846
Research Article
Silencing of the hydra serine protease inhibitor Kazal1
gene mimics the human SPINK1 pancreatic phenotype
Simona Chera*, Renaud de Rosa*,‡, Marijana Miljkovic-Licina, Kevin Dobretz, Luiza Ghila, Kostas Kaloulis§
and Brigitte Galliot¶
Department of Zoology and Animal Biology, University of Geneva, Sciences III, 30 Quai Ernest Ansermet, CH-1211 Geneva 4, Switzerland
*These authors contributed equally to this work
‡
Present address: ENS, 46 rue d’Ulm, 75005 Paris, France
§
Present address: APOXIS S.A., 18-20 Avenue de Sévelin, CH-1004 Lausanne, Switzerland
¶
Author for correspondence (e-mail: [email protected])
Journal of Cell Science
Accepted 23 November 2005
Journal of Cell Science 119, 846-857 Published by The Company of Biologists 2006
doi:10.1242/jcs.02807
Summary
In hydra, the endodermal epithelial cells carry out the
digestive function together with the gland cells that
produce zymogens and express the evolutionarily
conserved gene Kazal1. To assess the hydra Kazal1 function,
we silenced gene expression through double-stranded RNA
feeding. A progressive Kazal1 silencing affected
homeostatic conditions as evidenced by the low budding
rate and the induced animal death. Concomitantly, a
dramatic disorganization followed by a massive death of
gland cells was observed, whereas the cytoplasm of
digestive cells became highly vacuolated. The presence of
mitochondria and late endosomes within those vacuoles
assigned them as autophagosomes. The enhanced Kazal1
expression in regenerating tips was strongly diminished in
Kazal1(–) hydra, and the amputation stress led to an
immediate disorganization of the gland cells, vacuolization
Introduction
Owing to its position as sister group to bilaterians, Cnidaria
provides us with crucial information on bilaterian history.
Cnidarians, although lacking true organs, share with bilaterians
a tissue organization, an embryonic development that traverses
gastrulation (Bouillon, 1994), a behaviour controlled by a
neuromuscular system (Westfall, 1996; Seipel and Schmid,
2005) and a large number of evolutionarily-conserved genes
similarly involved in cell differentiation and/or developmental
tasks (Galliot, 2000; Steele, 2002; Kusserow et al., 2005).
Hydra is organized along a single oral-aboral axis that is
divided into three parts: the foot region, the body column
corresponding to the gastric cavity, and the apical head region
with the mouth opening surrounded by a ring of tentacles. The
two cell layers, ectoderm and endoderm, separated by the
extracellular mesoglea, comprise epithelial cells and interstitial
cells, from which neurons, nematocytes (stinging cells) and
gland cells derive. Gland cells produce zymogens that are
released in the gastric cavity and as such resemble pancreatic
cells in vertebrates (Lentz, 1966).
Metalloproteinases are highly conserved multifunctional
enzymes, involved in morphogenetic as well as digestive
processes in cnidarians (Pan et al., 1998; Sarras et al., 2002).
In bilaterians, protease inhibitors restrict their activity
according to a tight balance that prevents cellular defects as
autodigestion (Witt et al., 2000), abnormal cell migration and
of the digestive cells and death after prolonged silencing.
This first cellular phenotype resulting from a gene knockdown in cnidarians suggests that the Kazal1 serineprotease-inhibitor activity is required to prevent excessive
autophagy in intact hydra and to exert a cytoprotective
function to survive the amputation stress. Interestingly,
these functions parallel the pancreatic autophagy
phenotype observed upon mutation within the Kazal
domain of the SPINK1 and SPINK3 genes in human and
mice, respectively.
Supplementary material available online at
http://jcs.biologists.org/cgi/content/full/119/05/846/DC1
Key words: Kazal domain, SPINK1/SPINK3 serine protease
inhibitor, Autophagy, Autophagosome, RNA interference, Evolution
metastasis. Related protease inhibitors were identified in
cnidarians (Tschesche et al., 1987; Holstein et al., 1992; Yang
et al., 2003). Amongst those, the sea anemone elastase inhibitor
and the hydra antistatin act as serine protease inhibitors, the
former one encoding a Kazal domain (KD), initially
characterized in pancreatic tissue as trypsin inhibitor
(Rawlings et al., 2004). KDs are 40 to 60 amino acids (aa) long
and contain six cystein residues that form disulfide bridges;
their protease inhibitor activity was documented in vertebrates
(Kazal et al., 1948), blood-sucking insects (Mende et al.,
1999), animal parasites as inhibitors of host digestive enzymes
(Morris et al., 2002) and plant parasites (Tian et al., 2004). We
isolated the hydra gene Kazal1, which encodes three KDs and
exhibits a high level of expression in gland cells. To see
whether such a protease inhibitor in cnidarians elicits an effect
related to those known in vertebrates, we tested this gene for
its implication in protease inhibition by using double-stranded
RNA interference (dsRNAi).
dsRNAi has proved to be a powerful tool, both to look at
gene function and to implement systematic functional screens
in contexts not amenable to other genetic approaches (Novina
and Sharp, 2004). It was applied to hydra using electroporation
as a delivery route (Lohmann et al., 1999). Although this
method led to major side effects as tissue necrosis and lethality,
it highlighted the function of several genes in head regeneration
(Lohmann and Bosch, 2000; Smith et al., 2000; Cardenas and
Autophagy in Kazal1-knock-down hydra
Journal of Cell Science
Salgado, 2003). However, patterning events such as
maintenance, budding and sexual development, take place
continuously in hydra and cannot be induced at a precise time.
Therefore, we developed a milder strategy for dsRNAi that
allows repeated treatments of Hydra vulgaris (Hv) and H.
magnipapillata (Hm) through feeding, a strategy that provides
a stepwise and efficient gene-silencing effect. The delivery of
dsRNAs by feeding the animal on dsRNA-producing bacteria
was originally described in C. elegans (Timmons et al., 2001).
As hydra does not spontaneously feed on bacteria, we adapted
the solution set up in planarians, where bacteria are embedded
into agarose as part of an artificial food mix (Newmark et al.,
2003). We report here, that knocking down the hydra Kazal1
gene induces a phenotype surprisingly related to that obtained
in similar conditions in mammals (Witt et al., 2000; Drenth et
al., 2002; Ohmuraya et al., 2005), whereby gland cells and
endodermal epithelial cells die through autodigestion, probably
as a result from the lack of protection against digestive
enzymes.
Results
The hydra Kazal1 gene belongs to the serine protease
inhibitor Kazal family and is expressed in endodermal
gland cells
Initially, a 486-bp-long Hv cDNA (Kazal1-486) was isolated,
which encodes three KDs but lacks the 5⬘ end. Subsequently,
two sequence tags (ESTs; ace_0078.y, ace_0064.y) expressed
in H. magnipapillata and showing a perfect match with
Kazal1-486 were obtained, thus allowed us to extend the Hv
cDNA up to 569 bp (Fig. 1A, supplementary material Fig. S1).
These cDNAs from two distinct hydra species comprise a
single identical open reading frame, 504 bp long, leading to a
168 aa full-length putative translation product. The KD motifs
are highly related to those found either in bilaterian serine
protease inhibitors or in proteins like follistatin and agrin (Fig.
1B, supplementary material Fig. S2 and Table S1). In addition,
we identified a signal peptide (probability, 0.998) with a
cleavage site located between residues 16 and 17 (probability,
0.983), indicating that the Kazal1 protein is probably secreted.
In adult hydra, Kazal1 expression was restricted to the
endodermal cell layer of the body column (Fig. 2A-C). In
addition, the Kazal1-expressing cells exhibited the typical
Fig. 1. Structure and sequence of
the hydra Kazal1 protein.
