From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
RAPID COMMUNICATION
Somatic Mutations of the PIG-A Gene Found in Japanese Patients With
Paroxysmal Nocturnal Hemoglobinuria
By Norio Yamada, Toshio Miyata, Kenji Maeda, Teruo Kitani, Junji Takeda, and Taroh Kinoshita
Paroxysmal nocturnal hemoglobinuria (PNH) is an acquired
clonal hematologic disorder caused by deficient biosynthesis of the glycosylphosphatidylinositol (GP11 anchor. PIG-A,
an X-linked gene that participates in the first step of GPIanchor synthesis, is responsible for PNH. Abnormalities of
with
the PIG-A gene have been demonstrated in all patients
PNH that have been studiedto date. In this study, we analyzed 14 Japanese patients with PNH and identified 15 somatic mutationsof PIG-A. Themutations included eight
single-basechangesandseven
frameshiftmutations.The
singlebase changes were two nonsense, three missense,
and three splice site mutations. The frame shift mutations
were four single-base deletions,two single-base insertions,
and a replacement of two bases with one.They were all
different,exceptfor
the samemissense mutationbeing
disfound intwo patients. Moreover, these mutations were
tributed in various regions of the gene. These results indicated that the mutations occurred at random sites andthat
there isno mutation hot spot in the PIG-A gene.All the
mutations resulted in complete loss offunction. Interestingly, the granulocytes in these patients contained variable
proportions of mutant cells, suggesting that clonal expanbut is influenced
sion is not determined solely by mutations
by another factor(s).
0 1995 by The American Societyof Hematology.
P
thesis, genes other than PIG-A might be responsible for PNH
in some patients. However, this does not appear to be true,
because all 28 patients analyzed at the RNA andor DNA
levels had PIG-A abnormalities'8-22and because all of the
other 30 patients studied by means of cell hybridization belonged to class A.8,'2 The most likely explanation for this
uniformity of the responsible gene is that only PIG-A is on
the X chromosome and all other genes are autosomal. In
fact, two other genes, termed GPI-H and PIG-F, the genes
for class H and F mutations, r e ~ p e c t i v e l y , ~are
~ . autoso~
In autosomal genes, two mutations causing loss of
function must occur to gain the GPI-anchor-deficient phenotype, but this would be extremely rare. Another possibility
is that PIG-A is a hypermutable gene. For example, PIG-A
might causing loss of function must a mutation hot spot. To
address this question and to understand the nature of somatic
mutations of PIG-A, we analyzed PIG-A in 14 Japanese
patients with PNH.
AROXYSMAL nocturnal hemoglobinuria (PNH) is an
acquired clonal hematologic disorder characterized by
intravascular hemolysis and hemoglobinuria.' Abnormal
blood cells are deficient in the surface expression of multiple
proteins that are normally expressed on the cell membrane
via glycosylphosphatidylinositol (GPI) anchor.2 Surface deficiencies of complement regulatory proteins, decay-accelerating factor (DAF) and CD59, render red blood cells (RBCs)
sensitive to complement and lead to complement-mediated
hemolysis. In this disease, granulocytes, monocytes, platelets, and T, B, and natural killer (NK) lymphocytes as well
as RBCs are deficient in GPI-anchored proteins, indicating
somatic mutation of hematopoietic stem cells.3
The biochemical basis of PNH is the deficient biosynthesis
of the GP1 a n ~ h o r . The
~ . ~ biosynthetic pathway of the GP1
anchor consists of multiple reaction steps basically involving
sequential additions of sugars and other components to phosphatidylinositol (PI) from respective donor molecule^.^^^
Studies with affected lymphocyte cell lines8-" and granulocytes12from patients with PNH showed deficiency of the first
step of GPI-anchor synthesis. Biochemical and cytogenetic
analyses of various complementation classes of GPI-anchor
deficient mutant cell lines showed that three genes, those for
complementation class A, C, and H, are involved in the first
step of bio~ynthesis.'~.'~
Complementation analysis by cell
hybridization showed that affected cell lines established from
patients with PNH belong to class A, indicating that abnormality of the class A gene must be responsible for PNH.8.9
A cDNA of the class A gene, termed PIG-A gene, has
been isolated by expression cloning based on the complementation of surface DAF and CD59 expression on class A
mutant ~e1ls.l~
The transfection of PIG-A cDNA to the affected cell lines from two Japanese patients withPNHI6
complemented the surface expression of GPI-anchored proteins." A somatic mutation of PIG-A was indeed identified
in one of these cell lines.I7 The PIG-A gene has been localized to the short arm of the X chromosome at X ~ 2 2 . 1 , ' ~
indicating that it is haploid in somatic cells. Therefore, one
loss-of-function mutation in PIG-A would result in a GPIanchor-deficient phenotype.
Because multiple genes are involved in GPI-anchor synBlood, Vol 85, No 4 (February 15). 1995: pp 885-892
MATERIALS AND METHODS
Patients and blood cell samples. Patients no. 1 through 9, 11,
12, 14, and 16 were described elsewhere." Blood samples were
obtained from two additional patients (no. 17 and 18) after obtaining
their informed consent (Table 1). All of the patients had a positive
Fromthe Department of lmmunoregulation, Research Institute
for Microbial Diseases, Osaka University, Osaka: the Department
of Internal Medicine, Branch Hospital, Nagoya University School
of Medicine, Nagoya: and the Department of Hematology and Oncology, Osaka Universiry Medical School, Osaka, Japan.
Submitted September 29, 1994: accepted November 8, 1995.
Supported by grants from the Ministry of Education, Science and
Culture of Japan.
