Journal of Gerontology: BIOLOGICAL SCIENCES
2002, Vol. 57A, No. 2, B48–B53
Copyright 2002 by The Gerontological Society of America
Effects of Telomerase and Viral Oncogene Expression
on the In Vitro Growth of Human Chondrocytes
James A. Martin,1 Calista J. Mitchell,2 Aloysius J. Klingelhutz,2 and Joseph A. Buckwalter 1
1Department
of Orthopaedic Surgery, Biochemistry Laboratory, and 2Department of Microbiology, The University of Iowa,
Iowa City.
Senescent chondrocytes accumulate with aging in articular cartilage, a process that interferes
with cartilage homeostasis and increases the risk of cartilage degeneration. We showed previously that chondrocyte telomere length declines with donor age, which suggests that the aging
process is telomere dependent. From these results we hypothesized that telomerase should delay
the onset of senescence in cultured chondrocytes. Population doubling limits (PDL) were determined for chondrocytes expressing telomerase. We found that telomerase alone did not extend
PDL beyond controls that senesced after 25 population doublings. The human papillomavirus 16
oncogenes E6 and E7 were transduced into the same cell population to investigate this telomereindependent form of senescence further. Chondrocytes expressing E6 and E7 grew longer than
the telomerase cDNA (hTERT) cells but still senesced at 55 population doublings. In contrast,
chondrocytes expressing telomerase with E6 and E7 grew vigorously past 100 population doublings. We conclude that although telomerase is necessary for the indefinite extension of chondrocyte life span, telomere-independent senescence limits PDL in vitro and may play a role in
the age-related accumulation of senescent chondrocytes in vivo.
T
HE potential for human chondrocyte proliferation declines, and senescent cells accumulate with aging in articular cartilage (1). Based on examples in other tissues, it
has been suggested that these cellular changes contribute to
osteoarthritis, a common and costly age-related degenerative disease of cartilage (2–4). Senescence is induced by
multiple mechanisms that can often be traced to different
environmental conditions; thus it may be possible to devise
strategies to prevent or delay the onset of senescence in cartilage or other tissues. With this as a long-term goal, we undertook the present study to better define the cellular mechanisms that regulate chondrocyte growth and senescence.
Senescence is readily observed in vitro in long-term cultures of continuously dividing somatic cells, which enter
growth arrest after a characteristic number of population
doublings (PD) (5). This limit approaches 60 PD for human
fibroblasts, but chondrocytes may be limited to 30–35 PD
(6,7). Growth arrest at this stage is referred to as mortality
stage 1 (M1) (8). M1 growth arrest is induced by replication-dependent loss of telomeres, the DNA structures found
at chromosomal termini that are necessary for DNA replication (9). Telomere sequences are lost with each round of
DNA synthesis and may eventually erode to a length that
can no longer support chromosomal replication (10–12).
Telomere erosion is an inevitable consequence of mitosis in
all cells; however, net losses can be avoided through the activity of telomerase, a DNA polymerase that replaces telomeric sequences as they are lost (13). Telomerase is active
in most immortal cell lines, including germ cells and cells
derived from tumors (14–16). Moreover, normal fibroblasts
B48
transfected with the telomerase cDNA (hTERT) are effectively immortalized without the phenotypic disruption associated with oncogene transfection (17–19). This suggests
that the enzyme extends PD limits solely through the maintenance of telomeres.
Although hTERT is sufficient to immortalize fibroblasts,
some cell types, such as keratinocytes and mammary epithelial cells, have been found to be refractory to immortalization by hTERT alone (20,21). These data imply that PD can
be limited independently of telomere erosion. Human keratinocytes and epithelial cells stop growing in vitro at low PD
by means of a mechanism that is distinct from M1 growth
arrest. The causes of this form of arrest, termed mortality
stage 0 (M0), are not clear; however, oxidative stress and
other suboptimal environmental conditions appear to play a
role (22,23). Introduction of the high-risk human papillomavirus 16 (HPV16) oncogene E7 allowed epithelial cells to
overcome M0 arrest and to continue proliferation to M1.