(A) Schematic view of the Kazal1
cDNAs and the deduced Kazal1
protein structure. The gray box
highlights the divergent non-coding
5⬘ sequences of H. magnipapillata.
(B) Alignment of Kazal1 to selected
KD-containing sequences. The
signal peptide is underlined and the
cleavage site indicated by an
inverted triangle.
847
morphology of gland cells, with a multi-vacuolated cytoplasm
corresponding to large secretory vacuoles (Fig. 2D-G, arrows).
Those cells that are in direct contact with nutrients provide the
proteolytic enzymes required for their digestion (Lentz, 1966).
Similarly the hydra antistatin protease-inhibitor is expressed in
gland cells (Holstein et al., 1992). Owing to its highly similar
structure to protein inhibitors and its cellular localization, we
speculated that Kazal1 might exhibit some protease inhibitory
function such as to prevent the premature activation of
digestive enzymes. Since Kazal1-expressing cells are
immediately accessible to dsRNA when delivered by feeding,
we established a feeding strategy to silence this gene through
dsRNAi.
Ingestion of bacterially expressed dsRNAs is a harmless
procedure in hydra
Hydra is a predator, feeding only on live, mobile animal preys
and not on bacteria, we therefore adapted the solution used in
planarians (Newmark et al., 2003). We converted bacteria to a
sizeable food chunk by embedding them in agarose as part of
an artificial food mix but, in addition, we added glutathione to
the medium to trigger the hydra feeding-response, i.e. the
mouth opening and the synchronized movements of the
tentacles towards the mouth (Loomis, 1955). Finally, because
hydra medium has extremely weak buffering capacities, we
increased the buffer concentration to compensate, at least
partially, the bacteria-induced acidity that prevented hydra
from eating (Fig. 3A). This artificial food mix could actually
be offered to hydra repeatedly over long periods without the
appearance of unwanted toxic effects; populations treated over
a month remained stable (Fig. 3B). Unc-22 dsRNA-treated
control animals displayed a significant reduction of their size
within the first two weeks of treatment, probably due to the
change in diet. In fact, control hydra that were kept in the same
conditions but were not exposed to agarose, showed a similar
decrease in size (Fig. 3C).
We noticed rare cases (<1%) of heteromorphosis as doubleheaded or double-footed hydra (not shown), which were
similar whatever the type of dsRNA treatment, thus
corresponding to non-specific effects linked to the feeding
strategy. Finally, no significant variation in the headregenerative abilities of hydra exposed once, three times, eight
Journal of Cell Science
848
Journal of Cell Science 119 (5)
Fig. 2. Kazal1 is expressed in gland
cells of intact H. vulgaris.
(A-G) Kazal1-expressing cells were
detected after whole-mount in situ
hybridization with Fast-Red either in
fluorescence (A-C,F,G, red) or in
bright-fields conditions (A,C). To
highlight the regions and the cells that
do not express Kazal1, hydra were
subsequently immunodetected with
anti-␣-tubulin (B,E, green). Arrows
indicate the lower (A) and the upper
(B) limits of the Kazal1 expression
domain along the body column. In C,
a closer view of the body column
region shows that Kazal1-expressing
cells are restricted to the endodermal
layer. end, endoderm; ect, ectoderm;
mes, mesoglea. (D-G) Confocal views
of the endodermal layer. Kazal1expressing cells contain secretory
vacuoles (arrows) characteristic of
gland cells. The star indicates the
nucleus of a gland cell that does not
express Kazal1. Bars, 150 ␮m (A,B),
40 ␮m (C), 16 ␮m (D-G).
times or 19 times to the unc-22 dsRNA-bacteria-agarose
mixture were noticed (Fig. 3D). Therefore, this treatment per
se does not seem to affect the regeneration process.
The feeding strategy leads to a progressive and
complete Kazal1 silencing
Few feedings were required to obtain an efficient silencing of
the Kazal1 gene in H. vulgaris because after three feedings, a
noticeable difference was already seen between the hydra
receiving Kazal1 dsRNAs and those exposed to the control
unc-22 dsRNAs (Fig. 4A,B). After five feedings, Kazal1expressing cells were no longer detected in the former, whereas
Kazal1 expression was not affected in the latter. When we
examined the Kazal1-expressing cells under fluorescence
microscope, few residual Kazal1-positive cells were
nevertheless detected in the peduncle region, i.e. the lower part
of the body column (Fig. 4C-E). Confocal imaging confirmed
that the level of Kazal1 expression in gland cells of Kazal1(–)
hydra was either slightly residual or not detectable (Fig. 4H,I).
This silencing was specific as evidenced in Kazal1(–) hydra
by the unaltered expression of thrombospondin 1 (Tsp1, Fig.
4F,G), a gene normally expressed in the hypostome region
(Miljkovic-Licina et al., 2004), or cnox2, a gene expressed in
the neuronal cell lineages (M.M.-L., unpublished data). To test
the duration of the feeding-induced RNAi, we treated hydra six
times with Kazal1 dsRNAs, and then left them to recover with
normal feeding. Hydra remained completely devoid of Kazal1
transcripts for at least nine days after the last RNAi feeding
Fig. 3. The dsRNAi feeding strategy
in hydra. (A) Scheme describing the
production of dsRNAs in bacteria and
the feeding of hydra with the bacteriaagarose mix. (B) Evolution of the size
of the H. vulgaris populations
exposed three times a week to unc-22
dsRNAs over 5 weeks; s.d. values
correspond to four populations (50
hydra at t0) followed in two distinct
experiments. (C) Variations in hydra
body length over the first 2 weeks of
unc-22 dsRNA treatment. The values
correspond to the percentages of the
animal lengths at each time point over
their size at t0; s.d. values correspond
to ten hydra. (D) Appearance of
tentacle rudiments in headregenerating halves exposed either
1⫻, 3⫻, 8⫻ or 19⫻ to unc-22
dsRNAs (15 hydra per condition).
Journal of Cell Science
Autophagy in Kazal1-knock-down hydra
849
Fig. 4. Silencing of the Kazal1 gene
in intact adult H. vulgaris.
(A-E,H,I) Kazal1 expression was
detected after whole-mount in situ
hybridization with (A,B) NBT-BCIP
and (C-E,H,I) Fast-Red. A decrease in
the level of Kazal1 expression was
observed after 2 to 5 exposures to
Kazal1 dsRNA (A,C,D), but not in
hydra treated with (B) unc22 dsRNA
or (E) agarose. (F,G) Tsp1 expression
was not altered in hydra exposed 5⫻
to Kazal1 dsRNA (upper) when
compared to untreated animals
(lower). Confocal views showing the
residual or undetectable level of
Kazal1 expression in gland cells of
hydra exposed 5⫻ to Kazal1 dsRNA
(I) when compared to control hydra
treated with agarose (H). DAPI
staining (blue), ␣-tubulin staining
(green). Bars: 150 ␮m (C-E,F), 4 ␮m
(H,I).
(not shown). This value might, nevertheless, differ from one
gene to another.
Kazal1 silencing affects the budding rate and is lethal
To analyze the fitness of Kazal1(–) hydra, we performed three
distinct silencing experiments (RNAi-a, RNAi-b and RNAi-c)
where 100, 60 and 65 H. magnipapillata respectively, were fed
with bacteria producing either Kazal1 or empty vector dsRNA.
When we compared the size of the Kazal1(–) hydra population
to that of the control, we noticed a progressive but drastic
decrease in the number of the Kazal1-treated hydra following
the second dsRNAs exposure (Fig. 5A). After the fifth (RNAib and RNAi-c) and seventh time (RNAi-a) of exposure, the
Kazal1(–) population size was approximately 60% that of the
control. This evolution was affected by two distinct processes,
first the budding process that produced new hydra during the
Fig. 5. Survival and budding rates of Kazal1(–) H. magnipapillata.