Address reprint requests to Taroh Kinoshita, PhD, Department
of Immunoregulation, Research Institute for Microbial Diseases,
Osaka University, 3-1 Yamada-oh, Suita, Osaka 565, Japan.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1995 by The American Society of Hematology.
ooW-4971/95/85~-0030$3.00/0
885
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
YAMADA ET AL
886
Table 1. Mutations of PIG-A in Patients With PNH
Patient No.
Sex
CD59-DeficientPMN (%)
1
2
3
4
5
6
7
8
9
F
M
100
90
97
50
65
72
60
37
95
11
12
14
16*
17
18
F
F
M
M
F
M
F
SiteICodon
3' Splice site
5' Splice site
Codon 128
Codon 100
Codon 437
Codon 191
Codon 128
Codon 431
Codon 82
A to G, base change
-
Frame shift
Frame shift
Frame shift
Exon 5 deletion
Frame shift
A deletion
A to G, base change
T to A, base change
A insertion (TAC
F
Codon 136
Codon 312
Codon 112/113
5' Splice site
Codon 90
F
95
5' Splice iste
Codon 35
F
-
Exon 4 deletion
Exon 5 deletion
His to Arg
stop
Frame shift
Frame shift
His to Arg
stop
Frame shift
G to A, base change
A to G, base change
C to T, base change
C deletion (CTC TC)
83
94
43
98
40
M
M
M
Consequence
Mutation
TAAC)
T deletion
A deletion
GC to T, base change
T deletion
T insertion (TA
TA)
G to A, base change
T to A, base change
Exon 4 deletion
Ile to Lys
* This patient has been previously described."
Ham's test. Patients no. 12 and 17 had aplastic anemia, but the
remainder had no other hematologic disorders. Granulocytes (PMN)
and mononuclear cells were isolated by sedimentation through 6%
dextran and centrifugation on Ficoll-Hypaque (Pharmacia, Uppsala,
Sweden).
Flow cytometry of DAF and CD59. Cells were stained for DAF
and CD59 with biotinylated IA1OZ6and 5H8" monoclonal antibodies, respectively, and with phycoerythrin-conjugated streptoavidin
(Biomeda, Foster City, CA). The cells were then analyzed in a
FACScan (Becton Dickinson, Lincoln Park, NJ).
Reverse transcription-polymerase chain reaction (RT-PCR). We
isolated the total RNA from PMN** and reverse transcribed the
coding region of PIG-A using RNA from lo6 cells and primer B13
(Table 2 and Fig 1) with 200 U of RNAse H-free reverse transcriptase (Superscript; GIBCO-BRL, Grand Island, NY) in a final
Table 2. Primers Used for Analyses of PIG-A
A1
A2
A3
A4
A5
A6
A7
A1 1
A14
A16
AlTl
AIT2
AIT3
AIT4
B1
B2
B3
B4
B7
B10
B11
B12
B13
BIT1
BIT2
BIT3
5"ACAGCCACGACCCTCTl"CACAG
5"ACAlTTACCAGCTCTCTCAGTGC
5"GCTGATGTCAGCTCGGTGCTTAC
5'-GTTGTCAGCAGACTTGTl"ACAG
5"GATACCAGCTGCATGACAGGGTG
5"GAGGAGAGGGACCAAAGAGAATC
5'-ACTGAAGCATTCTGCATGGCG
5'-GGTTGCTCTAAGAACTGATGTC
5'-GAAGTCAGGGACATTGCCAGCTCCAGAAAACATCCATAACAT
volume of 20 pL at 37°C for 90 minutes. The coding region was
amplified with primers A1 1 and B 12 (Table 2 and Fig 1) by K R ,
each cycle of which consisted of 1 minute of denaturation at 93°C
1 minute of annealing at 55"C, and 2 minutes of extension at 72°C.
The reactions were repeated 25 times using [a-'2P]deoxycytidine
triphosphate (Amersham, Buckinghamshire, UK) and the products
were resolved by electrophoresis in 2% agarose gels, followed by
autoradiography. For cloning, the reactions were repeated 36 times
and the products were cloned into pBluescript I1 (Stratagene, La
Jolla, CA) for nucleotide sequencing or into Epstein-Barr virusbased mammalian expression vector, pEBy9 for transfection.
Amplifcation of the PIG-A gene. DNA was isolated from PMN
and MNC.30Regions of PIG-A gene3' were amplified by PCR using
the primer sets, AITl and B1, AI and BIT1, AIT2 and BIT2, AIT3
and BIT3, and AIT4 and B12 (Table 2 and Fig I ) for 36 cycles and
the products were used for hetero-duplex analysis or cloned into
pBluescript II for sequencing. Nucleotide sequences of the cloned
PCR products were determined by dideoxy chain termination using
either the Taq dye primer cycle sequencing kit or the Taq dye terminator cycle sequencing kit and a Model 370A DNA sequencer (Applied Biosystems, Foster City, CA).
A.
