Suppression of Endothelial P-Selectin Expression
Contributes to Reduced Cell Trafficking in Females
An Effect Independent of NO and Prostacyclin
Inmaculada C. Villar, Ramona S. Scotland, Rayomand S. Khambata, Melissa Chan, Johan Duchene,
Andre L. Sampaio, Mauro Perretti, Adrian J. Hobbs, Amrita Ahluwalia
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Objective—Sex hormones underlie the lower incidence of cardiovascular disease in premenopausal women. Vascular
inflammation is involved in the pathogenesis of several cardiovascular diseases and it has been reported that sex
hormones modulate inflammatory responses but mechanisms responsible for these effects are not yet fully established.
Herein, we assessed whether sex differences in leukocyte recruitment might exist and investigated the underlying
mechanisms involved in this response.
Methods and Results—Treatment with interleukin-1␤ (IL-1␤) or tumor necrosis factor-␣ caused leukocyte rolling,
adhesion, and emigration in mesenteric postcapillary venules in vivo that was substantially reduced in female mice
compared with male mice; this difference was abolished by ovariectomy and partially restored by estrogen replacement.
Deletion of endothelial nitric oxide (NO) synthase or cyclooxygenase-1 alone or in combination did not alter the
leukocyte recruitment in IL-1␤-treated females but significantly enhanced this response in male mice. Treatment of
murine pulmonary endothelial cells with IL-1␤ increased expression of P-selectin in male but not female cells.
Conclusion—We have demonstrated a profound estrogen-dependent and NO and prostacyclin-independent suppression of
leukocyte recruitment in females. (Arterioscler Thromb Vasc Biol. 2011;31:1075-1083.)
Key Words: endothelium 䡲 gender 䡲 leukocytes 䡲 nitric oxide 䡲 prostacyclin
A
endothelium is critical in maintaining an antiinflammatory,
and thereby antiatherogenic, phenotype of the blood vessel
wall.10,11 This activity has been attributed to its capacity to
release factors that not only alter the tone and growth of the
underlying smooth muscle but also regulate the reactivity of
circulating white cells, erythrocytes, and platelets and govern
vascular permeability. The prevailing wisdom currently promotes the thesis that estrogens upregulate the synthesis,
release, and activity of protective endothelial factors and
thereby sustain the protective phenotype conveyed by the
endothelium and underpin the protection of females from
cardiovascular disease.7
A significant proportion of this cytoprotective activity of
the endothelium has been attributed to alterations in NO
bioavailability by upregulation of synthesis, activity, or
both.5,12 However, the role of other potentially beneficial
endothelial mediators, including prostacyclin (PGI2) and
endothelium-derived hyperpolarizing factor (EDHF), has received little attention. There is some evidence, from diverse
animal models of inflammation, to suggest the existence of
sex hormone– dependent male/female differences in inflam-
lower incidence of cardiovascular disease in premenopausal women compared with age-matched male counterparts and postmenopausal women1,2 suggests that female
sex underlies a protective effect on the cardiovascular system.
Indeed, a wealth of evidence from observational and experimental studies, in both animals and humans, supports the
concept of a protective effect of ovarian hormones, predominantly estrogens.3,4 Understanding the molecular pathways
that underlie the beneficial effects of estrogens may, therefore, identify novel strategies that could be taken to harness
the therapeutic potential of hormone therapy safely and novel
targets to treat cardiovascular disease in both sexes.
A number of targets/pathways/mediators have been proposed to play a role in mediating the beneficial effects of
female sex hormones.3,5–7 Of these mechanisms, there is a
substantial body of evidence implicating estrogen-induced or
estrogen-enhanced activation of the endothelium.5 Endothelial dysfunction is thought to be instrumental in precipitating
the vascular inflammation that is an early and crucial event in
the pathogenesis of a number of cardiovascular disorders (eg,
atherosclerosis, ischemia/reperfusion injury).8,9 In health, the
Received on: October 11, 2010; final version accepted on: February 10, 2011.
From the Department of Pharmacology, University College London, London, United Kingdom (I.C.V., A.J.H.); William Harvey Research Institute,
Barts & London Medical School, Queen Mary University of London, London, United Kingdom (R.S.S., R.S.K., M.C., J.D., A.L.S., M.P., A.A.).
Drs Hobbs and Ahluwalia contributed equally to this work.
Correspondence to Amrita Ahluwalia, William Harvey Research Institute, Barts & London Medical School, Queen Mary University of London,
EC1M 6BQ London, United Kingdom. E-mail [email protected]
© 2011 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
1075
DOI: 10.1161/ATVBAHA.111.223545
1076
Arterioscler Thromb Vasc Biol
May 2011
matory cell recruitment.13–18 However, the exact pathways
(ie, whether this regulation occurs at the level of the endothelium or at the level of the circulating cell) and the
mediators involved are uncertain.
In this study, we demonstrate that reduced expression of
P-selectin underlies the attenuated leukocyte recruitment that
occurs in female mice in response to acute inflammatory stimuli.
Moreover, we demonstrate that although both NO and PGI2
tonically repress leukocyte recruitment in response to inflammatory stimuli in males, neither mediator has a role in females.
Materials and Methods
Animals
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
All experiments were conducted according to the Animals (Scientific
Procedures) Act 1986 (United Kingdom). The experiments were
performed on age-matched (6 to 7 weeks) female and male wild-type
(WT; C57BL6, Charles River), endothelial nitric oxide (NO) synthase knockout (eNOS⫺/⫺),19 cyclooxygenase-1 knockout (COX-1⫺/⫺),20
and eNOS⫺/⫺/COX-1⫺/⫺ double knockout (dKO) mice.21 All
knockout mice were bred in-house. In addition female WT ovariectomized (OVX) and sham-operated control animals were purchased
from Charles River. Ovariectomy was performed on sexually immature mice at 4 weeks of age. In 16 OVX mice, Alzet iosmotic pumps
(model 1004) were implanted at the time of surgery (Charles River),
containing vehicle (polyethylene glycol 400, Sigma-Aldrich) or a
replacement dose of estrogen of 0.4 ␮g/day providing physiological
levels in mice as previously demonstrated.22 Experiments were
conducted on these animals 2 weeks after surgery. Mice were
maintained in a 12-hour light/dark-cycle room with free access to
food and water.
Determination of Plasma Estrogen Concentration
Blood was collected into heparin by cardiac puncture from mice
anesthetized with isoflurane. Following centrifugation at 14 000 g
for 10 minutes at 4°C plasma was collected and estrogen concentration determined according to the manufacturer’s instructions using a
commercially available enzyme-linked immunoassay (estradiol EIA,
Cayman Chemical Co, Inc).
Myeloperoxidase Activity
Mesenteric tissue, collected at 0 minutes, 90 minutes, or 4 hours after
interleukin-1␤ (IL-1␤; 5 ng/mouse IP) treatment, was homogenized
in 1 mL of 0.5% hexadecyltrimethylammonium bromide in MOPS
buffer (10 mmol/L, pH 7). After homogenization, samples were
centrifuged at 4000 g for 20 minutes at 4°C, and the supernatant was
collected for determination of myeloperoxidase (MPO) levels as
previously described.23 MPO levels are expressed relative to protein
content as determined by Bradford assay.
Hematoxylin and Eosin Staining
Whole sections of mesentery were prepared on microscope slides
and dried overnight. General structures were identified by staining
with hematoxylin and eosin to enable identification of polymorphonuclear and mononuclear cells.
Intravital Microscopy
WT, eNOS⫺/⫺, COX-1⫺/⫺, and dKO (10 to 15 g) mice received
either murine IL-1␤ (5 ng, Peprotech),24 murine tumor necrosis
factor-␣ (TNF-␣; 300 ng, R&D Systems),25 or saline vehicle IP.
