmington, DE). The top half of the platelet rich supernatant was gently
aspirated and placed into fresh centrifuge tubes using polypropylene
pipettes, and centrifugation was repeated as above. The top half of the
platelet-rich plasma was aspirated from the tube and used as the source
of platelets for RNA purification. The platelet count was determined
using a Technicon H-3 hematology analyzer (Bayer-Miles, Tarrytown,
NY). A typical platelet preparation from fresh blood contains 5 to 10 ⫻
109 platelets and from a pheresis product 1 to 5 ⫻ 1011 platelets.
Samples of purified platelets were stained with Wright’s stain and
examined under a microscope. Rare leukocytes or erythrocytes (⬍1 per
10,000 platelets) were detected in some platelet preparations, whereas
others had no detectable cells. Platelets were pelleted at 3,500g for 20
minutes, dissolved in guanidinium thiocyanate extraction buffer (5 to
10 ⫻ 109 platelets/mL of guanidinium thiocyanate), and stored at 4°C
pending RNA isolation.
Leukocytes were purified as follows: Twenty mL of peripheral blood
collected into a 1/10th volume of 3.8% sodium citrate was diluted 1:1
with RPMI 1640 medium. Eight mL of the diluted blood was layered
onto 4 mL of Ficoll Hypaque (Lymphoprep Ficoll Hypaque, Nycomed
Pharma AS, Oslo) in a 15 mL tube followed by centrifugation at 800g
for 30 minutes in a DPR-6000 centrifuge (Damon/International Equipment Co Division, Needham Heights, MA). The pellet (erythrocytes
and granulocytes) and the intermediate layer halfway down the Ficoll
Hypaque (monocytes and lymphocytes) were carefully collected and
subjected to a second purification on Ficoll Hypaque as above. The
erythrocyte/granulocyte fraction (1 mL in volume) was brought up to 15
mL with 150 mmol/L NH4Cl, 10 mmol/L KHCO3 to lyse red cells, then
centrifuged at 1,000g for 5 minutes in a Beckman TJ-6 bench-top
centrifuge to pellet the granulocytes. The monocyte/lymphocyte fraction underwent centrifugation in a similar manner. Microscopic evaluation of the granulocyte and mononuclear cell preparations showed
contamination with some platelets (⬍1 per 10 leukocytes) with the
contamination being somewhat greater for the mononuclear cell preparations than the granulocytes. The majority of platelets do not sediment
through Ficoll Hypaque and remain in the upper layer. Leukocytes were
dissolved in guanidinium thiocyanate extraction buffer (1 ⫻ 106
cells/0.2 mL extraction buffer). Normal human bone marrow, 5 mL, was
obtained from a donor harvest for bone marrow transplantation. The
cells were pelleted by centrifugation at 3,000g for 10 minutes and the
pellet was dissolved in 2 mL of guanidinium thiocyanate extraction
buffer. All cell lysates were stored at 4°C pending RNA purification.
Cultures of MEG-01, HEL 92.1.7, and CHRF-288-11 megakaryocytic
leukemia cells and 293 cells transfected with a human liver FXI cDNA.
Cell lines were maintained in a 37°C fully humidified incubator with a
5% CO2 atmosphere. MEG-01 was grown in RPMI 1640 containing
10% heat-inactivated fetal calf serum (FCS), 2 mmol/L L-glutamine, 1
mmol/L sodium pyruvate, 1.5 gm/L sodium bicarbonate, 10 mmol/L
HEPES, and penicillin/streptomycin/amphotericin B. HEL 92.1.7 cells
were grown in RPMI 1640 containing 10% heat-inactivated FCS, 2
MARTINCIC, KRAVTSOV, AND GAILANI
mmol/L L-glutamine, and penicillin/streptomycin. CHRF-288-11 was
grown in Fischer’s medium supplemented with 10% heat-inactivated
FCS and penicillin/streptomycin. Cells were grown to a concentration
of approximately 1 ⫻ 107/20 mL media, then washed four times with
phosphate-buffered saline, pelleted by centrifugation at 1,000g for 10
minutes, and dissolved in 2 mL of guanidinium thiocyanate extraction
buffer. Cells that were adherent to the culture flasks were released by
incubation with trypsin/EDTA and then treated as above. Extracts were
stored at 4°C pending RNA purification. 293 cells transfected with a
wild-type FXI liver cDNA24,25 were grown in DMEM 5% FCS, 2
mmol/L L-glutamine, 1 mmol/L sodium pyruvate, and penicillin/
streptomycin/amphotericin B. These cells, which served as a positive
control for the RT/PCR process, were processed into guanidinium
thiocyanate extraction buffer as above.
