Carcinogenesis vol.23 no.6 pp.923–928, 2002
ACCELERATED PAPER
Profiling and selection of genes differentially expressed in the
pylorus of rat strains with different proliferative responses and
stomach cancer susceptibility
Satoshi Yamashita, Kuniko Wakazono, Takashi Sugimura
and Toshikazu Ushijima1
Carcinogenesis Division, National Cancer Center Research Institute, 1-1
Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045, Japan
1To
whom correspondence should be addressed
Email: [email protected]
Rat stomach cancers induced by N-methyl-N⬘-nitroN-nitrosoguanidine (MNNG) are widely used as a model
of differentiated-type human stomach cancers. ACI/NJcl
(ACI) rats show persistent and strong cell proliferation in
response to gastric mucosal damage by MNNG while
BUF/NacJcl (BUF) rats show transient and limited cell
proliferation. This difference is considered as one of the
mechanisms for the high susceptibility of ACI rats to
MNNG-induced stomach carcinogenesis. To identify genes
involved in the differential induction of cell proliferation,
cDNA subtraction was performed using RNA isolated from
the pylorus of ACI and BUF rats treated with MNNG. By
the temporal patterns of their expressions, the isolated 16
genes were overviewed and clustered into groups. Expression of the genes in group 1 (such as MHC class I and
class II genes and interferon-inducible genes Iigp, Mx2 and
Ubd) was induced by MNNG treatment, and the genes in
group 2 (such as cellular retinoic acid-binding protein II
(CrabpII)) were constantly expressed regardless of MNNG
treatment. Then, expression profiles among multiple rat
strains were compared with the extents of induction of cell
proliferation. Iigp, CrabpII and EST222005 were found to
show relatively good accordance, and these three genes were
considered as candidates for genes that control differential
induction of cell proliferation. Presence of polymorphisms
at the genomic DNA level was indicated for CrabpII and
EST222005, and these two genes were considered to be
better candidates than Iigp. It was shown that the temporal
profiles and profiles among strains, taking advantage of
animal models, are useful to select candidate genes from a
collection of genes isolated by various genome-wide scanning methods.
Introduction
N-Methyl-N⬘-nitro-N-nitrosoguanidine (MNNG)-induced rat
stomach cancers are known as a good model of differentiatedtype human stomach cancers (1,2). When MNNG is administered to rats in the drinking water, erosions with severe
inflammatory reaction are rapidly induced in weeks 1–2, and
gradually subside in weeks 6–8 (3,4). Regenerative changes
are mainly observed in weeks 6–12, atypical changes are
then observed in weeks 15–32, and adenocarcinomas of the
glandular stomach are finally induced in weeks 35–72 (4).
MNNG-induced stomach cancers respond to tumor promoters
in a manner accordant with epidemiological studies in human
(5,6), and show histological structures similar to differentiatedtype human stomach cancers (7). As for molecular bases for
MNNG-induced rat stomach cancers, infrequent occurrence of
p53 mutations and absence of K-ras and β-catenin mutations
were observed (8), and this profile is again in accordance with
the majority of differentiated-type human stomach cancers.
Bralow et al. (9) found that different strains of rats showed
significantly different susceptibility to MNNG-induced gastric
carcinogenesis. ACI/NJcl (ACI) rats are susceptible strains
and BUF/NacJcl (BUF) rats are resistant strains (9,10). By
linkage analysis using male ACI⫻ (ACI ⫻ BUF)F1 backcross
rats, we mapped one definitive quantitative trait locus (QTL)
and three suggestive QTLs that are involved in the stomach
cancer susceptibility. A definitive QTL on rat chromosome
(chr.) 15, Gastric cancer susceptibility gene 1 (Gcs1), gave
BUF-dominant susceptibility to MNNG-induced stomach carcinogenesis, and three suggestive QTLs on rat chr. 4, 3 and
15 gave BUF-dominant resistance (11).
As for a mechanism of the different stomach cancer susceptibilities, differential induction of cell proliferation after mucosal
damage has been implicated (12). MNNG does not require
metabolic activation steps, and directly attacks DNA and
cellular proteins (13,14). The degrees of erosions were almost
the same in the pyloric mucosae of the two strains, or a little
more severe in BUF rats (4), and DNA adduct levels were at
the same levels (2). These showed that MNNG delivery to its
target tissue and the overall level of DNA damage and repair
are at similar levels in the two strains. However, in ACI rats,
cell proliferation in reaction to mucosal damage is much
stronger, and the upward shift of the proliferative zone is more
prominent (12). In addition, (ACI ⫻ BUF)F1 rats show
induction of cell proliferation similar to BUF rats, and show
stomach cancer susceptibility again similar to BUF rats (10,12).