(A) Sizes of the hydra populations exposed to Kazal1 dsRNAi. After
each feeding hydra were counted and the percentage of Kazal1silenced hydra over the control population exposed to the empty
vector dsRNA was calculated. Each curve corresponds to a different
experiment; 100, 65 and 60 hydra were initially taken for RNAi-a,
RNAi-b and RNAi-c, respectively. (B) Budding rates observed in
Kazal1(–) and control hydra populations in (a) RNAi-a, (b) RNAi-b
and (c) RNAi-c experiments. The budding rate corresponds to the
ratio between the number of new hydra produced by budding over
the total number of hydra. Dark bars, control hydra; light bars,
Kazal1(–) hydra. (C) Duplication of the peduncle and basal region
observed in two different Kazal1(–) hydra after three feedings
(RNAi-b).
first week and, second, the death rate of the animals noticed
from the second week onwards. When we compared the
different budding rates, i.e. the percentages of new animals
produced upon budding in each experiment (Fig. 5B), we
observed that the budding rate was significantly lower in
Kazal1(–) hydra, i.e. 2.1, 3.6 and 3.3 times lower than in
control hydra in RNAi-a, RNAi-b and RNAi-c experiments
respectively. Although the budding rates were initially quite
850
Journal of Cell Science 119 (5)
Journal of Cell Science
similar in Kazal1-treated and control populations, budding
rapidly dropped after two days in Kazal1-treated populations,
disappearing completely after either three (RNAi-b, -c) or four
(RNAi-a) exposures. In control populations, however, budding
was still going on after the fourth (RNAi-b, RNAi-c) and fifth
(RNAi-a) feeding. Hence, the budding process was more
intense and more prolonged in control hydra. In addition, the
total number of Kazal1(–) hydra progressively decreased
indicating that animals were dying, a process not observed in
control populations. Therefore, Kazal1-silencing affects both,
budding rate and animal survival. Since RNAi-a was prolonged
to up to nine exposures with dsRNAs (20 days) and RNAi-b,c
to up to seven exposures (15 days), we searched for possible
morphological anomalies in Kazal1(–) hydra. Over this period
(15-20 days), 11% Kazal1(–) hydra exhibited anomalies
restricted to the peduncle and foot regions before dying during
the following days (Fig. 5C). Those mutant animals displayed
a very similar ‘clamp’-shape of their basal region, as if this
region was undergoing duplication. This phenomenon started
to appear after the third exposure in RNAi-b and RNAi-c but
was not observed in the control populations.
Cellular disorganization of the gland cells in intact
Kazal1(–) hydra
To analyze the cellular phenotype linked to Kazal1(–)
silencing, we macerated some animals the day after each
dsRNA exposure and performed immunocytochemistry with
antibodies against ribosomal S6 kinase (RSK) and ␣–tubulin.
In all cell types, staining for RSK was strong in the cytoplasm
and uncovered the organization of the organelles (Chera et al.,
2006). Among the various cell types, we did not detect any
morphological modifications of the interstitial cells and their
neuronal and nematocyte derivatives in Kazal1(–) hydra (data
not shown). By contrast, when we analyzed the gland cells, we
noticed a clear decrease in size until they eventually
disappeared. When, very rarely, cells did survive a total of
seven Kazal1(–) dsRNAs exposures, they exhibited fused
vacuoles (Fig. 6A,B). In fact, we noted a progressively altered
morphology of those Kazal1(–) gland cells: the cell outlines
were often irregular showing notches, the nucleus was
frequently no longer in its basal position, the graded
distribution of the vacuoles along the cellular apico-basal axis
(Lentz, 1966) was lost, while the vacuoles got progressively
enlarged until they fused, forming huge vacuoles (Fig. 6A,D).
The gland cells from control animals did not show any of those
changes (Fig. 6B,C). To track cytoplasmic organelles in
Kazal1(–) cells, we labeled those gland cells with anti-LBPA
antibody, a specific marker of late endosomes (Kobayashi et
al., 1998), and the mitotracker dye MitoFluor Red 589, which
accumulates in mitochondria of live and fixed cells (Molecular
Probes). We observed numerous cellular defects, like fusion of
secretory vacuoles (Fig. 6Fa,c arrows) and detachment of
cytoplasmic parts from the apical pole as well as from the basal
pole (Fig. 6Fb,c, arrowheads). In the latter case, those
cytoplasmic parts occasionally contained mitochondria and
could be as large as the apical moiety of the cell (Fig. 6Fd).
However, nuclear fragmentation, which is a typical feature of
apoptosis, was never detected. In hydra, gland cells
differentiate from large dividing interstitial cells (Schmidt and
David, 1986; Bode et al., 1987) and those cells were not
affected when Kazal1(–) was silenced. Therefore, to quantify
cell death of the gland cell population in Kazal1(–) hydra, we
measured the percentage of gland cells over dividing interstitial
cells in control and Kazal1(–) hydra at various time points in
RNAi-a, RNAi-b and RNAi-c experiments (Fig. 6G). This ratio
was stable in control hydra, varying between 90% to 100%. By
contrast, it dropped drastically in Kazal1(–) hydra, down to
17% after the seventh exposure in RNAi-a, to 9% and 0% after
the fifth exposure in RNAi-b and RNAi-c. Thus, we concluded
that in the absence of Kazal1 expression, gland cells can
neither differentiate nor survive. As previously noticed in the
analysis of the population sizes and budding rates of Kazal1(–)
hydra, the cellular phenotype was stronger in experiments
RNAi-b and RNAi-c than in RNAi-a. In RNAi-a, the number
of treated animals was larger suggesting that, animals were less
homogenously exposed to the agarose-bacteria mixture and,
Fig. 6. Cellular disorganization of
gland cells in Kazal1(–) intact hydra.
(A-F) Confocal images of H.
magnipapillata gland cells exposed up
to 7⫻ either to (A,D,F) Kazal1 or to
(B,C,E) empty vector dsRNAs,
subsequently immunodetected with
(A,B) anti-RSK, (C,D) anti-␣–tubulin,
(E,F) 6C4 anti-LBPA antibodies
(green) and stained with (E,F) Hoechst
33342 dye (blue) and the mitotracker
dye MitoFluor Red 589.
(F) Anomalies from four distinct gland
cells; arrows indicate fused vacuoles,
arrowheads cytoplasmic portions that
are expelled from the cell. Bars,
10 ␮m (A-D), 5 ␮m (E,F).
(G) Evolution of the gland-cell index
over the course of three independent RNAi experiments (RNAi-a, -b, -c). For each condition, the percentage of gland cells over doublets of
dividing interstitial cells was measured in control and Kazal1(–) hydra. This percentage was stable in control hydra with a 90% to 100% value.
Autophagy in Kazal1-knock-down hydra
consequently, the Kazal1 gene was less efficiently silenced in
these conditions.
Journal of Cell Science
Cellular disorganization of the digestive cells in intact
Kazal1(–) hydra
Interestingly, we also noticed in Kazal1(–) hydra
morphological alterations of the endodermal myoepithelial
cells (also named digestive cells) (Fig. 7). Hydra digestive cells
normally contain numerous digestive vacuoles that are
predominantly located at the apical pole (Lentz, 1966). In both,
Kazal1(–) and control hydra, digestive vacuoles detected with
anti-RSK antibody were present until the fourth feeding and
vanished at the subsequent stages (Fig. 7A,B, arrowheads).
Fig. 7. Cellular disorganization of
digestive cells in Kazal1(–) intact
hydra. (A-G) Endodermal epithelial
cells from H. magnipapillata
(A,B,G) and H. vulgaris (C-F)
exposed up to 7⫻ either to
(A,C,D,G) Kazal1 or to (B,E,F)
empty vector dsRNAs, subsequently
immunodetected with either the
(A,B) anti-RSK, or the anti-␣tubulin (C-G) antibodies (green).