PIG-A cDNA
5"AGCAGCCAGTTGTGGmAC
5'-GAGCTGAGATCCTGTmACTCT
5'-TGGATTCTCAGTCGTTCTGGTGA
5'-TCACTCClTTCTTCCCCTCTC
5'-GGTCATTGTlTATCATGGGACAG
5"GAAAMGAACTATGTGAATGGAT
5"ACTGTGAAAGAGGGTCGTGGCTG
5'-TTCAGTGCTGCTC?TAGTACAG
5'-GAlTCTCllTGGTCCCTCTCCTC
5'-CTTCAGTAAGGGAGGTATTCAG
5'-AGCCTllTCCAATCCTTCACAC
5'-CAAGAAAATGAGGAAGAGGAAGT
5'-TCTTACAATCTAGGCTTCCTTC
5"AATGATATAOAGGTAGCATAAC
5'-GCCAAACAATCATTATATACAAG
5'-CTTCTCCCTCAAGACAACATGAA
5'-GTACGTGAAACATCAAGTAAGAG
B. PlGAgene
+.:"-J.qq#-q~~-"
01
Exons 1
2
m
an
3
4 5
6
.
tkb
Fig 1. Schematia reprosantation of f f i - A d)NA [A) and the F O mic gene (B), as well as the primers used for PCR end reverse transcription.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
P E A GENE IN PNH
887
Hetero-duplex analysis. The coding region of PIG-A was amplified by PCR in sevenoverlapping fragments using the total
RT-PCR
product from each patient as a template and the primer sets
All
and B2, A2 and B3, A3 and B4, A4 and B7, A5 and B10, A16 and
B11,andA14andB12(Table2andFig
1). Forhetero-duplex
formation, the PCR products from a patient with 80% or more affected PMN were mixed withthe correspondingPCR products from
normal cDNA to obtain an approximate 1:1 ratio of the mutant to
thenormalproducts.ThePCRproductsfromapatientwithless
affected PMN were analyzed without any additions. Samples were
denatured for 3 minutes at95'C and then were kept at room temperature for 1 hourtoallowduplexformation.Thesesampleswere
resolved by electrophoresis in MDE gel (Hydrolink; AT Biochem,
Malvern, PA) for 4.5 hours at 800 V and bands were visualized by
staining with ethidium bromide. If a region containing a mutation
was detected with RT-PCR products, cDNA clones containing that
regionwereprepared.Forthis,abiggersegmentcontainingthe
region of interest was amplified by PCR from total cDNA and the
products were cloned. These cDNA clones were then used as templates for PCR and the products were analyzed
by MDE gel electrophoresis after mixing with equal amounts
ofnormalcDNA fragments. cDNA clones that showed hetero-duplex were sequenced to
determine the mutation. Regionsof PIG-A DNA were also analyzed
in a similar way.
Tmnsfectim. Weexamined thefunctionalactivity
of PIG-A
cDNAbytransfection
intoaPIG-A-deficientmutanthuman
Blymphoblastoid cell line,JY-5.3' The cells(5 X IO6)were mixed with
10 pg of pEB bearing PIG-A cDNA in0.8 mL of HeBS transfection
buffer?'Themixtureswere
electmporated at 250 V and 960 pF
with aGenePulser(Bio-Rad,Hercules,CA).Aftercultureand
selection with 400 p g h L hygromycin B, the transfected cells were
stained for CD59 and DAF to assess the complementation of the
PIG-A-deficient phenotype of the mutant.
Construction of chimeric PIG-A cDNAs from normal cDNA and
that of patients with missense mutations. Asegmentof
PIG-A
cDNA containing a missense mutation and the remaining segment
were prepared by restriction enzyme digestion of a mutant cDNA
that contained the coding region but lacked mostof the 3' untranslated region. The fragments were isolated by means of agarose gel
electrophoresis.The corresponding segmentsof
normal PIG-A
cDNAwere also prepared, but the full-length
PIG-A cDNAwas
used tohelp determine the origins
of the fragments. Chimeric cDNAs
were constructed by ligation of these fragments and pEB vector.
RESULTS
To identify somatic mutations of PIG-A in 14 patients
with PNH, we first analyzed PIG-A mRNA in PMN by RTPCR. When the mRNA had a size abnormality, we analyzed
DNA from PMN to determine the mutation responsible for
that abnormal mRNA. When the mRNA showed an apparently normal profile on RT-PCR analysis, we analyzed normal-sized PIG-A cDNA because it is a mixture of mutant
and normal types." We cloned the RT-PCR products and
distinguished mutant clones from the normal clones by transfection. To find a mutation, we sequenced either the entire
mutant cDNA or only a relevant region that had been localized by hetero-duplex analysis. The mutation found at the
mRNA level was confirmed by analysis of DNA.
Patients no. l and 2: Abnormal splicing. Among the
PMN of patients no. 1 and 2, 100% and 90%, respectively,
were CD59- (Table 1). Previous analysis of the RNA from
PMN showed that they had abnormal P I G 4 mRNA, exons 4
and 5 , respectively, being missing.I8 To identify the somatic
mutations that caused these abnormal mRNA, we analyzed
the DNA from PMN. Because a likely defect was abnormal
splicing, we amplified a segment containing junctions of
exons 4 and 5 by PCR with primers AIT3 and BIT3 (Fig
lB), cloned the products, and sequenced several clones. In
samples from patient no. 1 (female), we found an A to G
base change within the consensus 3' splice site sequence AG
located immediately 5' to exon 4. This mutation was found
in 4 of 10 clones obtained in two independent PCR (Table
1). There was no mutation in the 5' splice site flanking exon
4.
The analysis of patient no. 2 (male) showed that five of
six clones from two independent PCR had a G to A base
change within the consensus GT sequence of the 5' splice
site that flanks exon 5 (Table 1). There was no mutation in
the 3' splice site flanking exon 5. These results indicated
that the abnormal mRNA of these patients were formed by
abnormal splicing caused by somatic mutations within splice
sites.
Patients no. 4 and 8: Nonsense mutations. In patient no.
4, 50% of the PMN were CD59- (Table 1). From PMN of
this patient, we previously cloned the cDNA of nonfunctional PIG-A mRNA that should have a mutation within the
coding region." We sequenced three nonfunctional clones
and found a base change, C to T, in codon 100 that generates
a stop codon, TAG (Table 1). To confirm presence of this
mutation in DNA, we amplified the corresponding region of
DNA from PMN using primers AITl and B1 (Fig 1B) and
sequenced the cloned products. Two of six clones had the
same mutation as that found in the cDNA (data not shown).
