Am J Physiol Cell Physiol 293: C468–C476, 2007.
First published April 25, 2007; doi:10.1152/ajpcell.00286.2005.
Transport and regulatory characteristics of the yeast bicarbonate transporter
homolog Bor1p
Michael L. Jennings,1 Todd R. Howren,1 Jian Cui,1 Maria Winters,1 and Robyn Hannigan2
1
Department of Physiology and Biophysics, University of Arkansas for Medical Sciences, Little Rock; and 2Department
of Chemistry and Physics, Arkansas State University, Jonesboro, Arkansas
Submitted 14 June 2005; accepted in final form 5 April 2007
boron; SLC4; YNL275w
gene family known as SLC4 (28)
includes Na⫹-independent Cl⫺/HCO⫺
3 exchangers, electro⫹
genic and electroneutral Na⫹-HCO⫺
3 cotransporters, and Na dependent anion exchangers (1, 18, 26). The functions of these
transporters have been characterized extensively in mammals
and in some invertebrates (27). In addition, the genomes of
plants and fungi (but not prokaryotes) contain open reading
frames (ORFs) that are members of SLC4 but whose functions
are, for the most part, not well established. An exception is the
Arabidopsis thaliana SLC4 ORF known as BOR1, which was
THE BICARBONATE TRANSPORTER
1
For brevity, the word boron and its symbol B is used to denote boric acid
[H3BO3; B(OH)3]. Whenever boric acid is present, its conjugate base borate
⫺
[H4BO⫺
4 B(OH)4 ] will also be present in proportions dictated by the pKA
(9.25) and the pH. When specific chemical species are discussed, the terms
boric acid and borate are used, but otherwise, boron is used to mean boric
acid/borate. We assume that the only chemical form of boron present is boric
acid/borate, i.e., that boric acid is not chemically transformed to other compounds.
Address for reprint requests and other correspondence: M. L. Jennings,
Dept. of Physiology and Biophysics, Univ. of Arkansas for Medical Sciences, 4301 W. Markham St., Mail Slot 505, Little Rock, AR 72205 (e-mail:
[email protected]).
C468
shown by Takano et al. (32) to be necessary for boron1
[B(OH)3/B(OH)4⫺ ] loading of xylem. A. thaliana Bor1p functions as a pathway for uphill boric acid efflux from pericycle
cells into root stellar apoplasm (32), thereby increasing the
concentration of boron in xylem. In Arabidopsis, boron levels
do not strongly affect BOR1 gene transcription; the level of
functional transporter, however, is regulated by stimulation of
endocytosis and degradation of Bor1p when boron levels are
high (31).
In their study of Arabidopsis BOR1, Takano et al. (32) found
that a homologous Saccharomyces cerevisiae ORF, YNL275w
(BOR1),2 is responsible for the ability of yeast to maintain a
low cellular boron content following incubation for 1 h in
medium containing 0.5 mM boric acid. More recently Nozawa
et al. (20) showed that BOR1 deletant strains are more susceptible than wild-type strains to growth inhibition by boric acid
and that overexpression of BOR1 produces further protection
against boric acid toxicity. Very recently, Takano et al. (30)
published the first boron transport measurements in yeast,
showing that efflux is slower in the deletant strain than in the
wild-type strain.
Other functional information about Bor1p comes from the
work of Zhao and Reithmeier (37), who expressed S. cerevisiae
Bor1p with a COOH-terminal tag and found that the protein is
targeted to the plasma membrane and is not a glycoprotein.
They also found that Bor1p can bind stilbenedisulfonates and
that this binding can be inhibited by monovalent inorganic
anions, but not by sulfate or phosphate. A recent study by
Decker and Wickner (10) showed that S. cerevisiae Bor1pgreen fluorescent protein (GFP) localizes preferentially to the
vacuole and that cells lacking Bor1p have fragmented vacuoles. These findings suggest a role for yeast Bor1p in the
trafficking of proteins needed for vacuole fusion.
A separate SLC4 member (human SLC4 A11), previously
known as BTR1 (24) and renamed NaBC1, was shown recently
by Park et al. (23) to be an electrogenic Na⫹-borate [B(OH)4⫺
] cotransporter. In the absence of boric acid, NaBC1 acts as a
conductive pathway for Na⫹ and H⫹/OH⫺. Park et al. (23)
further showed that boric acid and/or borate, at low concentrations (⬍0.5 mM), activates the MAP kinase pathway and
stimulates mammalian cell growth. Higher boric acid/borate
2
Following the work of Takano et al. (32), the ORF YNL275w has been
designated BOR1 in the Saccharomyces Genome Database and National
Institutes of Health database. Accordingly, BOR1 is used in this article to refer
to this gene, and Bor1p is used to refer to the protein.
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
0363-6143/07 $8.00 Copyright © 2007 the American Physiological Society
http://www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.5 on June 15, 2017
Jennings ML, Howren TR, Cui J, Winters M, Hannigan R.
Transport and regulatory characteristics of the yeast bicarbonate transporter homolog Bor1p. Am J Physiol Cell Physiol 293: C468–C476, 2007. First published April 25, 2007;
doi:10.1152/ajpcell.00286.2005.—The functional properties of the
Saccharomyces cerevisiae bicarbonate transporter homolog Bor1p
(YNL275wp) were characterized by measuring boron (H3BO3), Na⫹,
and Cl⫺ fluxes. Neither Na⫹ nor Cl⫺ appears to be a transported
substrate for Bor1p. Uphill efflux of boron mediated by Bor1p was
demonstrated directly by loading cells with boron and resuspending in
a low-boron medium. Cells with intact BOR1, but not the deletant
strain, transport boron outward until the intracellular concentration is
sevenfold lower than that in the medium. Boron efflux through Bor1p
is a saturable function of intracellular boron (apparent Km ⬃1–2 mM).
The extracellular pH dependences of boron distribution and efflux
indicate that uphill efflux is driven by the inward H⫹ gradient.
Addition of 30 mM HCO⫺
3 does not affect boron extrusion by Bor1p,
indicating that HCO⫺
3 does not participate in Bor1p function. Functional Bor1p is present in cells grown in medium with no added boron,
and overnight growth in 10 mM H3BO3 causes only a small increase
in the levels of functional Bor1p and in BOR1 mRNA. The fact that
Bor1p is expressed when there is no need for boron extrusion and is
not strongly induced in the presence of growth-inhibitory boron
concentrations is surprising if the main physiological function of yeast
Bor1p is boron efflux. A possible role in vacuolar dynamics for Bor1p
was recently reported by Decker and Wickner (10). Under the conditions used presently, there appears to be mildly abnormal vacuolar
morphology in the deletant strain.
YEAST BORIC ACID TRANSPORT
MATERIALS AND METHODS
Materials, strains, and growth conditions. Unless otherwise indicated, all media, salts, buffers, and other chemicals were obtained
from Fisher Scientific (Pittsburgh, PA) or Sigma-Aldrich (St. Louis,
MO). Boric acid transport experiments were performed on Euroscarf
strains 1169 and 6808, purchased from Invitrogen (Carlsbad, CA).