This is thought to occur because E7 blocks the activity of
the p16/pRb pathway that induces M0 arrest (24). A second
oncogene, E6, targets the p53 pathway and may also play a
role in overcoming M0 (22,25). E6 and E7 coexpression is
sufficient to immortalize epithelial cells, but this depends on
reactivation of telomerase by E6, an effect that does not occur in fibroblasts (26). These studies demonstrate that at
least two distinct mechanisms lead to growth arrest in somatic cells and show that the requirements for immortalization differ in different types of cells.
Cartilage aging studies in our laboratory suggested that
chondrocytes senesce in vivo by means of a telomere-depen-
TELOMERASE AND CHONDROCYTE GROWTH
dent mechanism. This implies that chondrocytes reach their
population doubling limit (PDL) as a consequence of M1
growth arrest. From this, we hypothesized that a constitutive expression of telomerase would be sufficient to immortalize these cells. To test this hypothesis we transduced
chondrocytes with the hTERT cDNA and determined the
effect of telomerase expression on the population doubling
limit (PDL) of the cells. This experiment showed that hTERT
did not extend the PDL, as both vector controls and hTERT
transductants senesced after 25 PD, indicating that chondrocyte population growth was arrested at M0 rather than at
M1. Because E6E7 transduction overcomes this barrier in
other cell types, we tested the effects of these proteins on
chondrocyte growth. We found that E6E7 alone extended
the PDL to 60 and that the combination of E6E7 and
hTERT allowed growth to at least 100 PD. These data indicate that in vitro chondrocyte growth is limited by telomereindependent mechanisms that may contribute to the agerelated accumulation of senescent chondrocytes in cartilage.
METHODS
Cell Culture
Human articular cartilage was harvested from the central
portions of the medial and lateral surfaces of a tibial plateau
removed from a 47-year-old patient undergoing total joint
replacement for degenerative joint disease. Chondrocytes
were isolated as described (1) from approximately 4 g of
cartilage and plated in primary monolayer cultures in Dulbecco’s modified Eagle medium with 10% fetal calf serum
(Life Technologies, Rockville, MD). This initial population
was grown for two passages (1:2 split) and then seeded into
60-mm dishes at a density of 200,000 cells/dish.
Viral Transduction
A cDNA encoding hTERT (Geron Corporation, Menlo
Park, CA) was inserted as an EcoRI fragment into the retroviral vector pLXSN. Chondrocytes (third passage) were
transduced with pLXSN or pLXSN containing the hTERT
cDNA. After 24 hours of exposure the viral infection medium was replaced with fresh medium containing G418
(200 g/ml) for selection of positive transductants. The
transduced cells were then grown for 2 weeks in G418 before reverting to nonselective medium. E6 and E7 transductions were carried out as described previously (27).
Southern Blot Analysis for Mean Terminal Restriction
Fragment Length
DNA was isolated from 1 106 to 5 106 cells by using a DNEasy kit (Qiagen, Valencia, CA) according to the
manufacturer’s directions. Southern blots were performed
essentially as described (13), except that nonradioactive
methods were used to detect telomere sequences according
to Genius system directions published by the manufacturer
(Roche, Indianapolis, IN). The probe was a synthetic oligonucleotide complementary to human telomeric repeat sequences [(CCCTAA)3] (22) and labeled at the 3 end with
digoxigenen (Sigma Genosys, St Louis, MO). An antidigoxigenen alkaline phosphatase-conjugated antibody and a
chemiluminescent substrate, CDP-Star (Roche), were used
B49
to detect the digoxigenen-labeled probe. All DNA samples
were digested and analyzed on at least two gels.
Telomerase Activity Assay
Telomerase activity was determined by using a telomere
repeat amplification protocol (TRAP) assay kit (Roche) according to the supplier’s directions. This version of the assay
allows relative quantitation of telomerase activity if extracts
are prepared from equal numbers of cells. Accordingly, we
used a standard number of cells (1 106) for each determination. Relative telomerase activity (RTA) was calculated as
follows: [(ODsample ODheat inactivated sample)/ODinternal standard]/
[(ODpositive control extract ODextract buffer)/ODinternal standard].