After 1.5, 4, or 24 hours, mice were anesthetized with diazepam (6
mg/kg SC) and Hypnorm (0.7 mg/kg fentanyl citrate and 20 mg/kg
fluanisone IM), cautery incisions were made along the abdominal
region, and the mesenteric vascular bed was exteriorized for intravital microscopy recordings (for full details, see the Supplemental
Methods, available online at http://atvb.ahajournals.org). The extent
of basal and cytokine-elicited leukocyte rolling was analyzed by
counting the number of cells passing a fixed point per minute
(cells/min). A leukocyte was considered to be adherent to venular
endothelium if it remained stationary for a period of at least 30 s.
Adherent cells were expressed as the number per a 100-␮m length of
venule counted over 1 minute.
Air Pouch Model
IL-1␤ was used to induce cell migration (⬎90% neutrophils) into the
mouse air pouch as previously described.26 On day 6, 20 ng of murine
recombinant IL-1␤ was dissolved in 0.5 mL of 0.5% carboxymethylcellulose and injected into the pouches. Control mice received carboxymethylcellulose alone. In both cases, air pouches were washed 4
hours after administration of the stimulus with 2 mL of phosphatebuffered saline containing heparin (50 U/mL) and EDTA (3 mmol/L),
and the samples were collected. These were then centrifuged at 220g for
15 minutes at 4°C, and pellets were resuspended in 2 mL of phosphatebuffered saline containing heparin and EDTA. Polymorphonuclear
numbers were estimated by counting after specific staining with Turk’s
solution using a Neubauer hematocytometer.
Murine Primary Lung Endothelial Cell Culture
Endothelial cells were prepared from lungs of C57BL6 WT mice
according to validated and standard techniques27,28 (see Supplemental Methods for details).
Flow Cytometry
Whole blood, air pouch supernatants, and murine endothelial cell
cultures were collected and subjected to fluorescence-activated cell
sorting analysis to assess both cell types and adhesion molecules
expressed using a FACSCalibur flow cytometer (Becton Dickinson)
using CellQuest software (Becton Dickinson) (see Supplemental
Methods for full details).
Real-Time Quantitative Reverse
Transcription–Polymerase Chain Reaction
Expression of key neutrophil chemokine mRNA (CXCL1, CXCL2,
CXCL5) in mouse mesenteric tissue was determined by real-time
quantitative reverse transcription–polymerase chain reaction (see
Supplemental Methods for details).
Statistical Analysis
All data are expressed as mean⫾SEM. Statistical analyses were
performed using GraphPad Prism 5.0 (San Diego) and significance
determined using the Student t test for differences between 2 data
groups, 1-way ANOVA for more than 2 groups, and 2-way ANOVA for
comparison between sexes with and without cytokine treatment followed by Bonferroni post test where appropriate. The n values quoted
similarly indicate the number of experiments and animals used.
Results
Sex Differences in Granulocyte Infiltration in
Mouse Air-Pouch Model
IL-1␤ caused a significant increase in GR-1-positive (Figure
1A and 1B) leukocyte recruitment into air pouches of male
but not female WT mice, as assessed at the 4-hour time point
(Figure 1C). In contrast to intact female mice, cell recruitment was significantly raised in response to IL-1␤ in OVX
mice (Figure 1B).
Plasma estrogen concentration was substantially lower in
OVX (28.1⫾8.5 pg/mL, n⫽12) compared with shamoperated control mice (46.01⫾6.4 pg/mL, n⫽16, P⬍0.05).
The remaining measured estrogen likely relates to extragonadal generation due to the activity of aromatase.29 In
addition, uterus weight was significantly decreased in OVX
mice (9.4⫾5 mg, n⫽22) compared with sham-operated control mice (82.1⫾16.5 mg, n⫽21, P⬍0.001). There were no
Villar et al
Leukocyte Recruitment and Female Sex
1077
Figure 1. Flow cytometry analysis of leukocytes infiltrated into air pouches. Sixday-old air pouches were injected with
IL-1␤ (20 ng) at time 0, with lavage fluids
being collected 4 hours later. A, Representative forward scatter (FSC)/side scatter
(SSC) dot-plot of the whole cell population
collected from air pouches and histogram
of GR-1 positive expression (black line)
versus control (grey line) of gated cells in
the population R1. B, Density dot-plots of
air pouch lavage fluids collected from
vehicle control and IL-1␤ (5 ng)–treated
male WT mice. C, Total number of GR-1
positive cells recovered from air pouches
following vehicle or IL-1␤ treatment in
male (n⫽5), female (n⫽5 control, n⫽9
IL-1␤), and OVX female (n⫽5) mice. Data
are mean⫾SEM. Statistical significance
was assessed using 2-way ANOVA among
the 3 groups at P⬍0.05 (interaction probability value was not significant) and with
Bonferroni post tests shown as #P⬍0.05.
Leukocyte Rolling Studies
Sex Differences in Leukocyte Rolling
IL-1␤ (5 ng IP) treatment caused a time-dependent increase
of leukocyte rolling and adhesion that was significantly
5
Male
Female
30
Adhesion (cells/100
Rolling (cells/min)
m)
B
A 40
20
10
#
*
0
0
4
8
12
16
Time post IL-1
C
20
Male
Female
4
3
2
1
*
#
0
24
0
4
8
(h)
D 250
MPO (U/g protein)
v
12
16
20
24
Time post IL-1 ( h)
#
200
150
100
50
0
Time post
IL-1 ( h)
0
1.5
4
F
m)
#
20
Adhesion (cells/100
E
15
10
5
0
Male
Female
0
1.5
Female
Male
Rolling (cells/min)
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
greater in magnitude in male compared with female mice
(2-way ANOVA, P⬍0.05; Figure 2A and 2B). Histological
assessment of whole mesentery demonstrated that neutrophils
represented the predominant cell type recruited in these
experimental conditions (Figure 2C). Accordingly, in a separate experiment, a time-dependent increase in MPO levels
was evident from 0 to 4 hours following IL-1␤ treatment in
male but not female mice (2-way ANOVA P⬍0.05; Figure
differences in body weight between groups (OVX⫽21.09⫾
0.8 g; sham-operated control⫽20.7⫾0.5 g). These results
confirm successful surgery in OVX mice.
###
8
6
4
2
0
Male
Female
4
Figure 2. Leukocyte– endothelial cell interactions in mouse mesenteric postcapillary
venules. WT female and male mice were
treated with IL-1␤ (5 ng IP) at time 0 and
then, at the reported times, instrumented for
intravital microscopy analysis of the mesenteric microcirculation conducted for assessment of leukocyte rolling (A) and leukocyte
adhesion (B) in female and male mice (n⫽10
to 15 animals per group). C, Typical hematoxylin and eosin staining of mesenteric
postcapillary venules (v) from a male WT
mouse treated with IL-1␤ (5 ng, 1.5 hours).
The arrows identify multilobed nuclei of
granulocytes. Magnification ⫻400. D, Timecourse of the cell recruitment in response to
IL-1␤ (5 ng) as determined by measurement
of MPO in WT male (n⫽12 to 15) and
female (n⫽8 to 15) mice. Leukocyte recruitment assessed using intravital microscopy
1.5 hours after administration of TNF-␣ (300
ng IP) and shown as leukocyte rolling (E)
and leukocyte adhesion (F) in male (n⫽8)
and female (n⫽10) mice. All data shown as
mean⫾SEM of n mice per group. Statistical
significance determined using 2-way ANOVA
is shown as *P⬍0.05 for differences
between the sexes (in all cases, interaction
probability value was not significant), with
#P⬍0.05 representing the Bonferroni post
test (A and B), the Dunnett post test (D),
and the unpaired Student test (E and F).