Both strains were derived from strain BY4741 (MATa his3⌬1 leu2⌬0
met15⌬0 ura3⌬0). Strain 1169 is the BOR1 deletant, and strain 6808
is an arbitrarily chosen control deletant that lacks MET3 (ATP
sulfurylase), a gene that is not needed for growth in rich medium. The
deleted genes were replaced by a KanMX module that confers
resistance to geneticin (G418). For the boron transport experiments,
strains were grown aerobically in YPD medium (1% Difco yeast
extract, 2% Bacto-peptone, 2% glucose) plus 0.25 mg/ml G418 at
30°C with rotary shaking.
Radionuclides (22Na⫹ and 36Cl⫺) were purchased from DuPont
NEN (Boston, MA). Plasmid expression of Bor1p as well as 22Na⫹
and 36Cl⫺ transport experiments were performed with BOR1 deletant
strain 1169 and also with strain FKY282 (MAT␣ SRP40 pep4::LEU2
ura3-12 leu2-3,-112 his3-11,-15 trp1-1 ade2-1, kanamycin resistant),
the strain used by Groves et al. (14) to express the membrane domain
of the human AE1 anion exchanger. Influx of 22Na⫹ was also
measured in strain B31 (MATa ade2-1 can1-100 his3-11,15 leu23,112 trp1-1, ura3-1, mall0, ena1⌬::HIS3::ena4⌬ nha1⌬::LEU2),
which is deleted in several Na⫹ efflux pathways (2).
Preparation of plasmid pG1T containing epitope-tagged BOR1.
Plasmid pG1T was a generous gift from Robert Farley (University of
Southern California). The sole EcoRI site in pG1T, near the GAL1
promoter, was removed by site-directed mutagenesis (QuikChange;
Stratagene, La Jolla, CA), and an EcoR1 site was introduced into the
multiple cloning site. The BOR1 ORF was amplified from genomic
DNA (from strain FKY282) using PCR with primers located 226
bases upstream of the translation start site and 88 bases downstream
of the stop codon. The 5⬘ end of each primer contained sequences for
restriction sites (EcoRI and NheI), which were used to insert the PCR
product into the multiple cloning site of pG1T. The final construct
(pG1T/BOR1), including hemagglutinin sequences between the initiator methionine and the remaining BOR1 ORF, was verified by
sequencing.
Boric acid/borate influx. Overnight cultures were centrifuged and
resuspended in YPD (same volume as the original culture) buffered
with 5 mM citrate, titrated to pH 5.2 with KOH, plus various
concentrations of B(OH)3 to initiate influx, and incubated with shakAJP-Cell Physiol • VOL
ing at 30°C. At various times, aliquots were diluted ⬎10-fold in
ice-cold distilled water and centrifuged immediately (2 min, 4,000
rpm), and the supernatant was removed completely. Cell pellets were
resuspended in 50 or 100 ␮l of water and heated for 30 min at 100°C
(32). Solids were centrifuged in a microfuge, and 25 ␮l of supernatant
were assayed for total boron colorimetrically by the curcumin
reaction (Texas A&M Technical Bulletin; http://www-odp.tamu.edu/
publications/tnotes/tn15/ f_chem2.htm). Boron content is represented
as millimoles per liter of cell water. Interference in the assay by other
components of the cellular extract was not significant, as indicated by
the fact that late time points in efflux experiments in low-boron media
showed negligible boron contents. As an additional confirmation of
the validity of the assay, cellular boron contents were also measured
on some of the samples by inductively coupled plasma mass spectrometry (ICP-MS), using a PerkinElmer Sciex DRC II Dynamic
Reaction Cell ICP-MS (13). Results using the two methods were
indistinguishable (see Fig. 2A).
For investigation of the effect of bicarbonate on boron distribution,
cells from overnight cultures were incubated 1 h at 30°C in YPD
medium containing 2 or 4 mM boron, buffered with 5 mM K-citrate
and 10 mM Bis-Tris (pH 6.2) or 50 mM MES-Tris (pH 7.0). Comparisons were made of boron contents of cells in two parallel 10-ml
suspensions. In one of the suspensions, KHCO3 was added from a 1
M stock to a final concentration of 29 mM, and the suspension was
bubbled (50 –100 ml/min) with a mixture of air, O2, and CO2 to keep
the extracellular pH at 6.2 ⫾ 0.1 (70% CO2) or 7.0 ⫾ 0.1 (⬃12%
CO2) and the O2 between 21 and 30%. The extracellular pH in the
CO2/HCO⫺
suspensions drifted downward very
3 -supplemented
slowly, and no addition of base was needed to keep the pH in the
stated range during the incubation. In the other suspension, no addition of KHCO3 was made, and the suspension was bubbled with air to
minimize the accumulation of CO2 and HCO⫺
3 . The extracellular pH
of the air-bubbled suspension was monitored continuously, and additions of KOH were made periodically to keep the pH with 0.1 unit of
the initial pH. After 1 h, aliquots of both suspensions were diluted
10-fold in ice-cold distilled water and centrifuged immediately, and
the cellular boron contents were determined as described above.
Cell water was calculated from the wet weight of the cell pellet,
with the assumption that the cell pellet contains 0.78 g total water/g
pellet (measured on several samples of haploid strains), of which
0.28 g is outside the plasma membrane (based on the difference in
boron content of cold-washed and unwashed cells). This estimate of
extracellular water agrees with that of Conway and Downey (8).
Boron efflux. Following incubation for 60 –90 min or overnight in
YPD plus various concentrations of boric acid, cells were centrifuged
and immediately resuspended in 200 volumes of YPD buffered with
5 mM citrate, pH 5.2–5.3, at 30°C to initiate efflux, and intracellular
boron concentration was measured in aliquots following centrifugation at various times. For each time point, the instantaneous efflux was
estimated from the difference between the intracellular boron concentrations at the previous and following time point divided by the time
interval between the previous and following time points.
RT-PCR. RNA was extracted from yeast with Trizol reagent
(Invitrogen) and reverse transcribed with Moloney murine leukemia
virus reverse transcriptase (ABgene, Rochester, NY) primed with
random hexamers. Real-time PCR was performed using a MyIQ
thermal cycler (Bio-Rad, Hercules, CA) with primers obtained
from Integrated DNA Technologies (Coralville, IA). Primers for
amplifying BOR1 were designed using Primer3 (http://frodo.wi.mit.
edu/cgi-bin/primer3/primer3_www.cgi) and had the sequences ACTTGGCTGGCATATGAACC (forward) and ATTCCTAGAACCCCGCTGAT (reverse). Control PCR reactions verified the absence of
genomic DNA.
