Ubiquitin-Editing Enzyme A20 Promotes
Tolerance to Lipopolysaccharide in
Enterocytes
This information is current as
of June 15, 2017.
Jin Wang, Yannan Ouyang, Yigit Guner, Henri R. Ford and
Anatoly V. Grishin
J Immunol 2009; 183:1384-1392; Prepublished online 1 July
2009;
doi: 10.4049/jimmunol.0803987
http://www.jimmunol.org/content/183/2/1384
References
Subscription
Permissions
Email Alerts
http://www.jimmunol.org/content/suppl/2009/07/02/jimmunol.080398
7.DC1
This article cites 53 articles, 22 of which you can access for free at:
http://www.jimmunol.org/content/183/2/1384.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2009 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Supplementary
Material
The Journal of Immunology
Ubiquitin-Editing Enzyme A20 Promotes Tolerance to
Lipopolysaccharide in Enterocytes1
Jin Wang,* Yannan Ouyang,† Yigit Guner,*‡ Henri R. Ford,*‡ and Anatoly V. Grishin2*‡
I
ntestinal epithelial cells express TLR and produce a variety
of inflammatory factors in response to stimulation with TLR
ligands, which is important for the gut homeostasis (1– 8).
Despite its potential sensitivity and exposure to high concentrations of bacteria, the intestinal epithelium is refractory to induction
of inflammation by commensals under normal conditions. Being
sensitive at birth, the epithelium becomes unresponsive, or tolerant, shortly upon initial stimulation with colonizing bacteria (9).
As bacterial colonization persists, so does the tolerant state, which
likely accounts for the lack of dramatic inflammatory reaction to
commensals.
Several mechanisms that inhibit TLR signaling in enterocytes
have been identified. Decreased expression of TLR4 (10, 11), or its
coreceptor MD-2 (12, 13), has been proposed as a mechanism of
hyporesponsiveness to LPS in the intestine. MD-2 is degraded by
trypsin, which may suppress responses to LPS in the small intestine (14). Tolerance to TLR2 and TLR4 ligands in colonocytes has
been reported to result from induction of TLR-interacting protein
Tollip (15). However, LPS does not induce Tollip in m-ICcl2 enterocytes of the small intestinal origin (9) and lack of intestinal
inflammation in Tollip⫺/⫺ mice (16) argues against a pivotal role
of Tollip in the intestinal tolerance to bacteria. Tolerance to LPS in
*Division of Pediatric Surgery and †Division of Pathology, Childrens Hospital Los
Angeles, and ‡Department of Surgery, University of Southern California, Los Angeles, CA 90027
Received for publication December 1, 2008. Accepted for publication May 15, 2009.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by National Institutes of Health Grants 5R01AI014032
and 5R01AI049473 (to H.R.F.).
m-ICcl2 enterocytes is associated with posttranslational inhibition
of the IL-1R-associated kinase 1 (IRAK-1),3 a key mediator of
TLR signaling (9). Definitive mechanisms of tolerance to TLR
signaling in the gut remain elusive (17).
A20 is a zinc finger protein whose gene is an early target of the
proinflammatory transcription factor NF-␬B (18, 19). A20 inhibits
activation of NF-␬B via inflammatory cytokine receptors (19 –27),
TLR (28, 29), and nucleotide-binding oligomerization domain-containing receptor NOD2 (30) by its two ubiquitin-editing activities,
N-terminal deubiquitinase that removes K63-linked polyubiquitin
chains and C-terminal ubiquitin ligase that facilitates target protein
degradation via attachment of K48-linked polyubiquitin chains (31,
32). These two activities cooperatively down-regulate the key K63
polyubiquitination-dependent mediators of inflammatory signaling,
TNF-␣ receptor-associated factor 6 (TRAF6) (33, 34) and receptorinteracting protein kinase (35). Since A20⫺/⫺ mice develop severe
intestinal inflammation early in life (36, 37), it was suggested that A20
is important for the inhibition of innate immune responses in the gut
(17). A role of A20 in the regulation of intestinal inflammation is
further suggested by its inhibitory effect on TLR2-mediated production of IL-8 in enterocytes (38).