1078
Arterioscler Thromb Vasc Biol
May 2011
Table 1. Hemodynamic Parameters in Postcapillary Venules of
WT, eNOSⴚ/ⴚ, COXⴚ/ⴚ, and dKO Mice Under Basal Conditions
Venule
Diameter (␮m)
Center Line
Velocity (mm/s)
Wall Shear
Rate (s⫺1)
Male WT
25.6⫾1.0
2.4⫾0.4
486⫾66.5
Female WT
24.0⫾0.9
1.8⫾0.1
386⫾33.02
Male eNOS⫺/⫺
26.0⫾0.8
2.2⫾0.3
450⫾44.0
Female eNOS⫺/⫺
27.5⫾3.2
2.6⫾0.7
539⫾115
Male COX-1⫺/⫺
26.6⫾1.9
1.8⫾2.2
370⫾29.3
Female COX-1
27.0⫾2.0
1.4⫾0.03
304.3⫾28.7
Male dKO
22.3⫾0.3
1.3⫾0.1
294.7⫾32.9
Female dKO
29.8⫾2.6
1.3⫾0.1
249.2⫾41.0
Mouse
Sex/Genotype
⫺/⫺
Data are mean⫾SEM of 4 animals per group. No significant differences were
detected between the sexes for each genotype as determined with unpaired t
tests.
Role of Sex Hormones in Sex Differences on
Leukocyte Rolling
Although ovariectomy had no effect on basal leukocyte
rolling compared with sham-operated animals, IL-1␤-induced
leukocyte rolling was significantly increased in OVX mice
(2-way ANOVA, P⬍0.01; Figure 3A). This effect of ovariectomy on the response to IL-1␤ was in part reversed by
estrogen replacement (Figure 3B, n⫽8 for both groups,
P⬍0.05).
IL-1␤ Elevates Chemokine Expression in
Both Sexes
Quantitative polymerase chain reaction of mesenteric tissue
of IL-1␤-treated WT animals revealed increases in mRNA
expression, above that measured in saline-treated controls
Effect of IL-1␤ on Circulating Blood Cells
IL-1␤ (5 ng IP) provoked a significant rise in the number of
circulating granulocytes in male compared with female WT
mice. No significant differences in circulating monocyte or
lymphocyte numbers were evident between the sexes (Table
2). Fluorescence-activated cell sorting analysis demonstrated
P-selectin glycoprotein ligand-1 on the surface of all cell
types measured in both sexes. In addition, L-selectin expression was significantly elevated by cytokine treatment on
granulocytes in both sexes. Interestingly, however, the percentage of granulocytes expressing L-selectin under basal
conditions was higher in male compared with female mice
(Table 3).
Sex Differences in P-Selectin Expression on
Primary Murine Endothelial Cells
Treatment with IL-1␤ (20 ng/mL; 1.5 hours of treatment) did
not stimulate P-selectin expression (Figure 5A and 5B) in
cultures of female primary endothelial cells (94.1⫾0.5%
purity as identified by positive intercellular adhesion
molecule-2 expression; Figure 5C and 5D); in contrast,
P-selectin expression was significantly elevated in corresponding male endothelial cells (2-way ANOVA, P⬍0.05:
Figure 5B).
Sex Differences in Basal and IL-1␤–Induced
Leukocyte Rolling: Role of Endothelial NOS and
COX-1 Enzymes
Basal leukocyte rolling was significantly greater in male
compared with female eNOS⫺/⫺ mice (2-way ANOVA,
P⬍0.001; Figure 6A), and although IL-1␤ treatment appeared to cause a minor elevation of leukocyte rolling in both
sexes, this did not reach significance (Figure 6A). Basal
leukocyte rolling in female COX-1⫺/⫺ mice was similar to
male COX-1⫺/⫺ mice (Figure 6B); however, whereas IL-1␤
caused a profound increase in rolling in males, no such effect
was evident in age-matched female COX-1⫺/⫺ animals (2way ANOVA, P⬍0.001; Figure 6B). These effects were,
again, unrelated to differences in venular hemodynamics,
which did not vary between the groups (Table 1).
B
Rolling (cells/min)
Figure 3. Ovariectomy alters basal and
IL-1␤-stimulated leukocyte rolling in
#
50
50
mouse mesenteric postcapillary
Basal
venules. Mice were left untreated or
#
40
40
received IL-1␤ (5 ng IP), and the extent
+ IL-1
of cell rolling was determined 1.5 hours
30
30
later in female WT mice that had
undergone sham operation (n⫽7 to 9)
20
20
or ovariectomy operation (OVX, n⫽5 to
11) (A) and female OVX mice that had
10
10
been implanted with osmotic minipumps providing estradiol (E, 0.4
0
0
␮g/day) or vehicle (VEH) control (n⫽8
OVX+ VEH
OVX+ E
for both) (B). Data are mean⫾SEM.
Sham
OVX
Unpaired t test for comparison of 2
groups (OVX⫹VEH versus OVX⫹E) is shown as #P⬍0.05 or for Bonferroni post tests following 2-way ANOVA (P⬍0.05) comparing
sham-operated control versus OVX groups.
A
Rolling (cells/min)
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
2D). Because the greatest difference in cell rolling between
the sexes was evident at 1.5 hours following cytokine
treatment (26.9⫾7.9 cell/min [n⫽14] in males and 9.7⫾1.3
[n⫽9] cells/minute in females, Figure 2A), this time point
was used to investigate the mechanisms involved in the sex
differences in further experiments. This sex difference in
leukocyte recruitment was also apparent in response to the
distinct cytokine TNF-␣ (Figure 2E and 2F), where both
leukocyte rolling and adhesion were significantly lower in
female (n⫽8) compared with male (n⫽10) mice. There were
no significant differences in venular hemodynamics between
the sexes (Table 1).
(Figure 4), of all 3 of the neutrophil-specific chemokines
measured. However, this IL-1␤-induced chemokine elevation
was similar in both sexes (2-way ANOVA: not significant;
Figure 4).
Basal
+ IL-1
60
40
20
Female
Male
100
Basal
80
CXCL1 (KC) mRNA normalised to 18S
Fold increase
Leukocyte Recruitment and Female Sex
100
100
80
CXCL5 (LIX) mRNA normalised to 18S
Fold increase
CXCL2 (MIP2) mRNA normalised to 18S
Fold increase
Villar et al
+ IL-1
60
40
20
Female
Male
80
1079
Basal
+ IL-1
60
40
20
Female
Male
Figure 4. Chemokine gene product levels in mesenteric tissues. mRNA expression of CXCL1 (KC), CXCL2 (MIP2), and CXCL5 (LIX) was
assessed using quantitative reverse transcription–polymerase chain reaction of mesenteric tissue from male and female WT mice
treated with saline or IL-1␤ (5 ng IP, 1.5 hours). Data (n⫽6 animals per group) are expressed as fold increase above control WT normalized to 18S. All data shown as mean⫾SEM. Statistical significance determined using 2-way ANOVA demonstrated no significant
differences between the sexes (in all cases, interaction probability value was not significant).
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Sex Differences in IL-1␤–Induced Leukocyte
Rolling of dKO Mice
IL-1␤ treatment significantly increased leukocyte rolling in
male dKO mice, whereas in female dKO mice, rolling
remained at basal levels up to 4 hours after cytokine treatment
(Figure 6C). Venular hemodynamics were not altered in
either genotype or sex in comparison with WT controls
(Table 1).