PCR Analysis for E6 Expression
The polymerase chain reaction (PCR) was used to confirm
expression of E6 RNA. Total RNA was extracted from 1 106 cells by using an RNeasy kit (Qiagen) according to the
manufacturer’s directions. One microgram of total RNA was
reverse transcribed by using a Smart cDNA synthesis kit
(Clontech, Palo Alto, CA) and the resulting cDNA preparation
was amplified by using E6 sequence-specific primers (HPV
E6 forward, 5GACCCAGAAAGTTACCACAG3; HPV E6
reverse 5GCAACAAGACATACATCGAC3) that were
designed to amplify a 368 base pair product. PCR conditions for E6 amplification were as follows: 94C for 2 minutes, followed by 30 cycles of 94C for 30 seconds, 60C
for 30 seconds, 72C for 40 seconds, and one cycle of 72C
for 5 minutes. Glyceraldehyde phosphate dehydrogenase
(GAPDH)-specific primers and PCR conditions were described previously (1). PCR products were fractionated on
agarose gels, stained with ethidium bromide, and photographed.
Western Blot Analysis for E7 Expression
A Western blot analysis was performed by using extracts
from subconfluent cultures. Cells in 100-mm dishes were
extracted in 0.25 ml of lysis buffer, which consisted of 25
mM Tris-HCl pH 7.5, 125 mM NaCl, 2.5 mM ethylenediamine tetra-acetic acid (EDTA), 0.05% sodium dodecyl sulfate (SDS), 0.5% nonidet P-40, 0.5% doeoxcholate, and
10% glycerol, containing protease and phosphatase inhibitors. Total protein concentration was determined by bicinchoninic acid assay using a commercial kit (Pierce, Rockford IL). Forty micrograms of total protein in reducing
buffer was fractionated on a 14% SDS–polyacrylamide gel
using a discontinuous buffer system. Western blots were
performed by using Immobilon-P nylon membranes (Millipore, Bedford, MA). The blots were probed with the mouse
monoclonal antibody directed against HPV16-E7 (clone
8C9) as described by the supplier (Zymed, San Francisco,
CA). Blots were probed again with a goat–antimouse alkaline phosphatase conjugated secondary antibody (Promega,
Madison, WI), developed in CDP-Star (Roche), a chemiluminescent substrate, and exposed to Biomax MR autoradiography film (Eastman Kodak, Rochester, NY) for 30 minutes.
Karyotypic analysis of the hTERT/E6E7 population was
performed to determine if normal chromosomal structure
was maintained. The analysis was performed by standard
cytogenetic methods on 10 cells harvested at 65 PD.
B50
MARTIN ET AL.
Figure 1. In vitro growth of chondrocyte populations: the population doubling (PD) number is plotted as a function of time in culture
for chondrocytes transduced with hTERT/E6E7 (), hTERT (),
E6E7 (), or LXSN ().
RESULTS
Chondrocytes were grown continuously in monolayer
culture over a period of several months to determine the effects of hTERT and E6E7 transduction on PDL. PD was
calculated each time the cultures were trypsinized and
passed to new flasks. Accumulated PD was plotted as a
function of time to show changes in population growth rates
that occurred with successive passages (Figure 1). The
graph shows that chondrocytes transduced with the retroviral vector alone (LXSN) stopped growing after 25 PD. The
growth of chondrocytes transduced with the virus bearing
hTERT was also limited to 25 PD, indicating that telomerase expression did not extend the life span of this population. In contrast, E6E7 transduction extended growth to
55 PD, indicating that although viral oncogene expression
was not sufficient for immortalization, it allowed cells to
bypass early growth arrest at 25 PD. The population transduced with both hTERT and E6E7 surpassed even the 55
PD limit and continued to grow past 100 PD with no apparent decline in growth rate. These data indicate that two different mechanisms limit population growth in chondrocytes;
an early, telomerase-independent limit that was overcome
with the introduction of viral oncogenes, and a later telomerase-dependent limit.
Mean telomere restriction fragment analysis was performed to determine if hTERT transduction maintained
telomere length in growing chondrocyte populations. The
Southern blot shown in Figure 2 illustrates the results of this
analysis. The blot shows that extensive telomere erosion occurred in LXSN cells between 10 PD and 20 PD when population growth rate began to decline. Similar losses occurred in E6E7-transduced cells between 12 PD and 40 PD.
