Epigenetic Control of Highly Homologous
Killer Ig-Like Receptor Gene Alleles
This information is current as
of June 15, 2017.
Subscription
Permissions
Email Alerts
J Immunol 2005; 175:5966-5974; ;
doi: 10.4049/jimmunol.175.9.5966
http://www.jimmunol.org/content/175/9/5966
This article cites 40 articles, 23 of which you can access for free at:
http://www.jimmunol.org/content/175/9/5966.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2005 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
References
Huei-Wei Chan, Jeffrey S. Miller, Mikel B. Moore and
Charles T. Lutz
The Journal of Immunology
Epigenetic Control of Highly Homologous Killer Ig-Like
Receptor Gene Alleles1
Huei-Wei Chan,*† Jeffrey S. Miller,‡ Mikel B. Moore,*† and Charles T. Lutz2*†
ranscription is controlled by trans-acting factors that bind
to specific sites in promoters, enhancers, and other regulatory regions (1). Transcription also is controlled by heritable epigenetic features, which include DNA methylation and a
variety of histone protein posttranslational modifications (1–3).
Acetylation of histones H3 and H4 and methylation of histone H3
at the lysine 4 position are associated with transcription activation.
In contrast, transcription silencing is associated with methylation
of the promoter and 5⬘ region of the gene and with methylation of
histone H3 at the lysine 9 position. DNA methylation and suppressive histone modifications may prevent transcription even
when trans-acting factors are abundant. In turn, trans-acting factors may cause alterations in DNA methylation and histone modifications in response to cell signaling and differentiation. It is clear
that DNA methylation and histone modifications influence one another, but it is less clear which features operate independently and
whether changes occur in a defined sequence. Suppressive histone
modifications may precede DNA methylation by a considerable
time interval (2– 6). This suggests that DNA methylation is secondary to repressive histone modification. However, in several
models, DNA methylation appears to be a primary event (7, 8). It
is likely that each model system provides insight into the available
strategies to control transcription. Specific gene expression requirements may necessitate distinct combinations of epigenetic
regulatory mechanisms.
T
Killer Ig-like receptor (KIR)3 molecules are critical for human
NK and T lymphocyte discrimination of aberrant cells from normal self and influence the outcome of autoimmune diseases, transplantation, infectious diseases, and cancer (9). KIR gene expression is controlled by an unusual probabilistic mechanism.
Individual NK cells from the same human subject may express
from one to nine of the highly homologous KIR genes from the
densely packed KIR locus (9 –11), and expressed KIR genes may
be transcribed from the maternal, paternal, or both alleles (12).
Long-term NK clones maintain uniform KIR gene- and allele-specific expression, indicating that KIR transcription patterns are stable in mature NK cells through many rounds of DNA replication
(10, 12). Because KIR proteins differ in ligand specificity and
function, variegated KIR expression is functionally important. At
the KIR3DL1 locus, for example, the *001 and *002 alleles encode
inhibitory receptors and the KIR3DS1 allele encodes a stimulatory
receptor (9). The KIR alleles are extremely similar in both coding
and noncoding regions (11, 12), and differential transcription most
likely is regulated by epigenetic mechanisms. KIR promoters and
5⬘ regions are methylated in a nearly all-or-none pattern that
strictly correlates with allele-specific KIR expression, both in vitro
and in vivo (12). This finding suggests an important role of epigenetic controls in programming KIR gene expression. It is not
clear whether DNA methylation is a primary control mechanism or
whether it is secondary to other epigenetic events, such as histone
acetylation and methylation. We addressed the hypothesis that
clonally restricted and allele-specific KIR transcription is controlled primarily by DNA methylation in NK cells.
*Department of Pathology and Laboratory Medicine and †Department of Microbiology, Immunology, and Molecular Genetics, Markey Cancer Center, University of
Kentucky, Lexington, KY 40536; and ‡Department of Medicine, University of Minnesota, Minneapolis, MN 55455
Materials and Methods
Received for publication July 8, 2005. Accepted for publication August 16, 2005.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
Cells, Abs, flow cytometry, and cDNA preparation
NK92.26.5 NK cells were subcloned from 5-aza-2⬘-deoxycytidine (Aza)treated NK92.26 cells, and both cell lines were maintained in IL-2-containing medium, as described (12, 13). YT-Indy cells were provided by Z.
Brahmi (University of Indiana, Indianapolis, IN), and YT-HY cells were
provided by W. Leonard (National Institutes of Health, Bethesda, MD).
1
This work was supported by National Institutes of Health Grants R01 AI50656 and
R01 HL55417.
2
Address correspondence and reprint requests to Dr. Charles T. Lutz, Department of
Pathology and Laboratory Medicine, University of Kentucky, 800 Rose Street,
MS117, Lexington, KY 40536-0298. E-mail address: [email protected]
Copyright © 2005 by The American Association of Immunologists, Inc.
3
Abbreviations used in this paper: KIR, killer Ig-like receptor; Aza, 5-aza-2⬘-deoxycytidine; ChIP, chromatin immunoprecipitation; LCL, lymphoblastoid cell line; TSA,
trichostatin A.
0022-1767/05/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Mature human NK lymphocytes express the highly homologous killer Ig-like receptor (KIR) genes in a stochastic fashion, and KIR
transcription precisely correlates with allele-specific DNA methylation. In this study, we demonstrate that CpG methylation of a
minimal KIR promoter inhibited transcription. In human peripheral blood NK cells and long-term cell lines, expressed KIR genes
were associated with a moderate level of acetylated histone H3 and H4 and trimethylated histone H3 lysine 4. Histone modifications
were preferentially associated with the transcribed allele in NK cell lines with monoallelic KIR expression. Although reduced, a
substantial amount of histone acetylation and H3 lysine 4 trimethylation also was associated with nonexpressed KIR genes. DNA
hypomethylation correlated with increased chromatin accessibility, both in vitro and in vivo. Treatment of NK cell lines and
developing NK cells with the DNA methyltransferase inhibitor, 5-aza-2ⴕ-deoxycytidine, caused a dramatic increase in KIR RNA
and protein expression, but little change in histone modification. Our findings suggest that KIR transcription is primarily controlled by DNA methylation. The Journal of Immunology, 2005, 175: 5966 –5974.
The Journal of Immunology
Methylation and transient transfection
KIR3DL1 DNA containing 256 bp of the core promoter region was isolated and gel purified. Purified DNA fragments were either treated with
SssI methylase (New England Biolabs) or mock-treated (without enzyme).
DNA was ethanol precipitated before undergoing a second round of treatment. Completeness of CpG methylation was confirmed by HhaI restriction digestion of a small portion of DNA samples. An equal amount of
methylated and mock-methylated fragment was then ligated into SstI-XhoI
sites of pGL3-basic plasmid (Promega). These constructs were directly
transfected into YT cells along with control plasmids containing the ␤-galactosidase gene (16). Cell lysates were assayed for luciferase and ␤-galactosidase activity 40 h later, as described (16).
DNA methylation was analyzed, as described (12). In brief, genomic
DNA was treated with sodium bisulfite for 6 h at 50°C and PCR amplified
using 3DL1-specific primers. PCR products were directly subcloned into
pCRII-TOPO vector (Invitrogen Life Technologies) for sequencing.