Because this patient is female and 50% of her PMN were
affected, these results are in agreement with an idea that the
mutant PIG-A allele is on the active X chromosome of her
affected PMN.
We sequenced three nonfunctional clones of PIG-A cDNA
prepared from PMN of patient no. 8 and found a T to A
base change in codon 431, which generates the stop codon,
TAG (Table 1). To confirm the presence of this mutation in
the DNA, we sequenced PCR products from the DNA of
PMN amplified using primers AIT4 and B12 (Fig 1B). We
found the same mutation as that in the cDNA in two of five
clones (data not shown). This finding is reasonable because
patient no. 8 is male and 37% of his PMN were affected.
Patients no. 3 and 7: Missense mutations. Among the
PMN of patients no. 3 and 7, 97% and 608,respectively,
were CD59- (Table 1). Mutations in these patients were
identified in a similar way as described above at the cDNA
level by sequencing three nonfunctional clones. Both patients had the same missense mutation, namely an A to G
change within codon 128 that causes a change from His to
Arg (Table 1). This mutationwas confirmed at the DNA
level. Two of three and two of five clones of DNA amplified
byPCR from patients no.3and 7, respectively, had the
mutation. To confirm that this missense mutation accounted
for the loss of function of PIG-A, portions of cDNA that
contain codon 128 were exchanged between the nonfunctional clone from patient no. 7 and the wild-typecDNA.
Introduction of the mutant sequence from the nonfunctional
clone into wild-type cDNA resulted in a complete loss of
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
YAMADA ET AL
888
A.
B.
Patlent 7
[
'In
T
*-A
I
,
",m.
i'50
4+' :-2
:I
,
LO)
102
h
I03
-
Patient 18
8
2
L2-J
-,
4-8:'
1'
9,.
1.
$B'
188
v-2
,
i,
103
Fluon
Flwmacancelntenalty
I
, '!
;;!
caused a frame shift and the appearance of stop codons 16,
9, 50, and 116 nt downstream in patients no. 5, 6, 12, and
17, respectively. The presence of these mutations
DNA
in
was
confirmed by sequencing the PCR products amplified
I
p a t h t S + Normal 3'
Normal 5' + Patknt 3'
I
Normal
Patht
Fig 2. FACS analysis
after transfection of chimeric PIG-A cDNAs
to assess the effects ofthe missense mutationsfound in patients no.
7 and 18. PIG-A cDNAs bearingthe missense mutations,normal PIGA cDNA, and their chimeras were transfected into the PIG-A-deficient calls. After hygromycin selaction,
the cells were stained for
CD-. (A) Patient no. 7; (B) patient no. 18. Lines
1, chimeras consisting
of the mutation-bearing5' portion of patient's cDNA and the 3' portion of the normal cDNA; lines2, chimeres consistingof the 5' portion
of the normal cDNA endthe 3' portion of the patient's mutant cDNA;
linea 3, patient PIG-A cDNAbearingmissensemutations;lines
4,
normal PIG-A cDNA. As schamatically shown below the FACS profiles, the 3' untranslated regionwas maintained in the normal cDNA
to help differentiation of chimeras from the parental cDNAs.
ability to restore the surface expression of CD59 on PIGA-deficient mutant cells (Fig 2A). The portion of cDNA
introduced was sequenced before the exchange to ensure that
this mutation was the only nucleotide change. Conversely,
introduction of the wild-type sequence into the nonfunctional
clone resulted in the expression of functional activity (Fig
2A), indicating that this missense mutation was responsible
for the loss of function.
Patients no. 5, 6, 9, 11, 12, 14, and 17: Frame shifr mutations. Among the PMN of patients no. 5, 6, 12, and 17,
65%, 72%, 94%, and 40%, respectively, were CD59- (Table
1). Previous RT-PCR analysisI8 and that shown inFig 3
(lane 3) demonstrated that they have apparently normal-sized
PIG-A transcripts. Transfection showed that fractions of
these transcripts were nonfunctional.I8To identify the mutations in these patients, we subjected the RT-PCR products
to hetero-duplex analysis and then sequenced the relevant
regions. Patients no. 5, 12, and 17 showed a hetero-duplex
in one of seven segments on MDE gel electrophoresis (Fig
4A, B, and C). For example, hetero-duplex formation was
found when exon 6 was analyzed in patient no. 5 (lane 7 of
Fig 4A). We sequenced the cloned RT-PCR products that
showed the same hetero-duplex profile (lanes 1 through 3
and 5 of Fig 4A) and found a mutation. In this way, we
identified one mutation in the sample from each patient: a
deletion of C in codon 437 in patient no. 5, a deletion of A
in codon 312 in patient no. 12, andan insertion of T in
codon 90 in patient no.17 (Table 1). We identified the
deletion of A in codon 191 in patient no. 6 by sequencing
the whole coding region of three nonfunctional clones of
RT-PCR products." These deletion and insertion mutations
from theDNA of PMN (data not shown).
Hetero-duplex and sequencing analyses of the cDNA of
patient no. 12 identified a silent base change of T to C in
codon 175
in addition to the above base deletion. This base
change must
be genetic polymorphism rather than a somatic
mutation, because all PCR clones amplified from DNA of
MNC, only 10% of whichwere CD59-, had this change
(data not shown).
Mutations in patients no. 9 and 1 1, insertion of A in codon
82 and deletion of T in codon 136, respectively, were
previously
identified
at the cDNA level.lRThese mutations in
the DNA were shown by restriction mapping PCR-amplified
DNA fragments, because the former mutation generates a
new Hpa I site and the latter eliminates a NZa I11 site (data
not shown).