Isolation of RNA and RT. Total RNA from platelets and cell lines
was isolated using standard guanidinum thiocyantate/phenol:chloroform extraction and precipitated with 70% ethanol.26 Leukocyte, bone
marrow, and cell line poly-A RNA were isolated from the guanidinium
isothyocyante extractions using a PolyA Tract System 1000 (Promega)
according to the manufacturer’s instructions. PolyA RNA was eluted
from the system using nuclease-free water. A Ready-To-Go T-Primed
first-strand RT kit (Pharmacia) was used for RT reactions. Briefly, 5 µg
of total RNA (platelets) or 100 to 1,000 ng of poly A RNA (leukocytes,
bone marrow, or cell lines) was mixed with oligo-dT and random
hexanucleotides as recommended by the manufacturer. Samples were
heated at 65°C for 5 minutes, placed on ice for 2 minutes, and then
added to tubes containing the Ready-To-Go beads. After 1 minute of
incubation at room temperature, samples were mixed, transferred to a
37°C water bath, and incubated for 2 hours. To show that signals
obtained from PCR reactions were RT dependent and, therefore, not due
to contamination of RNA preparations with genomic or cDNA, RNA
underwent RT in the presence or absence of RT as follows: 2 µg of RNA
was added to reaction mixtures containing 1⫻ buffer, 0.5 mmol/L of
each deoxyribonucleoside (dNTPs), 0.5 µmol/L of random hexanucleotides, and 10 units of RNase inhibitor, and incubated at 37°C for 2 hours
either in the presence or absence of 4 units of Omniscript RT. Reactions
were then cooled on ice and 8 to 10 µL was used as template in a 50 µL
PCR reaction.
PCR amplification of RT mRNA and cDNA libraries. Oligonucleotide primer pairs for PCR (Table 1) were designed using OSP
software 27 and published sequences for human FXI,18,28 glycoprotein
IIb (GPIIb),29 and CD-18.30 Three sets of primers were prepared for FXI
to amplify sequences represented by exons 3 through 6 of the FXI heavy
chain, exons 10-14 from the carboxy-terminus of the heavy chain and
catalytic light chain, and exons 3-15 covering the entire sequence
encoding the mature protein (Fig 1). An additional pair of primers
amplifying parts of exon 10 and 11 were prepared (Table 1) for use in
Table 1. Oligonucleotide Primers Used for Polymerase Chain
Reaction Amplification of Reverse-Transcribed RNA. Primer
Sequences are 58-38, Left-to-Right
Protein
Position
Oligonucleotide Sequence
Factor XI (exon 3-6)
Factor XI (exon 3-6)
Factor XI (exon 10-15)
Factor XI (exon 10-15)
Factor XI (exon 3-15)
Factor XI (exon 3-15)
Factor XI (exon 10-11)
Factor XI (exon 10-11)
Glycoprotein IIb
Glycoprotein IIb
CD18
CD18
58 primer
38 primer
58 primer
38 primer
58 primer
38 primer
58 primer
38 primer
58 primer
38 primer
58 primer
38 primer
AAGATGTTTACTCTTCACTTTCACGG
CACTTTATCGAGCTTCGTTATTCTGG
CTAAAATACTTCACGGGAGAGGAGG
TCACTAAGGGTATCTTGGCTTTCTGG
CTGCTTTGAAGGAGGGGACATTACTACGG
CCTCATTGTGTTTGCAGGACAGAGGGC
AAATACTTCACGGGAGAGGAGG
CGGCTGTTAATATCCACTGGTTTC
GGGCGTGTGTATTTGTTCCTG
AGGTCTGGGTATCCGTTGTC
GTCTGAGGACTCCAGCAATG
CACTCACACTGGGGAAGAAC
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
FACTOR XI mRNA IN PLATELETS
3399
Fig 1. Strategy for PCR amplification of human FXI mRNA.
The FXI cDNA is encoded by 15
exons. Three sets of oligonucleotide primers (Table 1) were designed to amplify a 400 bp fragment from exons 3 to 6 of the
heavy chain (primers 1 and 2), a
552 bp fragment from exons 10
to 14 of the C-terminus of the
heavy chain and the catalytic
light chain (primers 3 and 4), and
a 1,673 bp fragment from exons
3 to 15 covering the coding region for the mature plasma protein (primers 5 and 6). A1 to A4
designate the four apple domains of the heavy chain; E,
exon.
identifying a common polymorphism in exon 1131 known to be present
in one of the platelet donors (see below). PCR reactions for GPIIb,
CD-18, and exons 3-6, 10-14, and 10-11 of FXI were amplified in
reactions containing 1⫻ TaKaRa reaction buffer, 1.5 mmol/L magnesium chloride, 100 µmol/L of each dNTPs, 10 pmol of each primer, 2.5
units of TaKaRa LA Taq polymerase, and 3.0 µL of RT mRNA in a total
volume of 50.0 µL. PCR was performed on a Perkin Elmer model 460
DNA Thermal Cycler (Foster City, CA). The following cycling
parameters were used: one cycle of denaturation at 94°C for 3 minutes,
annealing at 60°C for 40 seconds and extension at 70°C for 1 minute,
followed by 38 cycles of denaturation at 94°C for 30 seconds, annealing
at 60°C for 30 seconds, and extension at 72°C for 1 minute. Long-range
PCR to amplify the 1.6 kb long fragment covering FXI exons 3-15 was
performed in a total volume of 50 µL containing 1⫻ TaKaRa reaction
buffer, 1.5 mmol/L magnesium chloride, 400 µmol/L of each deoxyribonucleoside (dNTP), 10 pmol of each primer, 2.5 units of TaKaRa LA
Taq polymerase, and 3.0 µL of RT mRNA. PCR was performed on a
PTC-100 Thermal Cycler (MJ Research) using the following cycling
conditions: an initial cycle of denaturation at 94°C for 3 minutes
followed by 38 cycles of denaturation at 94°C for 40 seconds and
annealing/extension at 66°C for 2 minutes. Small PCR fragments were
size fractionated by electrophoresis on 2% NuSieve agarose gels.