Discussion
Female sex exerts a permissive influence over inflammatory
responses, a phenomenon thought to be driven principally by
the activity of female sex hormones and believed to play an
important role in underlying the cardioprotection evident in
premenopausal females.3,4 However, the exact mechanisms
involved in this effect are unclear. In this report, we have
demonstrated the existence of a sex difference in leukocyte
recruitment under inflammatory conditions and implicated
female sex hormones in mediating this effect. In addition, we
have demonstrated that neither NO or PGI2 is involved in this
effect and propose that EDHF is likely to play a crucial role
in mediating this protective phenotype. In addition, our
findings suggest that at least one of the potential downstream
target(s) for these beneficial effects is P-selectin, a key
endothelial cell adhesion molecule involved in the early
stages of the inflammatory cell recruitment process.30
Several studies have demonstrated that sex hormones
(particularly estrogen) suppress the leukocyte recruitment
Table 2. Total Number of Leukocytes in Whole Blood of
Female and Male WT Mice Under Basal Conditions and After
IL-1␤ Stimulation
Cell Type
Granulocytes
Female
Control
Male
Control
Female⫹IL-1␤
Male⫹IL1␤
1.954⫾0.8
1.2⫾0.4
2.3⫾1.0
3.79⫾1.4*
Lymphocytes
7.04⫾0.75
6.55⫾0.91
6.46⫾0.76
6.56⫾1.17
Monocytes
1.96⫾0.52
1.63⫾0.74
2.98⫾0.22
2.87⫾0.58
Mice were left untreated or received IL-1␤ (5 ng IP, 1.5 hours). Data (No. of
cells⫻105/ml) shown are mean⫾SEM for 5 animals per group. Statistical
analysis using 1-way ANOVA followed by Bonferroni post tests shown.
*P⬍0.05 for control vs IL-1␤.
that is evident in innate immune responses in experimental
models of inflammation using both in vivo and in vitro
models.13,14,16 –18 In accord with these studies, we observed
that leukocyte recruitment into murine air pouches following
treatment with the cytokine IL-1␤ was reduced in female
mice compared with age-matched male WT mice. This effect
is likely to reflect a generalized decrease in reactivity of the
female microvasculature because the responses to the distinct
proinflammatory cytokine TNF-␣ were also suppressed in
female compared with male mice. It is possible, however, that
these suppressive effects relate specifically to cytokine-induced cell recruitment because it has recently been demonstrated that, in rats, female sex worsens leukocyte recruitment
in response to an ischemia/reperfusion insult in the hepatic
microcirculation.31
Our findings also suggest that female sex hormones play a
role in mediating this apparent reduced sensitivity to cytokines because ovariectomy of mice resulted in a significant
increase in cell recruitment in response to IL-1␤ that was
Table 3. L-Selectin and PSGL-1 Expression in Circulating
Leukocytes in Basal Conditions and After IL-1␤ Stimulation
Cell Type
(Adhesion
Molecule)
Female
Control
Male
Control
Female⫹IL-1␤
Male⫹IL1␤
Granulocytes
(L-selectin)
26.8⫾1.7
39.4⫾3.6
51.8⫾6.7
54.0⫾5.5
Granulocytes
(PSGL-1)
99.9⫾0.1
99.6⫾0.1
99.6⫾0.07
99.8⫾0.07
Lymphocytes
(L-selectin)
46.6⫾4.1
44.9⫾5.9
51.6⫾7.5
50.8⫾9.2
Lymphocytes
(PSGL-1)
98.8⫾0.1
97.1⫾1.9
99.9⫾0.03
99.8⫾0.05
Monocytes
(L-selectin)
31.9⫾10.6
20.9⫾1.2
45.8⫾7.7
42.1⫾6.4
Monocytes
(PSGL-1)
98.4⫾0.3
97.3⫾1.0
99.1⫾0.2
99.0⫾0.2
Values report the percentage of L-selectin-positive and PSGL-1-positive
events for each respective leukocyte population. Mice were left untreated or
received IL-1␤ (5 ng IP, 1.5 hours). Data are shown as mean⫾SEM for 3 to 5
animals per group.
Arterioscler Thromb Vasc Biol
May 2011
Figure 5. Flow cytometry analysis of murine primary endothelial
cells. A, Representative histogram of P-selectin expression in
the presence of IL-1␤ (20 ng/mL, 1.5 hours) of isotype (black),
male (light grey), and female (dark grey) positive cells. B, Median
fluorescence intensity (MFI) of P-selectin expression in the
absence and presence of IL-1␤ (20 ng/mL, 1.5 hours). C, Representative forward scatter (FSC)/side scatter (SSC) dot-plot of
isolated cell population (R1). D, Representative histogram of
intercellular adhesion molecule-2 (ICAM-2) expression of positive cells (black) and isotype control (grey) in R1. Data shown
are mean⫾SEM for 7 primary cultures of WT cells, each prepared from 3 animals. Statistical significance was determined
using 2-way ANOVA of *P⬍0.05 between the sexes (interaction
probability value was not significant), with Bonferroni post test
shown as #P⬍0.05.
similar in magnitude to the response evident in males.
Previous characterization of this model of inflammation
indicates that the cellular infiltrate in response to IL-1␤ at this
time point (4 hours) is predominantly neutrophilic,32 a view in
part supported in the present study by fluorescence-activated
cell sorting analysis indicating that the cells recruited were
granulocytes. Interestingly, although substantial changes in
cell number were evident in response to IL-1␤, there were no
COX-1 -/-
A
80
60
Basal
IL-1
40
20
eNOS -/-
B
C
60
Rolling (cells/min)
###
100
Rolling (cells/min)
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
significant differences in the number of cells recruited in
response to the vehicle control, suggesting that sex hormones
play an important role in controlling leukocyte recruitment
principally under inflammatory conditions. There is considerable evidence suggesting that the beneficial effects of
female sex hormones relate predominantly to the activity of
estrogen,7,33 and to determine whether this hormone may
underlie the effects of female sex in the present study, we
investigated the effects of estrogen replacement in OVX
females. Our data suggest that the sex differences are, in part,
likely to be related to a suppressive effect of estrogen,
because the effects of ovariectomy were partially inhibited by
estrogen replacement. The dose of estrogen used in our
studies to replace the levels of this hormone in female mice
has previously been shown to restore physiological levels and
to exert antiinflammatory effects in mouse models.22 The
incomplete reversal of the effect of the cytokine may indicate
that other nonestrogenic influences/factors, such as progesterone, also play a role.
Leukocyte recruitment to sites of tissue injury is a dynamic, multistep process involving leukocyte rolling, adhesion, and emigration.30 To investigate whether the altered cell
recruitment evident in the air-pouch studies might be due
specifically to a sex-dependent suppression of a specific step
in the recruitment paradigm, we used the technique of
intravital microscopy. Our findings demonstrate that enhanced leukocyte rolling and adhesion induced by IL-1␤ are
suppressed in female WT mice compared with male mice, an
effect that was not due to inherent differences in venular
hemodynamics. Histological analysis of the mesenteric vasculature confirmed that the cellular target for this effect was
the neutrophil, a fact substantiated by measurement of MPO
in whole mesentery homogenates.
Our data support the thesis that estrogens exert tight
control on the early process of cell recruitment (leukocyte
rolling phenomenon), rather than having a generalized effect
on all steps of the cell recruitment paradigm, ie, rolling,
adhesion, and emigration. This is supported by the fact that
although IL-1␤ treatment resulted in an increase in the levels
of neutrophil chemokines that we have previously shown to
be pivotal in IL-1␤-induced cell adhesion (namely CXCL1,
#
50
40
30
Basal
+ IL-1
20
10
Female
Male
#
30
Female
Male
20
**
10
0
0
0
COX-1 -/- /eNOS-/40
Rolling Cells/min
1080
0
Female
Male
1
2
3
4
Time post IL-1 (h)
5
Figure 6. Basal and IL-1␤-stimulated leukocyte rolling in mouse mesenteric postcapillary venules. Mice were left untreated or received
IL-1␤ (5 ng IP), and the extent of cell rolling was determined 1.5 hours later in male (n⫽6 to 8) and female (n⫽6 to 9) eNOS⫺/⫺ mice
(A), 1.5 hours later in male (n⫽6 to 7) and female (n⫽6 to 13) COX-1⫺/⫺ mice (B), and 0 to 4 hours later in eNOS⫺/⫺/COX-1⫺/⫺ (dKO,
n⫽5 to 18) mice (C). Data are mean⫾SEM. Statistical significance determined using 2-way ANOVA demonstrated a significant difference between the sexes of **P⬍0.001 (A and B) and **P⬍0.01 (C) (in all cases, interaction probability value was not significant), with
Bonferroni post tests shown as #P⬍0.05.