To gain insight into the regulation of innate immune responses in
the small intestine, we examined tolerance to LPS in several enterocyte cell lines and in the native small intestinal epithelium. In this
study, we report that LPS-induced expression of A20 is necessary and
sufficient for the development of hyporesponsiveness to repeated
stimulation with LPS, that A20 prominently localizes to the luminal
interface of villus enterocytes in adult rodents, and that A20 levels in
the intestinal epithelium positively correlate with the bacterial load.
These findings point to the key role of A20 in the development of
intestinal tolerance to the commensal bacteria.
2
Address correspondence and reprint requests to Dr. Anatoly V. Grishin, Division of
Pediatric Surgery, Childrens Hospital Los Angeles MS35, 4661 Sunset Boulevard,
Los Angeles, CA 90027. E-mail address: [email protected]
3
Abbreviations used in this paper: Tollip, TLR-interacting protein; IF, immunofluorescence; IRAK-1, IL-1R-associated kinase 1; siRNA, small interfering RNA;
TRAF6, TNF-␣ receptor-associated factor 6.
Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.0803987
Materials and Methods
Animals, cell lines, reagents
All animal experiments have been approved by the Childrens Hospital of
Los Angeles Animal Care and Use Committee. Newborn rats were
obtained from timed pregnant Sprague Dawley females (Harlan). C57BL/6
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Although enterocytes are capable of innate immune responses, the intestinal epithelium is normally tolerant to commensal bacteria. To elucidate the mechanisms of tolerance, we examined the effect of preexposure to LPS on activation of p38, c-Jun, and
NF-␬B in enterocytes by several inflammatory and stress stimuli. Shortly after the initial LPS challenge, enterocytes become
tolerant to restimulation with LPS or CpG DNA, but not with IL-17 or UV. The state of tolerance, which lasts 20 –26 h, temporally
coincides with LPS-induced expression of the anti-inflammatory ubiquitin-editing enzyme A20. Small interfering RNA silencing
of A20 prevents tolerance, whereas ectopic expression of A20 blocks responses to LPS and CpG DNA, but not to IL-17 or UV. A20
levels in the epithelium of the small intestine are low at birth and following gut decontamination with antibiotics, but high under
conditions of bacterial colonization. In the small intestine of adult rodents, A20 prominently localizes to the luminal interface of
villus enterocytes. Lower parts of the crypts display relatively low levels of A20, but relatively high levels of phospho-p38. Gut
decontamination with antibiotics reduces the levels of both A20 and phospho-p38. Along with the fact that A20-deficient mice
develop severe intestinal inflammation, our results indicate that induction of A20 plays a key role in the tolerance of the intestinal
epithelium to TLR ligands and bacteria. The Journal of Immunology, 2009, 183: 1384 –1392.
The Journal of Immunology
RT-PCR, IF, Northern blots
Total RNA was extracted and purified using TRIzol reagent (Invitrogen)
and converted into first-strand cDNA using oligo(dT) and Moloney reverse
transcriptase. Equivalent amounts of the first-strand reaction were used as
template in real-time PCR with pairs of primers listed in supplemental
Table S1.4 Primers in each pair belong to different exons to distinguish
between cDNA and chromosomal amplicons. Real-time PCR (95oC for 10
min followed by 40 cycles of 95oC for 10 s, 55oC for 1 s, and 72oC for 40 s)
was performed using the FastStart DNA MasterPLUS SYBR Green I kit on
the Light Cycler 480 (Roche), and the critical cycle was determined for
each reaction. The amount of target sequence was deduced from a calibration curve and normalized to the amount of the housekeeping transcript
(Rps11) in the same sample. Samples containing ⬎5% genomic amplicons,
as determined by melting curves, were not scored. IF of cultured cells or
paraffin sections were performed as recommended by the Ab manufacturers. Before fixation, intestinal segments were flushed with PBS plus 7 mM
DTT to remove surface mucus. Images were taken on a BX51 microscope
equipped with a color camera using Picture Frame software (Olympus). For
comparisons, samples were processed on the same slide and photographed
at the same camera settings; identical adjustments were applied to the images. Care was exercised to minimize photobleaching. Poly(A)⫹ RNA for
Northern blots was isolated using a Dynabeads kit (Dynal). RNA samples
(2 ␮g/lane) were resolved on 1% agarose-glyoxal gel. Northern blot analysis was performed using a NorthernMax-Gly kit (Ambion) and 32P-labeled cDNA probes. RNA bands were quantified by densitometry of underexposed autoradiograms using a GelDoc scanner and Quantity One
software (Bio-Rad).