Long-range PCR fragments were separated on 1% SeaKem LE agarose
gels.
DNA sequencing. The PCR fragments representing FXI exons 3-6
from normal platelets, bone marrow, 293 control cells, MEG-01, HEL,
and CHRF-288-11 RNA were subjected to dideoxy-chain termination
sequencing using a Thermo Sequenase radiolabeled terminator cycle
sequencing kit according to the manufacturers recommendations.
Sequencing of the exon 10-11 product from the platelet RNA of an
individual known to carry a polymorphism in exon 11 was performed in
a similar manner. Fragments were sequenced in both directions using
the oligonucleotide primers originally used to produce the PCR
fragments. Reaction products were run on standard 7% polyacrylamide
gels followed by autoradiography overnight. Sequences were compared
with the published sequence for the human FXI cDNA.18
RESULTS
PCR analysis for FXI mRNA in platelets and bone marrow.
The human FXI gene contains 15 exons. Exon 1 is not
translated, whereas exon 2 encodes a signal peptide that is not
present on the mature molecule.28 Exons 3-10 encode the FXI
heavy chain and exons 11-15 encode the catalytic light chain.28
Three sets of PCR primers were used to amplify portions of the
FXI message from RT RNA (Fig 1). The expected PCR
products generated from the primer pairs, based on the pub-
lished cDNA sequence for FXI18 are: 400 bp for exons 3-6, 552
bp for exons 10-14, and 1,673 bp for exons 3-15. PCR products
of the expected sizes were generated when RT RNA from the
293 cell line transfected with a liver FXI cDNA (control cells)
was used as template (Fig 2A, lane 1). Human pancreas has
Fig 2. PCR amplification of FXI mRNA from platelets and megakaryocytic cell lines. PCR was performed as described in the Materials
and Methods section. (A) RT RNA extracted from human platelets
was used as template to amplify exons 3-6 (top), exons 10-14
(middle), and exons 3-15 (bottom) of the FXI message. Lanes 1, RNA
from 293 cells transfected with the human wild-type FXI cDNA
(positive control); 2, RNA extracted from fresh platelets; 3 and 4, RNA
extracted from platelets obtained by platelet-pheresis; and 5, no
template (negative control). (B) RT poly-A RNA from megakaryocytic
cell lines was used as template to amplify exons 3-6 of the FXI
message. Lanes 1, HEL 92.1.7 cells; 2, MEG-01 cells; 3, CHRF-288-11
cells; and 4, no template (negative control). The positions of molecular weight markers (MWM) in kilobases are shown at the left of the
figure.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3400
previously been showed by Northern blot analysis to express
FXI mRNA.25 PCR products similar to those from the control
cell line were obtained when a human pancreas cDNA library
was used as template for all three sets of PCR primers (data not
shown). When the PCR template was RT RNA from normal
human platelets, single products were obtained that were
identical in size to those from reactions with the 293 control
cells (Fig 2A). Note, in Fig 2A the control sample in lane one for
the exon 3-15 PCR product appears very heavy. This is due to
overexposure of the film to show the PCR products from
platelets, which are faint. The exon 3-15 PCR product represents a nearly full-length FXI message. As platelet RNA appears
to be partially degraded on ethidium-stained agarose gels (data
not shown), it is likely that there are very few full-length FXI
messages in platelet RNA, accounting for the weakness of this
PCR product. Peripheral blood platelets are anucleate cell
fragments lacking the machinery for RNA synthesis (except
perhaps for mitochondrial RNA). RNA in platelets, therefore,
must be produced by megakaryocytes. We identified FXI
message by RT-PCR in RNA from normal human bone marrow
(Fig 3, lane 1). Whereas the cell of origin of the message is not
determined by this experiment, the results are consistent with a
megakaryocytic origin for the FXI message identified in
platelets. The positive result with bone marrow RNA could have
been due to platelets within the bone marrow sample. However,
the bone marrow RNA was prepared from a small sample (5
mL), and in our experience there is insufficient platelet RNA in
this volume to generate a positive signal by RT-PCR. The DNA
Fig 3. PCR amplification of FXI exons 3-6, GPIIb, and CD-18 using
RT RNA from human platelets, bone marrow, and leukocytes. PCR
was performed as described in the Materials and Methods section.