Villar et al
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
CXCL2, and CXCL5),34 no difference between the levels of
expression were evident between the sexes. These findings
are congruent with observations in healthy volunteers demonstrating no difference in serum levels of CXCL135 or other
CXC chemokines.36
Our findings and proposed model are at odds with studies
suggesting higher levels of certain CXCL chemokines in the
sera of healthy women versus age-matched men37 at baseline
or following an inflammatory stimulus of lipopolysaccharide,36 and studies demonstrating estrogen-induced suppression of rat vascular CXCL chemokine expression in response
to the inflammatory stress of vascular balloon injury in vivo38
or expression by cultured smooth muscle cells in response to
TNF-␣.39 The reason for this discrepancy is uncertain but
may reflect differences in the inflammatory stimulus or the
stage at which the inflammatory response was sampled
following initiation of the response.
We considered whether the differences in cell recruitment
might simply reflect differences in circulating cell numbers.
Indeed, our studies demonstrated that although under control
conditions there were no significant differences in the circulating numbers of granulocytes, monocytes, or lymphocytes
between sexes, following IL-1␤ treatment granulocyte numbers rose significantly in male but not female mice. Supporting these findings are observations that the risk of coronary
artery disease is correlated to increasing circulating granulocyte numbers40 and particularly MPO levels (implicating
neutrophils41) in men, an effect that is not evident in women.
It is unlikely that the differences in the extent of circulating
cells might relate to specific sex differences in the levels of
leukocyte adhesion molecule expression because no differences in either L-selectin or PSGL-1, the key leukocyte
adhesion molecules involved in neutrophil rolling,30 were
found in our study. Thus, it is likely that the lower numbers
of circulating cells, in part, underlie the lower numbers
recruited in response to IL-1␤. However, sex differences in
the numbers of cells recruited (air-pouch experiments) in
response to IL-1␤ persists even after normalization for
circulating cell numbers giving values of near 1⫻105 cells
for females and 8⫻105 cells for males. This observation
suggests that sex differences in cell recruitment pathways
likely play a role.
Several studies have demonstrated that the beneficial
effects of female sex hormones within the circulation relate to
upregulation of pathways at the endothelial cell that are
critical in maintaining an antiinflammatory phenotype of the
blood vessel wall.7,42,43 Evidence supports the view that
estrogens upregulate the synthesis, release, and activity of
protective endothelial factors and suppress the expression of
pathogenic mediators by the endothelium.5,42 NO and PGI2
have been identified as important targets for estrogen activity3; however, our investigations using mice with targeted
disruption of eNOS, COX-1, or both (the principal enzymes
involved in endothelial generation of NO and PGI2, respectively) demonstrated that neither of these endothelial mediators played a role in mediating the protection against inflammatory cell recruitment in females. In contrast, the loss of
either or both of these proteins resulted in substantial increases in leukocyte rolling under basal conditions and
Leukocyte Recruitment and Female Sex
1081
following cytokine treatment in male mice. These findings
suggest that although both NO and PGI2 play important roles
in sustaining the antiinflammatory phenotype of endothelial
cells in male mice, they are redundant in female animals. This
profile of reactivity with respect to inflammatory cell recruitment mimics our findings with respect to other differences
evident in the vasoprotective effects of endothelial mediators
between the sexes. Recently, we proposed that although NO
and PGI2 play essential roles in maintaining a vasodilated
microvasculature of male mice, it is predominantly EDHF
that subserves this role in female mice. Moreover, that this
provision of EDHF is the predominant endothelial-derived
vasorelaxant factor that confers protection against hypertension in females.21 It is possible, therefore, that the differences
between the sexes demonstrated in the present study reflect a
difference in EDHF bioactivity and support the view that the
remit of EDHF extends beyond vasodilatation.
The identity of EDHF remains a hotly disputed issue, with
a number of distinct candidates having been proposed44 since
the term EDHF was first coined in 1988.45 One of the putative
EDHF candidates, at least in certain vascular beds, is C-type
natriuretic peptide (CNP).46 Our previous work has demonstrated that exogenous CNP prevents both leukocyte recruitment and platelet aggregation.47 Thus, it is tempting to
speculate that CNP, as an EDHF, may underpin the antileukocyte, antiatherogenic phenotype of the endothelium of
females. Further investigation of the role of CNP in leukocyte
recruitment and any sex differences that may be apparent is
clearly warranted.
Early leukocyte rolling in vivo is mediated by the interaction of endothelial (particularly P-selectin) and leukocyte
adhesion molecules (particularly PSGL-1). Our evidence
suggests that although alterations in leukocyte adhesion
molecules are unlikely to mediate the comparatively lower
cell recruitment in females, changes in endothelial adhesion
molecule expression might explain this phenomenon. Using
primary endothelial cells isolated and cultured from male and
female WT mice, we demonstrated that whereas P-selectin
expression is increased significantly in response to IL-1␤
treatment of endothelial cells of male mice, expression of this
adhesion molecule was largely unchanged following treatment of endothelial cells from female mice. These results
support the view that female sex hormones exert protection,
at least in part, by modulating expression of P-selectin on
endothelial cells during leukocyte rolling. Previous work
from our laboratory has demonstrated that the reduction of
leukocyte rolling exerted by CNP in mesenteric postcapillary
venules is due to a suppression of P-selectin expression, an
observation furthering a role for EDHF in the cytoprotective
effects of female sex on leukocyte recruitment. A limitation
of our findings, however, is that lung endothelial cells rather
than cells of mesenteric origin were used to assess the
P-selectin response to the cytokine. These cells were used
because of the difficulty in obtaining sufficient purity and
numbers of cells from the venular side of the mesenteric
circulation.
In summary, the present study demonstrates that leukocyte
rolling is modulated by female sex hormones in the present of
an inflammatory stimulus and that this effect is independent
1082
Arterioscler Thromb Vasc Biol
May 2011
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
of both NO and PGI2 and possibly due to EDHF activity. In
turn, we propose that our evidence supports modulation of the
expression of P-selectin on endothelial cells by sex hormones
to prevent leukocyte rolling, which has downstream consequences for the extent of cell adhesion and emigration. A
growing body of evidence suggests that leukocyte recruitment is likely to be pathogenic in atherosclerotic disease.
Indeed, circulating neutrophil numbers and levels of neutrophil chemokines48 are correlated with severity in acute
coronary syndromes, as well as being evident in thrombi and
at sites of plaque and rupture in patients.49 –51 In addition,
leukocytes have been identified at lesional sites in the early
stages of plaque formation, and neutrophil depletion is
associated with decreased atherosclerotic load in mouse
models of disease.52–55 The role of P-selectin in these phenomena is uncertain, especially because genetic deletion of
this adhesion molecule appeared to have no impact on the
beneficial effects of estradiol treatment on atherosclerosis in
a mouse model of disease,56 whereas vascular cell adhesion
molecule-1 has been implicated.16,56 However, the possibility
that other adhesion molecules might have been upregulated
and, therefore, compensated for the absence of P-selectin was
not investigated. We suggest that because leukocyte recruitment has been implicated in cardiovascular disease and our
findings suggest that leukocyte recruitment is specifically
attenuated in inflammation in females, these effects of sex on
leukocyte recruitment may play a role in mediating the
cardioprotection evident in premenopausal females.