Stars indicate phagosomes,
arrowheads digestive vacuoles
mostly abundant at the apical pole,
arrows point to the unusual vacuoles
that appear after 4⫻ exposures to
Kazal1 dsRNAs. (G) Two different
confocal sections of a highly
disorganized digestive cell that
exhibits a giant vacuole (arrow), nu:
nucleus. (H) Ectodermal epithelial
cells of H. vulgaris exposed up to
5⫻ either to Kazal1 dsRNAs
immunodetected with the anti-␣tubulin antibody (green). Bars, 8
␮m. (I,J) Endodermal epithelial cells
from H. magnipapillata exposed 4⫻
either to Kazal1 (J) or to the empty
vector (I) dsRNAs, labeled with the
late-endosome marker anti-LBPA
antibody (green) and a mitotracker
MitoFluor Red 589 (red). Arrows
indicate mitochondria that are either
(I,Ja) cytoplasmic or (Jb-j) intravacuolic; arrowheads show the
disruption of the cellular basal pole
in c, two vacuoles that undergo
fusion in h. Bars, 10 ␮m (I, Jac,e,h,j); 2 ␮m in (Jd,f,g,i). In every
panel, the cellular basal pole is at the
top and nuclei were counterstained
with Hoechst 33342 dye (blue).
851
However, from the third feeding onwards, we recorded in
Kazal1-treated hydra, but not in control hydra, an increasing
number of digestive cells that displayed large vacuoles (Fig.
7A,C,D,G,J arrows). In addition, from the fourth feeding, the
basal pole of the Kazal1(–) digestive cells often detached,
whereas the cell size drastically decreased (Fig. 7A,C). After
seven Kazal1 dsRNA exposures, very few of those cells were
actually able to support the maceration procedure and we
observed mostly debris. Except gland cells, these alterations
were not detected in any other cell types, including ectodermal
epithelial cells (Fig. 7H). Concomitantly, we observed a
progressive loss of the cytoplasmic organization, the tubulin
network appearing more and more disorganized in cells where
Journal of Cell Science
852
Journal of Cell Science 119 (5)
either numerous or giant vacuoles were progressively
occupying the cytoplasmic space (Fig. 7C,D,G).
However, like in gland cells, these vacuoles started to form
without any sign of apoptosis or necrosis. Therefore, we
suspected some autophagy process, whereby cytoplasmic
organelles are sequestered in double-membrane vacuoles, the
autophagosomes, which upon fusion with a late endosome will
form an autolysosome, where degradation of the sequestered
material will take place (Klionsky, 2005). To test whether those
vacuoles were indeed containing cytoplasmic organelles, we
performed a double labeling with the late endososome
membrane marker 6C4 (Kobayashi et al., 1998) and a
mitotracker dye MitoFluor Red 589 on cells isolated after four
dsRNAs exposures. We noticed that most digestive cells from
control hydra displayed a regular cytoplasmic distribution of
mitochondria (Fig. 7I), some of them showing also few vacuoles
that contained mitochondria (not shown). In Kazal1(–) hydra,
by contrast, we detected very few digestive cells with clearly
distinct cytoplasmic mitochondria (Fig. 7Ja,b), whereas in most
cells the numerous vacuoles contained mitochondria that colocalized with the membrane marker of late endosomes (Fig.
7Jc-j, arrows). As previously noticed, many cells were loosing
their basal moiety (Fig. 7Jc), whereas fusion of vacuoles was
seen in others (Fig. 7Jh). The sum of these defects produced
highly abnormal Kazal1(–) digestive cells that were very small
in size and had no distinct cytoplasmic mitochondria but giant
vacuoles (Fig. 7Jj). The presence of mitochondria, together with
late endosomes in those numerous vacuoles indicated that they
indeed contained cytoplasmic organelles and probably fused
with lysozomes. Thus, these vacuoles, which we identified as
autolysosomes, are the hallmark of a massive autophagy
process. Hence, the depletion in the Kazal1 protease inhibitor,
which is produced and secreted by the gland cells, also led to
deleterious effects within the immediately surrounding cells, i.e.
the digestive cells.
Kazal1 silencing does not affect kinetics of head
regeneration
We then investigated, whether similar cellular modifications
were also taking place in regenerating Kazal1(–) hydra. We
first observed the modulations of Kazal1 expression after midgastric section: in wild-type hydra, we noticed an early
decrease in the level of Kazal1 expression along the body
column, but not in the regenerating stumps where the density
of Kazal-1-expressing cells remained high at the early and
early-late stages of regeneration (Fig. 8A-C). A similar
regulation was observed in control RNAi hydra (Fig. 8D and
data not shown). By contrast, those animals exposed several
times to Kazal1 dsRNAs exhibited complete silencing in the
body column and a residual expression in the regenerating
stumps as noticed after six feedings (Fig. 8E). Interestingly,
intact hydra exposed to Kazal1 dsRNAs in the same
experiment showed a complete silencing already after four
feedings (Fig. 8F) suggesting that, silencing through RNA
interference is indeed more efficient in the body column than
in the regenerating tips. When head regeneration was tested in
H. magnipapillata exposed up to five times to Kazal1 dsRNAs,
tentacle rudiments started to appear without any delay (Fig. 8G
and data not shown). However, a larger number of exposures
to Kazal1 dsRNAs led to significant differences between the
silenced and the control populations (Fig. 8H). After the
seventh exposure, the appearance of tentacle rudiments was
slightly delayed although the head regenerated normally. After
the ninth exposure none of the silenced hydra regenerated
because the bisection actually led to their death within the next
20 hours. These results indicate that, silencing Kazal1
expression in the body column and the regenerating stumps
does not affect the head-formation process per se but rather the
conditions that are necessary to survive the amputation stress.
In fact, when silencing was maintained over a long period, the
stress of the amputation became lethal.
Fig. 8. Kazal1 silencing in
regenerating hydra. (A-C) Kazal1
expression in wild-type
regenerating hydra fixed 4, 6 and 30
hours after mid-gastric section.
Notice the strong level of
expression in the endodermal cells
of the (A,B, arrowheads) footregenerating tips and (A,B,C,
arrows) head-regenerating tips.
(D,E) Kazal1 expression in H.
magnipapillata having regenerated
4 hours is similar to the wild-type
pattern in control hydra exposed
6⫻ to (D) empty vector but
strongly silenced after 6⫻
exposures to (E) Kazal1 dsRNAs.
The arrow and arrowhead indicate
the residual expression in head- and
foot-regenerating tips, respectively.
(F) In intact hydra 4⫻ exposures to
Kazal1 dsRNAs (right) suffice to
completely silence Kazal1
expression when compared with the
control hydra exposed to empty vector (left). Bars, 150 ␮m. (G) Kinetics of tentacle rudiments appearance were similar in regenerating
H. magnipapillata exposed 3⫻ to unc-22 (䊐) or to Kazal1 (䉬) dsRNAs. (H) Appearance of tentacle rudiments recorded 42 hours (left) and 44
hours (right) after mid-gastric section of hydra exposed up to 9⫻ either to empty vector (䊐) or to the Kazal1 (䉬) dsRNAs.