Chromatin immunoprecipitation (ChIP) analysis
ChIP analysis was modified from a published protocol (17). For each immunoprecipitation, cells (5–10 ⫻ 106 cells for long-term cell lines and 3 ⫻
106 cells for short-term peripheral blood NK cell lines) were fixed with 1%
formaldehyde at room temperature for 10 min. Cross-linking was stopped
by addition of glycine to a final concentration of 0.125 M. After washing
in PBS, cells were lysed in RSB (10 mM Tris (pH 8.0), 3 mM MgCl2, 10
mM NaCl, and 0.05% Nonidet P-40), and nuclei were collected and lysed
in 1% SDS buffer. Nuclear lysates were sonicated on ice in the presence of
0.1 g of glass beads and precleared with fixed protein A-positive Staphylococcus aureus cells (both from Sigma-Aldrich). Aliquots of nuclear lysates either were analyzed immediately or frozen at ⫺70°C. Nuclear lysates were incubated overnight at 4°C with no Abs, 10 ␮g of normal rabbit
IgG (Sigma-Aldrich), 10 ␮l of anti-acetylated histone H3 Ab (Upstate Biotechnology), 10 ␮l of anti-acetylated histone H4 Ab (Upstate), or 5 ␮l of
Ab specific for trimethylated histone H3 lysine 4 (H3K4; Abcam). Abs
were precipitated with 10 ␮l of fixed S. aureus cells for 1 h at 4°C. Im-
munoprecipitated complexes were washed six times, and DNA was eluted
with 0.3 ml of elution buffer (50 mM NaHCO3 and 1% SDS). DNA was
released from cross-linking by incubation at 65°C for 4 –5 h in the presence
of 0.3 M NaCl and 10 ␮g of RNase A (Sigma-Aldrich). Samples were
proteinase K treated for 2 h at 45°C and applied to QIAquick columns
(Qiagen). Eluted DNA was digested with ApaI to improve specificity for
KIR3DL1. Three percent of the treated DNA was used for each PCR amplification. The quantity of KIR3DL1 or ␣-globin PCR product was normalized to G6PD levels, after subtracting the background from normal
rabbit IgG control for each cell line. The results shown are averages, with
error bars representing 1 SD.
Quantitative PCR
PCR was performed (SybrGreen JumpStart Taq ReadyMix; Sigma-Aldrich) on an MJ Opticon instrument (Bio-Rad), and results were quantified
using standard curves that were included in each PCR. Primers were obtained from Integrated DNA Technologies. For cDNA analysis, the primers
were: KIR3DL1, TTCTTGGTCCAGAGGGCCGTT and CTGTAGGTC
CCTGCAAGGGAAA; KIR3DL2, CGGTCCCTTGATGCCTGT and GAC
CACACGCAGGGCAG; and GAPDH, AGTCAGCCGCATCTTCTTTT and
GGGAAGGTGAAGGTCG. In all cases, primers were located in cDNA that
was encoded by separate exons. For quantitative RT-PCR, the amount of sample template was adjusted to give similar amplification of control GAPDH
cDNA. For ChIP assays, the primers were: KIR3DL1F, GTGAAGGACGC
GAGGTGTCAATTCTAGTGACAG and KIR3DL1R, ACCTCTAGGC
CCATATCTTTACCTCCAAGT; KIR3DL2, AGAATTCAATCACCTCAT
GTG and GCTTCCTTGAAATTGTTGTG; and G6PD, TAGGGCCGCATC
CCGCTCCGGAGAGAAGTCT and AGAGACGAGGAGGCGTGTAGGC
GGTGACG.
Chromatin accessibility assay
A total of 1.5–3 ⫻ 106 cultured cells or 1.5 ⫻ 106 freshly sorted peripheral
blood NK cells was washed with PBS and resuspended in RSB buffer.
Nuclei were washed once with 1⫻ restriction digestion buffer and divided
into aliquots for digestion with MspI I (0, 20, or 40 U at 37°C for 15 min;
New England Biolabs). DNA was isolated using QIAamp DNA blood
minikit (Qiagen), and 0.5–1 ␮g of DNA was ligated at the MspI overhangs
with linker oligonucleotides: LK1, CGAGTACTGCACCAGCAAATCC
and LK2, GGATTTGCTGGTGCAGTACT. After ApaI digestion to increase KIR3DL1 specificity, ligation products were PCR amplified using
LK2 and KIR3DL1R, and analyzed by agarose gel electrophoresis.
Results
KIR expression levels vary in NK and T cell lines
To determine whether KIR epigenetic features correlate with expression levels, we measured KIR3DL1 RNA and cell surface expression in several model cell lines. Of the cell lines examined,
NK92.26.5 NK cells had the highest levels of KIR3DL1 RNA and
cell surface expression (Fig. 1, A and B). NK92.26 had RNA levels
that were ⬃1.5% (range 1–3%) those of NK92.26.5. Some or all of
the KIR3DL1 RNA may have come from a small minority of
NK92.26 cells (up to 0.8% of cells) that expressed cell surface
KIR3DL1 at levels comparable to NK92.26.5 cells (Fig. 1C). Although YT NK cells have been reported to express KIR3DL1 RNA
(18), the YT cell lines used in these experiments did not express
KIR3DL1 RNA or cell surface protein (Fig. 1, A and C). As expected, LCL B lymphocytes, K562 myeloid cells, U937 monocytic
cells, and FaDu epithelial cells had no detectable KIR3DL1 RNA
or cell surface expression (Fig. 1, A and B, and data not shown).
Hut78 T cells had low-level KIR3DL1 RNA, but no detectable cell
surface expression (Fig. 1, A and B).
KIR3DL1 methylation and transcription are allele specific
We and others have shown that KIR transcription is repressed by
promoter and 5⬘ region DNA methylation (12, 19). We determined
the methylation status of the KIR3DL1 gene in NK92.26 NK cells
and Hut78 T cells. The bisulfite technique showed that NK92.26
had nearly uniform promoter methylation of 21 of 22 sequences
examined, including both the *001 and *002 alleles (Fig. 2A). One
KIR3DL1 sequence was hypomethylated, consistent with bright
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
These NK cells acted equivalently and are designated YT in the manuscript. Hut78 T cells, U937 monocytes, K562 myeloid cells, and FaDu
epithelial cells were obtained from the American Type Culture Collection.
The EBV-transformed YS-LCL B cell line has been described and is referred to as lymphoblastoid cell line (LCL) in the text (14). These cells
were grown in medium containing 10% iron-supplemented bovine serum
(HyClone).
Allophycocyanin-labeled anti-CD56 and PE-labeled or unlabeled p70
anti-KIR3DL1 mAb were obtained from Beckman Coulter or from BD
Biosciences. DX31 anti-KIR3DL2 mAb was provided by J. Phillips
(DNAX, Palo Alto, CA). GL183 and EB6 were obtained from Beckman
Coulter. Allophycocyanin-labeled anti-CD34, PE-labeled anti-CD38, and a
FITC-labeled mixture of lineage depletion markers (CD2, CD3, CD4,
CD5, CD7, CD8, CD10, and CD19) were all obtained from BD Biosciences. Control mouse IgG and PE-conjugated goat anti-mouse IgG were
obtained from Southern Biotechnology Associates.
All human cells were obtained with approval of the appropriate Institutional Review Board committee. CD34⫹CD38⫺lineage⫺ progenitors
were isolated from umbilical cord blood after CD34 enrichment using
MACS columns (Miltenyi Biotec), as indicated by the manufacturer. Cells
were then cultured as described with AFT024 mouse fetal liver stromal
cells, primitive-acting factors, IL-7, and either IL-2 or IL-15, conditions
known to induce NK cell differentiation from primitive progenitors (15).