Considering the important roles of cell proliferation in carcinogenesis (15,16), the difference between ACI and BUF rats in
induction of cell proliferation has been considered as one of
the mechanisms for the different stomach cancer susceptibilities
between the two strains. It can be hypothesized that the genes
responsible for stomach cancer susceptibility overlap the genes
responsible for the differential induction of cell proliferation.
In this study, we approached the genes that control differential induction of cell proliferation from expression profiles
among rat strains. The genes differentially expressed in the
pylorus of ACI and BUF rats after MNNG exposure were
isolated by cDNA subtraction. The isolated genes were characterized by the temporal profiles of their expression. The
candidate genes that control cell proliferation were selected
by analyzing rat strains both for induction of cell proliferation
and for expression levels of the isolated genes.
Materials and methods
Abbreviations: CrabpII, cellular retinoic acid-binding protein II; MNNG,
N-methyl-N⬘-nitro-N-nitrosoguanidine; RDA, representational difference analysis; RDA-WEEC, RDA with elimination of excessive clones.
© Oxford University Press
Rat strains, MNNG treatment and RNA extraction
ACI, BUF, and their F1 rats were purchased from CLEA Japan (Tokyo, Japan).
LEW/Crj (LEW), WKY/NCrj (WKY), SHR/NCrj (SHR) and F344/DuCrj
923
S.Yamashita et al.
(F344) rats were purchased from Charles River Japan (Yokohama, Japan).
WKAH, BN and WTC rats were donated by Dr Serikawa of Kyoto University.
After acclimatization for 1 week, rats at 8 weeks of age were given MNNG
(Aldrich Chemical, Milwaukee, WI) in the drinking water at a concentration
of 83 mg/l for a specified period, and were given distilled water for 1 day
before being killed. Pyloric mucosa was scraped off with blades, and total
RNA was extracted using ISOGEN (NIPPON GENE, Tokyo, Japan). mRNA
was isolated from the total RNAs after treatment with DNase I (Promega,
Madison, WI) using Oligotex-dT30 Super (Takara Shuzo, Kyoto, Japan).
cDNA subtraction
cDNA subtraction was performed by cDNA-representational difference analysis (cDNA-RDA) (17,18) and cDNA-RDA with elimination of excessive
clones (cDNA-RDA-WEEC) (19). First strand cDNA was synthesized from
4 µg of mRNA by SuperScript II reverse transcriptase (Life Technologies,
Rockville, MD) and 5⬘-TTTGGATCC(T)30VN-3⬘ oligo dT primer. Second
strand cDNA was synthesized by DNA polymerase I and RNase H. The
double-strand cDNA was then digested with MboI (Takara Shuzo). To 1 µg
of digest, the RBam adaptor (17) was ligated, and the ligation product was
amplified by PCR for 20 cycles with the RBam24 oligonucleotide to prepare
an amplicon. The RBam adaptor was removed by digestion with MboI, and
the JBam adaptor was ligated only to the tester amplicon. One µg of the tester
amplicon was mixed with 40 µg of the driver amplicon, and the mixture
underwent denaturation and reannealing. One tenth of the reannealed product
was amplified by PCR with the JBam24 oligonucleotide. The second cycle
was performed using the product of the first cycle, after replacing the JBam
adaptor with the NBam adaptor, as the tester, and the driver amplicon as the
driver. The PCR product after the second cycle was cloned into a plasmid.
Further, cDNA-RDA-WEEC was performed to isolate genes that were
expressed at low levels but still differentially. In cDNA-RDA-WEEC, 6 µl of
PCR solutions of the differential clones isolated in the first cDNA-RDA were
added to 20 µg of driver amplicon, and RDA was performed similarly. For
each subtraction experiment, 96 clones were analyzed for their independence
by cross-hybridization. Independent clones were screened by dot-blot hybridization with the amplicons of ACI and BUF rats to examine their differential
expression. Differential expression was finally confirmed by Northern blot
analysis.