Lanes 1, bone marrow; 2, 293 cells transfected with wild-type FXI
cDNA; 3, fresh platelets; 4, platelets from platelet-pheresis; 5, granulocytes; 6, mononuclear leukocytes. MWM indicates a 100 bp DNA
ladder that serves as molecular weight markers. The intense marker
band is 500 bp in size.
MARTINCIC, KRAVTSOV, AND GAILANI
sequences of the exon 3-6 PCR fragments from platelets, bone
marrow, pancreas, and the 293 control cells were identical to the
published sequence for the human FXI cDNA.18
A recent report describes a truncated FXI message lacking
exon 5 in the megakaryocytic leukemia cell line CHRF-28811.20 The absence of this exon in platelet or bone marrow
mRNA should have resulted in PCR products of 241 bp for the
exon 3-6 primer pair and 1,514 bp for the exon 3-15 primers.
We did not observe either of these smaller species in any fresh
platelet preparation (three separate donors, Figs 2A and 3 and
data not shown) or in platelet-pheresis products from our blood
bank (three separate donors, Figs 2A and 3).
PCR analysis for FXI mRNA in leukemia cell lines with
megakaryoblastic features. Cell lines MEG-01,21 HEL 92.1.7,22
and CHRF-288-1123 are derived from tissues of patients with
acute nonlymphocytic leukemia. These cell lines have been
shown to possess features and express proteins typically found
in normal megakaryocytes. An FXI cDNA lacking exon 5 and a
small part of the 38-portion of exon 4 has been isolated from a
cDNA library prepared from CHRF-288-11 RNA, and the
MEG-01 line is reported to express an FXI mRNA of 1.9 kb (the
message in liver is 2.1 kb) detectable by Northern blot
analysis.20 RNA was isolated from cells and analyzed by
RT-PCR with the exon 3-6 primer pair specific for the FXI
heavy chain (Fig 2B). PCR products identical to the one from
the control cell line were obtained with RNA from all three cell
lines. No product that could represent a truncated FXI mRNA
was identified in the cell lines. DNA sequences of the exon 3-6
PCR products for all cell lines were identical to the published
sequence for the human FXI cDNA from liver.18
PCR analysis of RNA from peripheral blood leukocytes. A
major concern when isolating RNA from peripheral blood
platelets is contamination of the platelet preparation with small
numbers of leukocytes that contain relatively large amounts of
RNA compared to platelets. Although the platelet isolation
technique used in this study produced several platelet preparations with no apparent leukocyte contamination by visual
microscopic inspection, some leukocyte contribution to all
platelet RNA preparations could not be ruled out. To address
this potential problem, RNA was isolated and reverse transcribed from granulocytes and from mononuclear leukocytes (a
combination of lymphocytes and monocytes) and along with
platelet RNA was analyzed by PCR for leukocyte- and plateletspecific markers, in addition to FXI. The results of a representative experiment are shown in Fig 3. All platelet preparations and
bone marrow were positive for GPIIb. As suspected, one of six
platelet preparations gave a positive signal for CD-18, a
component of the leukocyte marker LFA-1,30 indicating white
cell contamination of the platelet preparation (data not shown).
Both granulocytes and mononuclear cells were consistently
positive for CD18. In addition, some preparations of mononuclear cells were positive for GPIIb, which is typically only
found on platelets and megakaryocytes.32 This is consistent with
the platelet contamination noted in the leukocyte preparation.
Most importantly, granulocytes and mononuclear cells did not
give a positive signal for FXI. It is our impression that platelets
contain very small amounts of FXI mRNA, and the low level of
platelet contamination of the mononuclear cells would not
provide sufficient platelet RNA to detect the FXI message.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
FACTOR XI mRNA IN PLATELETS
3401
Fig 4. Control reactions for RT dependence. Reactions for RT of RNA from human platelets or human megakaryocytic cell lines were
performed as described in the Materials and Methods section either in the absence (-) or presence (ⴙ) of RT. The reaction products were then
subject to PCR amplification using the oligonucleotide primer pair specific for exons 3-6 of human factor XI. PCR products were obtained only for
reactions in which RT was present. Lanes 1, platelet RNA; 2, HEL 92.1.7 cells; 3, MEG-01 cells; 4, CHRF-288-11 cells; 5, 293 cells transfected with
wild-type FXI cDNA. The position of the molecular weight marker is shown at the left of the figure.
Although low levels of leukocyte expression of FXI mRNA can
not be ruled out by this analysis, the results show that platelets
are the major source of FXI mRNA in peripheral blood.
Control experiments for potential contamination of RNA
preparations with DNA. An obvious concern when using
PCR to detect mRNA is the generation of a false-positive signal
due to contamination with genomic or cDNA. Analysis by a
technique that does not involve amplification steps, such as
Northern blot or RNAse protection analysis can overcome this
limitation. However, we were unable to show FXI message by
these techniques in any of the RNA preparations in this study
except for the transfected 293 cells that overexpress the
message (data not shown). The amount of FXI message,
therefore, is below the level of detection for these types of
assays. In our experiments, PCR primer pairs were selected to
amplify fragments with more than one exon, eliminating the
possibility of genomic DNA being responsible for the signals.