A20 plasmid and small interfering RNA (siRNA)
Rat A20 open reading frame was amplified using primers CACCATGGC
TGAACAACTTCTTCCT and GGCGTACATCTGCTTGAACTG, Deep
Vent DNA polymerase (New England Biolabs), Moloney reverse transcriptase, and RNA from LPS-treated IEC-6 cells. Resulting RT-PCR product
was inserted into pcDNA3.1-V5His (Invitrogen) to yield pcDNA3-A20.
The insert and junctions were sequenced to verify the absence of mutations.
To generate A20 siRNA, the partial A20 cDNA fragment was amplified
with the primers GGGTAATACGACTCACTATAGAAACCAACGGTGA
TGGAAACTGCC and GGGTAATACGACTCACTATAGAGATGCCG
TTAAACGTCCGAGTG; the amplification product was used as template
4
The online version of this article contains supplemental material.
to direct T7 RNA polymerase-dependent synthesis of dsRNA, which was
then cut into 21-bp siRNA duplexes using the ShortCut RNase (New England Biolabs). Control siRNA was prepared similarly using the LEU2
template generated from yeast DNA with primers GGGTAATACGACT
CACTATAGCACGTTGGTCAAGAAATCACAGCC and GGGTAAT
ACGACTCACTATAGAACTTCTTCGGCGACAGCATCACC.
Transfections
IEC-6 or IEC-18 cells grown overnight to 90% confluence were gently
trypsinized, washed with RPMI 1640 plus 10% FCS, collected by centrifugation at 100 ⫻ g for 5 min, and resuspended at 3 ⫻ 107 cells/ml in the
Nucleofector Solution V (Amaxa). One hundred-microliter suspension aliquots were mixed with 10 ␮g of plasmid DNA and electroporated using the
T-030 protocol of Amaxa Nucleofector. Following a 10-min recovery in
RPMI 1640 plus FCS at 37oC, cells were plated in DMEM plus FCS.
Stable transfectants were selected with 1 mg/ml G418. HEK293 cells were
transfected using Lipofectamine 2000 (Invitrogen), as directed by the manufacturer. Near-confluent IEC-6 monolayers, mucosal scrapings, or longitudinally cut ileal segments from neonatal rats were transfected with
siRNAs complexed with Lipofectamine 2000.
A20 protein
HEK293 cells transiently transfected with pcDNA3-A20 were collected in
the hypotonic buffer (70 mM NaPO4 (pH 7.0) and 1 mM PMSF) 40 h after
transfection and disrupted in a Dounce homogenizer on ice (at least 95%
cells disrupted by trypan blue staining). Following a 10-min centrifugation
at 10,000 ⫻ g, the cleared lysate was adjusted to 10% glycerol/0.3 M
NaCl and His6-tagged A20 protein was purified by adsorption on the
Talon metal affinity resin (BD Clontech) as recommended by the manufacturer. Purity and concentration of the resulting preparation were
evaluated on Coomassie blue-stained polyacrylamide gel by comparison to
a series of standard BSA loads.
Intestinal mucus
Small intestine of an adult mouse was flushed with PBS and opened by a
longitudinal cut. The mucosal layer was scraped off and homogenized in a
20⫻ volume of PBS plus 1 mM PMSF. Following a 15-min centrifugation
at 10,000 ⫻ g, MgCl2 was added to the supernatant to 10 mM and nucleic
acids were digested with 20 ␮g/ml each of RNase A and DNase I for 5 h
at 37oC. The soluble mucus was purified from noncovalently attached proteins by three rounds of equilibrium CsCl gradient centrifugation (40).
Fractions containing mucus were identified by spotting onto nitrocellulose
and probing with the Muc2 Ab. The final preparation was dialyzed against
PBS and the protein concentration was determined using the Bio-Rad protein assay.
Cell content fractionation
Cells were suspended in the hypotonic buffer and disrupted on ice in a
Dounce homogenizer. The homogenate was centrifuged for 5 min at
100,000 ⫻ g at 15oC in the A-95 rotor of the Airfuge ultracentrifuge (Beckman Coulter). Equivalent amounts of supernatant (soluble fraction) and
pellet (particulate fraction) were analyzed by Western blotting.
Statistical analysis
Quantitative data are expressed as mean ⫾ SD. Pairs of data were compared using the Mann-Whitney U test, with differences considered significant at p ⬎ 0.95.