Journal of Cell Science
Autophagy in Kazal1-knock-down hydra
Enhancement of the vacuolization phenotype in
Kazal1(–) head-regenerating tips
To analyze the morphology of the Kazal1(–) cells located in the
regenerating tips, we bisected hydra after three exposures to
Kazal1 dsRNAs, and sliced-out the regenerating tips one or four
hours later to provide single cell preparations subsequently
submitted to anti-hyCREB and anti-RSK immunocytochemistry
(Fig. 9A,B). The anti-hyCREB antibody provides a strong and
specific nuclear signal in most hydra cell types, i.e. epithelial
cells, neurons, interstitial cells and a cytoplasmic signal in gland
cells and dividing nematoblasts (Chera et al., 2006). Moreover,
the CREB protein becomes transiently cytoplasmic and its level
is dramatically enhanced in stress conditions, such as
immediately after amputation (S.C., unpublished observation).
In Kazal1(–) hydra, the morphology of the ectodermal epithelial
cells, interstitial cells, neurons and nematoblasts, prepared from
either head- or foot-regenerating tips, was not altered when
compared with control hydra (Fig. 9A and data not shown). By
contrast, only a very small number of gland cells was found in
macerations of regenerating Kazal1(–) hydra. They all exhibited
the usual enhanced cytoplasmic CREB staining at that stage of
regeneration, large vacuoles and also a cellular disorganization
similar to that observed in intact Kazal1(–) hydra after five
exposures (compare Fig. 9Ad,i,n with Fig. 6D).
In addition, we noticed that a large number of Kazal1(–)
digestive cells prepared from both head- and foot-regenerating
tips contained large cytoplasmic vacuoles and showed an
enhanced CREB cytoplasmic staining (Fig. 9Aa,f,k, arrows). We
Fig. 9. The Kazal1(–) cellular
phenotype is enhanced after
amputation. (A,B) Confocal images
of cells isolated from (a-j) headregenerating tips (HR) and (k-o)
foot-regenerating tips (FR) of H.
vulgaris, 1 hour after bisection
following 3 exposures to (a-e) empty
vector or (f-o) Kazal1 dsRNAs. Cells
were stained with Hoechst 33342 dye
(blue) and immunodetected with the
anti-hyCREB (red), anti-RSK (green)
antibodies. Bars, 16 ␮m. (B) Staging
of the Kazal1(–) endodermal
phenotype. Stage (st.) 0, normal,
elongated shape, basal nucleus,
homogenous RSK-staining; st.1,
perinuclear vacuolization; st. 2,
multiple non-confluent cytoplasmic
vacuoles; st. 3, confluent vacuoles
occupying most of the cytoplasm.
Small digestive vacuoles that provide
false red staining (star) were
occasionally noted. (C) Frequencies
of the respective phenotypes in
control and Kazal1(–) hydra during
head- and foot-regeneration. For each
condition at least 300 endodermal
epithelial cells were counted.
853
identified three progressive stages in this Kazal1(–) phenotype of
digestive cells (Fig. 9B), starting from stage 0, which corresponds
to normal endodermal epithelial cells. At stage 1, one or several
large vacuoles were present in the vicinity of the nucleus. At stage
2, additional vacuoles were dispersed in the cytoplasm, whereas
at stage 3 those vacuoles were fused, occupying most of the
cytoplasmic space. Over 98% of the digestive cells isolated from
control hydra looked normal (like in stage 0) at both times of
regeneration (Fig. 9C and supplementary material Table S2).
However, as anticipated, Kazal1(–) cells isolated from headregenerating tips were strongly affected, to a much larger extent
than those prepared from foot-regenerating tips. One hour after
bisection, stages 2 plus 3 were the most frequent with over 60%
and 11%, respectively. In both contexts, these alterations were
transiently observed, as 4 hours after bisection, only 18% and 3%
of the cells from head- and foot-regenerating tips, respectively,
were still strongly affected (stages 2 plus 3). Therefore, silencing
of the Kazal1 gene induced drastic cellular alterations in
regenerating tips, a phenotype that is dramatically enhanced upon
amputation stress when compared with intact Kazal1(–) hydra,
and far more severe in head- than in foot-regenerating tips.
Discussion
Ingestion of bacterially-expressed dsRNAs leads to a
progressive, efficient and reversible gene silencing in
hydra
We show here, that repeated feedings with dsRNA-producing
bacteria specifically and efficiently suppresses gene expression
Journal of Cell Science
854
Journal of Cell Science 119 (5)
in hydra below the in situ hybridization detection limit. In case
of the Kazal1 gene, five feedings seemed to be necessary in H.
magnipapillata, although three were sufficient in H. vulgaris
to detect the cellular phenotype. In addition to species
sensitivity, efficiency of the RNAi procedure is probably linked
to the size of the initial animal population, as evidenced by the
difference in the respective intensities of the phenotypes
observed in RNAi-a versus RNAi-b-c experiments. In fact,
repeated feedings were required to obtain the phenotype
described here, but single or only few feedings can suffice to
generate phenotypes with more critical genes (S.C.,
unpublished data) and, indeed, incremental numbers of
feedings can be used to generate pseudo-‘allelic series’. We
also noticed that Kazal1 expression was more robust in
regenerating tips than in the body column, implying that
specific spatio-temporal regulations probably modulate the
sensitivity to silencing through RNAi.
Although this novel method was designed to damage hydra
as little as possible, it is not completely harmless. For each
RNAi treatment hydra have to stay for 1 hour in an
hyperosmotic environment and are submitted to additional
washes over the normal culture procedure, which can lead to
the loss of the weakest hydra. We, nonetheless, did not notice
any dissociation event or bacterial infection. Agarose sieving
should be fine because hydra that ingest a too large piece of
agarose cannot spit it out the following days, become unable
to eat artemia and eventually die. These adverse effects could
account for the fact that the treated populations exhibited some
rare nonspecific cases of heteromorphosis. But stepwise,
specific and reproducible phenotypes were generated with
several different genes at the cellular and also the
developmental level (this work and our unpublished data),
indicating that the nonspecific effects did not mask their
appearance.
Finally, with this method we were able to silence genes
expressed in the ectoderm, thereby demonstrating that the
silencing is systemic and not restricted to the place of delivery
(R.d.R., S.C., M.M.L., unpublished observations). Hence, this
procedure appears to be nontoxic with only moderate side
effects and offers a good starting point to set up large-scale
functional screens in hydra, using for example the growing
EST complement available. RNAi by bacterial feeding is an
extremely cheap and simple method, requiring no additional
specialised material besides the classical hydra culture and
basic molecular biology laboratory equipment. Therefore,
hydra could be subjected to genome-wide functional screens
that would identify the hydra genes required for their amazing
cell plasticity and regenerative potential, as it has recently been
done in planarians (Reddien et al., 2005).
Kazal1 silencing leads to autophagy in gland cells and
epithelial digestive cells
Kazal1(–) silencing had dramatic effects on hydra at the
homeostatic, morphological and cellular level. Electronic
microscopy studies allowed a precise description of the cellular
features of the hydra gastroepidermis. It is made up of two
endodermal cell types, the gland cells, which produce and
release zymogens in the gastric cavity, and the myoepithelial
endodermal cells, which carry out the digestive function
(Lentz, 1966). Mature gland cells, which are abundant along
the body column, display numerous similarities with pancreatic
acinar exocrine cells. In both cases, cells are packed with
secretory vacuoles that become larger at the apical pole.
Secretion is of the apocrine type, the content of these vacuoles
being pinched off from the apical pole of the cell into the
digestive cavity after feeding. In hydra, the digestive cells are
large columnar myoepithelial cells that connect to the
mesoglea through their basal pole and extend microvilli and
flagella into the gastric cavity. Those cells display a very
heterogeneous content of membrane-bound structures,
including digestive vacuoles mostly seen in the apical region,
residual bodies that contain irregular structures and are mostly
found at the basal pole of starved hydra, and an intracellular
space that is frequently observed but rather small in the
digestive cells located along the body column (Lentz, 1966).