NK cells were then cultured in various concentrations of Aza and trichostatin A (Sigma-Aldrich), as indicated. Cells were stained with anti-CD56
mAb and for individual anti-KIR mAb or a mixture containing anti-KIR
mAb, GL183, EB6, and DX9.
Mature NK cells were obtained as described from donor L, who was
heterozygous at the KIR3DL1 locus (12). Briefly, blood was incubated with
Ab complexes bispecific for glycophorin A and leukocyte CD3, CD4,
CD19, CD36, or CD66b (RosetteSep; StemCell Technologies). Erythrocyte-Leukocyte rosettes were removed by centrifugation through a Ficoll
density gradient (Sigma-Aldrich). This technique routinely produced 85–
90% CD56⫹ cells. Enriched NK cells were stained with anti-CD56 and p70
anti-KIR3DL1 mAb and flow cytometry sorted into CD56⫹KIR3DL1⫹
and CD56⫹KIR3DL1⫺ NK cells. Cells were cultured for 8 –15 days with
a stimulation mixture of PHA, IL-2, irradiated autologous PBMC, and
irradiated 721.221 B lymphoblasts.
Total RNA was extracted using TRIzol reagent, RNA was treated with
DNase I to remove genomic DNA, and reverse transcription was performed
using SuperScript II, all according to manufacturer protocols (Invitrogen
Life Technologies).
5967
5968
PRIMARY CONTROL OF KIR GENES BY DNA METHYLATION
KIR3DL1 cell surface expression by a small minority of NK92.26
cells (Fig. 1C). Hut78 also was heterozygous at the KIR3DL1 locus, with an *002 allele and a 3DS1-like allele. In Hut78, the *002
allele was heavily methylated, but half of the 3DS1 allele sequences were hypomethylated. These results indicated that about
half of Hut78 cells had a hypomethylated 3DS1 allele. 3DS1 is
similar to other stimulatory KIR proteins, which require DAP12
protein for cell surface expression (20). Like most T cells (20),
Hut78 cells did not express DAP12 RNA (data not shown), which
accounts for the apparent lack of 3DS1 cell surface expression.
We previously demonstrated that allele-specific KIR3DL1 transcription correlated with allele-specific DNA methylation in
NK92.26.5 cells and in peripheral blood NK clones (12). To extend this finding, we analyzed KIR3DL1 RNA expression in Hut78
T cells. Restriction endonuclease digestion of KIR3DL1 RT-PCR
products from control heterozygous polyclonal peripheral blood
NK cells showed two allelic bands with both NlaIII and BsaAI
digestion (Fig. 2B, lane 3). NK92.26.5 RT-PCR products showed
only the *001 allele (Fig. 2B, lane 2), consistent with previous
findings (12). Hut78 RT-PCR products showed a restriction endonuclease digestion pattern consistent with transcription of only the
3DS1 allele, without evidence of *002 allele transcription (Fig. 2B,
lane 1). This correlates with selective 3DS1 allele DNA hypomethylation in Hut78 (Fig. 2A). Thus, KIR DNA hypomethylation
correlated with allele-specific RNA expression in both NK cells
and T cells, including both inhibitory and stimulatory KIR.
DNA methylation inhibits KIR promoter activity
The correlation between allele-specific KIR gene expression and
promoter hypomethylation may indicate that DNA methylation in-
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 1. KIR3DL1 RNA and cell surface protein expression. A,
Quantitative RT-PCR was used to measure KIR3DL1 RNA in LCL, YT,
Hut78 (Hut), NK92.26 (26), and NK92.26.5 (26.5) cells. The results were
calculated as a KIR3DL1:GAPDH ratio, normalized to NK92.26.5 cells,
and presented as averages and SDs from four experiments. FaDu, K562,
and U937 cells had no detectable KIR3DL1 RNA (data not shown). B,
KIR3DL1 cell surface expression was tested using KIRp70 mAb (filled
curve) and mouse IgG isotype control (open curve) and presented on a
logarithmic scale. In the same experiment, FaDu, K562, and U937 cells
had no staining above background (data not shown). Results shown are
typical of three experiments. C, NK92.26 cells contain a small number of
KIR3DL1⫹ cells. KIR3DL1 cell surface expression was tested as above
and was plotted against forward scatter on a logarithmic scale. The percentage of events in the upper right quadrant is indicated. Results shown
are typical of four experiments.
FIGURE 2. KIR3DL1 DNA methylation and RNA expression are allele
specific. A, Methylation status of KIR3DL1 alleles in NK92.26 and Hut78
cells as determined by bisulfite analysis. The location of exon 1 is indicated. F and E, Represent methylated and nonmethylated CpG sites, respectively. Each row of circles represents an individual DNA subclone.
The *001, *002, and 3DS1 KIR3DL1 alleles are indicated. B, KIR3DL1
RT-PCR products from Hut78 (Hut), NK92.26.5 (26.5), or control heterozygous peripheral blood NK cells (NK) were digested with NlaIII or
BsaAI and electrophoresed on agarose gels with m.w. standards. The peripheral blood NK cells and NK92.26.5 cells are heterozygous for the *001
and *002 KIR3DL1 alleles. Hut78 is heterozygous for the 3DS1 and *002
KIR3DL1 alleles. The *001 and 3DS1 PCR products share the same endonuclease digestion pattern (2 NlaIII sites, 1 BsaAI site), which differs
from that of *002 PCR products (1 NlaIII site, 2 BsaAI sites). The polymorphism leading to differential restriction enzyme digestion is illustrated
below each photograph. Results shown are typical of three experiments.
The Journal of Immunology
10.6 (histone H3)- and 19.7 (histone H4)-fold higher in K562 cells
than in NK92.26 and NK92.26.5 cells (data not shown). KIR3DL1nonexpressing epithelial cells, myeloid cells, B cells, and YT NK
cells had similar low-level KIR3DL1-associated acetylated histone
H3 and H4 levels (Fig. 4A and data not shown). KIR3DL1⫹
NK92.26.5 cells had KIR3DL1-associated levels of acetylated H3
and acetylated H4 that were ⬃5-fold greater than the KIR3DL1⫺
FaDu epithelial cells (Fig. 4A). The level of KIR3DL1-associated
histone acetylation in Hut78 cells and NK92.26 cells was intermediate between that of KIR3DL1⫺ FaDu epithelial cells and
KIR3DL1⫹ NK92.26.5 NK cells. The differences between cell
lines were surprisingly small. Even though Hut78 cells had easily
detectable levels of KIR3DL1 RNA and promoter hypomethylation, KIR3DL1-associated histone acetylation was only about
double that of the FaDu-negative control (Fig. 4A). Likewise,
even though NK92.26 cells had almost complete KIR3DL1 promoter methylation and only 1–3% as much KIR3DL1 RNA as
did NK92.26.5 cells (Fig. 1A), NK92.26 cells had close to half
the level of KIR3DL1-associated acetylated histone H3 and H4
(Fig. 4A).
KIR3DL1 promoter histone acetylation
Chromosomal DNA may become methylated secondary to histone
modification (3). Therefore, we investigated histone modifications
using the ChIP assay. We examined histone H3 acetylation at the
lysine 9 and lysine 14 positions and H4 acetylation at the 5th, 8th,
12th, and 16th positions. As a positive control, we measured ␣-globin-associated acetylated histone levels, which were an average of
FIGURE 3. In vitro methylation inhibits KIR3DL1 promoter activity.