Table I List of primers used for PCR
Clone
(gene)
name
Forward primer
Reverse primer
aD9
aA1
aA11
aA3
aB1
aD3
waB9
aC10
aB2
aC10
wbC11
wbB2
wbD11
bA7
⫹D5
bA2
bC9
TAATATCGCCATCCTACTTT
TCAACCAACACACCGCCACT
AGTGTGGAGCGGGCTAAGAA
ACGTCAGAACTCATATTCCC
AGGGCATGCTCCAGCTCCTG
GGTGAATGACCCGTCCAAGC
GCGTTGTCATCTTATGGGATT
CGAACATGAAGCTGGGACAC
CACAGAAGGCGTTTATGAGA
CGAACATGAAGCTGGGACAC
CTCGCTTCCTAGCTGTACAC
ATGGAGCTGGGGCTTCTGAC
TCTACCTGGAAGCCTGTTT
GCCTGTGTTCTGTTGCGATG
ATTCCTCTGCGGTAAACCTC
TTTAATCATCCTGCCCGTCT
GCTTCTACCCTGCTGACATC
GAAACAATACATGAAAGGCT
GAGGAAGAAACCGCTCATAA
CCCACTCTCAATGAGATCAA
TGCCTCTTTCTCATAGTCGAG
GCCTTGCCAACCGCTCCTTC
GGGAAAGGTCCTGGTGTCGT
GACTCCACCAGAGACAAGGG
AGCTTGGCTGACTGTAAAGG
CAGTCGTAAATGTCGTCGTT
AGCTTGGCTGACTGTAAAGG
GGCAACTTGAAAATTGGAG
AACTTCTTCTGGAGGCCACA
AGCCACAGTGTGCAGAAATC
ATGCGATTGCCTAAGACGTA
TCATACGTGTGTGCGCTCAA
TTCATTGGCTGGTGGTTCAC
ATGGCCACAGCTCCGAGGAC
β-actin
li
CIITA
PCNA
TCCTCCCTGGAGAAGAGCTA
ACTGGAGAACCTTCGCATGA
GCTTTCTGGCTGGCTTAGTTT
CGGCGTGAACCTACAGA
CCAGACAGCACTGTGTTGGC
GGCGCTTGGAGCATGTTATC
AAGAACCTTCCGTTTCCTATCT
TCGCAGCGGTATGTGTCGAA
Sequencing and chromosomal mapping
Cycle sequencing was performed using BigDye Terminator kit and ABI310
DNA sequencer (Applied Biosystems, Foster City, CA). Homology searches
were performed with the BLAST program at a GenBank Web site. When a
clone had a homology with a mouse or human gene and the rat orthologue
had not been cloned, the clone was considered to be the rat orthologue. The
genes, whose chromosomal positions had not been known, were mapped using
the Rat/Hamster Radiation Hybrid Panel (Research Genetics, Huntsville,
AL) and the RH Mapping Service in OLETF Project (http://ratmap.ims.utokyo.ac.jp/menu/RH.html).
Northern blot analysis and quantitative RT-PCR
A pool of total RNA (25 µg) was prepared from three rats that underwent the
same treatment. Two pools from ACI and two from BUF were run in a 1%
agarose gel containing 2.2 M formaldehyde. The RNA was transferred to
Hybond-XL membrane (Amersham Pharmacia Biotech, Uppsala, Sweden),
and the filter was hybridized with a 32P-labelled probe. Signals were quantified
by BAS-2000II scanner (Fuji Photo Film, Tokyo, Japan).
For quantitative RT-PCR, cDNA was synthesized from total RNA with
oligo (dT)12–18 primer and Superscript II reverse transcriptase (Life
Technologies). Real-time PCR analysis was performed using a iCycler iQ
detection system (Bio-Rad Laboratories, Hercules, CA) with SYBR Green
PCR Core Reagents (Applied Biosystems) and 200 nM of primers. The PCR
conditions were 3 min at 50°C, 10 min at 95°C, followed by 40 cycles of
denaturation for 30 s at 94°C, annealing for 30 s at specified temperature,
and extension for 30 s at 72°C. The sequences of the primers and annealing
temperature are listed in Table I. The absence of non-specific amplification
was confirmed by analyzing the PCR products with agarose gel electrophoresis
and melting curve. To quantify the number of molecules of a specific gene in
the sample, a standard curve was generated using templates that contained
101 to 106 copies of the gene. The amount of β-actin of each cDNA solution
was also quantified, and the amount of the gene of interest was normalized
to the amount of β-actin.
Analysis of induction of cell proliferation
Male rats of each strain at 8 weeks of age were given 63 mg/l MNNG for 2
weeks. They were intraperitoneally injected with 200 mg/kg of BrdU (Sigma
Chemical, St. Louis, MO) 1 h before being killed. The stomach was fixed
with formalin, and cells with BrdU were stained with anti-BrdU antibody
(DAKO A/S, Glostrup, Denmark) and ABC vector staining kit. Numbers of
924
Fig. 1. Representative results in northern blot analysis using clones obtained
by cDNA-RDA. RNAs from three ACI or BUF rats were pooled for one lane,
and two pools for each strain were run.
labelled cells were counted in 30 pits in each rat. Four ACI, eight WKY, 11
LEW, nine F344 and six BUF rats were analyzed, and the number for a strain
was calculated as the average ⫾ standard deviation.