Results
Enterocytes develop tolerance to LPS following brief exposure
to this ligand
To gain insight into intestinal tolerance to bacteria, we examined
the activating phosphorylation of p38 MAPK in response to repeated stimulation with LPS in several enterocyte cell lines. LPS
activates p38 MAPK in IEC-6, IEC-18, RIE-1, and SW480 cells at
concentrations as low as 2 ng/ml; maximum activation requires
0.5–1 ␮g/ml. The activation peaks at 5–15 min and returns to the
baseline in ⬃1 h (data not shown). Fifteen-minute preexposure to
LPS inhibits p38 activation in response to restimulation with this
TLR ligand, beginning 1 h after the initial challenge, in each of the
four cell lines. In proliferating cultures, cells remain unresponsive
to LPS for 20 –28 h (Fig. 1A). However, in stationary cultures, the
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
mice were bred in-house; adult mice were used at 12–16 wk of age. Selective gut decontamination in mice raised under specific pathogen-free
conditions was achieved by supplementing drinking water with polymyxin
B and neomycin at 0.4 mg/ml each and rifaximin at 0.2 mg/ml for 7 days.
Full-term newborn rodents were obtained by cesarean section, avoiding
introduction of bacteria or pyrogens, and maintained at 32oC and 80%
relative humidity. Segments of neonatal terminal ileum were gently flushed
with DMEM ⫹ 10% FCS and incubated in the same medium at 37oC and
10% CO2. Mucosal scrapings were obtained by gentle scraping of the mucosal side of longitudinally opened small intestine with a blunt end of a
sterile scalpel; 70 – 80% of cells in mucosal scrapings were enterocytes.
IEC-6, IEC-18, SW480, HEK293 cells, and Enterobacter cloacae 29004
were purchased from American Type Culture Collection; RIE-1 cells were
a gift from Dr. H. Xu (University of Arizona, Tucson, AZ). SW480 cells
were grown in Leibowitz medium plus 10% FCS in humidified air; other
cell lines were grown in DMEM plus 10% FCS in 10% CO2. IEC-6, IEC18, and RIE-1 cells were used at passage 20 –30. Abs were from the following sources: A20, U.S. Biologicals (immunofluorescence (IF)), Alexis
(Western blot for human A20), Dr. A. Ma, University of California, San
Francisco (Western blot for rodent A20); V5, Invitrogen; ␤-actin, SigmaAldrich; I␬B, p38, phospho-p38, c-Jun, phospho-c-Jun, ␤-catenin, and
GAPDH, Cell Signaling; Tgn38/S-20, Muc2/H-300, HSP70/K-20, Santa
Cruz Biotechnology; and TRAF6, Upstate Biotechnology. Mouse rIL-17
and LPS from Escherichia coli 0127:B8 were from PeproTech and SigmaAldrich. LPS was used without additional purification. We have previously
found that purification of this commercial preparation by DNase treatment,
proteinase K digestion, and repeated phenol extraction did not change its
ability to elicit dose-dependent responses in IEC-6 cells (39). Moreover,
effects of 1 ␮g/ml LPS from Sigma-Aldrich on p38, c-Jun, and NF-␬B in
IEC-6 cells were completely abrogated by a 20-min preincubation with 20
␮g/ml polymyxin B or adsorption on polymyxin B-agarose (Sigma-Aldrich), which rules out the contribution of TLR ligands other than LPS.
Synthetic oligonucleotide TCGTCGTTTCGTCGTTTTGTCGTT was used
as CpG DNA.
1385
1386
A20 IN INTESTINAL TOLERANCE TO LPS
inflammatory and noninflammatory stimuli. To test this, we examined the effects of preexposure to LPS on responses to UV (stress),
IL-17 (inflammatory cytokine that acts independently of TLR signaling), and unmethylated CpG DNA (TLR9 ligand). Preexposure
to LPS inhibits responses to LPS and CpG DNA, but not to UV or
IL-17. Preexposure to CpG DNA inhibits responses to CpG DNA
and LPS (Fig. 2B shows data for IEC-6 cells; similar data for
IEC-18, RIE-1, and SW480 cells not shown). Normal sensitivity to
inflammatory cytokines in enterocytes tolerized to LPS have been
previously reported by others (15). Because tolerance to LPS does
not affect activation of p38, c-Jun, and NF-␬B by stimuli other than
TLR ligands, desensitization likely targets common upstream
step(s) in the TLR signaling cascade.