Differential interference contrast and FM 4-64 microscopy. Fluorescent dye FM4-64 [N-(3-triethylammoniumpropyl)-4-(p-diethylaminophenylhexatrienyl) pyridinium dibromide; Synapto red] was
purchased from Calbiochem (La Jolla, CA). Cells were labeled with
293 • JULY 2007 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.5 on June 15, 2017
concentrations inhibit growth. Overexpression of NaBC1
causes both the stimulatory and inhibitory effects of boron to
take place at lower concentrations, indicating that NaBC1 uses
the inward Na⫹ gradient to drive an uphill influx of borate (23).
The experiments described in this article were designed to
test several functional characteristics of boron transport
through S. cerevisiae Bor1p, including the driving force for
uphill transport, the possible role of bicarbonate, the saturability of efflux, the regulation of the transporter by boron in the
growth medium, and the proposed effect of Bor1p on vacuolar
morphology. We demonstrate directly that Bor1p mediates a
saturable uphill boron efflux, with characteristics consistent
with a bicarbonate-independent exchange of extracellular H⫹
for intracellular H3BO3. Functional Bor1p is constitutively
expressed in cells grown in rich medium without added boron,
and functional protein as well as BOR1 mRNA are increased
only slightly during growth in boron concentrations that significantly inhibit growth. The lack of major induction results in
only a limited ability of native Bor1p to increase the resistance
of yeast to growth inhibition by boric acid.
C469
C470
YEAST BORIC ACID TRANSPORT
FM4-64 essentially as described by Vida and Emr (34). Overnight
cultures of control and BOR1 deletant strains were centrifuged and
resuspended in YPD at absorbance (600 nm) of 20, and FM 4-64 was
added to a final concentration of 32 ␮M from a 16 mM stock in
DMSO. Cells were incubated with dye for 15 min, centrifuged,
resuspended in YPD, and incubated for 1 h at 30°C to allow the dye
to be internalized and traffic to the vacuole (34) and was then put on
ice before slide preparation. The suspension (2 ␮l), either in YPD or
after centrifugation and resuspension in water, was applied to glass
slides coated with polylysine, covered with an 18 ⫻ 18-mm coverslip,
sealed with nail polish, and examined immediately using a Zeiss
Axiovert 200M microscope with a ⫻100 objective. Final images (see
Fig. 8) were prepared from raw micrographs using NIH ImageJ
software.
RESULTS
AJP-Cell Physiol • VOL
Fig. 1. Lack of effect of deletion or overexpression of the Saccharomyces
cerevisiae bicarbonate transporter homolog Bor1p on 36Cl⫺ or 22Na⫹ influx.
A: BOR1 deletant strain carrying plasmid pG1T/BOR1 was grown in yeast
nitrogen broth (YNB) medium containing either 2% glucose (F) or 2%
galactose (). Influx of 36Cl⫺ was measured at 22°C in YNB (4 mM total Cl⫺).
B: wild-type BOR1 (strain FKY282; F) or BOR1 deletant cells () were grown
overnight at 30°C in YNB medium in which all but ⬃5 ␮M Cl⫺ was replaced
36
by SO2⫺
Cl⫺ was measured for 2, 4, 6, and 8 min at 22°C after
4 . Influx of
changing to fresh medium and adding 0.036, 0.1, 0.36, or 1.08 mM Na36Cl.
The curves drawn through the data are Michaelis-Menten functions with Km ⫽
0.013 (F) and 0.010 mM (). C: influx of 22Na⫹ was measured for 2–15 min
at 22°C in YNB medium (1.7 mM total Na⫹) in the following strains:
left, wild-type vs. BOR1 deletant strain (Del); middle, BOR1 deletant strain
with pG1T/BOR1, grown in 2% glucose or 2% galactose; and right, strain B31
grown in YNB/galactose with or without transformation by pG1T/BOR1. WT,
wild type.
In strains with wild-type BOR1, cellular boron reached a
steady-state level more rapidly than in the deletant strain (Fig.
2B), and the steady-state level was far lower than that expected
for a passive distribution. Figure 2C shows the steady-state
boron distribution ratio as a function of extracellular concentration. As expected for a passive distribution, the symmetrical
boron distribution in the deletant strain was independent of
concentration over the range studied. In contrast, for cells with
wild-type BOR1, the distribution ratio [B]in/[B]out became
progressively larger at higher concentrations; at 16 mM boron,
the two strains had similar intracellular boron contents, as
expected if Bor1p-mediated efflux is a saturable function of the
intracellular boron concentration. The concentration depen-
293 • JULY 2007 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.5 on June 15, 2017
Lack of 22Na⫹ or 36Cl⫺ flux mediated by Bor1p. Because
many members of the bicarbonate transporter family (SLC4)
transport Cl⫺, Na⫹, or both (1, 18, 26), it is of interest to test
these ions as potential substrates of Bor1p. Overexpression of
BOR1 in the deletant strain did not increase the influx of either
22
Na⫹ or 36Cl⫺ (Fig. 1). Overexpression of BOR1 in strain
B31, which is deficient in several Na⫹ efflux pathways (2),
also did not stimulate 22Na⫹ influx (Fig. 1C). We also examined 36Cl⫺ influx at concentrations of 0.01–1 mM, which are
lower than those that have been investigated previously in
yeast (9, 14, 17). Influxes at low concentration revealed the
existence of a high-affinity transporter for 36Cl⫺, which are
described separately (Jennings ML and Cui J, unpublished
observations). The high-affinity Cl⫺ flux was present in both
the wild-type and the BOR1 deletant strain (Fig. 1B) and was
therefore not catalyzed by Bor1p. We conclude that neither
Na⫹ nor Cl⫺ is transported by Bor1p under the conditions
examined.
Steady-state distribution of boron and time course of influx.
Figure 2B shows the time course of increase of total cellular
boron for cells incubated at 30°C in YPD plus 4 mM H3BO3,
buffered at pH 5.2 with 5 mM Na-citrate. In the BOR1 deletant
strain, the time course of influx was indistinguishable from a
single exponential, with a steady-state cellular boron content
that was slightly lower (per unit cell water) than the extracellular concentration. The steady-state boron distribution ratio
([B]in/[B]out) was 0.7– 0.8. This distribution ratio may not be
significantly different from unity, considering that after 60 –90
min, the influx had only reached about 95% of equilibrium, and
there were minor losses (probably 5–10%, but difficult to
measure) of boron during the wash before analysis. Given
these considerations, a measured distribution ratio of 0.7– 0.8
in the deletant strain is very close to that expected for a passive
distribution. Our data indicate that, to a first approximation,
boron is neither extruded from nor concentrated in the cells of
the BOR1 deletant strain.
It should be pointed out that the boron distribution ratio in
the BOR1 deletant (Fig. 2) was significantly lower than those
reported very recently by Takano et al. (30) in the same strain.
For example, Takano et al. (30) found that at an extracellular
boron concentration of 10 mM, the cellular boron was 19
mmol/kg wet wt, which was over 30 mmol per liter of intracellular water. The difference between our data and those of
Takano et al. (30) is not likely to be caused by the analytical
method; curcumin and ICP-MS give the same values for boron
concentration in hot water extracts of yeast (Fig. 2A).