Sources of Funding
This work and Dr Villar were supported by the British Heart
Foundation; Dr Scotland was supported by a Wellcome Trust Career
Development Fellowship; Dr Hobbs was supported by a Wellcome
Trust Senior Fellowship; Drs Duchene and Chan were supported by
a Barts & the London Trustees Basic Science Fellowship and PhD
Studentship, respectively; Drs Sampaio and Perretti were supported
by the Wellcome Trust and the William Harvey Research Foundation. This work forms part of the research themes contributing to the
translational research portfolio of Barts and the London Cardiovascular Biomedical Research Unit, which is supported and funded by
the National Institute of Health Research.
Disclosures
None.
References
1. Barrett-Connor E. Sex differences in coronary heart disease. Why are
women so superior? The 1995 Ancel Keys Lecture. Circulation. 1997;
95:252–264.
2. Lerner DJ, Kannel WB. Patterns of coronary heart disease morbidity and
mortality in the sexes: a 26-year follow-up of the Framingham population.
Am Heart J. 1986;111:383–390.
3. Mendelsohn ME, Karas RH. Molecular and cellular basis of cardiovascular gender differences. Science. 2005;308:1583–1587.
4. Dubey RK, Imthurn B, Zacharia LC, Jackson EK. Hormone replacement
therapy and cardiovascular disease: what went wrong and where do we go
from here? Hypertension. 2004;44:789 –795.
5. Orshal JM, Khalil RA. Gender, sex hormones, and vascular tone. Am J
Physiol Regul Integr Comp Physiol. 2004;286:R233–R249.
6. Mendelsohn ME, Karas RH. The protective effects of estrogen on the
cardiovascular system. N Engl J Med. 1999;340:1801–1811.
7. Villar IC, Francis S, Webb A, Hobbs AJ, Ahluwalia A. Novel aspects of
endothelium-dependent regulation of vascular tone. Kidney Int. 2006;70:
840 – 853.
8. Yang Z, Ming XF. Recent advances in understanding endothelial dysfunction in atherosclerosis. Clin Med Res. 2006;4:53– 65.
9. Consentino F, Volpe M. Hypertension, stroke, and endothelium. Curr
Hypertens Rep. 2005;7:68 –71.
10. Malek A, Alper SL, Izumo S. Hemodynamic shear stress and its role in
atherosclerosis. JAMA. 1999;282:2035–2042.
11. Lamon BD, Hajjar DP. Inflammation at the molecular interface of atherogenesis: an anthropological journey. Am J Pathol. 2008;173:1253–1264.
12. Thompson J, Khalil RA. Gender differences in the regulation of vascular
tone. Clin Exp Pharmacol Physiol. 2003;30:1–15.
13. Squadrito F, Altavilla D, Squadrito G, Campo GM, Arlotta M, Arcoraci
V, Minutoli L, Serrano M, Saitta A, Caputi AP. 17␤-Oestradiol reduces
cardiac leukocyte accumulation in myocardial ischaemia reperfusion
injury in rat. Eur J Pharmacol. 1997;335:185–192.
14. Card JW, Carey MA, Bradbury JA, Degraff LM, Morgan DL, Moorman
MP, Flake GP, Zeldin DC. Gender differences in murine airway responsiveness and lipopolysaccharide-induced inflammation. J Immunol. 2006;
177:621– 630.
15. Xing D, Miller A, Novak L, Rocha R, Chen YF, Oparil S. Estradiol and
progestins differentially modulate leukocyte infiltration after vascular
injury. Circulation. 2004;109:234 –241.
16. Nathan L, Pervin S, Singh R, Rosenfeld M, Chaudhuri G. Estradiol
inhibits leukocyte adhesion and transendothelial migration in rabbits in
vivo : possible mechanisms for gender differences in atherosclerosis. Circ
Res. 1999;85:377–385.
17. Simoncini T, Hafezi-Moghadam A, Brazil DP, Ley K, Chin WW, Liao
JK. Interaction of oestrogen receptor with the regulatory subunit of
phosphatidylinositol-3-OH kinase. Nature. 2000;407:538 –541.
18. Eckhoff DE, Eckstein C, Smyth CA, Vilatoba M, Bilbao G, Rahemtulla
FG, Young CJ, Anthony TJ, Chaudry IH, Contreras JL. Enhanced isolated
pancreatic islet recovery and functionality in rats by 17␤-estradiol
treatment of brain death donors. Surgery. 2004;136:336 –345.
19. Huang PL, Huang Z, Mashimo H, Bloch KD, Moskowitz MA, Bevan JA,
Fishman MC. Hypertension in mice lacking the gene for endothelial nitric
oxide synthase. Nature. 1995;377:239 –242.
20. Langenbach R, Morham SG, Tiano HF, Loftin CD, Ghanayem BI,
Chulada PC, Mahler JF, Lee CA, Goulding EH, Kluckman KD, Kim HS,
Smithies O. Prostaglandin synthase 1 gene disruption in mice reduces
arachidonic acid-induced inflammation and indomethacin-induced gastric
ulceration. Cell. 1995;83:483– 492.
21. Scotland RS, Madhani M, Chauhan S, Moncada S, Andresen J, Nilsson
H, Hobbs AJ, Ahluwalia A. Investigation of vascular responses in endothelial nitric oxide synthase/cyclooxygenase-1 double-knockout mice:
key role for endothelium-derived hyperpolarizing factor in the regulation
of blood pressure in vivo. Circulation. 2005;111:796 – 803.
22. Zhan E, Keimig T, Xu J, Peterson E, Ding J, Wang F, Yang XP.
Dose-dependent cardiac effect of oestrogen replacement in mice postmyocardial infarction. Experimental Physiology. 2008;93:982–993.
23. Cuzzocrea S, Tailor A, Zingarelli B, Salzman AL, Flower RJ, Szabó C,
Perretti M. Lipocortin 1 protects against splanchnic artery occlusion and
reperfusion by affecting neutrophil migration. J Immunol. 1997;159:
5089 –5097.
24. McLean P, Ahluwalia A, Perretti M. Association between kinin B1
receptor expression and leukocyte trafficking across mouse mesenteric
post-capillary venules. J Exp Med. 2000;192:367–380.
25. Woodfin A, Voisin MB, Imhof BA, Dejana E, Engelhardt B, Nourshargh
S. Endothelial cell activation leads to neutrophil transmigration as supported by the sequential roles of ICAM-2, JAM-A, and PECAM-1. Blood.
2009;113:6246 – 6257.
26. Perretti M, Ahluwalia A, Harris JG, Goulding NJ, Flower RJ.
Lipocortin-1 fragments inhibit neutrophil accumulation and neutrophildependent edema in the mouse. J Immunol. 1993;151:4306 – 4314.
27. Hartwell DW, Mayadas TN, Berger GT, Frenette PS, Rayburn H, Hynes
RO, Wagner DD. Role of P-selectin cytoplasmic domain in granular
targeting in vivo and in early inflammatory responses. J. Cell Biol.
1998;143:1129 –1141.
28. Kuhlencordt PJ, Rosel E, Gerszten RE, Morales-Ruiz M, Dombkowski D,
Atkinson WJ, Han F, Preffer F, Rosenzweig A, Sessa WC, Gimbrone
MA, Ertl G, Huang PL. Role of endothelial nitric oxide synthase in
endothelial activation: insights from eNOS knockout endothelial cells.
Am J Physiol Cell Physiol. 2004;286:C1195–C1202.