Control PCR reactions in which the template was RNA that had
not been reverse transcribed were performed for all RNA
preparations (Fig 4). These reactions did not generate PCR
products indicating that RNA preparations were not contaminated with factor XI cDNA, and that PCR products in reactions
using RT RNA as template were dependent on the RT reaction.
This shows that the template for the PCR signals is, indeed,
mRNA.
Finally, several polymorphisms that do not result in amino
acid changes have been reported in the coding sequence for the
human FXI gene.31 One of these polymorphisms, a T to C
change at base pair 1234 within exon 11, was known to be
present in one copy of the FXI gene from one of our platelet
donors. A PCR primer pair that amplifies portions of exons 10
and 11 (Table 1) was used to generate a 216 bp fragment from
the platelet RNA of this donor, and the base pair sequence of the
PCR product was determined (Fig 5). The sequence shows both
a T and a C residue at base pair 1234, consistent with the known
heterozygous state for this person. This result could not have
been created by genomic DNA contamination of the sample, as
the PCR product involves parts of two exons separated by
several kilobases of intron sequence in the gene.28 The pattern is
highly unlikely to be caused by cDNA contamination because
two separate sequences are present in the PCR product and no
cDNAs containing the T to C polymorphism have been created
in our laboratory. These data also confirm that platelet RNA is
the template responsible for the PCR products in our experiments.
DISCUSSION
The bleeding diathesis associated with FXI deficiency has
been perplexing since the first description of FXI-deficient
patients in 1953.33 Congenital deficiency of FXI is a relatively
rare disorder with a particularly high incidence in people of
Ashkenazi Jewish descent.34 Excessive bleeding is typically
triggered by trauma or surgical procedures, however, hemorrhage does not correlate well with plasma FXI levels determined by contact activation initiated clotting assays.7,8 In a
seminal study, Asakai et al5 presented an explanation for some
of the variation when they noted that hemorrhage depends not
only on the FXI level in plasma, but also on the tissue involved.
Bleeding from the oral cavity and urinary tract are particularly
common, likely due to the high levels of fibrinolytic activity in
these tissues. Nevertheless, there are severely deficient patients
Fig 5. Nucleotide sequence of an RT-PCR amplified portion of FXI
exon 11 from platelet RNA. RT-PCR and DNA sequencing were
performed as described in the Materials and Methods section using
platelet RNA from an individual known to be heterozygous for a T to
C polymorphism within amino acid codon 379 of FXI (nucleotide
position 1234 of the human cDNA sequence18) and a person homozygous for the wild-type (T) allele. The arrow indicates the position of
the polymorphism. Note the signal for both a T and C residue at this
position for the heterozygous individual.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3402
who do not bleed with surgical procedures, suggesting an
alternative procoagulant activity may be present in some
individuals that substitutes for plasma FXI. It has been proposed
that the platelets of some people contain an FXI-like activity
that may modify bleeding in the absence of plasma FXI.14,15
Platelet ␣-granules, contain numerous proteins involved in
hemostasis and fibrinolysis that are also present in plasma.35
The source of granule proteins appears to vary. The vWF 36 and
the A chain of factor XIII37 are apparently of megakaryocyte
origin, as megakaryocytes express mRNA for these proteins. In
contrast, megakaryocytes do not express mRNA for albumin or
the ␣ and ␤ chains of fibrinogen, indicating these proteins are
taken up into granules from the plasma.38 Our results show FXI
mRNA in human platelets and bone marrow, as well as three
cell lines with megakaryocyte features. Furthermore, platelets
are the major source of FXI mRNA in peripheral blood, because
leukocyte RNA does not contain FXI message. The amount of
FXI message in platelets and the leukemia cell lines appears to
be small. Nevertheless, the data suggest FXI similar to the
protein produced by the liver may be present in platelets, and
could be released at sites of platelet activation to increase local
concentrations of this clotting factor at a wound site. It should
be noted that it is difficult to postulate a role for a platelet pool
of FXI in the variable bleeding observed in FXI deficiency,
because this protein would presumably be affected by the same
mutation that produced the plasma deficiency state.
The presence of FXI mRNA in platelets does not provide
definitive proof that FXI protein is present. The issue of whether
or not platelets contain FXI protein, and the form this protein
takes, is a controversial one. Evidence for platelet FXI comes
from three major lines of investigation: (1) assays of FXI
activity, (2) antibody-based immunologic studies of FXI antigen, and (3) molecular biology investigations of FXI mRNA.
Well-washed platelets contain small amounts of activity that
shorten the abnormally long clotting time of FXI-deficient
plasma in an aPTT assay.13,39,40 The nature of this activity is
difficult to determine by this type of assay, however, as complex
platelet extracts contain factors that interact with the clotting
cascade at many levels. Indeed, Schiffman et al41,42 and Osterud
et al43 made this point when they examined platelet extracts for
FXI activity and concluded no appreciable activity was present.