LPS induces A20 mRNA and protein
unresponsive state may last ⬎72 h (Fig. 1B). Our findings corroborate previously described tolerance to TLR ligands in enterocytes
(9, 15, 41).
To test whether pretreatment with LPS affects other intracellular
mediators of TLR signaling, we examined activation of NF-␬B and
phosphorylation of the transcription factor c-Jun following restimulation with LPS at various times after the initial challenge.
Pretreatment of IEC-6 cells with LPS dramatically inhibits these
responses. No marked degradation of I␬B, increase in phospho-cJun (Fig. 2A), or increase in NF-␬B DNA-binding activity (supplemental Fig. S1) occurs in response to restimulation at 1–18 h
after the initial challenge. Therefore, a brief initial challenge with
LPS profoundly inhibits the subsequent LPS-induced activation of
p38, c-Jun, and NF-␬B.
We next asked whether desensitization to LPS directly affects
p38, c-Jun, or NF-␬B. If pretreatment with LPS renders these targets refractory, one might expect their unresponsiveness to other
FIGURE 2. Effect of pretreatment with LPS on inflammatory signaling. A, Levels of phospho-p38, phospho-c-Jun, and I␬B in IEC-6 cells pretreated with
1 ␮g/ml LPS for 15 min, incubated in LPS-free medium for the indicated times, and restimulated with LPS for 15 min. B, Activation of p38, c-Jun, and
NF-␬B in IEC-6 cells pretreated with LPS or CpG DNA for 15 min, incubated in LPS-free medium for 4 h, and treated with 50 mJ/cm2 UVC followed
by incubation in growth medium for 1 h, or 100 ng/ml IL-17 for 15 min, or 20 ␮g/ml CpG DNA for 15 min, or LPS for 15 min, as indicated. ⫺, Untreated
cells; ⫹, cells treated with LPS once for 15 min. Arrowhead indicates specific I␬B bands; the band above I␬B is due to nonspecific immunoreactivity of
a particular batch of I␬B Ab. Data are representative of at least three independent experiments.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 1. Tolerance to LPS-induced phosphorylation of p38 in enterocyte cell lines. Phosphorylation of p38 in subconfluent IEC-6, IEC-18,
RIE-1, and SW480 cells (A) and in confluent, stationary IEC-6 cells (B)
pretreated with 1 ␮g/ml LPS for 15 min, incubated in LPS-free medium for
the indicated times, and restimulated with LPS for 15 min. ⫺, Untreated
cells; ⫹, cells treated with LPS once for 15 min. Data are representative of
at least three independent experiments.
Development of tolerance to LPS may involve induction of negative and/or repression of positive regulators of inflammation. To
identify genes potentially implicated in the development of tolerance to LPS, we used real-time RT-PCR to examine the time
course of LPS-induced expression of 28 innate immune transcripts
in IEC-6 cells (supplemental Table S1). A20, TIRAP/MAL, and
ST2 were induced by LPS. TIRAP/MAL and ST2 were not studied
further because the former is a positive regulator of inflammation
and induction of the latter takes ⬎8 h, whereas tolerance to LPS
develops in ⬃1 h after LPS challenge. This report focuses on the
role of A20 in the regulation of responses to LPS.
To confirm induction of A20 at the mRNA level, we used Northern blot analysis. In IEC-6 cells, A20 mRNA is barely detectable
under basal conditions; however, its levels surge ⬎100-fold at 1 h
of treatment with LPS or Gram-negative enteric bacteria Enterobacter cloacae (Fig. 3A). A20 mRNA levels subsequently decrease, yet they remain above the baseline for at least 17 h (Fig. 3,
A and B). LPS also induces the A20 mRNA in IEC-18 and RIE-1
cells (Fig. 3A). Inhibitor of RNA polymerase II ␣-amanitin blocks
A20 induction (Fig. 3C), indicating the requirement of transcription. Neither UV nor IL-17 induces A20 in IEC-6 cells (data not
shown). Thus, A20 transcription is strongly but transiently induced
by LPS or Gram-negative enteric bacteria.