29. Davidge ST, Zhang Y, Stewart KG. A comparison of ovariectomy models
for estrogen studies. Am J Physiol Regul Integr Comp Physiol. 2001;280:
R904 –R907.
Villar et al
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
30. Ley K, Laudanna C, Cybulsky MI, Nourshargh S. Getting to the site of
inflammation: the leukocyte adhesion cascade updated. Nat Rev Immunol.
2007;7:678 – 689.
31. Burkhardt M, Slotta J, Garcia P, Seekamp A, Menger M, Pohlemann T.
The effect of estrogen on hepatic microcirculation after ischemia/
reperfusion. Int J Colorect Dis. 2008;23:113–119.
32. Perretti M, Flower RJ. Modulation of IL-1-induced neutrophil migration
by dexamethasone and lipocortin 1. J Immunol. 1993;150:992–999.
33. Arnal JF, Fontaine C, Billon-Gales A, Favre J, Laurell H, Lenfant F,
Gourdy P. Estrogen receptors and endothelium. Arterioscler Thromb
Vasc Biol. 2010;30:1506 –1512.
34. Viola A, Luster AD. Chemokines and their receptors: drug targets in
immunity and inflammation. Annu Rev Pharmacol Toxicol. 2008;48:
171–197.
35. Kanda Y, Koike K, Sakamoto Y, Osako Y, Masuhara K, Watanabe K,
Tsurufuji S, Hirota K, Miyake A. GRO-␣ in human serum: differences
related to age and sex. Am J Reprod Immunol. 1997;38:33–38.
36. Coyle SM, Calvano SE, Lowry SF. Gender influences in vivo human
responses to endotoxin. Shock. 2006;26:538 –543.
37. Giraldo E, Hinchado M, Garcia J, Ortega E. Influence of gender and oral
contraceptives intake on innate and inflammatory response: role of neuroendocrine factors. Molecular and Cellular Biochemistry. 2008;313:
147–153.
38. Miller AP, Feng W, Xing D, Weathington NM, Blalock JE, Chen YF,
Oparil S. Estrogen modulates inflammatory mediator expression and
neutrophil chemotaxis in injured arteries. Circulation. 2004;110:
1664 –1669.
39. Xing D, Feng W, Miller AP, Weathington NM, Chen YF, Novak L,
Blalock JE, Oparil S. Estrogen modulates TNF-␣-induced inflammatory
responses in rat aortic smooth muscle cells through estrogen receptor-␤
activation. Am J Physiol Heart Circ Physiol. 2007;292:H2607–H2612.
40. Rana JS, Boekholdt SM, Ridker PM, Jukema JW, Luben R, Bingham SA,
Day NE, Wareham NJ, Kastelein JJ, Khaw KT. Differential leucocyte
count and the risk of future coronary artery disease in healthy men and
women: the EPIC-Norfolk Prospective Population Study. J Intern Med.
2007;262:678 – 689.
41. Rana JS, Arsenault BJ, Despres JP, Cote M, Talmud PJ, Ninio E, Jukema
JW, Wareham NJ, Kastelein JJ, Khaw KT, Boekholdt SM. Inflammatory
biomarkers, physical activity, waist circumference, and risk of future
coronary heart disease in healthy men and women. Eur Heart J. 2009.
42. Khalil RA. Sex hormones as potential modulators of vascular function in
hypertension. Hypertension. 2005;46:249 –254.
43. Nilsson BO. Modulation of the inflammatory response by estrogens with
focus on the endothelium and its interactions with leukocytes. Inflamm
Res. 2007;56:269 –273.
44. Edwards G, Félétou M, Weston A. Endothelium-derived hyperpolarising
factors and associated pathways: a synopsis. Pfluegers Archiv Eur J
Physiol. 2010;459:863– 879.
Leukocyte Recruitment and Female Sex
1083
45. Chen G, Suzuki H, Weston AH. Acetylcholine releases endotheliumderived hyperpolarizing factor and EDRF from rat blood vessels. Br J
Pharmacol. 1988;95:1165–1174.
46. Chauhan SD, Nilsson H, Ahluwalia A, Hobbs AJ. Release of C-type
natriuretic peptide accounts for the biological activity of endotheliumderived hyperpolarizing factor. Proc Natl Acad Sci U S A. 2003;100:
1426 –1431.
47. Ahluwalia A, Foster P, Scotland RS, McLean PG, Mathur A, Perretti M,
Moncada S, Hobbs AJ. Antiinflammatory activity of soluble guanylate
cyclase: cGMP-dependent down-regulation of P-selectin expression and
leukocyte recruitment. Proc Natl Acad Sci U S A. 2004;101:1386 –1391.
48. Zineh I, Beitelshees AL, Welder GJ, Hou W, Chegini N, Wu J, Cresci S,
Province MA, Spertus JA. Epithelial neutrophil-activating peptide
(ENA-78), acute coronary syndrome prognosis, and modulatory effect of
statins. PLoS One. 2008;3:e3117.
49. Naruko T, Ueda M, Haze K, van der Wal AC, van der Loos CM, Itoh A,
Komatsu R, Ikura Y, Ogami M, Shimada Y, Ehara S, Yoshiyama M,
Takeuchi K, Yoshikawa J, Becker AE. Neutrophil infiltration of culprit
lesions in acute coronary syndromes. Circulation. 2002;106:2894 –2900.
50. Naruko T, Furukawa A, Yunoki K, Komatsu R, Nakagawa M, Matsumura
Y, Shirai N, Sugioka K, Takagi M, Hozumi T, Itoh A, Haze K,
Yoshiyama M, Becker AE, Ueda M. Increased expression and plasma
levels of myeloperoxidase are closely related to the presence of
angiographically-detected complex lesion morphology in unstable
angina. Heart. 2010;96:1716 –1722.
51. Weber C, Zernecke A, Libby P. The multifaceted contributions of leukocyte subsets to atherosclerosis: lessons from mouse models. Nat Rev
Immunol. 2008;8:802– 815.
52. van Leeuwen M, Gijbels MJ, Duijvestijn A, Smook M, van de Gaar MJ,
Heeringa P, de Winther MP, Tervaert JW. Accumulation of
myeloperoxidase-positive neutrophils in atherosclerotic lesions in
LDLR⫺/⫺ mice. Arterioscler Thromb Vasc Biol. 2008;28:84–89.
53. Zernecke A, Bot I, Djalali-Talab Y, Shagdarsuren E, Bidzhekov K,
Meiler S, Krohn R, Schober A, Sperandio M, Soehnlein O, Bornemann J,
Tacke F, Biessen EA, Weber C. Protective role of CXC receptor 4/CXC
ligand 12 unveils the importance of neutrophils in atherosclerosis. Circ
Res. 2008;102:209 –217.
54. Drechsler M, Megens RTA, van Zandvoort M, Weber C, Soehnlein O.
Hyperlipidemia-triggered neutrophilia promotes early atherosclerosis.
Circulation. 2010;122:1837–1845.
55. Hazen SL. Neutrophils, hypercholesterolemia, and atherogenesis.
Circulation. 2010;122:1786 –1788.
56. Gourdy P, Mallat Z, Castano C, Garmy-Susini B, Mac Gregor JL, Tedgui
A, Arnal JF, Bayard F. The atheroprotective effect of 17␤-estradiol is not
altered in P-selectin- or ICAM-1-deficient hypercholesterolemic mice.
Atherosclerosis. 2003;166:41– 48.