YEAST BORIC ACID TRANSPORT
C471
Fig. 2. A: comparison of cellular boron contents by the curcumin method and
inductively coupled plasma mass spectrometry (ICP-MS). Yeast cells were
incubated in YPD medium (1% Difco yeast extract, 2% Bacto-peptone, 2%
glucose) containing various concentrations of H3BO3. Cells were centrifuged,
resuspended in YPD, incubated for various times, and then centrifuged to stop
the boron efflux. Cells were then heated for 30 min at 100°C in 50 or 100 ␮l
of water. Boron content of the extract was determined using either the
curcumin method or ICP-MS (see MATERIALS AND METHODS). B: time course of
increase in cellular boron in S. cerevisiae strains with wild-type (F) or deleted
BOR1 (Œ). Cells from overnight cultures were suspended in YPD plus 4 mM
B(OH)3 and incubated at 30°C. Suspension was diluted 10-fold in cold water
at the indicated times and centrifuged immediately, and total cellular boron
was determined using the curcumin method. Error bars represent range of data
for 2 determinations on a single cell preparation. C: steady-state boron
distribution ratios (cell water:extracellular medium) in wild-type (F) or BOR1
deletant strains (Œ) following incubation in YPD containing 5 mM citrate, pH
5.0 –5.3, at 30°C for 60 –90 min in the presence of 1, 2, 4, 8, or 16 mM H3BO3.
Error bars represent range of data for 2 experiments (1 and 16 mM boron) or
SD for 3– 4 experiments (2, 4, or 8 mM boron). [B], boron concentration.
dence of boron distribution ratio in the wild-type strain is in
qualitative agreement with data of Takano et al. (30, 32).
Boron efflux mediated by Bor1p. The time course of net
boron efflux into a low-boron medium at 30°C is shown in
Fig. 3. Cells were incubated 1 h in YPD containing various
concentrations of H3BO3 and then washed and resuspended in
YPD, pH 5.2, with no added boron. The time course of efflux
in the deletant strain was indistinguishable from a single
exponential at all concentrations (Fig. 3A). The half-time for
efflux in the deletant strain was 12–15 min, similar to the time
course for influx (Fig. 2) and in excellent agreement with the
half-time for boron efflux in the same deletant strain published
by Takano et al. (30).
AJP-Cell Physiol • VOL
Fig. 3. Saturable boron efflux mediated by Bor1p. A: time course of efflux of
boron from cells with deleted BOR1 (strain 1169). Cells were loaded with
boron by incubation in YPD plus 2, 4, or 16 mM B(OH)3 for 1.5 h at 30°C.
Efflux was measured in YPD with no added boron, pH 5.0 –5.5, at 30°C.
B: time course of efflux of boron from cells with wild-type BOR1 (strain
6808). Cells were loaded with boron by incubation in YPD plus 4, 8, or 16 mM
B(OH)3 for 1.5 h at 30°C. Efflux was measured as in A. C: efflux of boron into
YPD medium as a function of the intracellular boron concentration ([B]in)
[strain 6808 (wild-type BOR1)]. Data points were derived from the efflux
measurements in Fig. 4B and other similar experiments (see MATERIALS AND
METHODS). Open circles represent efflux from cells that had been grown
overnight in YPD plus 10 mM H3BO3; filled symbols represent efflux from
cells that had been exposed to 4, 8, 10, or 16 mM H3BO3 for 60 –90 min before
the efflux was measured. The dashed line represents the diffusive efflux
measured in the deletant strain (from data in A). The curve through the data
represents a Michaelis-Menten function added to the diffusive efflux represented by the dashed line. The Michaelis-Menten parameters for the curve
were Vmax ⫽ 0.67 mmol 䡠 liter cell water⫺1 䡠 min⫺1 and Km ⫽ 1.8 mmol/liter
cell water. cw, Cell water.
293 • JULY 2007 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.5 on June 15, 2017
In contrast to the deletant strain, the time course of boron
efflux from the wild-type strain was exponential only at the
lowest concentrations (Fig. 3B). At cellular boron concentrations above ⬃1 mM, the semilogarithmic slope was progressively steeper as the intracellular concentration decreased,
indicating that efflux saturates at high boron concentrations.
Instantaneous effluxes at each intracellular boron concentration
are plotted in Fig. 3C. Efflux was described reasonably well by
a hyperbolic (Michaelis-Menten) function plus a nonsaturable
component, the magnitude of which was derived independently
from the fluxes in the knockout strain (Fig. 3A). The maximal
efflux for the saturable component was 0.7 mmol䡠liter cell
water⫺1 䡠min⫺1, and the half-maximal intracellular boron concentration was roughly 1–2 mM.
Direct demonstration of uphill boron efflux. The steady-state
distribution and efflux rates of boron in wild-type strain were
certainly consistent with the idea that Bor1p mediates an uphill
boron efflux. A direct demonstration of active boron transport
requires loading of cells with a high boron concentration and
showing that Bor1p can transport boron outward against a
gradient. In the experiment shown in Fig. 4, cells were pre-
C472
YEAST BORIC ACID TRANSPORT
the steady-state boron distribution was not affected by the
presence of 25 mM HCO⫺
3 (with sufficient CO2 to be in
equilibrium with HCO⫺
3 at the stated pH). Moreover, net boron
efflux into a low-boron (10⫺5 M) medium at pH 6.35 was not
affected by 29 mM HCO⫺
3 (Fig. 5C). The fact that there was no
detectable effect of ⬃30 mM HCO⫺
3 in the extracellular medium (which must also increase intracellular CO2 and HCO⫺
3)
suggests that bicarbonate does not interfere with boron transport (see DISCUSSION).
Lack of induction of BOR1 by growth in media containing
H3BO3. The rate of boric acid efflux was not strongly affected
by the duration of exposure of cells to boric acid. The filled
symbols in Fig. 3C refer to cells that had been acutely loaded
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.5 on June 15, 2017
Fig. 4. Direct demonstration of active boron efflux mediated by Bor1p. Yeast
cells of strain 1169 (BOR1 deletant) or 6808 (wild-type BOR1) were incubated
for 90 min in YPD containing 40 mM H3BO3 and 5 mM citrate buffer, pH 5.5.
Cells were centrifuged and resuspended in YPD and 5 mM citrate, pH 5.5, and
incubated at 30°C. At the indicated times, aliquots were centrifuged, and the
boron contents of cells ([B]in) and medium ([B]out) were measured using the
curcumin method.
loaded in YPD medium containing 40 mM H3BO3, centrifuged, and resuspended in medium containing 2 mM H3BO3,
and the time courses of intracellular and extracellular boron
concentrations were measured. In the deletant strain, intracellular boron concentration dropped progressively from an initial
value of over 20 mM to a final value very close to the
extracellular concentration, as expected if boron transport in
these cells is mainly by way of passive diffusion. In the
wild-type strain, the boron concentration dropped to a value far
below the extracellular level, demonstrating directly that Bor1p
catalyzed an uphill efflux of boron, resulting in an inward
gradient of about sevenfold. The final boron distribution in
cells preloaded in a 40 mM boron medium and then resuspended in 2 mM boron was indistinguishable from that of cells
in 2 mM boron with no preexposure to high boron concentration (Fig. 2).