Results
Isolation of differentially expressed genes by cDNA subtraction
Three male ACI rats and three male BUF rats were treated
with MNNG for 2 weeks, and RNA was extracted from their
pyloric epithelium. cDNA subtraction was performed using a
pool of RNA from the three male ACI rats as the tester and a
pool of RNA from the three male BUF rats as the driver, and
nine clones overexpressed three-fold or more in ACI rats
were isolated (representative results in Figure 1). In cDNA
subtraction using BUF as the tester and ACI as the driver,
seven clones overexpressed three-fold or more in BUF rats
were isolated (Figure 1). The nine clones overexpressed in
ACI rats included mouse Iigp gene, rat endogenous retroviral
sequence, rat aldehyde dehydrogenase gene, rat MHC class II
RT1.B-1 β chain (RT1.B-1β), rat Mx2 gene (also called MxB),
rat mucin-like protein gene, rat diubiquitin gene (Ubd, also
Differentially expressed genes in the rat pylorus
Table II List of clones obtained by cDNA-RDA
Clone
name
GenBank
accession No.
Clone
length (bp)
Expression change (fold)
Northern
blot
RT–PCR
Genomic
Chromosomal Temporal Result of homology search by BLAST
polymorphismb position
profile
(microsatellite
GenBank
Gene/EST
marker placed
accession No.
by RH panel)
ACI-BUF
aD9
AB072240
356
36
3.0
–
aA1
AB072241
395
12
8.3
–
aA11
aA3
AB072242
AB072243
236
686
9.3
8.3
20
21000
ndc
⫹
aB1
aD3
AB072244
AB072245
566
872
7.9
4.2
3.8
1.8
–
–
waB9
AB072246
157
2.8
34
–
aB2
AB072247
588
1.9
3.4
–
aC10
AB072248
310
nda
194
BUF-ACI
wbC11
AB072249
wbB2
AB072250
294
387
69
29
wbD11
AB072251
229
bA7
AB072252
⫹D5
Chr 18
(D18Got54)
Repetitive
sequenced
Chr 13
Chr 20
1a
AJ007971
Mouse Iigp
1b
D90005
2
1a
M23995
X56596
Chr 11
Chr 1
(D1Rat111)
Chr 20
(D20Wox5)
Chr 20
1a
1b
X52712
M81920
Rat endogenous retroviral
sequence
Rat aldehyde dehydrogenase
Rat MHC class II RT1.B-1 β
chain (RT1.B-1β)
Rat Mx2
Rat mucin-like protein
1a
AJ312394
Rat diubiquitin (Ubd)
1a
M29311
⫹
Chr 16
(D16Rat36)
1b
BF283485
Rat MHC class II RT1.B-1 α
chain (RT1.B-1α)
Rat EST448076
1800
96
–
–
Chr 1
1a
Chr 7 (D7Mit5) 2
X61925
U23407
29
48
–
2
AC004406
662
5.1
2.8
–
2
–
No homology
AB072253
445
3.2
3.3
–
1b
AF168795
Rat schlafen-4 (Slfn-4)
bA2
AB072254
567
3.1
196
–
1b
AI178337
Rat EST222005
bC9
AB072255
355
3.0
6.6
⫹
Chr 15
(D15Rat64)
Chr 1
(D1Wox23)
Chr 10
(D10Rat58)
Chr 20
(D20Wox5)
Chr 20
Rat pancreatic lipase
Rat cellular retinoic acidbinding protein II (Crabp II)
Mouse ma40a113
1b
AJ249704
Rat MHC class I RT1.A1b
(RT1.A1b)
aBelow the detection limit (not detected).
bComparison of PCR products using primers for RT-PCR and genomic DNA of ACI and BUF rats.
cPCR products were not generated in both ACI and BUF (not detected).
dThe rat endogenous retroviral sequence is known to be present repeatedly in the rat genome, and could
called Fat10), rat MHC class II RT1.B-1 α chain (RT1.B-1α),
and rat EST448076 (Table II). The seven clones overexpressed
in BUF rats included the rat pancreatic lipase gene, rat
cellular retinoic acid-binding protein II gene (CrabpII), mouse
ma40a113, clone bA7, rat schlafen-4 gene (Slfn-4), rat
EST222005, and rat MHC class I RT1.A1b (RT1.A1b)
(Table II). Clone bA7 did not have any homology in GenBank,
but still had an open reading frame longer than 200 bp.
Temporal profiles of the differentially expressed genes
RNA was collected from the pyloric glands of ACI and BUF
rats at seven time points (before MNNG treatment and 1, 2,
3, 5, 7 and 10 weeks after initiation of MNNG treatment).