Moreover, DNA-containing phagocytic vacuoles or
phagosomes, were described when the cells carry out
macrophagic functions. These vacuoles or phagosomes are
more abundant in starved than in well-fed animals suggesting
that, phagocytosis of neighboring cells is a survival mechanism
in hydra (Bosch and David, 1984). In intact Kazal1(–) hydra,
both cell types involved in the digestive process showed
progressive dramatic changes.
The gland cells first exhibited an altered apico-basal
organization together with an enlargement of their vacuoles,
which subsequently fused. Thereby, after four or five dsRNAi
exposures, they formed huge vacuoles and expelled part of
their cytoplasmic content at a time when the gland cells
underwent a phase of massive cell death. Concerning the
epithelial digestive cells, we did not notice any modification of
their apical digestive vacuoles after several exposures to
dsRNAs. Subsequently, the digestive process was seemingly
less active in control and also in Kazal1(–) hydra, as evidenced
by the limited number of digestive vacuoles after five feedings.
However, at the same time, we observed in Kazal1(–) hydra
large membrane-bound vacuoles that appeared before the
digestive cells started to lose their basal part, shrink and
eventually die. These unusual vacuoles that are located at
variable positions along the cellular apico-basal axis, contained
in most cases mitochondria associated with late-endosome
membranes and, more rarely, non-polymerized tubulin
associated with DNA.
To carry out their digestive function, digestive cells are
permanently producing membrane-bound vacuoles through
pinocytosis and phagocytosis. Nevertheless, in Kazal1(–)
hydra, the presence of mitochondria and late endosomes
within most of these vacuoles indicate that the membranebound vacuoles presumably correspond to autophagosomes
and autolysozomes, which subsequently fuse and ultimately
disrupt their membranes to release their content into the intracytoplasmic space. Formation of autophagosomes, which
correspond to large autophagic vacuoles fused to lysosomes,
is the dynamic process that characterizes autophagy, a celldeath mechanism distinct from necrosis and apoptosis
(Lockshin and Zakeri, 2004). In hydra, in conditions where
we noticed this vacuolization phenotype, we did not record
any swelling of cell membranes and organelles (a hallmark of
necrosis); neither did we observe any specific signs of
apoptosis such as nuclear fragmentation or cell shrinkage.
Hence, the cellular anomalies induced upon Kazal1 silencing
display the characteristic features of autophagy, a process that
probably accounts for the massive cell death of gland and
Autophagy in Kazal1-knock-down hydra
Journal of Cell Science
digestive cells as well as the high rate of mortality observed
in Kazal1(–) hydra.
Amputation stress enhances the Kazal1(–) autophagy
phenotype
In regenerating Kazal1(–) hydra, very few gland cells survived
the amputation stress. The very small number of gland cells
that did survive were highly disorganized, with enlarged
vacuoles and a phenotype more pronounced in cells from headregenerating tips. Hence, compared with intact Kazal1(–)
hydra, the vacuolated lethal phenotype of gland cells was
dramatically increased upon amputation. Similarly,
immediately after bisection, over 30% of the digestive cells
prepared from head-regenerating halves formed large
membrane-bound intracellular spaces, which are usually only
observed in endodermal epithelial cells of the tentacles. Since
head-regenerating halves do not contain any tentacles, we
conclude that this cellular phenotype is linked to Kazal1
silencing.
This enhanced cellular digestive phenotype, observed within
the first hours after amputation, was transient when only three
Kazal1 dsRNA exposures had taken place. This transient
feature can be explained in two ways. Either the observed
cellular are reversible and quickly fixed by the affected
digestive cells, or the damaged cells are eliminated and
replaced by healthy ones. We favor the second scenario
because on one hand, we expected the amputation stress to be
rather limited (affecting only the endodermal cells located in
the regenerating tip where the cellular consequences of
amputation are major; S.C., unpublished data), on the other
hand, we showed that silencing was incomplete in the
regenerating tips after three dsRNA exposures. However, after
a higher number of dsRNA exposures inducing a prolonged
Kazal1 silencing, the cellular modifications were probably no
longer reversible, as evidenced by the fact that the amputation
stress became lethal in Kazal1(–) hydra after seven exposures
to dsRNAs.
Interestingly, the immediate enhancement of the cellular
phenotype after bisection was strongly asymmetric. We
observed major modifications of gland cells and endodermal
epithelial cells in the head-regenerating stumps but not in footregenerating ones. An asymmetric response during early
regeneration has already been reported at the gene expression
level (Gauchat et al., 1998) and also at the signal transduction
level (Cardenas and Salgado, 2003; Kaloulis et al., 2004), but
this is the first report of an immediate asymmetry in the cellular
response to the amputation stress.
The hydra Kazal1(–) phenotype mimics the
Spink1/Spink3 autophagy pancreatic phenotype
Given the structure of the Kazal1 protein and its specific
production by the gland cells, we conclude that Kazal1
functions as a protease inhibitor, and thus propose that, the
Kazal1(–) phenotype is caused by the premature activation of
secreted digestive enzymes, a process normally prevented by
Kazal1. This situation is somewhat analogous to the effect of
mutations in the human pancreatic trypsin inhibitor SPINK 1
(Witt et al., 2000, Drenth et al., 2000) or the mouse cognate
gene Spink3 (Ohmuraya et al., 2005). It has been proposed that
Kazal-type serine protease inhibitors like SPINK1 and
SPINK3 prevent the intra-pancreatic activation of trypsinogen
855
(Witt et al., 2000); when deficient, the imbalance between
trypsinogen activation and protease inhibitors leads to
enzymatic activation, autodigestion of the exocrine pancreas by
activated proteases and progressively chronic pancreatitis
characterized by the loss of acinar cell mass. Pancreatic acinar
cells of Spink3 mutant mice start forming vacuoles
immediately after birth, which have been identified as
autophagosomes (Ohmuraya et al., 2005). Similarly to the
hydra, where gland cells die in few days, the massive cell death
observed in pancreatic acini was associated neither with
necrosis nor with apoptosis, but rather with autophagy as
confirmed by histological and biochemical evidences
(Ohmuraya et al., 2005). Just before cell death, disruption of
the membranes of autophagosomes and the subsequent release
of their enzymatic content within acinar cells were observed.
Interestingly, Spink3–/– mice not only exhibit an autophagic
degeneration of the exocrine pancreas but a concomitant
degeneration of the thin smooth-muscle layer, and the villi of
the duodenum and the small intestine, and altogether, those
defects lead to severe growth retardation and animal death.
Furthermore, beside the essential roles of SPINK3 in the
maintenance and regeneration of acinar cells in the perinatal
period, a cytoprotective function was also identified in the adult
mouse pancreas (Neuschwander-Tetri et al., 2004). Pancreatic
injury in mice induces specific overexpression of Spink3, an
upregulation that might reflect an endogenous cytoprotective
mechanism to prevent further injury. In hydra, the specific
maintenance of high levels of Kazal1 expression in
regenerating stumps, and the dramatic cellular effects observed
when Kazal1 was silenced, support a similar cytoprotective
role for Kazal1 in regenerating hydra. Hence, this functional
study indicates that Kazal1 has indeed a key role in the
digestive physiology of hydra, the maintenance of homeostatic
conditions that allow growth and survival of hydra, but also the
protection of those cells exposed to the amputation stress. In
fact, such cytoprotective function that we have highlighted
during regeneration has never been reported in any previous
studies concerning hydra regeneration but appears as a specific
requirement of the regeneration process per se.