Using immunoprecipitation techniques with polyclonal antihuman FXI antibodies, three groups have reported on the partial
purification of a 220 kD protein from platelets by immunoprecipitation.14-16 The protein appears to be on the platelet surface,
because it copurifies with the membrane fraction of sonicated
platelets.13 The migration of this protein through SDSpolyacrylamide gels is different from plasma FXI, a 160 kD
homodimer comprised of identical disulfide-bond–linked 80 kD
polypeptides.17 Under reducing conditions the platelet protein
migrates as a single 50 to 55 kD protein implying that the 220
kD protein is a polymer of a smaller subunit. The protein shares
some features with plasma FXI, in addition to cross-reactivity
with antibodies. Like plasma FXI, the platelet protein is cleaved
by factor XIIa, and the cleaved form appears to cleave the
synthetic substrate S-2366, indicating it is a protease.15 In
contrast, unlike plasma FXI the platelet protein is not activated
by trypsin, its proposed catalytic domain is substantially larger
than that of factor XIa, and it has not been shown that it has
MARTINCIC, KRAVTSOV, AND GAILANI
FXIa activity (ie, activates factor IX). Although this protein
may eventually be shown to possess FXI activity, it is difficult to
invoke it at present as an explanation for variable bleeding in
FXI deficiency because it is not known if some people have the
protein while others lack it.
Using flow cytometry, Hu et al44 detected binding of anti-FXI
antibodies to platelets from normal and FXI-deficient patients, a
finding supported by earlier studies.14 These authors propose
that the binding site for the antibody is a FXI-like molecule
encoded by a modified message from the FXI gene that may
circumvent mutations responsible for plasma FXI deficiency.
The findings are consistent with this hypothesis, however, other
possibilities must be considered. The simplest explanation is
that the antibody is cross-reacting with a protein that may have
homology to FXI, but is not a product of the FXI gene. In this
circumstance it would not be expected to be affected by a
mutation causing deficiency of plasma FXI. Alternatively, the
antibodies could bind to normal FXI in normal platelets, and to
mutant FXI molecules in platelets from FXI-deficient patients.
A common point mutation associated with FXI deficiency in
Ashkenazi Jews is a phenylalanine to leucine substitution at
amino acid 283.5 The mutation interferes with normal dimer
formation of FXI, resulting in reduced secretion of the protein
into plasma.45 Factor XI associated with platelets may be stored
in granules and not be secreted, however, and abnormal proteins
could be retained within the platelets. Taken as a whole, the data
obtained with FXI antibodies indicate that platelets contain a
protein that is a protease and that has some homology to plasma
FXI. The range of activities of this protein and its role in
hemostasis, if any, remain to be determined.
Using PCR techniques, Hsu et al have recently provided
evidence for an alternatively spliced mRNA from the FXI
gene,20 and postulate that it codes for the 50 to 55 kD subunit of
the platelet protein identified by FXI antibodies. With platelet
RNA as template, each exon of the FXI gene could be amplified
individually by RT/PCR except for exon 5, which encodes a
portion of the apple two domain of the FXI heavy chain. This
group also isolated a novel FXI cDNA lacking exon 5 and the
38-terminal bp of exon 4 from a leukemia cell line cDNA
library.20 This cell line, CHFR-288-11, shows megakaryocytic
features including expression of platelet factor 4, vWF, and
glycoprotein IIb/IIIa, as well as induction of multinucleation
and hyperploidy upon stimulation with phorbol ester.23 We were
interested to determine if the novel FXI message identified in
the cDNA library of this cell line, is present in normal human
blood tissues and in freshly prepared RNA from megakaryocyte
cell lines.
We did not find evidence for truncated FXI mRNA in normal
platelets or in the three megakaryoblast cell lines tested,
including CHRF-288-11. All PCR products representing the
FXI heavy chain contain normal sequence for exon 5. The
results with RT-PCR cannot exclude the presence of low levels
of alternatively spliced message, however, the data indicate the
predominant message for FXI in platelets and cell lines is
identical to the message produced in liver. Generation of FXI
mRNA lacking exon 5 that would maintain an open reading
frame would require an unusual mRNA splicing event that
would ignore nearly perfect consensus donor splice junctions at
the 38-end of exons 4 and 5.28 Our studies failed to identify this
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
FACTOR XI mRNA IN PLATELETS
species in normal blood cells. It is possible that some individuals may have a polymorphism in the FXI gene that could allow
this splicing event to occur, and that we did not identify it in the
platelets of the six individuals we tested. However, this
possibility would not explain the discrepancy between our data
with CHRF-288-11 mRNA and the previously published results
of the novel alternatively spliced FXI message from a library
prepared from this same cell line.20
In summary, our results show FXI mRNA in platelets,
suggesting platelets may contain FXI of megakaryocytic origin
that is similar to plasma FXI produced in the liver. Although
platelets appear to contain a membrane protein that cross-reacts
with FXI antibodies, our data do not support the premise that
this protein is a product of an alternatively spliced message
from the FXI gene. This is supported by the failure of mutations
in the FXI gene causing plasma FXI deficiency to influence the
presence of the platelet membrane protein.44
ACKNOWLEDGMENT
The authors are grateful to Dr Jerry Ware (Scripps Inst, LaJolla, CA)
for providing cDNA libraries and information regarding HEL and
CHRF-288-11 cells, and to Dr Michael Lieberman (University of
Cincinnati, Cincinnati, OH) for providing the CHRF-288-11 cell line.
