PCR and Replication Review Assignment
Name: ______________________________________
PART I: Replication
1. What does DNA stand for?
2. Suppose one strand of DNA looks like this: G-A-T-A-G-G-T-C-T-A-G-A-A-C-T. What would the strand
bound to it look like?
3. How do the bases in DNA pair up? A - _____ G - _____ T - ______ C - ______
4. A change to a gene or chromosome at the DNA sequence level is called a __________________________.
5. What do we call a set of three nitrogen bases in mRNA & tRNA? ________________ & ________________.
6. What organelles in a cell contains the DNA (there are 3)? _________________________________________
7. What organelle is the protein factory in a cell? ________________________
8. What is the name of the cellular process where DNA is copied? ____________________________
9. The copying of DNA in a cell is controlled by a series of chemicals called ______________________.
10. The two backbones of DNA run in opposite directions, we call this arrangement ________________________.
11. DNA will only replicate in what direction?
12. Based on the fact that the two backbones run in opposite directions, one backbone replicates as a solid piece, the
other replicates in sections. What are the names given to these two backbones?
13. What molecule carries the genetic code from the nucleus to the ribosome for protein synthesis? ____________
14. What type of RNA assembles proteins (Hint: it’s found in ribosomes)? __________________
15. What are the building blocks of proteins? ___________________ _________________
16. What is another term for a protein? ___________________________ (a chain, a natural polymer).
17. What is an exon?
18. What is an intron?
19. What is a Locus?
Part II: PCR
20. What does VNTR stand for?
21. Where do a person's VNTRs come from?
22. Explain why it is that two unrelated people are not likely to possess the same pair of VNTR sequences.
23. By using PCR and gel electrophoresis, scientists can decipher an individual’s genetic make up, or genotype, at a
particular VNTR locus. What is the function, or role of each of the following components in this process:
a. Primers
b. Taq polymerase
c.
PCR
d. Electrophoresis
e. DNTPs
24. The section of DNA to be replicated is pictured below. If the forward and reverse primers are 10 nucleotides long,
and the forward primer is complimentary to the 5’ to 3’ strand, and the reverse primer is complementary to the 3’
to 5’ strand, what would be the base sequence in each primer?
DNA:
5’ – ATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAG – 3’
3’ - TATCTATCTATCTATCT AT CTATCTATCTA TCTATCTA TCTATC – 5’
a. Forward: _________________________________________________
b. Reverse: _________________________________________________
25. If a person’s maternal band migrates further in the gel than his or her paternal band, it is because
_________________________________________________________.
26. What would a person’s banding pattern look like if both chromosome loci for the VNTR in question contained the
same number of repeats? Draw an example in the box:
27. What does STR stand for?
28. How are STRs used in PCR to identify and individual?
29. Based on the gel below, what are the genotypes of the
individuals that were tested for this particular allele? It is
possible to have partial repeats (for example, 6.5) I will
do #1 and #5 for you to show you how this gel is read.
#
Genotype
#
1
22.2 – 23.2
10
2
11
3
12
4
13
5
20 - 20
Genotype
14
6
15
7
16
8
17
9
30. From what parts of the human body is DNA
acquired?
31. Does every cell in the body contain DNA?
Explain.
32. List three practical applications of DNA fingerprinting.
33. What are some of the current problems with DNA fingerprinting?
34. The chemical structure of everyone's DNA is the same, so how can each person have their own distinct DNA
fingerprint?
35. What is the relationship between chromosomes and DNA?
36. What are the two main types of DNA testing and what do they stand for?
37. Compare the two main types of DNA testing in terms of reliability and
quantity of sample needed for performance.
38. Are there any VNTR trends in the general population? If so, explain.
39. Suppose the following are DNA samples of a couple who plan on having
children. Give a possible DNA coding for two of their children.
40. On the following page are six different DNA tests. Suppose these
DNA tests are of a couple who are married and there possible
children.
a. Which of the kids belong to both parents?
b. Which of the kids belong to only the mother?
c. Which of the kids belong to only the father?
d. Which of the kids belong to neither parent?
41. The following are DNA test performed in order to solve a crime.
Sample A is a DNA test is from a group of hairs found at a crime scene. The other samples are DNA test
from suspects. What can you conclude?