Regulation of autophagy from hydra to mammals
Autophagy is a well-conserved process, initially characterized
as a response to starvation and growth factor deprivation to
promote cell survival. The genetic machinery at work during
this process has been genetically dissected in yeast,
Dictyostelium discoideum, nematode and Drosophila
melanogaster (Levine and Klionsky, 2004). However, the
regulation of this process in pathological conditions is still
poorly understood. The protective function of Kazal-type
serine protease inhibitors against excessive autophagy was
previously suspected from the physiopathological alterations
of the exocrine pancreas linked to human mutations of the
SPINK1 gene. It recently received strong support from detailed
cellular and molecular analyses of mice with a mutated version
of the homologous Spink3 gene. The results reported here
provide a first example of a genetic defect affecting an
evolutionarily-conserved gene, which leads to similar cellular
alterations, i.e. excessive autophagy in hydra and mammals.
This suggests that hydra provides a useful model system to
highlight some evolutionarily-conserved aspects in the
regulation of autophagy.
856
Journal of Cell Science 119 (5)
Materials and Methods
Hydra culture
H. vulgaris (Hv, Zürich strain) and H. magnipapillata (Hm, strain 105) were cultured
in hydra medium (HM; 1 mM NaCl, 1 mM CaCl2, 0.1 mM KCl, 0.1 mM MgSO4,
1 mM Tris pH 7.6) as in Gauchat et al. (Gauchat et al., 2004). For regeneration
experiments, hydra were bisected 24 hours after the last RNAi feeding and fixed at
various time points of regeneration.
Cloning of the hydra Kazal1 gene
Primer Gli-for1 (caagadcarytwgthcayca) and Gli-rev1 (tgwacwgtyttwacrtgytt)
provided the initial 486 bp-long Hv Kazal1 cDNA. Cognate EST sequences from
H. magnipapillata were subsequently identified (www.hydrabase.org) and the
Kazal-F1 (caatgaagtgtgttgctg) and Kazal-R3 (aaacctctcattacgcattctgtgg) primers
used to extend the 5⬘ end of the Hv Kazal1 cDNA up to 569 bp (EMBL accession
number AM110763). The sequences were analyzed at the Pole BioInformatique
Lyonnais (Combet et al., 2000), BLASTed onto the SwissProt database and aligned
using the MULTALIN program (supplementary material Fig. S2). The signal
peptide was mapped on the SignalP 3.0 Server (www.cbs.dtu.dk/services/SignalP/).
Journal of Cell Science
In situ hybridization coupled to immunohistochemistry
The Kazal1-486 riboprobe was SP6 synthesised and in situ hybridization was
performed as in Gauchat et al. (Gauchat et al., 2004). Samples were stained with
either NBT/BCIP or Fast Red (Daco Cytomation), then washed in PBST, blocked
in 2.5% BSA, incubated overnight in anti-␣tubulin antibody (1:1500, Sigma),
washed in PBS, incubated 3 hours at RT in Alexa 488 anti-mouse antibody (1:500,
Molecular Probes), washed again in PBS, mounted in Mowiol and examined on
Axioplan2 (Zeiss) microscope equipped with a Plan-Apochromat 40x objective.
Images were captured through an Axiocam camera with the Openlab System
Software (Improvision), processed with the FotoStation Pro4.5 software (FotoWare)
and final artwork was done with Photoshop software (Adobe). Confocal imaging
was performed on a TCS SP2 AOBS Leica microscope.
RNA interference (RNAi)
The Kazal1-486 cDNA was inserted into the pPD129.36 (L4440) double T7 vector
(http://www.ciwemb.edu/pages/firelab.html) and the sequence was regularly
controlled. For control animals, we used either the pLT61.1 vector (L4440 unc-22)
that produces dsRNAs against the unc-22 nematode gene or the empty L4440 vector.
Kazal1 dsRNAs were then produced as in (Newmark et al., 2003). After a 4-hour
induction with IPTG, 2 ml bacteria were pelleted, resuspended in a final volume of
200 ␮l 0.5% LMP agarose in HM and kept on ice. The solidified mix was griddled
through an artemia filter (Hobby Dohse) and given to 60-100 hydra maintained in
an eppendorf tube in a maximal volume of 1 ml HM 5 mM Tris pH 7.5. Glutathione
(50 ␮M final) was immediately added to induce the feeding response (Loomis,
1955). After 1 hour, hydra were extensively washed in HM. Bacteria feeding was
conducted three times a week and artemia given on alternative days when indicated.
Immunocytochemistry
Five hydra were macerated in 100 ␮l 7% glycerol, 7% acetic acid for 15 minutes,
fixed in 100 ␮l 8% PFA for 15 minutes, and spread on gelatine-treated slides after
addition of 10 ␮l 10% Tween-80 as described by David (David, 1973). Cells were
dried for 3 hours, blocked in 2% BSA and incubated overnight with the following
antibodies: anti-␣–tubulin (1:2000, Sigma), mixed anti-hyCREB (1:4000)
(Kaloulis et al., 2004), anti-RSK (1:1000, Transduction Laboratories) and the 6C4
anti-phospholipid LBPA 1:50 (Kobayashi et al., 1998). After several washes in
PBS, cells were incubated for 2 hours at room temperature with mixed Alexa Fluor
488 and Alexa Fluor 555 antibodies (1:600 each), washed in PBS, stained for 5
minutes in Hoechst 33342 dye (1 ng/ml, Molecular Probes), washed in PBS, water,
mounted and imaged as above. Staining with the mitotracker dye MitoFluor 589
(200 nM) was performed for 20 minutes as indicated by the supplier (Molecular
Probes).
We thank the Fire’s lab members for the RNAi vectors, Marie
Gomez for her help with the feeding RNAi procedure, Christoph
Bauer and Jorge Ritz from the bioimaging platform (Frontiers in
Genetics NCCR), Jean Grünberg and Jean-Claude Martinou for
helpful discussions, Denis Duboule, Pedro Herrera and Volker Schmid
for critical reading of the manuscript. R.d.R. was an EMBO
fellowship recipient (ALTF 598-2002). The laboratory is funded by
the Swiss National Foundation, the State of Geneva, the Fonds Claraz
and the Academic Society of Geneva.
References
Bode, H. R., Heimfeld, S., Chow, M. A. and Huang, L. W. (1987). Gland cells arise
by differentiation from interstitial cells in Hydra attenuata. Dev. Biol. 122, 577-585.
Bosch, T. C. and David, C. N. (1984). Growth regulation in Hydra: relationship between
epithelial cell cycle length and growth rate. Dev. Biol. 104, 161-171.
Bouillon, J. (1994). Embranchement des cnidaires (Cnidaria). In Traité de Zoologie.
Cnidaires, Cténaires. Vol. III, Fascicule II (ed. P. P. Grassé), pp. 1-28. Paris:
Masson.
Cardenas, M. M. and Salgado, L. M. (2003). STK, the src homologue, is responsible
for the initial commitment to develop head structures in Hydra. Dev. Biol. 264, 495505.
Chera, S., Kaloulis, K. and Galliot, B. (2006). The cAMP Response Element Binding
Protein (CREB) as an integrative HUB selector in metazoans: clues from the hydra
model system. Biosystems (in press).
Combet, C., Blanchet, C., Geourjon, C. and Deleage, G. (2000). NPS@: network
protein sequence analysis. Trends Biochem. Sci. 25, 147-150.
David, C. N. (1973). A quantitative method for maceration of hydra tissue. Roux’s Arch.
171, 259-268.
Drenth, J. P., te Morsche, R. and Jansen, J. B. (2002). Mutations in serine protease
inhibitor Kazal type 1 are strongly associated with chronic pancreatitis. Gut 50, 687692.
Galliot, B. (2000). Conserved and divergent genes in apex and axis development of
cnidarians. Curr. Opin. Genet. Dev. 10, 629-637.
Gauchat, D., Kreger, S., Holstein, T. and Galliot, B. (1998). prdl-a, a gene marker for
hydra apical differentiation related to triploblastic paired-like head-specific genes.
Development 125, 1637-1645.