Extracellular pH dependence of efflux suggests H⫹ antiport.
The rate of efflux of boron from cells with intact BOR1 was
dependent on the extracellular pH (Fig. 5A). Efflux was more
rapid at pH 5.5 than at pH 6.5–7, consistent with the idea that
the uphill boron efflux is driven by the inward H⫹ gradient.
Figure 5B shows that the steady-state distribution of boron was
more symmetrical at higher pH, again consistent with the idea
that the uphill boron efflux is driven by an influx of H⫹. We
attempted to detect H⫹ influx associated with boron efflux, but
the background rate of H⫹ efflux was too high to detect an
decrement associated with boron transport.
Lack of effect of bicarbonate on boron distribution and
efflux. Because Bor1p is a member of the bicarbonate transporter family, it was of interest to determine whether bicarbonate itself is either transported by Bor1p or affects boron
transport. Tracer (H14CO3⫺ ) bicarbonate transport measurements are possible in principle, but only with extremely high
pH on both sides of the membrane (see Ref. 36); these
conditions are not compatible with a study of intact yeast. It is,
however, possible to vary CO2/HCO⫺
3 at constant extracellular
pH and measure the effect on boron distribution and transport.
Figure 5B shows that at extracellular pH of either 6.2 or 7.0,
AJP-Cell Physiol • VOL
Fig. 5. A: time course of efflux of boron into YPD medium at extracellular pH
5.0 ⫾ 0.1 and 6.6 ⫾ 0.4. Cells from strain 6808 (wild-type BOR1) were loaded
with boron by preincubation for 1 h at 30°C in YPD plus 5 mM B(OH)3. Cells
were centrifuged and resuspended at 22°C in YPD buffered with 10 () or 20
mM MOPS (Œ) (initial pH 7.0) or 10 mM MOPS and 5 mM citrate, pH 5.0 (■,
F). The lines through the data correspond to efflux rate constants of 0.068
min⫺1 (, Œ) and 0.155 min⫺1 (■, F). B: lack of effect of HCO⫺
3 /CO2 on the
steady-state distribution of boron. Cells from strain 6808 were incubated 60
min in YPD, pH 6.2 ⫾ 0.1 or 7.0 ⫾ 0.1, containing 2 mM H3BO3, and the
boron distribution was measured at 30°C as in Fig. 3, in the presence (CO2)
and absence (air) of 25–30 mM HCO⫺
3 /CO2 (see MATERIALS AND METHODS).
Bars represent means and SD of a total of 4 determinations using 2 separate
cell preparations at each pH value. C: lack of effect of HCO⫺
3 /CO2 on boron
efflux. Overnight cultures of strain 6808 were loaded with boron by incubation
for 1 h at 30°C in YPD and 4 mM H3BO3, buffered with 10 mM Bis-Tris and
5 mM citrate. Suspensions were bubbled with air (no added HCO⫺
3 ) or with
70% CO2-30% O2 and 29 mM added KHCO3. In both cases, the extracellular
pH was 6.35 ⫾ .05. After boron loading, cells were centrifuged, supernatant
was removed, and efflux was initiated by resuspension at 22°C in the same
medium (air or CO2/HCO⫺
3 ) without added boron.
293 • JULY 2007 •
www.ajpcell.org
YEAST BORIC ACID TRANSPORT
C473
Fig. 6. A: time course of boron efflux from cells of strain 6808 (wild-type
BOR1) that had been incubated in YPD plus 10 mM or 40 mM H3BO3 for
either 1 h (F, E) or overnight (Œ, ‚). Efflux was measured at 30°C in YPD with
no added boron, as in Fig. 3. B: relative levels of BOR1 mRNA of cells of
strain 6808 grown overnight in YPD with 0 or 10 mM added H3BO3. Error
bars represent range of 2 determinations on 2 different cell preparations with
real-time RT-PCR.
with H3BO3 for 1–1.5 h. Data indicated by open symbols were
derived from experiments on cells that had been grown overnight in 10 mM H3BO3. This concentration retarded growth
somewhat (see below) but allowed growth of cells in sufficient
quantities for transport assays. The boron efflux at each intracellular concentration was indistinguishable in cells loaded
overnight from that in cells exposed to boron for 1–1.5 h. This
finding is illustrated further in Fig. 6A, which shows the time
course of boron efflux from parallel cultures, each of which
was loaded with boron by incubation in 10 mM H3BO3. One of
the cultures was incubated with 10 mM H3BO3 overnight, and
the other was incubated for 1 h. There may have been a slight
increase in the rate of efflux in the cells that had been exposed
to boron overnight, but the effect was small. Overnight incubation at an even higher boron concentration, 40 mM, also did
not increase the rate of boron efflux compared with cells loaded
for only 1.6 h (Fig. 6A, open symbols).
Figure 6B shows the relative amounts of BOR1 mRNA, as
estimated by real-time RT-PCR on extract of cells from the
same cultures as those used in the transport experiments in Fig.
6A. There may have been a slight stimulation of mRNA levels
by incubation in 10 mM H3BO3, but, as was observed with
transport, the effect was small. Therefore, expression of neither
BOR1 mRNA nor functional Bor1p is strongly stimulated by
growth in media containing concentrations of H3BO3 sufficient
to cause a severalfold inhibition of cumulative growth in
overnight cultures (see below).
Effect of H3BO3 on growth of S. cerevisiae. Although ⬃10⫺5
M H3BO3 is included in many synthetic culture media for S.
cerevisiae (29), it is not clear whether boron is absolutely
AJP-Cell Physiol • VOL
Fig. 7. Effect of boric acid on growth of S. cerevisiae. Exponential cultures
were diluted in media containing 0, 3, 6, 10, 20, 40, 60, or 80 mM B(OH)3 and
incubated at 30°C aerobically with rotary shaking. Cell density was measured
at 60- to 90-min intervals as absorbance at 590 nm. Growth rate was calculated
by fitting absorbance to an exponential function of time for at least 4 data
points covering 4 – 6 h. Rates are plotted relative to the rate with no added
boron. A: strain 1169 (BOR1 deletant) or strain 6808 (wild-type BOR1) grown
in YPD (2% glucose). Values are means ⫾ SD of 3 cell preparations. B: strain
1169 (BOR1 deletant) with plasmid pG1T/BOR1 (overexpressed) grown in
YNB (2% galactose or 2% glucose). Values are means ⫾ range of 2 cell
preparations. For comparison, the dotted curves at right represent the data for
the deletant strain from the respective strain at left.