The 256-bp KIR3DL1 minimal promoter was isolated by restriction endonuclease digestion and gel purification. Left panel, Promoter fragments
were either methylated with SssI DNA methylase or mock methylated under parallel conditions, but without enzyme. Fragments were quantified,
and equal amounts were ligated to SstI/XhoI-digested pGL3-basic plasmids
upstream of the luciferase transcription start site. Ligation products were
transfected into YT cells, and luciferase activity was corrected for transfection efficiency. The methylated promoter activity is presented as a fraction of the mock-methylated promoter activity. Right panel, As comparison
groups, YT cells were transfected with intact pGL3-basic plasmid that
contained the 256-bp KIR3DL1 minimal promoter (KIR) or that did not
have a promoter (None). The promoterless plasmid activity is presented as
a fraction of KIR3DL1 promoter plasmid activity. These data are representative of three independent experiments.
FIGURE 4. KIR3DL1-associated histone acetylation was assessed by
the ChIP assay. Shown are quantitative PCR values in comparison with the
internal control, G6PD. A, The amount of KIR3DL1-associated acetylated
histone H3 and H4 is expressed as a fraction of that in NK92.26.5 cells in
six experiments. Cell line abbreviations are as in Fig. 1. B, Peripheral blood
NK cells were flow cytometry sorted into CD56⫹KIR3DL1⫺ and
CD56⫹KIR3DL1⫹ populations and were cultured for 8 –15 days. The
amount of KIR3DL1-associated acetylated H3 and H4 is expressed as a
fraction of that in KIR3DL1⫹ NK cells. YT NK cells were included as a
comparison group. The left panel in B is an average of two experiments.
The right panel is the result of one experiment.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
hibits transcription. Alternatively, DNA methylation changes may
be secondary to other epigenetic changes that regulate transcription. To test whether KIR promoter methylation inhibits transcription, we used the cassette methylation assay in which all CpG sites
within the 256-bp minimal KIR3DL1 promoter were methylated
without modification of the luciferase reporter plasmid. Plasmids
probably do not fully assemble chromatin within 40 h of transfection (21) and the cassette methylation assay has been used to test
the effect of precisely targeted promoter methylation (22). As a
control, KIR3DL1 promoter DNA was mock methylated in the
absence of SssI CpG methylase enzyme. Completeness of methylation was confirmed by lack of digestion with the HhaI methylation-sensitive restriction endonuclease (data not shown). Equal
amounts of mock-methylated and SssI-methylated promoter fragments were ligated to an unmodified luciferase reporter gene, and
ligation products were directly transfected into YT cells. Although
YT cells did not express the endogenous KIR3DL1 gene (Fig. 1),
they did express KIR3DL1 promoter-driven luciferase reporter
genes in transient transfection experiments (12), indicating that YT
cells contained the trans-acting factors needed for KIR transcription. Control, mock-methylated KIR3DL1 promoter DNA directed
luciferase expression (Fig. 3). SssI methylase treatment reduced
KIR3DL1 promoter function by an average of 92.5% (ranging from
82.2 to 97.7% inhibition in three independent experiments). These
results indicate that precisely targeted KIR3DL1 promoter CpG
methylation inhibited transcription in transfected NK cells. Based
on newly validated criteria (23), the cluster of CpG sites in the
KIR3DL1 promoter is not sufficiently dense to qualify as a CpG
island. Therefore, our results indicate that relatively low density
CpG methylation inhibits transcription.
5969
5970
Because long-term culture may induce epigenetic changes (24),
we wished to examine polyclonal peripheral blood NK cells. Purified CD56⫹ NK cells were sorted into KIR3DL1⫹ and
KIR3DL1⫺ populations. In two experiments, the KIR3DL1⫹ and
KIR3DL1⫺ populations were ⬎98 and ⬎95% pure, respectively
(data not shown). The cells were expanded with one or two rounds
of in vitro stimulation and were analyzed by ChIP. Levels of
KIR3DL1-associated H3 and H4 acetylation were ⬃1.7- and 4.1fold higher in KIR3DL1⫹ NK cells than in KIR3DL1⫺ NK cells,
respectively (Fig. 4B). In both populations of polyclonal NK cells,
specific anti-acetylated histone Ab produced KIR3DL1 signal that
was significantly higher than the background found in the
KIR3DL1⫺ YT NK cell line (Fig. 4B). Although KIR3DL1⫺ polyclonal NK cells had heavily methylated KIR3DL1 promoters (12),
KIR3DL1-associated histone acetylation was significant and only
moderately lower than in KIR3DL1⫹ NK cells.
Histone methylation at the KIR3DL1 promoter
FIGURE 5. KIR3DL1 histone methylation. Long-term cell lines (A) and
short-term peripheral blood NK cells (B) were analyzed for trimethylation
at the histone H3 residue 4 lysine (H3Me), as described in Fig. 4. Results
shown are an average of five (A) and two (B) experiments.
methylation levels correlated well with KIR3DL1 gene expression
in long-term and short-term cell lines, the differences between
KIR3DL1⫹ and KIR3DL1⫺ polyclonal NK cells were not
dramatic.
Allele-specific biasing of histone modifications
Numerous DNA-binding transcription factors recruit proteins that
remodel chromatin. We have shown that KIR3DL1 can be expressed in a monoallelic fashion, despite very high allele sequence
similarity in the KIR3DL1 promoter. Under these circumstances,
one KIR3DL1 allele remained heavily methylated and not expressed even when trans-acting factors were present to transcribe
a nearly identical second allele (12). We determined whether histone modifications preferentially associated with the expressed allele. We performed ChIP using Abs to acetylated H3 and to methylated H3K4, amplified the immunoprecipitated KIR3DL1 DNA,
and determined allele identity by restriction endonuclease digestion of the PCR products (Fig. 6). Because of low signal, two PCR
rounds were required to amplify ChIP products from Hut78 cells.
A BstUI site is present in the *002 allele, but not in the *001 or
3DS1 alleles. Nonselected DNA gave rise to PCR products with
and without a BstUI recognition site (Fig. 6, “Total DNA ⫹”). This
result is consistent with the heterozygous KIR3DL1 status in
NK92.26.5 and Hut78 cells and shows that the PCR products were
susceptible to BstUI digestion. As an additional control, MspI
completely digested all PCR products (data not shown). DNA that
was coprecipitated with Abs to either acetylated histone H3 or to
methylated H3K4 produced only faint BstUI digestion bands. This
finding indicates that the permissive acetylated histone H3 and
methylated H3K4 modifications preferentially associated with the
active *001 and 3DS1 alleles in NK92.26.5 and Hut78 cells, respectively. Thus, even in the presence of trans-acting factors that
were adequate to drive high-level KIR3DL1 transcription in
NK92.26.5 cells, permissive histone modifications were preferentially associated with the expressed *001 allele, compared with the
nonexpressed *002 allele. It also is worth noting that even though
the level of KIR3DL1-associated histone acetylation was quite
modest in Hut78 cells (Fig. 4A), the acetylated H3 histones preferentially associated with the expressed 3DS1 allele, compared
with the nonexpressed *002 allele.