Erosion continued to at least 50 PD, near the point of
growth arrest. The introduction of hTERT lead to markedly
different results: telomere length was maintained through
population doublings in both the hTERT and the hTERT/
E6E7 populations. Moreover, telomere lengths were always
Figure 2. Mean terminal restriction fragment analysis: shown is a Southern blot of HinfI/RsaI digested genomic DNA probed with a telomere-specific sequence. Results are shown for cells transduced with LXSN vector, E6E7, hTERT, or hTERT/E6E7. Numbers above the lanes
indicate the population doubling (PD) at which DNA was harvested.
TELOMERASE AND CHONDROCYTE GROWTH
greater in both these populations than in LXSN or E6E7
transductants. These results show that hTERT transduction
prevented replication-dependent telomere erosion, indicating that telomerase expression levels were sufficient to
maintain telomere length.
The TRAP assay was used to confirm that telomere maintenance was associated with telomerase activity in hTERT
transductants. The assay was performed with extracts from
subconfluent cultures harvested at successive PD. Equal
numbers of cells from each population were used for each
extraction and the results were normalized to a standard, telomerase-positive extract provided by the manufacturer.
RTAs calculated from these data are shown in Figure 3.
This histogram reveals that telomerase was highly active in
both populations carrying the hTERT gene. Activity levels
in hTERT cells did not decline from 14 PD to 20 PD (right
column). Activity in hTERT/E6E7 was stable from 14 PD
to 51 PD (right column), indicating that hTERT transgene
expression was very stable over time. Although telomerase
expression is induced by E6 in keratinocytes and epithelial
cells, activity remained at background levels in E6E7 chondrocytes from 14 PD to 50 PD, indicating the absence of
such effects in this cell type. These results clearly link telomere maintenance with telomerase activity and with the
presence of the hTERT transgene.
A reverse transcription PCR (RT-PCR) and Western blot
were used to confirm E6 and E7 expression, respectively.
Results of the RT-PCR analysis are shown in Figure 4. A
368 base pair band corresponding to the expected E6 product was amplified from the E6E7 and hTERT/E6E7 lines,
but not from the hTERT or LXSN lines. The positive control GAPDH reactions yielded a 272 base pair product in all
four lines. A Western blot analysis for E7 protein expression is shown in Figure 5. Immunoreactive bands of the expected molecular weight (15 kDa) were prominent in the
Figure 3. Telomerase activity assay: relative telomerase activity in
chondrocytes transduced with hTERT, hTERT/E6E7, or E6E7 alone
is shown. The two columns for each population represent assays done
at a different population doubling (PD) as indicated beneath the columns. Sample values were normalized to values for a positive control
extract provided by the supplier.
B51
Figure 4. Expression of human papillomavirus 16 E6 mRNA: a
polymerase chain reaction analysis for E6 expression in hTERT (T),
E6E7 (E), LXSN (L), and hTERT/E6E7 (TE) cells is shown. Lanes
show products of glyceraldehyde phosphate dehydrogenase amplification (g) and E6 amplification products (e) for each cell line. The
molecular weights of bands in the standard (Hae III digested x174
DNA) are indicated in base pairs.
E6E7 and hTERT/E6E7 lines but were absent in both the
hTERT and LXSN lines. The nonspecific signals from
higher molecular weight proteins were similar in strength in
all four lanes, indicating that similar amounts of protein
were loaded in each lane. Together these experiments confirm expression of E6 and E7 in the appropriate cell lines.
A cytogenetic analysis of hTERT/E6E7 cells at 65 PD revealed a number of chromosomal abnormalities. Chromosome numbers ranged from 43 to 47. A composite karyotype based on abnormalities common to 6 of 10 cells
indicated a deletion of the long arm of chromosome 5 with a
breakpoint at 5q13; 2. An additional abnormality in at least
2 of 10 cells was an addition of unknown material to the
long arm of chromosome 19 at 19q13.4; 3.