Expression levels of the 16 isolated genes and three other
related genes, MHC class II invariant chain (Ii), MHC class
II transactivator (CIITA) and PCNA, were quantified by
quantitative RT-PCR (Figure 2). According to the induction
levels by MNNG, the 16 genes could be clustered into two
groups. Expressions of the genes in group 1 (Figure 2A and
2B) were maximally induced at 1 and 2 weeks after initiation
of MNNG treatment. They could be further clustered by the
presence of differences between ACI and BUF rats before
MNNG treatment. Genes in group 1a (Figure 2A) were not
differentially expressed before MNNG treatment and the strain
differences were induced by MNNG treatment. The differences
not be mapped.
(fold change) were maintained till 10 weeks after initiation of
MNNG treatment. On the other hand, genes in group 1b
(Figure 2B) were differentially expressed even before MNNG
treatment, and, even when their expression was induced by
MNNG, the strain differences were maintained. The genes in
group 2 (Figure 2C) were expressed at relatively constant
levels, and strain differences were accordingly constant.
Throughout the analytical periods, RT1.B-1β and
EST448076 were expressed only in ACI rats, while rat
pancreatic lipase, CrabpII and EST222005 were expressed
only in BUF rats. The PCNA gene, which is expressed in late
G1/S-phase and reflects the number of cells in cell cycle (20),
were expressed at relatively constant levels, and difference
between ACI and BUF rats was slight (Figure 2D). Therefore,
β-actin was used for normalization of mRNA amount in
this study.
Expression profiles among rat strains
To select genes that control induction of cell proliferation, the
number of BrdU-labelled cells in a pit was measured in
additional rat strains after treatment with MNNG for 2 weeks.
The numbers obtained for male ACI, WKY, LEW, F344 and
BUF rats were 6.9 ⫾ 0.5, 7.5 ⫾ 0.3, 8.5 ⫾ 1.0, 4.6 ⫾ 1.1
and 3.7 ⫾ 0.7 cells/pit, respectively. The former three strains
showed relatively large numbers of labelled cells while the
925
S.Yamashita et al.
Fig. 2. Expression levels of the genes in group 1a (A); those in group 1b (B); those in group 2 (C); and other related genes (D). For each gene, the expression
profiles among rat strains in the pylorus were analyzed after MNNG treatment for 2 weeks (left panels). Temporal profiles (right panels) were measured just before
initiation of MNNG treatment (week 0) for 2 weeks, and at weeks 1, 2, 3, 5, 7 and 10. Expression level of a gene was quantified by normalizing the copy number of
the gene, measured by real-time RT-PCR, to that of β-actin. fACI, female ACI rats; F1, F1 rats of ACI and BUF.
latter two strains showed smaller numbers (P ⬍ 0.001 by
Student’s t-test). The number of labelled cells in
(ACI ⫻ BUF)F1 (F1) rats was reported to be similar to that
of BUF rats (12).
926
The expression levels of the 16 genes isolated and the three
other related genes were measured in the pylorus of male rats
of six strains, ACI, WKY, LEW, F344, BUF and F1, after
MNNG treatment for 2 weeks (Figure 2, left panels). Additional
Differentially expressed genes in the rat pylorus
data for SHR, WKAH, BN and WTC strains can be found at
our Web (www.ncc.go.jp/research/rat-genome). Sex differences
between male ACI (ACI) and female ACI (fACI) rats were
slight in all genes. Iigp, CrabpII and EST222005 showed
profiles among the strains almost concordant with the induction
of cell proliferation. Since most of MHC genes are highly
polymorphic, direct comparison of their expression levels is
not possible between the rat strains with different haplotypes,
such as ACI and BUF rats. Therefore, we analyzed expression
level of CIITA to estimate the intensity of the signal to
transcribe MHC genes (21), and that of Ii, nonpolymorphic
and co-expressed with class II genes (22), to estimate the
response of class II genes (Figure 2D). The expression profiles
of Ii and CIITA among rat strains were not in accordance with
the extents of induction of cell proliferation.
Screening for polymorphisms at the genomic DNA level
As a simple procedure for screening of polymorphisms at the
genomic DNA level, genomic DNA of ACI and BUF rats was
amplified by PCR with the primers used for RT-PCR analysis.
PCR product was obtained for 15 of the 16 genes analyzed
(Table II), and three of them showed polymorphisms. For
RT1.B-1β and EST448076, PCR product was obtained only
from ACI rats. For RT1-A1b, PCR products of different sizes
were obtained for ACI and BUF rats.