As reported previously, patient no. 14 had skewed profile
of PIG-A transcripts on RT-PCR, the band of 1,500 bp,
which corresponds to the normal size coding region, being
greatly decreased, and, instead, a band of 850 bp, which is
a product of the alternative splicing, being increased." Because the 850-bp band lacked a 3'- portion of exon 2," we
sequenced exon 2 after PCR amplification of DNA using
primers A1 1 and BIT1 . We found a change from GC to T
in codon 112/113 (nt 336/337) in 3 of 10 clones obtained in
two independent PCR (data not shown). Because 43% of
PMN of this male patient were CD59- (Table l), this ratio
of mutants to normal clones is reasonable. This mutation
caused a frame shift and a stop codon 34 nt downstream.
Patient no. 18: Double PNH clones. As shown in Fig
3, the RT-PCR of PMN from patient no. 18 showed double
bands of 1,500 and 1,400 bp as well as two shorter, alternatively spliced bands of 850 and 750 bp. Because 95% of her
PMN were DAF- and CD59- (Fig 5A), the normal sized
1,500-bp band might also be abnormal.
We analyzed the abnormally shorter 1,400-bp band first.
Restriction mapping of the cloned 1,400-bp bandshowed
that exon 4 was missing. To identify the mutation responsible
for this defect, we amplified, cloned, and sequenced the junctions of exon 4 from DNA of PMN. Two of six clones had
a G to A change within the consensus GT sequence of the
5' splice site (Table 1). Because this patient is female and
because the ratio of 1,500- to 1,400-bp bands was about 1
to 2 (lane 4 inFig 3), this result supported a notionthat
two thirds of her PMN had this mutation on the active X
chromosome that causes abnormal splicing of exon 4.
We then analyzed the 1,500-bp cDNA. Hetero-duplex
analysis of cDNA segments amplified by PCR from the total
RT product showed a mutation in a segment corresponding
to the 5' halfof exon 2 (lane 5 in Fig 4D). Three of four
clones of the PCR product showed a similar hetero-duplex
when mixed with the corresponding PCR product from normal cDNA (lanes 2 through 4 in Fig 4D). Sequence analysis
of these clones identified a missense mutation, a T to A
change in codon 35 that changes Ile to Lys (Table 1). TO
confirm the presence of this mutation in DNA, we sequenced
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
PIG-A GENE IN PNH
889
1 2 3 4
0 1500bp
Fig 3. RT-PCR analysis of PIG-A mRNA in PMN
from patients no. l? and 18. Samples of RNA were
reverse-transcribed and the coding region of PIG-A
was amplified by PCR. The products were resolved
by agarose gel electrophoresis and visualized by autoradiography. Lane 1, amplified coding region of
PlG-A cDNA; lane 2, a normal individual; lane 3, patient no. 17; lane 4, patient no. 18.Sizes are indicated
on the right.
A.
Patient 5
I
1 2 3 4 4 6 7
B. Patient 12
I
1 2 3 6 5 6
Fig 4. Hetero-duplex analysis for patients no. 5,
17,
and 18. (A) Patient no. 5. Samples of cDNA
amplified with primers A14 and B12 are shown.
Lanes 1 through 5, mixtures ofpatient's cloned cDNA
and normal cDNA; lane 6, normal cDNA; lane 7, patient's total cDNA. Clones shown in lanes l through
3 and 5 had a mutation. (B) Patient no. 12.Samples of
cDNA amplified with primers A5 and B10 are shown.
Lanes 1 through 4, mixtures of patient's cloned cDNA
and normal cDNA; lane 5, normal cDNA; lane 6, a
mixture of patient's total cDNA and normal cDNA.
All four clones had a mutation. IC) Patient no. 17.
Samples of cDNA amplified with primers A l l and B2
are shown. Lane 1, normal cDNA; lane 2, patient's
total cDNA; lanes 3 and 4, mixturesof patient's
cloned cDNA and normal cDNA; lanes 5 and 6, patient's cloned cDNA shown inlanes 3 and 4, respectively, alone. Both clones had a mutation. (D) Patient
no. 18.Samples of cDNA amplified with primers A1 1
and 82. Lanes 1 through 4, mixtures of patient's
cloned cDNA and normal cDNA; lane 5, patient's total cDNA; lane 6, normal cDNA. Clones shown in
lanes 2 through 4 had a mutation.
12,
c. Patient 17
nn
123456
1400 bp
850 bp
750 bp
D. Patient 18
I
123656
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
YAMADA ET AL
890
A.
PMN
Patient
9
Fluorescence
intensity
Fluorescence
intensity
B. Lymphocytes
Patient
Fluorescence
Intensity
Fluorescence
intensity
Fig 5. FACS analysis ofPMN (A) and lymphocytes (B) from patient
no. 18. Lines 1 and 2,cells from patient no. 18 stained for CD59 and
its negative control, respectively; lines 3 and 4, cells from a normal
individual stained for CD59 and its negative control, respectively.
the PCR products from theDNAofMNC.
In the MNC.
10% of lymphocytes (Fig 5B) and 90% of monocytes (data
not shown) were CD59-. Two of 20 clones from the MNC
had the same missense mutation (data not shown).
Wethen tested, by means of transfection. whether the
missense mutation causes a functional loss. The cloned
1,500-bp cDNA that bears the missense mutationdid not
complement the surface expression of CD59 on the PIG-Adeficient mutant cells (Fig 2B). Replacement of a portion of
the mutant cDNA containing codon 35 with that of the normal cDNA restored the activity to complement the mutant
cells. Conversely, replacement of that portion of the normal
cDNA with that of the mutant cDNA resulted in the absence
of activity to complement surface expression of CD59 (Fig
2B), indicating that the missense mutation is responsible for
the loss of function.