FIGURE 6. Allele-specific histone modifications correlate with allelespecific KIR3DL1 expression. ChIP was performed on Hut78 and
NK92.26.5 cells using Abs specific for acetylated histone H3 (H3Ac) and
histone H3 trimethylated at lysine 4 (H3Me), as indicated. Hut78 ChIP
products were amplified in two sequential rounds of PCR. KIR3DL1 PCR
products were digested with BstUI and electrophoresed on agarose gels
with m.w. standards. Although BstUI is sensitive to DNA methylation, the
PCR products do not contain methylated cytosines, and promoter methylation status does not affect this assay. Heterozygous Hut78 and NK92.26.5
cells express the 3DS1 and *001 KIR3DL1 alleles, respectively. A BstUI
site is present in the *002 allele, but not in the 3DS1 and *001 alleles. As
a control, KIR3DL1 PCR products amplified from total cellular DNA were
BstUI digested (⫹) or not digested (⫺). Results shown are typical of four
experiments.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
We wished to examine trimethylation of histone H3 lysine 4
(H3K4), which correlates precisely with active transcription in
other model genes (25, 26). Using an Ab specific for trimethylated
histone H3K4, we found background levels of H3K4 methylation
in association with the KIR3DL1 promoter and 5⬘ region in
KIR3DL1⫺ non-NK cells (Fig. 5A). In parallel with the hierarchy
of KIR3DL1 RNA expression, KIR3DL1-associated H3K4 methylation levels were highest in NK92.26.5 cells and decreased in
order Hut78 ⬎ NK92.26 ⬎ YT ⫽ background (Fig. 5A). The
H3K4 methylation level averaged ⬎7-fold higher in KIR3DL1⫹
NK92.26.5 cells than in KIR3DL1⫺ NK92.26 cells (Fig. 5A) in
five experiments. In contrast to the finding of minimal histone H3
and H4 acetylation, Hut78 cells had a substantial level of
KIR3DL1-associated H3K4 methylation (Fig. 5A) that averaged
close to half of that observed in NK92.26.5 cells.
In both KIR3DL1⫹ and KIR3DL1⫺ polyclonal NK cells, the
KIR3DL1-associated histone H3K4 methylation level was significantly elevated above the background level characteristic of YT
cells. Histone H3 methylation at lysine 4 was only 2.6-fold higher
in KIR3DL1⫹ polyclonal NK cells than in KIR3DL1⫺ polyclonal
NK cells (Fig. 5B). Although KIR3DL1-associated histone H3K4
PRIMARY CONTROL OF KIR GENES BY DNA METHYLATION
The Journal of Immunology
KIR3DL1 promoter accessibility correlates with transcription
duced cell surface KIR3DL1 expression on 28 and 97% of YT and
NK92.26 cells, respectively (Fig. 8A). In the same cells, drug treatment increased KIR3DL1 RNA by 51- and 167-fold, respectively
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Covalent modifications on histone N-terminal ends modulate chromatin structure and dictate access to trans-acting factors. Because
the differences in KIR3DL1-associated histone changes were slight
to moderate, we tested chromatin accessibility. The MspI accessibility assay was validated in previous studies (27). Inaccessibility
in this assay could be due to chromatin compaction or blocking by
bound repressive proteins. We measured the ability of MspI restriction endonuclease to digest chromatin at a site 26 bp downstream of the transcriptional start site (Fig. 7). Isolated nuclei were
incubated with MspI; DNA was extracted and ligated to MspI
adapters. The ligation products were PCR amplified using an
adapter-specific primer and a KIR3DL1-specific primer. The
KIR3DL1 transcription start site was readily accessible in
NK92.26.5 and Hut78 cells (Fig. 7A). In NK92.26 cells, the
KIR3DL1 transcription start site was weakly accessible in some
experiments and not accessible in others (Fig. 7). Accessibility
could not be detected in cells that did not express KIR3DL1
mRNA (Fig. 7A).
We also performed chromatin accessibility assays on the nuclei
of peripheral blood NK cells that were analyzed immediately after
sorting. The KIR3DL1 promoter was accessible in polyclonal
KIR3DL1⫹ NK cells, but not in polyclonal KIR3DL1⫺ NK cells
(Fig. 7B). Thus, KIR3DL1 chromatin accessibility correlated with
transcription in cell lines cultured in vitro and in fresh peripheral
blood NK cells in vivo.
5971
DNA methyltransferase inhibition induces KIR3DL1
transcription and chromatin changes
Because DNA methyltransferase inhibition caused increased KIR
expression (12, 19), we wished to study how DNA methyltransferase inhibition would affect histone modification. We examined
three cell lines that showed a range of responsiveness to Aza, a
powerful inhibitor of DNA methyltransferase. Aza treatment in-
FIGURE 7. KIR3DL1 promoter accessibility. A, Nuclei isolated from
long-term cell lines were incubated with 0, 20, or 40 U of MspI restriction
endonuclease. DNA was extracted, ligated to MspI adapters, and PCR amplified with an adaptor-specific and a KIR3DL1-specific primer. Cell line
abbreviations are as in Fig. 1. B, Sorted CD56⫹KIR3DL1⫺ (3DL1⫺ NK)
and CD56⫹KIR3DL1⫹ (3DL1⫹ NK) peripheral blood NK cells were analyzed without in vitro culture and were compared with long-term cell
lines. Results shown are typical of three experiments.
FIGURE 8. Effect of DNA methyltransferase inhibition on KIR3DL1 gene
expression and histone modification. LCL, YT, and NK92.26 cells were
treated with DMSO solvent or with 1 ␮M Aza for 72 h. A and B are each
typical of four experiments. C, Shown as averages of either three (H4Ac) or
four (H3Ac and H3Me) experiments. A, Cell surface expression. Shown is
staining with control mouse IgG (open curves) and anti-KIR3DL1 mAb (filled
curves). B, KIR3DL1 RNA levels normalized to the amount of GAPDH RNA.
Levels are expressed as a fraction of the value in Aza-treated cells. No treatment (⫺) and treatment with DMSO solvent or with Aza are indicated for YT
cells and for NK92.26 cells. NK92.26 cells reached a higher absolute level
than did YT cells (⬎200-fold). C, KIR3DL1-associated histone H3 acetylation
(H3Ac), H4 acetylation (H4Ac), and H3K4 methylation (H3Me). Treatment
with DMSO solvent alone (⫺) or with Aza (⫹) is indicated for YT and for
NK92.26 (26) cells. Results are normalized with G6PD values and expressed
as a fraction of the Aza-treated NK92.26 cells.
5972
PRIMARY CONTROL OF KIR GENES BY DNA METHYLATION
Table I. Inhibition of DNA methyltransferases induces KIR expression
in developing NK cellsa
Aza (␮M)
% KIR⫹ NK Cells
(3 days)
% KIR⫹ NK Cells
(7 days)
0
0.5
1
2
4.5
15.1
19.6
21.0
7.4
25.3
30.0
33.8
a
CD34⫹CD38⫺ lineage-progenitor cells were sorted from umbilical cord blood
and cultured with murine fetal stroma cells and cytokines. After 54 days, cells (⬎95%
CD56⫹ NK cells) were cultured in medium containing Aza at the indicated concentrations for 3 and 7 days. Cells were then stained with a mixture of anti-KIR mAbs.
The data are representative of two independent experiments.