293 • JULY 2007 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.5 on June 15, 2017
essential for yeast growth. Boron is, however, a significant
nutrient for S. cerevisiae, because the addition of boric acid to
nominally boron-free synthetic medium increases cell number
by ⬃50% in overnight cultures (3). The half-maximal effect
of boron on growth is in the low micromolar range (3). Using
both the curcumin assay and ICP-MS, we estimated that the
boron concentration in the YPD medium we used was 1–5 ⫻
10⫺5 M. The boron concentration in normal YPD medium is
therefore adequate for optimum growth.
At concentrations much higher than those normally found in
growth medium, boric acid is known to be toxic to yeast (21,
22). If Bor1p is able to keep the cellular boron levels low in the
presence of potentially toxic extracellular concentrations of
boron, then the BOR1 deletant strain should be more susceptible than wild-type strains to growth inhibition by boron.
Figure 7A shows that wild-type and BOR1 deletant strains had
similar sensitivity to growth inhibition by H3BO3. Although
expression of native Bor1 did not strongly protect yeast from
C474
YEAST BORIC ACID TRANSPORT
indicated that the most common morphology in both strains
was the single large vacuole but that the deletant strain had a
higher percentage of cells (⬃25%) with multiple vacuoles than
did the wild-type strain (⬃10%).
To ensure that the deletant strain used for microscopy was
authentic, we measured cellular boron contents (following 60
min of incubation in 2 mM extracellular boron in YPD) in
aliquots of the same cultures used for microscopy. As expected, the intracellular boron concentration in the contents of
the wild-type strain were sevenfold lower than in the deletant strain. Our data indicate that there does appear to be an
abnormal vacuolar morphology or a vacuolar fusion defect
in the BOR1 deletant strain used, but the abnormality is not
nearly as pronounced as that described by Decker and
Wickner (10).
DISCUSSION
Active efflux of boron driven by electrochemical H⫹ gradient. The transport experiments described provide direct demonstration of uphill boron efflux mediated by S. cerevisiae
Bor1p (Fig. 4). The most likely mechanism for this efflux is a
coupled exchange of intracellular H3BO3 for extracellular H⫹,
as indicated by the fact that the steady-state boron gradient was
steeper at more acid extracellular pH and net efflux was
accelerated by lowering the extracellular pH (Fig. 5). In glucose-fed S. cerevisiae in the presence of extracellular K⫹ (in
our experiments as K-citrate buffer), the cytoplasmic pH is
near neutrality (7.0 ⫾ 0.5) over a wide range (pH 4 – 8) of
extracellular pH values (5, 25). It is reasonable to assume,
therefore, that the cytoplasmic pH in our experiments was
Fig. 8. Vacuole morphology in wild-type and BOR1 deletant strains. Overnight cultures in YPD were labeled with FM4-64 as described by Vida and Emr (34)
(see MATERIALS AND METHODS). Slides were prepared of cells either in YPD (A and C) or within 30 min of suspension in water (B and D). Images at left of each
panel are differential interference contrast images, and images at right are FM4-64 fluorescence.
AJP-Cell Physiol • VOL
293 • JULY 2007 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.5 on June 15, 2017
growth inhibition by H3BO3, overexpression of Bor1p under
control of the GAL1 promoter did protect (Fig. 7B), as expected from the work of Nozawa et al. (20).
Vacuolar morphology in BOR1 deletant strain. Decker and
Wickner (10) recently showed that the majority of cells in a
BOR1 deletant strain have fragmented vacuoles that lack
several proteins normally associated with vacuoles. This finding suggests that Bor1p has a subcellular function that is
distinct from its role as a plasma membrane transport protein.
To investigate further a possible role of Bor1p in vacuolar
dynamics, we used FM 4-64 fluorescence (10, 34) to examine
vacuolar morphology in control and BOR1 deletant strains. For
micrographs shown in Fig. 8, A and C, slides were prepared
directly from suspensions in YPD. In these micrographs, the
FM 4-64 fluorescence in most cells was mainly in one to three
medium-sized vacuoles, very similar to the FM 4-64 pattern
originally shown by Vida and Emr (34). Vacuolar morphologies in YPD were similar in BOR1 deletant and wild-type
strains (Fig. 8, A and C), although there appeared to be slightly
more cells with multiple vacuoles in the deletant strain. Because of the heterogeneity of vacuolar morphology in both
wild-type and deletant strains, it is difficult to quantify the
difference between the two strains in YPD medium.
It is known that suspending either Schizosaccharomyces
pombe (4, 6) or Saccharomyces cerevisiae (35) in hyposmotic
medium causes a rapid fusion of vacuoles into a single large
organelle in most cells. Figure 8, B and D, shows vacuolar
morphology of control and deletant strains within 30 min
following resuspension in distilled water. The morphology is
clearly distinct from that observed in YPD medium, with many
cells showing single large vacuoles. Blind scoring of full fields
YEAST BORIC ACID TRANSPORT
AJP-Cell Physiol • VOL
suggesting that this transporter can drive boron into the cell or
inhibit the efflux driven by Bor1p. Under the conditions we
used, we did not find any evidence for uphill inward transport
of boron; further work is needed to determine the mechanism
by which DUR1 deletion causes a decrease in cellular boron.
Role of Bor1p in protecting yeast from boron toxicity. Our
data on the effects of boron on growth are similar to those of
Takano et al. (30), although they are presented in a somewhat
different way. Our data are given as growth rates in exponential cultures, whereas Takano et al. (30) plotted cumulative
growth after 11 h. Takano et al. found that cumulative growth
of the deletant strain in 5 mM boron is 25% lower than that of
the wild-type strain. In terms of growth rate of an exponential
culture, this amounts to a difference of about 15%. We did not
observe a detectable difference between wild-type and deletant
strains regarding the effects of boron on growth rates, but it is
possible that an effect of 15% would be within the error of our
measurements.
Nozawa et al. (20) showed that in medium containing 90
mM boron, the deletion strain has about 10% more cellular
boron than the wild-type strain (20). We did not examine
concentrations this high, but a 10% difference is certainly
compatible with the data we obtained at lower concentrations
(Fig. 2). At high boron concentrations, the efflux driven by
Bor1p is sufficient to cause a significant difference in growth
on plates (20), although the cellular boron levels are decreased
by only 10%.
Although it is quite clear from this study and the work of
Takano et al. (32) that Bor1p catalyzes the uphill extrusion of
boron across the plasma membrane of S. cerevisiae, it is also
true that some of the characteristics of yeast boric acid transport described presently would not be expected if the main
purpose of Bor1p were to protect cells from the toxic effects of
boric acid/borate. Bor1p is constitutively expressed in cells
grown in YPD medium, which contains boric acid at concentrations far below toxic levels, and the BOR1 gene is not
induced by exposure of cell to boron (Fig. 6; see also Ref. 30).
If the purpose of Bor1p were to extrude boric acid as a
detoxification mechanism, then it would be surprising that the
protein is produced under conditions in which it would not be
needed and not strongly induced by conditions that would seem
to require it.