We thank Dr Mortimer Poncz (University of Pennsylvania, Philadelphia, PA) for recommendations concerning leukocyte and platelet
specific markers, and Dr George J. Broze, Jr (Washington University,
St. Louis, MO) for his thoughtful reading of the manuscript. We also
wish to thank Mr Mao-Fu Sun for expert technical assistance.
REFERENCES
1. Lindquist P, Fujikawa K, Davie E: Activation of bovine factor IX
(Christmas factor) by factor XIa (activated plasma thromboplastin
antecedent) and a protease from Russel’s viper venom. J Biol Chem
253:1902, 1978
2. DiScipio R, Kurachi K, Davie E: Activation of human factor IX
(Christmas factor). J Clin Invest 61:1528, 1978
3. Osterud B, Bouma B, Griffin G: Human blood coagulation factor
IX: Purification, properties, and mechanism of activation by activated
factor XI. J Biol Chem 253:5946, 1978
4. Walsh P, Bradford H, Sinha D, Piperno J, Tuszynzki G: Kinetics of
the factor XIa catalyzed activation of human coagulation factor IX. J
Clin Invest 73:1392, 1984
5. Asakai R, Chung D, Davie E, Seligsohn U: Factor XI deficiency in
Ashkenazi Jews in Israel. N Engl J Med 325:153, 1991
6. Seligsohn U: Factor XI deficiency. Thromb Haemost 70:68, 1993
7. Ragni M, Sinha D, Seaman F, Lewis J, Spero J, Walsh P:
Comparison of bleeding tendency, factor XI coagulant activity, and
factor XI antigen in 25 factor XI-deficient kindreds. Blood 65:719, 1985
8. Bolton-Maggs P, Wan-Yin B, McGraw A, Slack J, Kernoff P:
Inheritance and bleeding in factor XI deficiency. Brit J Haematol
69:521, 1988
9. Rapaport S, Proctor R, Patch M, Yettra M: The mode of
inheritance of PTA deficiency: Evidence for the existence of major PTA
deficiency and minor PTA deficiency. Blood 18:149, 1961
10. Edson J, White J, Krivit W: The enigma of severe factor XI
deficiency without hemorrhagic symptoms. Thromb Diath Haemorrh
18:342, 1967
11. Tavori S, Brenner B, Tirski I: The effect of combined factor XI
deficiency with von Willebrand factor abnormalities on hemorrhagic
diathesis. Thromb Haemost 63:36, 1990
12. Brenner B, Laor A, Lupo H, Zivelin A, Lanir N, Seligsohn U:
Bleeding predictors in factor XI-deficient patients. Blood Coagul
Fibrinolysis 8:511, 1997
3403
13. Lipscomb M, Walsh R: Human platelets and factor XI: Localization in platelet membranes of factor XI-like activity and its functional
distinction from plasma factor XI. J Clin Invest 63:1006, 1979
14. Tuszynski G, Bevacqua S, Schmaier A, Colman R, Walsh P:
Factor XI antigen and activity in human platelets. Blood 59:1148, 1982
15. Schiffman S, Yeh C: Purification and characterization of platelet
factor XI. Thromb Res 60:87, 1990
16. Komiyama Y, Nomura S, Murakami T, Masuda M, Egawa H,
Murata L, Okubo S, Kokawa T, Yasunaga K: Purification and characterization of platelet-type factor XI from human platelets. Thromb
Haemost 69:1238, 1993 (abstract)
17. Bouma B, Griffin J: Human blood coagulation factor XI,
purification, properties, and mechanism of activation by activated factor
XII. J Biol Chem 252:6432, 1977
18. Fujikawa K, Chung D, Hendrickson L, Davie E: Amino acid
sequence of human factor XI, a blood coagulation factor with four
tandem repeats that are highly homologous with plasma prekallikrein.
Biochemistry 25:2417, 1986
19. Hsu T, Walsh P: Platelet factor XI mRNA amplified from human
platelets by reverse transcription polymerase chain reaction. Blood
82:207A, 1993 (abstract)
20. Hsu T, Shore S, Seshsmma T, Bagasra O, Walsh P: Molecular
cloning of platelet factor XI, an alternative splicing product of the
plasma factor XI gene. J Biol Chem 273:13787, 1998
21. Ogura M, Morishima Y, Ohno R, Hirabayashi N, Nagura H, Saito
H: Establishment of a novel human megakaryoblastic leukemia cell
line, MEG-01, with positive Philadelphia chromosome. Blood 66:1384,
1985
22. Martin P, Papayannopoulou T: HEL cells: A new human erythroleukemia cell line with spontaneous and induced globin expression.