To establish whether the accumulation of A20 mRNA in LPStreated enterocytes is associated with the increased expression of
A20 protein, we used Western blotting with A20 Abs. A20 protein
is strongly induced in enterocytes after 1 h of LPS or CpG DNA
treatment, and levels of A20 protein remain high within at least
4 – 8 h (Fig. 3D shows data for LPS- and CpG DNA-treated
IEC-18 and LPS-treated SW480 cells; other data not shown). As
The Journal of Immunology
1387
the stability of A20 protein, IEC-6 cells transfected with pcDNA3A20 were incubated with the protein synthesis inhibitor cycloheximide, and levels of the V5 epitope-tagged A20 protein were examined by Western blotting. t ⁄ of A20-V5, as determined by
cycloheximide chase, is ⬃2 days (Fig. 3E). In proliferating cells,
the ratio of A20 to total protein is likely to decrease faster than in
quiescent cells due to the ongoing protein synthesis after the cessation of A20 expression, which may explain faster recovery of
LPS responses in proliferating cultures (Fig. 1). LPS-induced expression and stability of A20 protein are consistent with its role in
the development of long-lasting hyporesponsiveness to LPS.
From the images in supplemental Fig. S2, it appears that A20 is
not homogenously distributed inside the cell, as expected of a cytosolic protein, but displays granular localization. To assess intracellular distribution of A20, we separated cell homogenate into
soluble and particulate fractions by high-speed centrifugation and
examined the A20 content of each fraction by Western blotting.
Successful fractionation was confirmed by probing fractions for
glyceraldehyde phosphate dehydrogenase, a typical soluble protein, and ␤-catenin, a typical protein associated with the particulate
fraction. About half of A20 in LPS-stimulated IEC-6 cells is associated with the particulate fraction (Fig. 4A). This supports recently reported association of A20 with intracellular membranes
(42). A20 does not localize to Golgi bodies in IEC-6 cells (Fig.
4B). Although A20 IF appears distributed throughout the cell (supplemental Fig. S2 and Fig. 4B), confocal microscopy reveals that
this protein is largely excluded from the nuclei (Fig. 4C).
12
FIGURE 3. Time course of A20 mRNA and protein induction. A, A20
and ␤-actin mRNA levels in enterocytes treated with 1 ␮g/ml LPS or 107
CFU/ml E. cloacae for the indicated times. B, Time course of A20 mRNA
induction in IEC-6 cells by LPS; average data from three Northern blots.
C, A20 RT-PCR after 1-h stimulation of IEC-6 cells with LPS, with or
without a 30-min pretreatment with 10 ␮g/ml ␣-amanitin. D, Western blot
for the time course of LPS- or CpG DNA-induced A20 protein expression.
E, Levels of A20-V5 protein in IEC-6 cells stably transfected with
pcDNA3.1-A20 and treated with 10 ␮M cycloheximide for the indicated
times. ␤-Actin and heat shock protein 70 (Hsp70) blots are shown to demonstrate equal lane load. Data in D and E are representative of at least three
independent experiments.
an independent approach to evaluating A20 levels, we used IF with
A20 Ab. The chicken A20 Ab from U.S. Biologicals (the two other
A20 Abs did not work in IF) specifically reacts with A20 in IEC-6
cells because staining is not observed with chicken preimmune
serum and because pcDNA3-A20-transfected, but not vector-transfected cells display a strong A20 signal (supplemental Fig. S2A).
A20 IF intensity reaches plateau at 1 h of LPS treatment, remains
high for at least 8 h, and somewhat decreases by 24 h (supplemental Fig. S2B), which corroborates Western blot results. The
long-lasting increase in A20 protein levels following the surge of
the A20 transcript suggested that this protein is stable. To assess
A20 is necessary and sufficient for the establishment of
tolerance to LPS
To examine the causal relationship between A20 expression and
tolerance to LPS, we evaluated responses to LPS under conditions
of A20 ectopic expression or silencing. Transfection of IEC-6 cells
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 4. Localization of A20 in IEC-6 cells. A, Distribution of A20
protein between soluble and particulate fractions in a homogenate of IEC-6
cells treated with LPS for 2 h. Also shown is the distribution of a typical
soluble (glyceraldehyde phosphate dehydrogenase) and a membrane-associated (␤-catenin (␤-cat)) proteins. B, Two-color IF for A20 (green) and
Tgn38 (red) in IEC-6 cells treated with LPS for 2 h. C, Confocal image of
A20 IF across mid-section of IEC-6 cells treated with LPS for 2 h. Bar, 10
␮m. All data are representative of at least three independent experiments.