Oxyanion transport by Bor1p? Zhao and Reithmeier (37)
showed that a variety of inorganic anions, including some
oxyanions, can compete for stilbenedisulfonate binding to
Bor1p, and it is possible that Bor1p is a H⫹-coupled exchanger
that can extrude not only boric acid but other inorganic species.
Boron is a metalloid, along with silicon, germanium, arsenic,
antimony, tellurium, and polonium. S. cerevisiae has separate
mechanisms for arsenic and antimony resistance that are unrelated to BOR1 (33). Arsenite exposure has an approximately
twofold stimulatory effect on transcription of BOR1 (15), and
it is possible that Bor1p can transport arsenite or arsenate.
There are many other possible oxides or oxyanions that could
be substrates. In addition to determining the boron content of
the control and BOR1 deletant strains, the cellular contents of
20 other metals and metalloids was determined by ICP-MS
(data not shown). There were no consistent differences in the
cellular contents of any of these elements in the deletant and
control strains under the conditions tested. A systematic study
using media containing specific additions of other metalloids is
293 • JULY 2007 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.5 on June 15, 2017
neutral and that the inward H⫹ gradient decreased as the
extracellular pH was raised. Accordingly, the observed effect
of extracellular pH on both the boron efflux and the steadystate distribution (Fig. 5) are consistent with the idea that
Bor1p catalyzes a 1:1 exchange of H⫹ for H3BO3. A coupled
H⫹/H3BO3 exchange through Bor1p is certainly consistent
with the fact that other members of the bicarbonate transporter
family are coupled exchangers or cotransporters (1, 18, 26). It
is also worth noting that at least one member of the family, the
anion exchanger AE1, can transport H⫹ under some circumstances (16, 19).
Lack of apparent interaction with bicarbonate. We found
that there was no effect of 25–30 mM HCO⫺
3 on boron
distribution or H3BO3 efflux mediated by Bor1p in the extracellular pH range 6.2–7.0 (Fig. 5). It has been known for many
years that bubbling a yeast suspension with CO2 causes major
buildup of intracellular HCO⫺
3 (5, 7). Therefore, intracellular
and extracellular HCO⫺
3 , CO2, and H2CO3H concentrations
were all elevated in the experiments in Fig. 5, with no detectable effect on either boron distribution or efflux. The simplest
interpretation of this finding is that HCO⫺
3 is not a substrate
for yeast Bor1p. This is perhaps not surprising, given that
H3BO3 is transported outward by Bor1p and that, under
most conditions, there is an outward bicarbonate gradient in
yeast [cytoplasmic pH higher than extracellular pH (5, 25)].
Accordingly, Bor1p clearly does not catalyze an exchange
of HCO⫺
3 for H 3BO 3.
Takano et al. (32) measured the effect of neutral pH and
HCO⫺
3 on boron distribution in wild-type yeast. In agreement
with our data, they found that the boron distribution at neutral
pH is much more symmetrical than at acid pH. They also found
that addition of 30 mM NaHCO3 doubles the boron contents of
yeast cells incubated in a medium containing 0.5 mM H3BO3
and buffered at pH 7 with MES-Tris. This result is clearly
different from those of the experiment shown in Fig. 5, in
which we found no effect of a similar HCO⫺
3 concentration.
The final pH (after 1 h of incubation) of the suspensions used
by Takano et al. (32) was not specified; it is possible that pH
differences caused by the presence or absence of HCO⫺
3 could
contribute to the observed effect of 30 mM HCO⫺
on
boron
3
distribution.
Other transport pathways for H3BO3. The present data can
be explained nearly quantitatively without postulating any
boron transport pathways other than efflux through Bor1p and
passive diffusion across the lipid bilayer. The rate constant for
boron efflux in the deletant strain is ⬃0.05/min (Fig. 3). For a
cell with a volume-to-surface ratio of ⬃0.8 ⫻ 10⫺4 cm (29),
this rate constant corresponds to a permeability coefficient of
⬃6 ⫻ 10⫺8 cm/s. This value is toward the lower end of the
range (9.5 ⫻ 10⫺9 to 7 ⫻ 10⫺6 cm/s) determined by Dordas
and Brown (11) for the passive permeability of lipid bilayer
membranes to B(OH)3. This permeability coefficient is about
fivefold lower than the H3BO3 permeability of squash root
plasma membrane vesicles, where proteins of the aquaporin
family may contribute to the H3BO3 flux (12). In S. cerevisiae
the passive H3BO3 permeability is sufficiently low that there is
no reason to postulate a role for aquaporins, and the recent data
of Nozawa et al. (20) indicate that neither aquaporin AQY1 nor
AQY2 has a measurable effect on boron distribution.
Nozawa et al. (20) also showed that deletion of the urea
transporter DUR3 causes a decrease in the cellular boron level,
C475
C476
YEAST BORIC ACID TRANSPORT
necessary to determine whether there are other substrates for
Bor1p.
Possible effect on vacuolar morphology. The micrographs in
Fig. 8 show that vacuolar morphology, in either YPD or
hyposmotic medium, is similar in control and BOR1 deletant
strains. There are slightly more cells with multiple vacuoles in
the deletant strain, but the difference is much less dramatic
than that found by Decker and Wickner (10), who showed that
95% of BOR1 deletant cells have fragmented vacuoles. We
have no explanation for the difference between the two studies,
and further work is needed to determine the extent of the
vacuolar abnormality in BOR1 deletant strains under various
growth conditions.
ACKNOWLEDGMENTS
GRANTS
This work was supported by National Institute of General Medical Sciences
Grant R01 GM026861-25 (J. Evans was supported by National Institutes of
Health Supplement GM026861-23S1).
REFERENCES
1. Alper SL, Darman RB, Chernova MN, Dahl NK. The AE gene family
of Cl/HCO3 exchangers. J Nephrol 15: S41–S53, 2002.
2. Banuelos MA, Sychrova H, Bleykasten-Grosshans C, Souciet J, Potier
S. The Nha1 antiporter of Saccharomyces cerevisiae mediates sodium and
potassium efflux. Microbiology 144: 2749 –2758, 1998.
3. Bennett A, Rowe RI, Soch N, Eckhert CD. Boron stimulates yeast
(Saccharomyces cerevisiae) growth. J Nutr 129: 2236 –2238, 1999.
4. Bone N, Millar JB, Toda T, Armstrong J. Regulated vacuole fusion and
fission in Schizosaccharomyces pombe: an osmotic response dependent on
MAP kinases. Curr Biol 8: 135–144, 1998.
5. Calahorra M, Martinez GA, Hernandez-Cruz A, Pena A. Influence of
monovalent cations on yeast cytoplasmic and vacuolar pH. Yeast 14:
501–515, 1998.
6. Cheng H, Sugiura R, Wu W, Fujita M, Lu Y, Sio S, Kawai R,
Takegawa K, Shuntoh H, Kuno T. Role of the Rab GTP-binding protein
Ypt3 in the fission yeast exocytic pathway and its connection to
calcineurin function. Mol Biol Cell 13: 2963–2976, 2002.