To determine whether this missense mutation is present
in a clone of PMN different from that bearing the splice
abnormality, we sequenced the 1.400-bp, abnormally spliced
cDNA and found no mutation in codon 35 (data not shown).
This indicated that the patient’s PMN consist of two PNH
clones, with about 60% bearing a mutation in a splice site.
about 30% bearing a mutation within the coding region. and
5% being normal cells.
DISCUSSION
We analyzed here the PMNfrom 14 Japanese patients
withPNHandidentified
15 somatic mutations of PIG-A
(Table I ). Mutations were first found in mRNAandthen
confirmed in DNA. The mutations included eight single-base
changes and seven frame shift mutations. The single-base
changes were two nonsense and three missense mutations,
as well as three examples of abnormal splicing caused by
single-base changes. The frame shift mutations were four
single-base deletions, two single-base insertions, and a replacement of two bases with one base. These mutations were
all different except for one missense mutation found in both
patients no. 3 and 7. The mutations were distributed in various regions of the gene, suggesting thatthey occurred at
random sites and that there is no mutation hot spot in the
PIG-A gene. Thus, we now have no evidence that mutation
rate of the PIG-A gene is abnormally high. This finding
further supports the notion that X-chromosomal location of
the PIG-A gene accounts for the uniformity of the responsible gene for PNH.
Together with a previously demonstrated single-base deletion in patient no. 16 (Table l),” all 16 somatic mutations
found to date in Japanese patients with PNH are small mutations. Nine mutations in British patients have been reported:
two missense and one nonsense mutations, two single-base
deletions, the insertion of five bases, two examples of replacements of two bases by one base, and a 4-kb deletion.l~J,211.2?
Four mutations in American patients have been
reported: one missense mutation, one single-base deletion,
one two-base deletion, and one two-base insertion.*’ Fourteen mutations have recently been identified in Thai patients.
They include six single-base deletions; one each of two-,
three-,five-andIO-base
deletions; two single-base insertions; and two base changes at splice sites (P. Pramoonjago
et al. manuscript in preparation). Except for the 4-kb deletion, the largest of the 4 2 mutations was a IO-base deletion.
Thus, a big deletion or a gross rearrangement involving PIGA gene has not been found. These events may be very rare
in the hematopoietic stem cells of patients with PNH or a
big deletion might have critical effects on the cells because
an essential gene is thought to be located closely to the PIGA gene.”
In patients with PNH, mutant clonal cells occupy significant fractions of the blood cells. During the early stage of
the disease, expansion of the mutant clone must occur. It
seems unlikely that a mutant clone has intrinsic ability to
grow advantageously seems unlikely, because the expansion
does not seem to continue but rather to become stabilized
at a particular level of occupancy. The level of occupancy
by a mutant clone varies in different patients. The patients
studied in this investigation had 37% to 100% affected PMN.
All mutations in these patients resulted in loss of function,
causing complete deficiency of the surface expression of
GPI-anchored proteins. This finding implies that the extent
to which a mutant clone expands is not determined solely
by the mutation of P I G 4 but is influenced by some other
factor(s). This is consistent with the notion that there is some
mechanism(s) that selectively suppresses normal hematopoietic cells during expansion of a mutant clone(s):”’ stronger
suppression would result in a higher extent of occupancy
by a mutant clone, and different suppressions would cause
various extents of expansion of the mutant cells.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
891
PIG-A GENE IN PNH
3. Yomtovian R, Prince GM, Medof ME: The molecular basis
In patient no. 18, we found two abnormal clones of PMN
for paroxysmal nocturnal hemoglobinuria. Transfusion 33:852,1993
bearing different somatic mutations. Two British patients
4. Mahoney JF, Urakaze M, Hall S . DeGasperi R, Chang HM,
with two PNH clones have been found.*' The frequency of
Sugiyama E, Warren CD, Borowitz M, Nicholson-Weller A, Rosse
patients with double clones is, therefore, at least 3 in 39.
W,
Yeh ETH: Defective glycosylphosphatidylinositol anchor synAbout one fourth of patients with PNH have two phenotypithesis in paroxysmal nocturnal hemoglobinuria granulocytes. Blood
cally different abnormal RBCs, one with a complete defi79:1400, 1992
ciency of DAF and CD59 (type III PNH cells) and the other
5. Hirose S , Ravi L, Prince GM, Rosenfeld M, Silber R, Hazra
with partial deficiencies of DAF andor CD59 (type II PNH
SV,Medof ME: Synthesis of mannosyl-glucosaminyl-inositolphoscells).".3s These RBCs have different sensitivities to complepholipids in normal but not paroxysmal nocturnal hemoglobinuria
cells. Proc Natl Acad Sci USA 895025, 1992
ment and may be different clones bearing different muta6. McConville MJ, Ferguson MAJ: The structure, biosynthesis
tions. Thus, the frequency of cases with double clones may
and function of glycosylated phosphatidylinositols in the parasitic
be even higher.
protozoa and higher eukaryotes. Biochem J 294:305, 1993
So far, we found 4 patients with abnormal splicing (Table
7. Englund PT: The structure and biosynthesis of glycosyl phos1). In three of them, mutations in the 5' splice sites were
phatidylinositol protein anchors. Annu Rev Biochem 62:121, 1993
associated with the splicing out of the immediately upstream
8. Armstrong C, Schubert J, Ueda E, Knez JJ, Gelperin D, Hirose
exons. In one, a mutation in the 3' splice site was associated
S, Silber R, Hollan S , Schmidt RE, Medof ME: Affected paroxysmal
with the splicing out of the exon immediately downstream.
nocturnal hemoglobinuria T lymphocytes harbor a common defect
These are the typical consequences of mutations within the
in assembly of N-acetyl-D-glucosamine inositol phospholipid corresplice sites found in several genetic diseases.36
sponding to that in class A Thy-l murine lymphoma mutants. J Biol
Chem 267:25347, 1992
We found missense mutations in 3 patients. Patients no.