Table II. Inhibition of DNA methyltransferase induces expression of
multiple KIR proteins in developing NK cellsa
Protocol
Anti-KIR mAb
No Aza
Aza (1 ␮M)
p Value
1
KIR mixture
18.2 ⫾ 4.8
42.1 ⫾ 5.3
0.012
2
DX9
GL183
EB6
7.8 ⫾ 1.6
17.0 ⫾ 3.5
4.5 ⫾ 0.9
22.3 ⫾ 3.4
48.6 ⫾ 5.5
30.7 ⫾ 3.0
0.005
⬍0.001
⬍0.001
a
CD34⫹CD38⫺lineage⫺ progenitor cells were sorted from umbilical cord blood
and cultured with murine fetal stroma cells and cytokines. After 28 days, 1 ␮M Aza
was added to some wells. The cultures were maintained for an additional 4 wk, with
weekly replacement of half the medium volume without additional Aza. In two experiments (protocol 1), NK cells were stained with an anti-KIR mixture. In two
separate experiments (protocol 2), NK cells were stained with individual antiKIR mAb, as indicted. The data shown are the percentage of KIR⫹ NK cells
(mean ⫾ SEM) under each condition. Each data set represents an average of five
replicates from each of two independent experiments. Significance was determined by
Student’s t test.
age of KIR⫹ cells. Aza treatment up-regulated the expression of
several KIR, as detected by three anti-KIR mAb with nonoverlapping specificities, including DX9 anti-KIR3DL1 (Table II). These
data show that DNA demethylation initiates KIR transcription, and
suggest that DNA methylation controls KIR transcription during
NK cell development.
Discussion
Gene silencing involves histone posttranslational modifications,
DNA methylation, and association of regulatory proteins that suppress transcription through multiple rounds of DNA replication.
The study of gene silencing has led to two competing models of
epigenetic control. In several vertebrate developmental systems,
DNA methylation is a late event and becomes fully established
long after repressive histone modifications have been enforced. In
a recent detailed study of Dntt silencing in thymus cells, Su et al.
(4) demonstrated a sequential loss of acetylation at histone H3
lysine 9 (H3K9), loss of methylation at histone H3 lysine 4
(H3K4), gain of H3K9 methylation, and gradual gain of DNA
methylation. In transgene silencing, early loss of histone acetylation and H3K4 methylation was followed by a slow, gradual gain
of H3K9 methylation and DNA methylation (28). In X-chromosome inactivation, loss of H3K9 acetylation and H3K4 methylation and gain of H3K9 methylation were followed by loss of
histone H4 acetylation, and followed later by DNA methylation (5,
6). Although the order of histone modification can be variable, the
available studies suggest that H3 histone acetylation is lost early
and DNA methylation is applied late in gene silencing. These and
similar studies led to the concept that DNA methylation reinforces
gene silencing that is already established by other epigenetic
mechanisms (3).
In contrast to the models mentioned above, the study of gene
silencing in cancer cells suggests that DNA methylation may provide the primary control of transcription, with histone modifications playing a secondary role. This conclusion was supported by
observations that silenced tumor suppressor genes were reactivated
either by Aza treatment or by combined elimination of dnmt1 and
dnmt3b DNA methyltransferase genes, but not by TSA inhibition
of histone deacetylase activity (7, 29). Aza inhibition of DNA
methyltransferases caused sequential loss of DNA methylation, activation of gene transcription, gain of histone acetylation and
H3K4 methylation, and loss of H3K9 methylation (7). DNA methylation attracts DNMT1 and methyl-CpG-binding proteins, both of
which associate with histone deacetylases (30 –32), thus providing
a mechanism by which DNA methylation directs histone
modification.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
(Fig. 8B). Cell surface protein and RNA levels in drug-treated
NK92.26 cells were comparable to those of KIR3DL1⫹
NK92.26.5 cells (data not shown), indicating that high-level transcription was induced in the great majority of Aza-treated
NK92.26 cells. DNA methyltransferase inhibition did not induce
KIR cell surface expression or RNA in LCL B cells (Fig. 8A and
data not shown). In LCL B cells, Aza treatment did not alter
KIR3DL1-associated histone acetylation or methylation (data not
shown). Aza-treated NK92.26 NK cells increased KIR3DL1-associated histone acetylation by an average of 1.6-fold and methylated
H3K4 by an average of 2.5-fold (Fig. 8C). In YT NK cells, druginduced changes in histones were small and inconsistent, reflecting
cell surface KIR3DL1 induction on a minority of cells (Fig. 8C).
Showing the generality of these findings, essentially identical results (H.-W. Chan, personal observation) were obtained in all three
cell lines for KIR3DL2, a locus that is separated from KIR3DL1 by
one to four other KIR genes in various haplotypes (9, 11). Because
YT cells had little or no KIR3DL1-associated histone acetylation
or H3K4 trimethylation (Figs. 4 and 5), we tested whether the
histone deacetylase inhibitor, trichostatin A (TSA), could further
increase KIR3DL1 expression in YT and other cells. TSA treatment did not increase KIR expression on NK92.26, YT, or LCL
cells, at several doses, alone or with a range of Aza concentrations,
although TSA did up-regulate cell surface CD56 gene expression
on YT cells (data not shown). Collectively, our results indicate that
DNA methyltransferase inhibition dramatically increased KIR
transcription, despite little to no increase in histone acetylation or
methylation.
In many developmental systems, change in DNA methylation is
a late event that follows changes in histone modification. DNA
methylation controls KIR transcription in mature NK cells, but it is
not clear how locus- and allele-specific expression is established in
developing NK cells. To study whether DNA methylation influences KIR expression in immature NK cells, we used a culture
system that recapitulates several aspects of normal NK cell development, including variegated KIR expression (15). Primitive
CD34⫹CD38⫺ hemopoietic progenitor cells that did not express
mature lineage markers were cultured in the presence of mouse
AFT024 stroma cells and cytokines. After 54 days, ⬎95% of the
cells had matured into CD56⫹ NK cells. The cells were harvested
and cultured in medium containing various concentrations of Aza
and TSA. As shown in Table I, Aza caused a dose-related increase
in the percentage of KIR⫹ NK cells after 3 days of culture, which
continued to increase over time. Several doses of TSA, up to toxic
levels, did not further increase KIR expression at any dose of Aza
tested (data not shown). To extend these findings, we added Aza
once at 28 days of culture, soon after CD56⫹ NK cells had begun
to appear (Table II). KIR cell surface expression was analyzed 28
days later. Aza caused a highly significant increase in the percent-
The Journal of Immunology
closed chromatin configurations are presumed to be quite local,
because transcribed and quiescent KIR genes are often adjacent
(10, 11).
As proposed for tumor suppressor genes, we hypothesize that
DNA methylation is the key regulator controlling KIR transcription, both in mature NK cells and in development. In support of
this hypothesis, histone acetylation and methylation differed only
moderately between KIR3DL1⫹ and KIR3DL1⫺ peripheral blood
NK cells. Hut78 T cells expressed KIR despite levels of histone H3
and H4 acetylation that were only about twice that of KIR3DL1⫺
FaDu epithelial cells. Furthermore, KIR gene expression in NK
cell lines was increased by Aza inhibition of DNA methyltransferases, but not by TSA inhibition of histone deacetylases. Similar
observations were made in a culture system that mimicked several
aspects of normal NK cell development, including variegated KIR
expression. Short-term Aza treatment of NK cell lines caused only
small to moderate increases in histone acetylation and H3K4 methylation. These observations support the hypothesis that KIR transcription is primarily controlled by DNA methylation, with histone
modifications playing a secondary role.