Discussion
The 16 genes, which had been isolated by cDNA-RDA using
RNA isolated from the pylorus of ACI and BUF rats after
MNNG exposure, were clustered into three groups, 1a, 1b and
2, by their temporal profiles of expression. Genes in groups
1a and 1b were maximally induced at weeks 1 and 2, which
was in accordance with the time course of reactive inflammation
(4). Genes with known functions in groups 1a and 1b included
one MHC class I gene, two MHC class II genes and three
interferon-inducible genes, Iigp (23), Mx2 (MxB) (24) and
Ubd (Fat10) (25). All these genes were known to be involved
in inflammatory response, and genes with unknown functions
in groups 1a and 1b, EST448076 and EST222005, were
speculated to be also involved in inflammatory response. Before
MNNG treatment, genes in group 1a were not differentially
expressed while those in group 1b were differentially expressed.
It was expected that differential expression of genes in group
1a after MNNG treatment were due to differential induction
of their upstream signals.
The extents of induction of cell proliferation were measured
in 10 rat strains, including (ACI ⫻ BUF)F1 rats. As for the
six strains whose stomach cancer susceptibilities had been
known (10,26), the extents of induction of cell proliferation
were in accordance with the susceptibility. ACI, WKY and
LEW rats showed strong induction in cell proliferation and
were susceptible to stomach cancer, while F344, BUF and F1
showed weak induction and were resistant. These profiles
among strains were used to select genes that control differential
induction of cell proliferation. Among the multiple genes
related to the regulation of cell proliferation induction, the
same set of genes were expected to be involved in the
difference between ACI and BUF rats and in the difference
between ACI and F1 rats. Therefore, expression level in F1
rats comparable with BUF rats was used as a requisite criterion.
The accordance in strains other than ACI, BUF and F1 rats
were additionally used. Based on these criteria, Iigp, CrabpII
and EST222005 were selected as candidate genes that control
differential induction of cell proliferation after MNNG treatment. Although Ubd (Fat10) was known to modulate cell
growth during B cell or dendritic cell development and
activation (27), its expression profile among strains was against
its being a candidate gene.
CrabpII encodes a transcriptional regulator that is involved
in retinoic acid (RA) signalling (28), and plays a key role in the
synergistic growth suppressive effect by RA and γ-interferon in
breast cancer cells (29). This key role of CrabpII in cell
proliferation suggested that its polymorphism could cause
differential response to mucosal damage caused by MNNG.
As for EST222005, no function has been reported. Iigp was
cloned as an interferon-inducible GTPase (23), but its function
has not been characterized yet. By use of temporal profiles
and profiles among rat strains, we were able to select not
only a well characterized gene, CrabpII, but also poorly
characterized genes, EST222005 and Iigp, as candidate genes.
Analysis of cell types where these candidate genes are
expressed and linkage mapping using the induction of cell
proliferation as a phenotypic marker will further contribute to
find out critical genes for induction of cell proliferation. None
of the genes selected were in the chromosomal positions where
QTLs for stomach cancer susceptibility had been mapped
using ACI ⫻ (ACI ⫻ BUF)F1 backcross rats (11). However,
there is still a possibility that new QTLs for stomach cancer
susceptibility will be mapped using intercross rats and colocalized with some of the genes selected in this study.
From the MHC region on rat chromosome 20, three MHC
genes and two genes, Ubd (Fat10) and EST222005 were
isolated. A previous report that Ii, the MHC class II gene and
the MHC class I gene are induced after MNNG exposure
(30,31) was confirmed. However, the expression profiles among
rat strains of Ii and CIITA suggested that the total expression
levels of the MHC class II genes were unlikely to control
differential induction of cell proliferation. There remains a
possibility that the haplotypes of MHC genes are involved in
differential induction of cell proliferation.
RT1.B-1β, EST448076, CrabpII and EST222005 were
expressed only in one strain at any time point, and were not
expressed at all in some strains. They were analyzed by PCR
using primers for RT-PCR and genomic DNA, and presence
of polymorphisms in genomic DNA was confirmed for
RT1.B-1β and EST448076. These suggested that CrabpII and
EST222005 could also have polymorphisms at the genomic
DNA level. Theoretically, differential expression of a gene
between two strains can be induced by two mechanisms. One
is by different intensities of upstream signal, and the other is
by differences intrinsic to the gene, such as a polymorphism
in its promoter or deletion of its coding sequence. Genes that
are differentially induced by the latter mechanism should have
much better chances of working as primary causes. Therefore,
among the three genes that showed accordance among the
strains, CrabpII and EST222005 were selected as those with
priority.
In this study, temporal profiles and profiles among rat strains
offered a non-biased method to evaluate the isolated genes.
The selection strategy contributed to the selection of CrabpII
and EST222005 as candidates for genes that control differential
induction of cell proliferation. The selection strategy taken
here can be applied to search for genes responsible for various
interesting phenotypes in animal models.
927
S.Yamashita et al.