9. Takahashi M, Takeda J, Hirose S , Hyman R, Inoue N, Miyata
3 and 7 had a mutationin codon 128 that changes His to Arg.
T, Ueda E, Kitani T, Medof M E , Kinoshita T Deficient biosynthesis
His 128 is conserved in mouse Pig-a37and yeast SPT14,38a
of N-acetylglucosaminyl phosphatidylinositol, the first intermediate
yeast homologue of PlG-A,37*39
consistent with its essential
of glycosyl phosphatidylinositol anchor biosynthesis, in cell lines
role in the function. Patient no. 18 had an Ile to Lys mutation
established from patients with paroxysmal nocturnal hemoglobinin codon 35. Ile 35 is conserved in mouse Pig-a but is within
uria. J Exp Med 177:517, 1993
the N-terminal36 amino acids that are truncated in SPT14.
10. Hidaka M, Nagakura S , Horikawa K, Kawaguchi T, Iwamoto
Because these N-terminal portions have only 50% amino
N, Kagimoto T, Takatsuki K, Nakakuma H: Impaired glycosylation
acid identity, whereas the rest of the molecules have 88%
of glycosylphosphatidylinositol-anchorsynthesis in paroxysmal nocidentit~,~'so
it was uncertain whether these N-terminal porturnal hemoglobinuria leukocytes. Biochem Biophys Res Commun
191571, 1993
tions are functionally important was not clear. Identifying
11. Hillmen P, Bessler M, Mason PJ, Watkins WM, Luzzatto L
this mutant demonstrated their functional importance.
Specific defect in N-acetylglucosamine incorporation in the biosynThe mutation in patient no. 14 was the same as that found
thesis of the glycosylphosphatidylinositol anchor in cloned cell lines
in a British patient HH8.I9 In the former, we analyzed PMN
from patients with paroxysmal nocturnal hemoglobinuria. Roc Nafl
and, in the latter, we analyzed a B-lymphoblastoid cell line.
Acad Sci USA 905272, 1993
In both, the amounts of normal sized transcript greatly de12. Noms J, Hall S , Ware RE, Kamitani T, Chang HM, Yeh E,
creased. Inthe
former, the 850-bp product increased,
Rosse W Glycosyl-phosphatidylinositol anchor synthesis in paroxwhereas, in the latter, the 1,200-bp product increa~ed.'~.'~ ysmal nocturnal hemoglobinuria: Partial or complete defect in an
This difference may be caused bythe cell type. Possible
early step. Blood 832316, 1994
explanations for these abnormal transcripts in cells bearing
13. Stevens VL, Raetz CR: Defective glycosyl phosphatidylinosia frame-shift mutation in the coding region were previously
to1 biosynthesis in extracts of three Thy-l negative lymphoma cell
mutants. J Biol Chem 266:10039, 1991
discussed.19 One explanation is that the generation of a pre14. Sugiyama E, DeGasperi R, Urakaze M, Chang HM, Thomas
mature stop codon due to this frame shift resulted in instabilU,Hyman R, Warren CD, Yeh ETH: Identification of defects in
ity of the normal-sized transcript. Another explanation is
glycosylphosphatidylinositol anchor biosynthesis in the Thy-l exthat the close proximity of the mutation to an alternative
pression mutants. J Biol Chem 266:12119, 1991
splice site resulted in skewed splicing. Further analysis is
15. Miyata T, Takeda J, Iida Y, Yamada N, Inoue N, Takahashi
necessary to clarify this.
M, Maeda K, Kitani T, Kinoshita T: Cloning of PIG-A, a component
ACKNOWLEDGMENT
We thank Drs T. Kageyama, Y. Kurata, Y. Kanayama, K. Yasunaga, Y. Kishimoto, T. Fujita, A. Kanamaru, N. Takemori, K. Hirai,
A. Shibata, S . Maruyama, and M. Nakamura for providing us with
blood samples from patients, and Dr N. Inoue for critically reading
the manuscript. We also thank Keiko Kinoshita and Maria Lourdes
Parumog for technical assistance.
REFERENCES
1. Rotoli B, Luzzatto L: Paroxysmal nocturnal haemoglobinuria.
Clin Haematol 2: 113, 1989
2. Rosse W:
Paroxysmal nocturnal hemoglobinuria. Curr Top
Microbiol Immunol 178:163, 1992
in the early step of GPI-anchor biosynthesis. Science 259: 1318, 1993
16. Ueda E, Nishimura J, Kitani T, Nasu K, Kageyama T, Kim
YU, Takeda J, Kinoshita T Deficient surface expression of glycosylphosphatidylinositol-anchored proteins inB cell lines established
from patients with paroxysmal nocturnal hemoglobinuria. Int Immuno1 4:1263, 1992
17. Takeda J, Miyata T, Kawagoe K, Iida Y, Endo Y, Fujita T,
Takahashi M, Kitani T, Kinoshita T Deficiency of the GP1 anchor
caused by a somatic mutation of the PIG-A gene in paroxysmal
nocturnal hemoglobinuria. Cell 73:703, 1993
18. Miyata T, Yamada N, Iida Y, Nishimura J, Takeda J, Kitani
T, Kinoshita T Abnormalities of PIG-A transcripts in granulocytes
from patients with paroxysmal nocturnal hemoglobinuria. N Engl J
Med 330:249, 1994
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
892
19. Bessler M, Mason PJ, Hillmen P, Miyata T, Yamada N,
Takeda J, Luzzatto L, Kinoshita T: Paroxysmal nocturnal haemoglobinuria (PNH) is caused by somatic mutations in the PIG-A gene.