DISCUSSION
The results of this study showed that hTERT transduction
was not sufficient to extend the life span of a normal chondrocyte population under typical monolayer culture conditions. We found that although hTERT was expressed at sufficient levels to maintain telomere length in dividing
chondrocytes, the population nevertheless stopped growing
after only 25 PD, the same growth limit we observed in controls lacking telomerase. These data showed that M0 growth
arrest at 25 PD was induced by mechanisms unrelated to
telomere length. Cells carrying the viral oncogenes E6 and
E7 overcame the 25 PDL, doubling life span to 55 PD.
Southern blots showed extensive telomere erosion over this
period, indicating that cells carrying E6E7 were still subject
to M1 growth arrest by means of replicative senescence. In-
B52
MARTIN ET AL.
Figure 5. Human papillomavirus 16 E7 protein expression: a Western blot analysis for E7 expression in hTERT (T), E6E7 (E), LXSN (L),
and hTERT E6E7 (TE) cells is shown. Molecular weight standards are indicated in kilodaltons and an arrow points to bands at 15 kDa, the
estimated molecular weight of the E7 protein.
definite growth was only achieved when hTERT was coexpressed with E6E7, indicating that telomerase was sufficient
to overcome M1 arrest in chondrocytes.
Although E6E7 appeared to extend PDL, we did not find
evidence that the E6 protein induced endogenous telomerase expression as has been reported for keratinocytes and
epithelial cells (26). This finding prompted us to confirm
that the oncogenes were expressed in the appropriate cell
lines. We found that E6 RNA and E7 protein were detectable in both lines transduced with viral DNA, indicating that
chondrocytes, like fibroblasts, do not reactivate hTERT expression in the presence of E6.
In conclusion, we found that chondrocytes senesce in
vitro in two stages: an early telomere-independent stage,
and a later telomere-dependent stage. Early senescence
sharply limited growth to approximately half the replicative
potential of the population. The fact that this block was alleviated by oncogene expression suggests that arrest was
caused by activation of one or more tumor suppressor proteins that mediate responses to DNA damage (22,28–30).
The relevance of this finding to cartilage aging and degeneration are unclear, because damage may be caused postisolation by culture-related factors such as oxidative stress. Although this would seem to suggest that early senescence is a
culture artifact, oxidative conditions in articular cartilage
could also cause sufficient DNA damage to provoke senescence in vivo. Future studies will help to determine if this
form of growth arrest contributes to the accumulation of senescent chondrocytes with cartilage aging.
Acknowledgments
This work was supported by the Veterans Administration and the Department of Orthopaedic Surgery at the University of Iowa. The hTERT
construct was a generous gift of Geron Corporation. The E6/E7LXSN was
kindly provided by Denise Galloway, the Fred Hutchinson Cancer Research Center, Seattle, Washington.
Address correspondence to James A. Martin, PhD, Department of Orthopaedic Surgery, Biochemistry Laboratory, 1182 ML, The University of
Iowa, Iowa City, IA 52242. E-mail: [email protected]
References
1. Martin J, Buckwalter J. Telomere erosion and senescence in human articular cartilage chondrocytes. J Gerontol Biol Sci. 2001;56A:B172–
B179.
2. Chang E, Harley C. Telomere length and replicative aging in human
vascular tissues. Proc Natl Acad Sci USA. 1995;92:11,190–11,194.
3. Dimiri G, Lee X, Basile G, et al. A biomarker that identifies senescent
human cells in culture and in aging skin in vivo. Proc Natl Acad Sci
USA. 1995;92:9363–9367.
4. Buckwalter J, Mankin H. Articular cartilage II. Degeneration and osteoarthrosis, repair, regeneration and transplantation. J Bone Joint
Surg Am. 1997;79A:612–632.
5. Hayflick L, Moorehead P. The serial cultivation of human diploid cell
strains. Exp Cell Res. 1961;25:585–621.
6. Kolettas E, Buluwela L, Bayliss M, Muir H. Expression of cartilagespecific molecules is retained in long-term cultures of human articular
chondrocytes. J Cell Sci. 1995;108:1991–1999.
7. Allsopp R, Vaziri H, Piatyszek M, et al. Telomere length predicts replicative capacity of human fibroblasts. Proc Natl Acad Sci USA. 1992;
89:10,114–10,118.
8. Wright W, Shay J. The two-stage mechanism controlling cellular senescence and immortalization. Exp Gerentol. 1992;27:383–389.