Acknowledgements
This work was supported by Grants-in-Aid for the 2nd-term
Cancer Control Strategy and for Cancer Research from the
Ministry of Health, Labor and Welfare; by the Program for
Promotion of Fundamental Studies in Health Sciences of the
Organization for Pharmaceutical Safety and Research (OPSR);
and by a grant from the Princess Takamatsu Cancer
Research Fund.
References
1. Sugimura,T. and Fujimura,S. (1967) Tumor production in glandular stomach
of rats by N-methyl-N⬘-nitro-N-nitrosoguanidine. Nature, 216, 943–944.
2. Ohgaki,H. and Sugimura,T. (1997) Experimental gastric cancer. In
Sugimura,T. and Sasako,M. (eds) Gastric Cancer. Oxford University Press,
New York, pp. 73–86.
3. Matsukura,N., Kawachi,T., Sasajima,K., Sano,T., Sugimura,T. and Hirota,T.
(1978) Induction of intestinal metaplasia in the stomachs of rats by
N-methyl-N⬘-nitro-N-nitrosoguanidine. J. Natl Cancer Inst., 61, 141–144.
4. Ohgaki,H., Kusama,K., Hasegawa,H., Sato,S., Takayama,S. and
Sugimura,T. (1986) Sequential histologic changes during gastric
carcinogenesis induced by N-methyl-N⬘-nitro-N-nitrosoguanidine in
susceptible ACI and resistant BUF rats. J. Natl Cancer Inst., 77, 747–755.
5. Tatematsu,M., Takahashi,M., Fukushima,S., Hananouchi,M. and Shirai,T.
(1975) Effects in rats of sodium chloride on experimental gastric cancers
induced by N-methyl-N⬘-nitro-N-nitrosoguanidine or 4-nitroquinoline-1oxide. J. Natl Cancer Inst., 55, 101–106.
6. Kobori,O., Shimizu,T., Maeda,M., Atomi,Y., Watanabe,J., Shoji,M. and
Morioka Y. (1984) Enhancing effect of bile and bile acid on stomach
tumorigenesis induced by N-methyl-N⬘-nitro-N-nitrosoguanidine in Wistar
rats. J. Natl Cancer Inst., 73, 853–861.
7. Saito,T., Inokuchi,K., Takayama,S. and Sugimura,T. (1970) Sequential
morphological
changes
in
N-methyl-N⬘-nitro-N-nitrosoguanidine
carcinogenesis in the glandular stomach of rats. J. Natl Cancer Inst., 44,
769–783.
8. Hirayama,Y., Wakazono,K., Yamamoto,M., Kitano,M., Tatematsu,M.,
Nagao,M., Sugimura,T. and Ushijima,T. (1999) Rare mutations of p53,
Ki-ras and beta-catenin genes and absence of K-sam and c-erbB-2
amplification in N-methyl-N⬘-nitro-N-nitrosoguanidine-induced rat
stomach cancers. Mol. Carcinogen., 25, 42–47.
9. Bralow,S.P., Gruenstein,M. and Meranze,D.R. (1973) Host resistance to
gastric adenocarcinomatosis in three strains of rats injesting N-methyl-N⬘nitro-N-nitrosoguanidine. Oncology, 27, 168–180.
10. Ohgaki,H., Kawachi,T., Matsukura,N., Morino,K., Miyamoto,M. and
Sugimura,T. (1983) Genetic control of susceptibility of rats to gastric
carcinoma. Cancer Res., 43, 3663–3667.
11. Ushijima,T., Yamamoto,M., Suzui,M., Kuramoto,T., Yoshida,Y.,
Nomoto,T., Tatematsu,M., Sugimura,T. and Nagao,M. (2000)
Chromosomal mapping of genes controlling development, histological
grade, depth of invasion and size of rat stomach carcinomas. Cancer Res.,
60, 1092–1096.
12. Ohgaki,H., Tomihari,M., Sato,S., Kleihues,P. and Sugimura,T. (1988)
Differential proliferative response of gastric mucosa during carcinogenesis
induced by N-methyl-N⬘-nitro-N-nitrosoguanidine in susceptible ACI rats,
resistant Buffalo rats and their hybrid F1 cross. Cancer Res., 48, 5275–5279.
13. Sugimura,T., Fujimura,S., Nagao,M., Yokoshima,T. and Hasegawa,S.
(1968) Reaction of N-methyl-N⬘-nitro-N-nitrosoguanidine with protein.
Biochem. Biophys. Acta, 170, 427–429.
14. Lawley,P.D. and Shah,S.A. (1972) Methylation of ribonucleic acid by the
carcinogens dimethyl sulphate, N-methyl-N-nitrosourea and N-methyl-
928
N⬘-nitro-N-nitrosoguanidine. Comparisons of chemical analyses at the
nucleoside and base levels. Biochem. J., 128, 117–132.