It is becoming clear that gene silencing and gene activation can
proceed via multiple pathways. The numerous mechanisms that
enforce silencing and activation allow individual control of transcription that fits the unique needs of the cell. For example, most
CpG islands are nonmethylated regardless of transcription (3).
CpG island hypomethylation keeps genes in a state of readiness,
allowing rapid activation. Such a control strategy would not work
for the KIR locus in which only some genes and alleles are expressed, despite very high sequence similarity (11, 12). KIR gene
expression may play a role in determining the outcome of serious
infection and in autoimmune diseases (9, 40, 41). The heterogeneity of gene expression control strategies presents an opportunity
to manipulate normal and aberrant KIR gene expression without
globally dysregulating transcription control of other genes.
Acknowledgments
We thank Drs. Andy Russo, Julie Wells, and Peggy Farnham for their
generous advice, and Z. Brahmi, W. Leonard, and J. Phillips for gifts of
cells and mAb. We are grateful to Drs. Mark F. Stinski, Bret Spear, and
Steve Anderson for their critical reading of the manuscript.
Disclosures
The authors have no financial conflict of interest.
References
1. Fry, C. J., and C. L. Peterson. 2002. Transcription: unlocking the gates to gene
expression. Science 295: 1847–1848.
2. Smale, S. T. 2003. The establishment and maintenance of lymphocyte identity
through gene silencing. Nat. Immunol. 4: 607– 615.
3. Bird, A. 2002. DNA methylation patterns and epigenetic memory. Genes Dev.
16: 6 –21.
4. Su, R. C., K. E. Brown, S. Saaber, A. G. Fisher, M. Merkenschlager, and
S. T. Smale. 2004. Dynamic assembly of silent chromatin during thymocyte
maturation. Nat. Genet. 36: 502–506.
5. Heard, E., C. Rougeulle, D. Arnaud, P. Avner, C. D. Allis, and D. L. Spector.
2001. Methylation of histone H3 at Lys-9 is an early mark on the X chromosome
during X inactivation. Cell 107: 727–738.
6. Lock, L. F., N. Takagi, and G. R. Martin. 1987. Methylation of the Hprt gene on
the inactive X occurs after chromosome inactivation. Cell 48: 39 – 46.
7. Fahrner, J. A., S. Eguchi, J. G. Herman, and S. B. Baylin. 2002. Dependence of
histone modifications and gene expression on DNA hypermethylation in cancer.
Cancer Res. 62: 7213–7218.
8. Stirzaker, C., J. Z. Song, B. Davidson, and S. J. Clark. 2004. Transcriptional gene
silencing promotes DNA hypermethylation through a sequential change in chromatin modifications in cancer cells. Cancer Res. 64: 3871–3877.
9. Carrington, M., and P. Norman. 2003. The KIR Gene Cluster. National Library of
Medicine (U.S.), National Center for Biotechnology Information, Bethesda.
10. Valiante, N. M., M. Uhrberg, H. G. Shilling, K. Lienert-Weidenbach, K. L. Arnett,
A. D’Andrea, J. H. Phillips, L. L. Lanier, and P. Parham. 1997. Functionally and
structurally distinct NK cell receptor repertoires in the peripheral blood of two
human donors. Immunity 7: 739 –751.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
In all of the model systems discussed above, heavy DNA methylation was not observed to coexist with significant amounts of
histone acetylation. However, this is what we observed in nonexpressed KIR genes. Our previous study showed that KIR promoter
and 5⬘ regions were methylated in a nearly all-or-none pattern that
strictly correlated with allele-specific KIR expression, both in vitro
and in vivo (12). In this study, we show that histone H3 and H4
proteins were substantially acetylated in both KIR⫹ and KIR⫺
peripheral blood NK cells. The level of KIR-associated histone
acetylation was only 1.7- to 4.1-fold higher in KIR⫹ NK cells than
in KIR⫺ NK cells. We observed similar small differences in histone H3K4 methylation levels. Thus, heavily methylated nonexpressed KIR genes were associated with histone proteins with permissive posttranslational modifications, showing that heavy DNA
methylation did not preclude a substantial level of histone
acetylation.
How is KIR methylation applied (or removed) selectively? Most
CpG islands become demethylated in early embryogenesis (3).
However, this is not likely for the KIR locus. The progeny of a
single hemopoietic progenitor express heterogeneous KIR genes
(15), which effectively rules out inheritance of gene-specific or
allele-specific epigenetic marks that are set in an early stage of
development. KIR gene- and allele-specific expression is activated
over an extended period during NK development, but stabilizes
upon reaching a mature NK cell stage and is maintained through
subsequent rounds of cell division (10, 12, 15). Our preliminary
studies indicate that KIR genes are heavily methylated in hemopoietic progenitor cells (H.-W. Chan, personal observations). The
relative paucity of cis-acting promoter elements reported to be essential for KIR transcription further reinforces the importance of
epigenetic control (33–35). Given the extremely high KIR allele
sequence similarity (12), the trans-acting factors that direct highlevel allele-specific KIR transcription in mature NK cells are not
sufficient to demethylate silent KIR genes and initiate new KIR
transcription. DNA methylation maintains stable expression patterns of KIR in mature NK cells.
We propose that sequence-specific factors recruit DNA demethylase enzymes to KIR genes during NK development. We propose
that one or more components of the resulting demethylation complex is expressed in limited amounts in immature NK cells and
disappears in mature NK cells. Because the demethylation complex is proposed to be present in limited amounts, KIR genes and
alleles are demethylated in a largely stochastic fashion. Some KIR
promoters may be inherently better able to recruit elements of the
complex, resulting in unequal KIR gene activation. Consistent with
this possibility, Shilling et al. (36) mapped quantitative differences
in KIR gene expression to the KIR locus. Nonetheless, the selection
of KIR genes for activation is largely a stochastic process. The
probability of recruitment of the proposed sequence-specific factors or demethylation complex to KIR proximal promoters may be
made more or less likely by antegrade and retrograde transcription
from bidirectional promoters, such as have been identified upstream of Ly-49 genes (37).
The biochemical identification of DNA demethylase complexes
is controversial, but it is clear that genes can be rapidly demethylated in the absence of DNA replication (38). We suggest that loss
of DNA methylation leads to loss of histone deacetylase complexes, gain of acetylated histones, and opening of the chromatin
to transcription factors. The DNA-binding proteins that direct KIR
transcription may prevent remethylation in a mechanism that involves blocking access by DNA methyltransferases, as demonstrated for other genes (39). In contrast to transcribed KIR genes,
methylated KIR genes and alleles remain in closed chromatin and
are quiescent, despite measurable histone acetylation. Open and
5973
5974
26. Schneider, R., A. J. Bannister, F. A. Myers, A. W. Thorne, C. Crane Robinson,
and T. Kouzarides. 2004. Histone H3 lysine 4 methylation patterns in higher
eukaryotic genes. Nat. Cell Biol. 6: 73–77.
27. Futscher, B. W., M. M. Oshiro, R. J. Wozniak, N. Holtan, C. L. Hanigan,
H. Duan, and F. E. Domann. 2002. Role for DNA methylation in the control of
cell type specific maspin expression. Nat. Genet. 31: 175–179.