EMBO J 13:110, 1994
20. Bessler M, Mason P, Hillmen P, Luzzatto L: Somatic mutationsand cellular selection inparoxysmal nocturnal haemoglobinuria. Lancet 343:951, 1994
21. Ware RE, Rosse WF, Howard TA: Mutations within the Piga
gene in patients with paroxysmal nocturnal hemoglobinuria. Blood
83:24 18, I994
22. Bessler M, Mason PJ, Hillmen P, Luzzatto L: Mutations in
the PIG-A gene causing partial deficiency of GPI-linked surface
proteins (PNH 11)in patients with paroxysmal nocturnal haemoglobinuria. Br J Haematol 87:863, 1994
23.Kamitani T, Chang HM, Rollins C, Waneck G, Yeh ETH:
Correction of a defect in GP1 anchor biosynthesis in Ltk- cells by
a cloned human cDNA. FASEB J 7:1050, 1993 (abstr)
24. Inoue N, Kinoshita T, Orii T, Takeda J: Cloning of a human
gene, PIG-F, a component of glycosylphosphatidylinositol anchor
biosynthesis, by a novel expression cloning strategy. J Biol Chem
268:6882, 1993
25. Ware RE, Howard TA, Kamitani T, Chang HM,Yeh ETH,
Seldin MF: Chromosomal assignment of genes involved in glycosylphosphatidylinositol anchor biosynthesis: Implications for the pathogenesis of paroxysmal nocturnal hemoglobinuria. Blood 83:3753,
1994
26. Kinoshita T, Medof ME, Silber R, Nussenzweig V: Distribution of decay-accelerating factor in the peripheral blood of normal
individuals and patients with paroxysmal nocturnal hemoglobinuria.
J ExpMed 162:75, 1985
27. Sugita Y, Ito K, Shiozuka H, Gushima H, Tomita M, Masuho
Y: Recombinant soluble CD59 inhibits reactive haemolysis with
complement. Immunology 82:34, 1994
28. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem 162:156, 1987
29. Margolskee RF, Kavathas P, Berg P: Epstein-Barr virus shuttle vector for stable episomal replication of cDNA expression libraries in human cells. Mol Cell Biol 8:2837, 1988
YAMADA ET AL
30. Sambrook J, Fritsch EF, Maniatis T: Analysis and cloning
of eukaryotic genomic DNA, in Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory,
I989
3 1. Iida Y, Takeda J, Miyata T, Inoue N, Nishimura J, Kitani T,
Maeda K, Kinoshita T: Characterization of genomic PIG-A gene:a
gene for GPI-anchor biosynthesis and paroxysmal nocturnal hemoglobinuria. Blood 83:3126, 1994
32. Hollander N, Selvaraj P, Springer TA: Biosynthesis and function of LFA-3 in human mutant cells deficient in phosphatidylinositol-anchored proteins. J Immunol 141:4283, I988
33. Schaefer L, Ferrero GB, Grillo A, Bassi MT, Roth EJ, Wapenaar MC, van Ommen GB, Mohandas TK, Rocchi M, Zoghbi HY,
Ballabio A: A high resolution deletion map of human chromosome
Xp22. Nature Genet 4:272, 1993
34. Shichishima T, Terasawa T, Hashimoto C, Ohto H, Uchida
T, Maruyama Y: Heterogenous expression of decay accelerating
factor and CD59hembrane attack complex inhibition factor on paroxysmal nocturnal haemoglobinuria (PNA) erythrocytes. Br J
Haematol 78:545, 1991
35. Rosse WF, Hoffman S, Campbell M, Borowitz M, Moore JO,
Parker CJ: The erythrocytes in paroxysmal nocturnal haemoglobinuria of intermediate sensitivity to complement lysis. Br J Haemato1 79:99, 1991
36. Krawczak M, Reiss J, Cooper DN: The mutational spectrum
of single base-pair substitutions in mRNA splice junctions of human
genes: Causes and consequences. Hum Genet 90:41, 1992
37. Kawagoe K, Takeda J, Endo Y, Kinoshita T: Molecular cloning of murine Pig-a, a gene for GPI-anchor biosynthesis, and demonstration of interspecies conservation of its structure, function and
gene locus. Genomics 23566, 1994
38. Fassler JS, Gray W, Lee JP, Yu G, Gingerich G: The Saccharomyces cerevisiae SPT14 gene is essential for normal expression
of the yeast transposon, Ty, as well as for expression of the HIS4
gene and several genes in the mating pathway. Mol Gen Genet
230:310, 1991
39. Bessler M, Hillmen P, Longo L, Luzzatto L, Mason PJ: Genomic organization of the X-linked gene (PIG-A) that is mutated in
paroxysmal nocturnal haemoglobinuria and of a related autosomal
pseudogene mapped to 12q21. Hum Mol Genet 3:751, 1994
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
1995 85: 885-892
Somatic mutations of the PIG-A gene found in Japanese patients with
paroxysmal nocturnal hemoglobinuria
N Yamada, T Miyata, K Maeda, T Kitani, J Takeda and T Kinoshita
Updated information and services can be found at:
http://www.bloodjournal.org/content/85/4/885.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.