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Suppression of Endothelial P-Selectin Expression Contributes to Reduced Cell Trafficking
in Females: An Effect Independent of NO and Prostacyclin
Inmaculada C. Villar, Ramona S. Scotland, Rayomand S. Khambata, Melissa Chan, Johan
Duchene, Andre L. Sampaio, Mauro Perretti, Adrian J. Hobbs and Amrita Ahluwalia
Arterioscler Thromb Vasc Biol. 2011;31:1075-1083; originally published online February 24,
2011;
doi: 10.1161/ATVBAHA.111.223545
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2011 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/31/5/1075
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2012/11/15/ATVBAHA.111.223545.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
On‐line methods supplement Suppression of endothelial P‐selectin underlies reduced cell trafficking in females: an effect independent of NO and PGI2 1
Inmaculada C. Villar, 2Ramona S. Scotland, 2Rayomand S. Khambata, 2Melissa Chan, 2Johan Duchene, 2Andre L., Sampaio, 2Mauro Perretti 1Adrian J. Hobbs & 2Amrita Ahluwalia 1
Department of Pharmacology, University College London, Gower St, London WC1E; 2William Harvey Research Institute, Barts & The London Medical School, Queen Mary University of London, EC1M 6BQ. Author for correspondence A Ahluwalia Tel: +44 207 882 8377 Fax: +44 207 882 3402 Email: [email protected] 1 Intravital Microscopy Mesenteries were superfused with bicarbonate buffer at 37° [in g/liter: NaCl, 7.71; KCl, 0.25; MgSO4, 0.14; NaHCO3, 1.51; and CaCl2, 0.22 (pH 7.4); gassed with 5% CO2 and 95% N2] at a rate of 2 ml/min. The temperature of the stage was maintained at 37°C. Red blood cell (rbc) velocity was measured in venules by using an optical Doppler velocimeter (Microcirculation Research Institute, Texas A&M University, College Station). Venular blood flow was calculated from the product of mean rbc velocity (V mean = centerline velocity/1.6) and microvascular cross‐sectional area, assuming a cylindrical geometry. Wall shear rate was calculated by the Newtonian definition: shear rate = 8,000 × (V mean/diameter). Three to five randomly selected post‐capillary venules (diameter 20‐40µm, length >100µm) were observed for each mouse; measurements were taken 5–10min after exposure of the chosen vessels. Murine Primary Lung endothelial cell culture For each experiment lungs from three mice were collected, placed in ice‐cold Dulbecco's modified Eagle's medium (DMEM) and the tissue minced and then digested for 1 h at 37°C in 0.1% collagenase‐A (Sigma, UK). The cellular digest was passed through a blunt 14‐gauge needle followed by filtration through a 70‐µm nylon mesh, then centrifuged at 800 g for 10 min at room temperature. The pellet was resuspended in DMEM/F12 medium (37°C) [containing 20% FBS, 50 µg/ml endothelial mitogen (Biomedical Technologies, UK), 100 µg/ml heparin, and penicillin‐
streptomycin] and plated in 0.1% gelatin‐coated T75 flasks. Cells were washed after 24 h and cultured for 2–4 days. Magnetic beads (5 µg/4x106 beads, Dynabeads, Invitrogen, UK) were coated with anti‐mouse CD102 (clone 3C4; Pharmingen, UK) antibody. Per flask, 4x106 beads were added and incubated for 1 h at 37°C. Cells were trypsinized and selected in a magnetic field for 10 min, washed, and then plated in 0.1% gelatin‐coated 6‐well plates. Experiments were performed on cultures that were 80‐90% confluent (~100,000/well). Flow Cytometry Whole blood and murine air pouch supernatants Blood (50 µl) collected by cardiac puncture from WT mice or samples from air pouch experiments (200 µl) were incubated with PBS containing 0.1% sodium azide, 10% rat serum and the blocking antibody FcgIIR mAb (CD16/CD32) for 30 min at 4°C. Cells were then labelled with FITC‐conjugated 2 CD62L (2.5 µg/mL eBioscience, UK) for L‐selectin or RPE‐conjugated CD162 (0.5 µg/mL ebioscience, UK) for PSGL‐1 combined with one of the following PE or FITC‐conjugated mAb for 30 min at 4°C: anti‐GR‐1 for granulocytes (Clone RB6‐8C5; eBioscience, UK), anti‐CD3e for lymphocytes (Clone 145‐
2C11; eBioscience, UK) or anti‐F4/80 for monocytes and macrophages (Clone BM8; eBioscience, UK). After labelling, erythrocytes were lysed (blood samples only) with (500 µl) lysing reagent for 1‐2 min and 125 µl of fixative (Beckman Coulter, UK ), then all cells were washed, centrifuged, and suspended in PBS containing 0.1% sodium azide for analysis with FACScalibur flow cytometer (Becton Dickinson, San Jose, CA) using CellQuestTM software (Becton Dickinson). Murine primary endothelial cells. Endothelial cells were harvested in trypsin/EDTA and subcultured in six‐well plates (Falcon, UK). Cells were then treated with murine IL‐1β (20 ng/ml) for 90 min. Cells were then washed in 2 ml DMEM/F12 for 1 min. Rat anti‐mouse monoclonal antibody against P‐
selectin [FITC‐conjugated CD62P (clone RB40.34, BD Pharmingen, UK) was diluted with PBS containing 0.1% sodium azide and incubated in the dark at 37°C for 30 min with cells. After this time endothelial cells were collected using trypsin /EDTA (0.025% trypsin 0.01% EDTA Invitrogen; 500 μl per well) at 37°C for 2 min and then trypsin activity blocked by the addition of 500 μl of Trypsin Neutralizing Solution (Invitrogen). Following this FACS analysis was performed. In all cases, forward‐ and side‐scatters were set to exclude erythrocytes and/or dead cells. Positive and negative populations were identified based on single or dual‐colour staining performed with a PE‐ and FITC‐conjugated IgG isotype (eBioscience, UK). The cell type and expression pattern of PSGL‐
1, L‐selectin and P‐selectin were determined by measuring the PE and FITC mean fluorescence intensity (MFI) of the specific antibody and the percentage of positive cells. Real‐time quantitative RT‐PCR Expression of key neutrophil chemokine mRNA was determined by real‐time quantitative RT‐PCR. Briefly, mesenteric vascular beds were removed from control or IL‐1β‐treated (5ng, 90 min) mice as described above, snap frozen, and stored at ‐80°C until use. Samples were homogenized using ceramic beads (Precellys 24, Bertin Technologies, UK) and total RNA isolated using a NucleoSpin RNA II purification kit (Macherey‐Nagel, UK). cDNA was synthesized from 1 µg of total RNA with Moloney 3 Murine Leukemia virus reverse transcriptase (Promega, UK) using oligo(dT) nucleotides. The following primers were used: CXCL1 (KC): 5'‐TGAGCTGCGCTGTCAGTGCCT‐3' 5'‐AGAAGCCAGCGTTCACCAGA‐3'; CXCL2 (MIP‐2):5’‐GAGCTTGAGTGTGACGCCCCCAGG‐3’ CXCL5 (LIX): 5’‐GTTAGCCTTGCCTTTGTTCAGTATC‐3’ 5'‐GCATTTCTGTTGCTGTTCACGCTG‐3' 5'‐CCTCCTTCTGGTTTTTCAGTTTAGC‐3'; 18S: 5'‐AGCCTGCGGCTTAATTTGAC‐3' 5'‐CAACTAAGAACGGCCATGCA‐3'. Standard curves for were generated to determine the amplification efficiencies of target and reference genes. Quantitative PCR was performed on an ABI Prism 7900 sequence detection system (Applied Biosystems, UK) utilizing SYBR green (ABgene, UK) with 100nM primers and 20ng of cDNA. Chemokine expression was normalized to 18S and expressed as a relative value using the comparative threshold cycle (Ct) method (2‐∆∆Ct)1. The levels of mRNA expression of genes of interest were normalized to male control. Reference List 1. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real‐time quantitative PCR and the 2(‐Delta Delta C(T)) Method. Methods. 2001;25:402‐408. 4