28. Mutskov, V., and G. Felsenfeld. 2004. Silencing of transgene transcription precedes methylation of promoter DNA and histone H3 lysine 9. EMBO J. 23:
138 –149.
29. Bachman, K. E., B. H. Park, I. Rhee, H. Rajagopalan, J. G. Herman, S. B. Baylin,
K. W. Kinzler, and B. Vogelstein. 2003. Histone modifications and silencing
prior to DNA methylation of a tumor suppressor gene. Cancer Cell 3: 89 –95.
30. Rountree, M. R., K. E. Bachman, and S. B. Baylin. 2000. DNMT1 binds HDAC2
and a new co-repressor, DMAP1, to form a complex at replication foci. Nat.
Genet. 25: 269 –277.
31. Fuks, F., W. A. Burgers, A. Brehm, L. Hughes-Davies, and T. Kouzarides. 2000.
DNA methyltransferase Dnmt1 associates with histone deacetylase activity. Nat.
Genet. 24: 88 –91.
32. Nan, X., H.-H. Ng, C. A. Johnson, C. D. Laherty, B. M. Turner, R. N. Eisenman,
and A. Bird. 1998. Transcriptional repression by the methyl-CpG-binding protein
MeCP2 involves a histone deacetylase complex. Nature 393: 386 –389.
33. Trompeter, H.-I., N. Gómez-Lozano, S. Santourlidis, B. Eisermann, P. Wernet,
C. Vilches, and M. Uhrberg. 2005. Three structurally and functionally divergent
kinds of promoters regulate expression of clonally distributed killer cell Ig-like
receptors (KIR), of KIR2DL4, and of KIR3DL3. J. Immunol. 174: 4135– 4143.
34. Van Bergen, J., C. A. Stewart, P. J. van den Elsen, and J. Trowsdale. 2005.
Structural and functional differences between the promoters of independently
expressed killer cell Ig-like receptors. Eur. J. Immunol. 35: 2191–2199.
35. Xu, J., A. N. Vallejo, Y. Jiang, C. M. Weyand, and J. J. Goronzy. 2005. Distinct
transcriptional control mechanisms of killer immunoglobulin-like receptors in
natural killer (NK) and in T cells. J. Biol. Chem. 280: 24277–24285.
36. Shilling, H. G., N. Young, L. A. Guethlein, N. W. Cheng, C. M. Gardiner,
D. Tyan, and P. Parham. 2002. Genetic control of human NK cell repertoire.
J. Immunol. 169: 239 –247.
37. Saleh, A., G. E. Davies, V. Pascal, P. W. Wright, D. L. Hodge, E. H. Cho,
S. J. Lockett, M. Abshari, and S. K. Anderson. 2004. Identification of probabilistic transcriptional switches in the Ly49 gene cluster: a eukaryotic mechanism
for selective gene activation. Immunity 21: 55– 66.
38. Bruniquel, D., and R. H. Schwartz. 2003. Selective, stable demethylation of the
interleukin-2 gene enhances transcription by an active process. Nat. Immunol. 4:
235–240.
39. Hsieh, C. L. 1999. Evidence that protein binding specifies sites of DNA demethylation. Mol. Cell. Biol. 19: 46 –56.
40. Rajagopalan, S., and E. O. Long. 2005. Understanding how combinations of HLA
and KIR genes influence disease. J. Exp. Med. 201: 1025–1029.
41. Snyder, M. R., C. M. Weyand, and J. J. Goronzy. 2004. The double life of NK
receptors: stimulation or co-stimulation? Trends Immunol. 25: 25–32.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
11. Wilson, M. J., M. Torkar, A. Haude, S. Milne, T. Jones, D. Sheer, S. Beck, and
J. Trowsdale. 2000. Plasticity in the organization and sequences of human KIR/
ILT gene families. Proc. Natl. Acad. Sci. USA 97: 4778 – 4783.
12. Chan, H. W., Z. B. Kurago, C. A. Stewart, M. J. Wilson, M. P. Martin,
B. E. Mace, M. Carrington, J. Trowsdale, and C. T. Lutz. 2003. DNA methylation
maintains allele-specific KIR gene expression in human natural killer cells.
J. Exp. Med. 197: 245–255.
13. Lutz, C. T., and Z. B. Kurago. 1999. Human leukocyte antigen class I expression
on squamous cell carcinoma cells regulates natural killer cell activity. Cancer
Res. 59: 5793–5799.
14. Shi, Y., K. D. Smith, M. G. Kurilla, and C. T. Lutz. 1997. Cytotoxic CD8⫹ T
cells recognize EBV antigen but poorly kill autologous EBV-infected B lymphoblasts: immunodominance is elicited by a peptide epitope that is presented at low
levels in vitro. J. Immunol. 159: 1844 –1852.
15. Miller, J. S., and V. McCullar. 2001. Human natural killer cells with polyclonal
lectin and immunoglobulinlike receptors develop from single hematopoietic stem
cells with preferential expression of NKG2A and KIR2DL2/L3/S2. Blood 98:
705–713.
16. Lanigan, T. M., and A. F. Russo. 1997. Binding of upstream stimulatory factor
and a cell-specific activator to the calcitonin/calcitonin gene-related peptide enhancer. J. Biol. Chem. 272: 18316 –18324.
17. Weinmann, A. S., S. M. Bartley, T. Zhang, M. Q. Zhang, and P. J. Farnham.
2001. Use of chromatin immunoprecipitation to clone novel E2F target promoters. Mol. Cell. Biol. 21: 6820 – 6832.
18. Stewart, C. A., J. Van Bergen, and J. Trowsdale. 2003. Different and divergent
regulation of the KIR2DL4 and KIR3DL1 promoters. J. Immunol. 170:
6073– 6081.
19. Santourlidis, S., H. I. Trompeter, S. Weinhold, B. Eisermann, K. L. Meyer,
P. Wernet, and M. Uhrberg. 2002. Crucial role of DNA methylation in determination of clonally distributed killer cell Ig-like receptor expression patterns in NK
cells. J. Immunol. 169: 4253– 4261.
20. Lanier, L. L., B. C. Corliss, J. Wu, C. Leong, and J. H. Phillips. 1998. Immunoreceptor DAP-12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature 391: 703–707.
21. Smith, C. L., and G. L. Hager. 1997. Transcriptional regulation of mammalian
genes in vivo: a tale of two templates. J. Biol. Chem. 272: 27493–27496.
22. Robertson, K. D., and R. F. Ambinder. 1997. Mapping promoter regions that are
hypersensitive to methylation-mediated inhibition of transcription: application of
the methylation cassette assay to the Epstein-Barr virus major latency promoter.
J. Virol. 71: 6445– 6454.
23. Takai, D., and P. A. Jones. 2002. Comprehensive analysis of CpG islands in
human chromosomes 21 and 22. Proc. Natl. Acad. Sci. USA 99: 3740 –3745.
24. Flatau, E., E. Bogenmann, and P. A. Jones. 1983. Variable 5-methylcytosine
levels in human tumor cell lines and fresh pediatric tumor explants. Cancer Res.
43: 4901– 4905.
25. Santos Rosa, H., R. Schneider, A. J. Bannister, J. Sherriff, B. E. Bernstein,
N. C. Emre, S. L. Schreiber, J. Mellor, and T. Kouzarides. 2002. Active genes are
tri-methylated at K4 of histone H3. Nature 419: 407– 411.
PRIMARY CONTROL OF KIR GENES BY DNA METHYLATION