7. Conway EJ, Brady TG. Biological production of acid and alkali. 1.
Quantitative relations of succinic and carbonic acids to the potassium and
hydrogen ion exchange in fermenting yeast. Biochem J 47: 360 –369,
1950.
8. Conway EJ, Downey M. An outer metabolic region of the yeast cell.
Biochem J 47: 347–355, 1950.
9. Coury LA, McGeoch JEM, Guidotti G, Brodsky JL. The yeast
Saccharomyces cerevisiae does not sequester chloride but can express a
functional mammalian chloride channel. FEMS Microbiol Lett 179: 327–
332, 1999.
10. Decker BL, Wickner WT. Enolase activates homotypic fusion and
protein transport to the vacuole in yeast. J Biol Chem 281: 14523–14528,
2006.
11. Dordas C, Brown PH. Permeability of boric acid across lipid bilayers and
factors affecting it. J Membr Biol 175: 95–105, 2000.
12. Dordas C, Chrispeels MJ, Brown PH. Permeability and channel-mediated transport of boric acid across membrane vesicles isolated from squash
roots. Plant Physiol 124: 1349 –1361, 2000.
13. Grippo AA, Hamilton B, Hannigan R, Gurley BJ. Metal content of
ephedra-containing dietary supplements and select botanicals. Am J
Health Syst Pharm 63: 635– 644, 2006.
AJP-Cell Physiol • VOL
293 • JULY 2007 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.5 on June 15, 2017
We are grateful to Kernesha Townsend and Jonathan Evans for assistance
in performing some of the boric acid transport experiments. We are also
grateful to Vladimir Lupashin (University of Arkansas for Medical Sciences)
and Bob Farley (University of Southern California) for providing yeast strains
and helpful advice, to Brian Storrie (University of Arkansas for Medical
Sciences) for assistance with microscopy, and to Clifford Slayman (Yale
University) for helpful information about yeast cell water.
14. Groves JD, Falson P, LeMaire M, Tanner MJA. Functional cell surface
expression of the anion transport domain of human red cell band 3 (AE1)
in the yeast Saccharomyces cerevisiae. Proc Natl Acad Sci USA 93:
12245–12250, 1996.
15. Haugen AC, Kelley R, Collins JB, Tucker CJ, Deng C, Afshari CA,
Brown JM, Ideker T, Van Houten B. Integrating phenotypic and
expression profiles to map arsenic-response networks. Genome Biol 5:
R95, 2004.
16. Jennings ML. Proton fluxes associated with erythrocyte membrane anion
exchange. J Membr Biol 28: 187–205, 1976.
17. Kuroda T, Bihler H, Bashi E, Slayman CL, Rivetta A. Chloride channel
function in the yeast TRK-potassium transporters. J Membr Biol 198:
177–192, 2004.
18. Kurtz I, Petrasek D, Tatishchev S. Molecular mechanisms of electrogenic sodium bicarbonate cotransport: structural and equilibrium thermodynamic considerations. J Membr Biol 97: 77–90, 2004.
19. Milanick MA, Gunn RB. Proton-sulfate cotransport: external proton
activation of sulfate influx into human red blood cells. Am J Physiol Cell
Physiol 247: C247–C259, 1984.
20. Nozawa A, Takano J, Kobayashi M, von Wirén N, Fujiwara T. Roles
of BOR1, DUR3, and FPS1 in boron transport and tolerance in Saccharomyces cerevisiae. FEMS Microbiol Lett 262: 216 –222, 2006.
21. Otero L, Fleites A, Mendez FJ, Palacio V, Vazquez F. Susceptibility of
Candida species isolated from female prostitutes with vulvovaginitis to
antifungal agents and boric acid. Eur J Clin Microbiol Infect Dis 18:
59 – 61, 1999.
22. Otero L, Palacio V, Mendez FJ, Vazquez F. Boric acid susceptibility
testing of non-C. albicans Candida and Saccharomyces cerevisiae: comparison of three methods. Med Mycol 40: 319 –322, 2002.
23. Park M, Li Q, Shcheynikov N, Zeng W, Muallem S. NaBC1 is a
ubiquitous electrogenic Na⫹-coupled borate transporter essential for cellular boron homeostasis and cell growth and proliferation. Mol Cell 16:
331–341, 2004.
24. Parker MD, Ourmozdi EP, Tanner MJA. Human BTR1, a new bicarbonate transporter superfamily member and human AE4 from kidney.
Biochem Biophys Res Commun 282: 1103–1109, 2001.
25. Pena A, Ramirez J, Rosas R, Calahorra M. Proton pumping and the
internal pH of yeast cells, measured by pyranine introduced by electroporation. J Bacteriol 177: 1017–1022, 1995.
26. Romero MF, Fulton CM, Boron WF. The SLC4 family of HCO⫺
3
transporters. Pflügers Arch 447: 495–509, 2004.
27. Romero MF, Henry D, Nelson S, Harte PJ, Dillon AK, Sciortino CM.
Cloning and characterization of a Na⫹-driven anion exchanger (NDAE).
J Biol Chem 275: 24552–24559, 2000.
28. Saier MH Jr. Families of proteins forming transmembrane channels. J
Membr Biol 175: 165–180, 2000.
29. Sherman F. Getting started with yeast. Methods Enzymol 194: 3–21,
1991.
30. Takano J, Kobayashi M, Noda Y, Fujiwara T. Saccharomyces cerevisiae Bor1 is a boron exporter and a key determinant of boron tolerance.
FEMS Microbiol Lett 267: 230 –235, 2007.
31. Takano J, Miwa K, Yuan L, von Wirén N, Fujiwara T. Endocytosis
and degradation of BOR1, a boron transporter of Arabidopsis thaliana,
regulated by boron availability. Proc Natl Acad Sci USA 102: 12276 –
12281, 2005.
32. Takano J, Noguchi K, Yasumori M, Kobayashi M, Gajdos Z, Miwa K,
Hayashi H, Yoneyama T, Fujiwara T. Arabidopsis boron transporter for
xylem loading. Nature 420: 337–340, 2002.
33. Tamas MJ, Wysocki R. Mechanisms involved in metalloid transport and
tolerance acquisition. Curr Genet 40: 2–12, 2001.
34. Vida TA, Emr SD. A new vital stain for visualizing vacuolar membrane
dynamics and endocytosis in yeast. J Cell Biol 128: 779 –792, 1995.
35. Wang YX, Kauffman EJ, Duex JE, Weisman LS. Fusion of docked
membranes requires the armadillo repeat protein Vac8p. J Biol Chem 276:
35132–35140, 2001.
36. Wieth JO. Bicarbonate exchange through the red cell membrane determined with [14C]bicarbonate. J Physiol 294: 521–539, 1979.
37. Zhao R, Reithmeier RAF. Expression and characterization of the anion
transporter homologue YNL275w in Saccharomyces cerevisiae. Am J
Physiol Cell Physiol 281: C33–C45, 2001.