15. Ames,B.N. and Gold,L.S. (1990) Too many rodent carcinogens: mitogenesis
increases mutagenesis [published erratum appears in Science 1990, Sep
28; 249 (4976):1487]. Science, 249, 970–971.
16. Cohen,S.M. and Ellwein,L.B. (1990) Cell proliferation in carcinogenesis.
Science, 249, 1007–1011.
17. Lisitsyn,N., Lisitsyn,N. and Wigler,M. (1993) Cloning the differences
between two complex genomes. Science, 259, 946–951.
18. Hubank,M. and Schatz,D.G. (1994) Identifying differences in mRNA
expression by representational difference analysis of cDNA. Nucleic Acids
Res., 22, 5640–5648.
19. Ushijima,T., Morimura,K., Hosoya,Y., Okonogi,H., Tatematsu,M.,
Sugimura,T. and Nagao,M. (1997) Establishment of methylation-sensitiverepresentational difference analysis and isolation of hypo- and
hypermethylated genomic fragments in mouse liver tumors. Proc. Natl
Acad. Sci. USA, 94, 2284–2289.
20. Iwatani,Y., Kamigaki,T., Suzuki,S., Ohno,M., Nakamura,T. and Kuroda,Y.
(1999) Proliferating cell nuclear antigen as a predictor of therapeutic effect
of continuous 5-fluorouracil administration in gastric cancer. Int. J. Oncol.,
14, 965–970.
21. Mach,B. (1999) Perspectives: immunology. Regulating the regulator.
Science, 285, 1367.
22. Moore,B.B., Cao,Z.A., McRae,T.L., Woo,C.H., Conley,S. and Jones,P.P.
(1998) The invariant chain gene intronic enhancer shows homology to
class II promoter elements. J. Immunol., 161, 1844–1852.
23. Boehm,U., Guethlein,L., Klamp,T., Ozbek,K., Schaub,A., Futterer,A.,
Pfeffer,K. and Howard,J.C. (1998) Two families of GTPases dominate the
complex cellular response to IFN-gamma. J. Immunol., 161, 6715–6723.
24. Melen,K., Keskinen,P., Ronni,T., Sareneva,T., Lounatmaa,K. and
Julkunen,I. (1996) Human MxB protein, an interferon-alpha-inducible
GTPase, contains a nuclear targeting signal and is localized in the
heterochromatin region beneath the nuclear envelope. J. Biol. Chem., 271,
23478–23486.
25. Raasi,S., Schmidtke,G. and Groettrup,M. (2001) The ubiquitin-like protein
fat10 forms covalent conjugates and induces apoptosis. J. Biol. Chem.,
276, 35334–35343.
26. Tatematsu,M., Aoki,T., Inoue,T., Mutai,M., Furihata,C. and Ito,N. (1988)
Coefficient induction of pepsinogen 1-decreased pyloric glands and gastric
cancers in five different strains of rats treated with N-methyl-N⬘-nitroN-nitrosoguanidine. Carcinogenesis, 9, 495–498.
27. Liu,Y.C., Pan,J., Zhang,C., Fan,W., Collinge,M., Bender,J.R. and
Weissman,S.M. (1999) A MHC-encoded ubiquitin-like protein (FAT10)
binds noncovalently to the spindle assembly checkpoint protein MAD2.
Proc. Natl Acad. Sci. USA, 96, 4313–4318.
28. Delva,L., Bastie,J.N., Rochette-Egly,C., Kraiba,R., Balitrand,N.,
Despouy,G., Chambon,P. and Chomienne,C. (1999) Physical and functional
interactions between cellular retinoic acid binding protein II and the
retinoic acid-dependent nuclear complex. Mol. Cell Biol., 19, 7158–7167.
29. Widschwendter,M., Daxenbichler,G., Dapunt,O. and Marth,C. (1995)
Effects of retinoic acid and gamma-interferon on expression of retinoic
acid receptor and cellular retinoic acid-binding protein in breast cancer
cells. Cancer Res., 55, 2135–2139.
30. Furihata,C., Oka,M., Yamamoto,M., Ito,T., Ichinose,M., Miki,K.,
Tatematsu,M., Sakaki,Y. and Reske,K. (1997) Differentially expressed
MHC class II-associated invariant chain in rat stomach pyloric mucosa
with N-methyl-N⬘-nitro-N-nitrosoguanidine exposure. Cancer Res., 57,
1416–1418.
31. Oka,M., Furihata,C., Kitoh,K., et al. (1998) Involvement of dendritic cell
response to resistance of stomach carcinogenesis caused by N-methyl-N⬘nitro-N-nitrosoguanidine in rats. Cancer Res., 58, 4107–4112.
Received December 28, 2001; revised and accepted March 18, 2002