9. Blackburn E. Structure and function of telomeres. Nature. 1991;350:
569–572.
TELOMERASE AND CHONDROCYTE GROWTH
10. Allsopp R, Harley C. Evidence for a critical telomere length in senescent human fibroblasts. Exp Cell Res. 1995;219:130–136.
11. Allsopp R, Chang E, Kashefi-Aazam M, et al. Telomere shortening is
associated with cell division in vitro and in vivo. Exp Cell Res. 1995;
220:194–200.
12. Harley C, Futcher A, Greider C. Telomeres shorten during ageing of
human fibroblasts. Nature. 1990;345:458–460.
13. Counter C, Avilion A, LeFeuvre C, et al. Telomere shortening associated with chromosome instability is arrested in immortal cells which
express telomerase activity. EMBO J. 1992;11:1921–1929.
14. Avilion A, Piatyszek M, Gupta J, Shay J, Bacchetti S, Greider C. Human telomerase RNA and telomerase actitvity in immortal cell lines
and tumor tissues. Cancer Res. 1996;56:645–650.
15. Klingelhutz A. Telomerase activation and cancer. J Mol Med. 1997;
75:45–49.
16. Meyerson M, Counter C, Eaton E, et al. hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and
during immortalization. Cell. 1997;90:785–795.
17. Vaziri H, Benchimol S. Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended
replicative life span. Curr Biol. 1998;8:279–282.
18. Bodnar A, Ouellette M, Frolkis M, et al. Extension of life-span by introduction of telomerase into normal human cells. Science. 1998;279:
349–352.
19. Jiang X, Jimenez G, Chang E, et al. Telomerase expression in human
somatic cells does not induce changes associated with a transformed
phenotype. Nat Genet. 1999;21:111–114.
20. Dickenson M, Hahn W, Ino Y, et al. Human keratinocytes that express
hTERT and also bypass a p16INK4a-enforced mechanism that limits
life span become immortal yet retain normal growth and differentiation characteristics. Mol Cell Biol. 2000;20:1436–1447.
21. Kiyono T, Foster S, Koop J, McDougall J, Galloway D, Klingelhutz
A. Both Rb/p16INK4a inactivation and telomerase activity are required to immortalize human epithelial cells. Nature. 1998;396:84–88.
B53
22. Demers GW, Foster SA, Halbert CL, Galloway DA. Growth arrest by
induction of p53 in DNA damaged keratinocytes is bypassed by the
human papillomavirus 16 E7. Proc Nat Acad Sci USA. 1994;91:4382–
4386.
23. Chen Q. Replicative senescence and oxidant induced premature senscence: beyond the control of cell cycle checkpoints. Ann NY Acad Sci.
1995;908:111–125.
24. Foster SA, Galloway DA. Human papillomavirus type 16 E7 alleviates
a proliferation block in early passage human mammary epithelial cells.
Oncogene. 1996;12:1773–1779.
25. Scheffner M, Werness BA, Huibregtse JM, Levine AJ, Howley PM.
The E6 oncogene encoded by the human papillomavirus types 16 and
18 promotes degradation of p53. Cell. 1990;63:1129–1136.
26. Klingelhutz AJ, Foster SA, McDougall JK. Telomerase activation by
the E6 gene product of the human papillomavirus type 16. Nature.
1996;380:79–82.
27. Halbert C, Demers D, Galloway D. The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial
cells. J Virol. 1991;65:474–478.
28. Robles S, Adami G. Agents that cause DNA double strand breaks lead
to p16INK4a enrichment and the premature senescence of normal fibroblasts. Oncogene. 1998;16:1113–1123.
29. Toussaint O, Medrano EE, Zglinicki, T. Cellular and molecular mechanisms of stress-induced premature senescence of human diploid
fibroblasts and melanocytes. Exp Gerontol. 2000;35:927–945.
30. Ramirez R, Morales C, Herbert B-S, et al. Putative telomere-independent mechanisms of replicative aging reflect inadequate growth
conditions. Genes Develop. 2000;15:398–403.
Received June 8, 2001
Accepted September 10, 2001
Decision Editor: John A. Faulkner, PhD