Gauchat, D., Escriva, H., Miljkovic-Licina, M., Chera, S., Langlois, M. C., Begue,
A., Laudet, V. and Galliot, B. (2004). The orphan COUP-TF nuclear receptors are
markers for neurogenesis from cnidarians to vertebrates. Dev. Biol. 275, 104-123.
Holstein, T. W., Mala, C., Kurz, E., Bauer, K., Greber, M. and David, C. N. (1992).
The primitive metazoan Hydra expresses antistasin, a serine protease inhibitor of
vertebrate blood coagulation. FEBS Lett. 309, 288-292.
Kaloulis, K., Chera, S., Hassel, M., Gauchat, D. and Galliot, B. (2004). Reactivation
of developmental programs: The cAMP-response element-binding protein pathway is
involved in hydra head regeneration. Proc. Natl. Acad. Sci. USA 101, 2363-2368.
Kazal, L. A., Spicer, D. S. and Brahinski, R. A. (1948). Isolation of a cristalline trypsin
inhibitor-anticoagulant protein from the pancreas. J. Am. Chem. Soc. 70, 3034-3040.
Klionsky, D. J. (2005). The molecular machinery of autophagy: unanswered questions.
J. Cell Sci. 118, 7-18.
Kobayashi, T., Stang, E., Fang, K. S., de Moerloose, P., Parton, R. G. and Gruenberg,
J. (1998). A lipid associated with the antiphospholipid syndrome regulates endosome
structure and function. Nature 392, 193-197.
Kusserow, A., Pang, K., Sturm, C., Hrouda, M., Lentfer, J., Schmidt, H. A., Technau,
U., von Haeseler, A., Hobmayer, B., Martindale, M. Q. et al. (2005). Unexpected
complexity of the Wnt gene family in a sea anemone. Nature 433, 156-160.
Lentz, T. L. (1966). Fine structure of the gastrodermis. In The Cell Biology of Hydra (ed.
W. T. Daems), pp. 51-67. Amsterdam: North-Holland Publishing.
Levine, B. and Klionsky, D. J. (2004). Development by self-digestion: molecular
mechanisms and biological functions of autophagy. Dev. Cell 6, 463-477.
Lockshin, R. A. and Zakeri, Z. (2004). Apoptosis, autophagy, and more. Int. J. Biochem.
Cell Biol. 36, 2405-2419.
Lohmann, J. U. and Bosch, T. C. (2000). The novel peptide HEADY specifies apical
fate in a simple radially symmetric metazoan. Genes Dev. 14, 2771-2777.
Lohmann, J. U., Endl, I. and Bosch, T. C. (1999). Silencing of developmental genes in
Hydra. Dev. Biol. 214, 211-214.
Loomis, W. (1955). Glutathione control of the specific feeding reactions of Hydra. Ann.
New York Acad. Sci. 62, 209-228.
Mende, K., Petoukhova, O., Koulitchkova, V., Schaub, G. A., Lange, U., Kaufmann,
R. and Nowak, G. (1999). Dipetalogastin, a potent thrombin inhibitor from the bloodsucking insect. Dipetalogaster maximus cDNA cloning, expression and
characterization. Eur. J. Biochem. 266, 583-590.
Miljkovic-Licina, M., Gauchat, D. and Galliot, B. (2004). Neuronal evolution: analysis
of regulatory genes in a first-evolved nervous system, the hydra nervous system.
Biosystems 76, 75-87.
Morris, M. T., Coppin, A., Tomavo, S. and Carruthers, V. B. (2002). Functional
analysis of Toxoplasma gondii protease inhibitor 1. J. Biol. Chem. 277, 4525945266.
Neuschwander-Tetri, B. A., Fimmel, C. J., Kladney, R. D., Wells, L. D. and Talkad,
V. (2004). Differential expression of the trypsin inhibitor SPINK3 mRNA and the
mouse ortholog of secretory granule protein ZG-16p mRNA in the mouse pancreas
after repetitive injury. Pancreas 28, E104-E111.
Newmark, P. A., Reddien, P. W., Cebria, F. and Sanchez Alvarado, A. (2003).
Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in
planarians. Proc. Natl. Acad. Sci. USA 100, S11861-S11865.
Novina, C. D. and Sharp, P. A. (2004). The RNAi revolution. Nature 430, 161-164.
Ohmuraya, M., Hirota, M., Araki, M., Mizushima, N., Matsui, M., Mizumoto, T.,
Haruna, K., Kume, S., Takeya, M., Ogawa, M. et al. (2005). Autophagic cell death
of pancreatic acinar cells in serine protease inhibitor Kazal type 3-deficient mice.
Gastroenterology 129, 696-705.
Pan, T., Groger, H., Schmid, V. and Spring, J. (1998). A toxin homology domain in an
astacin-like metalloproteinase of the jellyfish Podocoryne carnea with a dual role in
digestion and development. Dev. Genes Evol. 208, 259-266.
Rawlings, N. D., Tolle, D. P. and Barrett, A. J. (2004). Evolutionary families of
peptidase inhibitors. Biochem. J. 378, 705-716.
Reddien, P. W., Bermange, A. L., Murfitt, K. J., Jennings, J. R. and Sanchez
Alvarado, A. (2005). Identification of genes needed for regeneration, stem cell
function, and tissue homeostasis by systematic gene perturbation in planaria. Dev. Cell
8, 635-649.
Sarras, M. P., Jr, Yan, L., Leontovich, A. and Zhang, J. S. (2002). Structure,
Autophagy in Kazal1-knock-down hydra
Journal of Cell Science
expression, and developmental function of early divergent forms of metalloproteinases
in hydra. Cell Res. 12, 163-176.
Schmidt, T. and David, C. N. (1986). Gland cells in Hydra: cell cycle kinetics and
development. J. Cell Sci. 85, 197-215.
Seipel, K. and Schmid, V. (2005). Evolution of striated muscle: Jellyfish and the origin
of triploblasty. Dev. Biol. 282, 14-26.
Smith, K. M., Gee, L. and Bode, H. R. (2000). HyAlx, an aristaless-related gene, is
involved in tentacle formation in hydra. Development 127, 4743-4752.
Steele, R. E. (2002). Developmental signaling in Hydra: what does it take to build a
“simple” animal? Dev. Biol. 248, 199-219.
Tian, M., Huitema, E., Da Cunha, L., Torto-Alalibo, T. and Kamoun, S. (2004). A
Kazal-like extracellular serine protease inhibitor from Phytophthora infestans
targets the tomato pathogenesis-related protease P69B. J. Biol. Chem. 279,
26370-26377.
857
Timmons, L., Court, D. L. and Fire, A. (2001). Ingestion of bacterially expressed
dsRNAs can produce specific and potent genetic interference in Caenorhabditis
elegans. Gene 263, 103-112.
Tschesche, H., Kolkenbrock, H. and Bode, W. (1987). The covalent structure of the
elastase inhibitor from Anemonia sulcata–a “non-classical” Kazal-type protein. Biol.
Chem. Hoppe Seyler 368, 1297-1304.
Westfall, J. A. (1996). Ultrastructure of synapses in the first-evolved nervous systems. J.
Neurocytol. 25, 735-746.
Witt, H., Luck, W., Hennies, H. C., Classen, M., Kage, A., Lass, U., Landt, O. and
Becker, M. (2000). Mutations in the gene encoding the serine protease inhibitor, Kazal
type 1 are associated with chronic pancreatitis. Nat. Genet. 25, 213-216.
Yang, Y., Cun, S., Xie, X., Lin, J., Wei, J., Yang, W., Mou, C., Yu, C., Ye, L., Lu, Y.
et al. (2003). EST analysis of gene expression in the tentacle of Cyanea capillata. FEBS
Lett. 538, 183-191.