Science 216:1233, 1982
23. Fugman D, Witte D, Jones C, Aronow B, Lieberman M: In vitro
establishment and characterization of a human megakaryoblastic cell
line. Blood 75:1252, 1990
24. Sun Y, Gailani D: Identification of a factor IX binding site on the
third apple domain of activated factor XI. J Biol Chem 271:29023, 1996
25. Gailani D, Sun M, Sun Y: A comparison of murine and human
factor XI. Blood 90:1055, 1997
26. Chomczynski P, Sacchi N: Single-step method of RNA isolation
by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal
Biochem 162:156, 1987
27. Hillier L, Green P: OSP: A computer program for choosing PCR
and DNA sequencing primers. PCR Methods Appl 1:124, 1991
28. Asakai R, Davie E, Chung D: Organization of the gene for
human factor XI. Biochemistry 26:7221, 1987
29. Frachet P, Uzan G, Thevenon D, Denarier E, Prandini M,
Marguerie G: GP IIb and GP IIIa amino acid sequences deduced from
human megakaryocyte cDNAs. Mol Biol Rep 14:27, 1990
30. Kishimoto T, O’Connor K, Lee A, Roberts T, Springer T:
Cloning of the beta subunit of the leukocyte adhesion proteins:
Homology to an extracellular matrix receptor defines a novel supergene
family. Cell 48:681, 1987
31. Martincic D, Zimmerman S, Ware R, Sun M, Whitlock J, Gailani
D: Identification of mutations and polymorphisms in the factor XI genes
of an African-American family by dideoxy fingerprinting. Blood
92:3309, 1998
32. Bennet JS, Poncz M: Platelet glycoproteins IIb and IIIa, in High
K, Roberts H (eds): Molecular Basis of Thrombosis and Hemostasis.
New York, NY, Dekker, 1995, p 579
33. Rosenthal R, Dreskin O, Rosenthal N: New hemophilia-like
disease caused by deficiency of a third plasma thromboplastin factor.
Proc Soc Exp Biol Med 82:171, 1953
34. Seligsohn U: High gene frequency of factor XI (PTA) deficiency
in Ashkenazi Jews. Blood 51:1223, 1978
35. Niewiarowski S, Holt J, Cook J: Biochemistry and physiology of
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3404
secreted platelet proteins, in Colman R, Hirsh J, Marder V, Salzman E
(eds): Hemostasis and Thrombosis: Basic Principles and Clinical
Practice (ed 3). Philadelphia, PA, Lippincott, 1994, p 546
36. Ginsberg D, Konkle B, Gill J, Montgomery R, Bockenstedt P,
Johnson T, Yang A: Molecular basis of human von Willebrand disease:
Analysis of platelet von Willebrand factor mRNA. Proc Natl Acad Sci
USA 86:3723, 1989
37. Poon M, JA R, Low S, Sinclair G, Jones A, Blahey W, Ruether B,
Hoar D: Hemopoietic origin of factor XIII A subunits in platelets,
monocytes, and plasma. J Clin Invest 84:787, 1989
38. Handgama P, Rappolee P, Werb Z, Levin J, Bainton D: Platelet
alpha granule fibrinogen, albumin, and immunoglobulin G are not synthesized by rat or mouse megakaryocytes. J Clin Invest 86:1364, 1990
39. Walsh P: Albumin density gradient separation and washing of
platelets and the study of platelet coagulant activities. Br J Haematol
22:205, 1972
MARTINCIC, KRAVTSOV, AND GAILANI
40. Connellan J, Muntz R, Castaldi P: Factor XI in the coagulant
activity of platelets. Haemostasis 6:41, 1977
41. Schiffman S, Rapaport S, Chong M: Platelets and initiation of
intrinsic clotting. Br J Haematol 24:633, 1973
42. Schiffman S, Rimon A, Rapaport S: Factor XI and platelets:
Evidence that platelets contain only minimal factor XI activity and
antigen. Br J Haematol 35:429, 1977
43. Osterud B, Harper E, Rapaport S, Lavine K: Evidence against
collagen activation of platelet-associated factor XI as a mechanism for
initiating intrinsic clotting. Scand J Haematol 22:205, 1979
44. Hu C, Baglia F, Mills D, Konkle B, Walsh P: Tissue-specific
expression of functional platelet factor XI is independent of plasma
factor XI expression. Blood 91:3800, 1998
45. Meijers J, Davie E, Chung D: Expression of human blood
coagulation factor XI: Characterization of the defect in factor XI type
III deficiency. Blood 79:1435, 1992
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
1999 94: 3397-3404
Factor XI Messenger RNA in Human Platelets
Danko Martincic, Vladimir Kravtsov and David Gailani
Updated information and services can be found at:
http://www.bloodjournal.org/content/94/10/3397.full.html
Articles on similar topics can be found in the following Blood collections
Hemostasis, Thrombosis, and Vascular Biology (2485 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.