1388
A20 IN INTESTINAL TOLERANCE TO LPS
poresponsiveness to LPS-induced p38 activation and I␬B degradation within 1–16 h of the initial LPS challenge (Fig. 5C). Experiments with IEC-18 transfectants yielded similar results (data
not shown). These results demonstrate that A20 expression is both
necessary and sufficient for the tolerance to LPS in enterocyte cell
lines.
A20 localizes to the luminal interface of the intestinal epithelium
with pcDNA3-A20, but not with the empty vector, dramatically
decreases phosphorylation of p38 and c-Jun, as well as degradation
of I␬B in response to LPS or CpG DNA, but not UV or IL-17 (Fig.
5A), indicating that A20 expression is sufficient for the specific
inhibition of TLR signaling. Because our transfectants expressed
A20 at the level similar to that in LPS-stimulated cells (Fig. 5B),
inhibition of LPS signaling was not due to massive overexpression
of the A20 protein. By contrast, transfection with A20 siRNA, but
not with the control LEU2 siRNA, abrogates establishment of hy-
A20 expression in the intestinal epithelium is inducible by LPS
and correlates with bacterial load of the gut
Having validated the A20 Ab for IF in intestinal sections, we set
out to examine changes in A20 levels associated with aging and
bacterial colonization of the gut. Levels of A20 protein in the
epithelium of rat ileum are low at birth (Fig. 8A, left, and supplemental Fig. S4A, left), but increase by day 4, the time of emergence
of significant bacterial population of the gut, and are high at 6 mo,
the time by which the intestinal microbiota are fully established
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 5. A20 is necessary and sufficient for the development of tolerance to LPS in IEC-6 cells. A, Levels of phospho-p38, I␬B, and phosphoc-Jun in cells stably transfected with pcDNA3.1-V5His or pcDNA3-A20
and treated with LPS, UV, IL-17, or CpG DNA for the indicated times. B,
Levels of A20 protein in IEC-6 cells transfected with pcDNA3.1-V5His or
pcDNA3-A20 and treated with or without LPS as indicated. A20-V5 has
slightly lower electromobility than native A20 due to added C-terminal
sequence (His6 and V5 tags plus spacers). C, Levels of phospho-p38, I␬B,
and A20 in IEC-6 cells transfected with LEU2 or A20 siRNAs and treated
with LPS for 15 min, incubated in LPS-free medium for the indicated
times, and rechallenged with LPS for 15 min. Arrows indicate position of
I␬B bands; the band above I␬B is due to nonspecific immunoreactivity of
a particular batch of I␬B Ab. ⫺ and ⫹, naive transfectants treated without
and with LPS, respectively, for 15 min. Data are representative of at least
three independent experiments. ␤-cat, ␤-catenin.
To gain an insight into the role of A20 in the small intestine, we
examined A20 IF in the ileal sections from adult mice. The A20
Ab (U.S. Biologicals) prominently decorates the luminal surface of
the villi and large spots that were tentatively identified as goblet
cell cups (Fig. 6A, left). The staining is specific because it is abrogated by substitution of the primary Ab with preimmune serum
and by preincubation of the primary Ab with the excess of affinitypurified A20 protein (Fig. 6B). Staining of goblet cells raised the
concern that the Ab might have also reacted with the intestinal
mucus. Indeed, the staining is abrogated by preincubation of the
Ab with the excess of purified intestinal mucus (Fig. 6B). Therefore, the A20 Ab has a spurious affinity to the mucus, which apparently accounts for the nonspecific staining of goblet cell cups.
To distinguish between A20 and mucus staining, we performed
two-color IF for A20 and the predominant intestinal mucin Muc2.
The Muc2 Ab decorates goblet cell cups (Fig. 6A, middle), which
appear yellow/orange on the merged image due to costaining with
the A20 Ab (Fig. 6A, right). Although surface mucus was removed
by rinsing with PBS plus 7 mM DTT, it was possible that surface
staining was due to Ab reactivity against residual mucin other than
Muc2. To rule this out, we performed two-color staining for A20
and ␤-actin, the cytoskeletal protein that localizes to the apical
submembrane of villus enterocytes. Colocalization with ␤-actin
(Fig. 6C) indicated that the A20 signal is intracellular, which rules
out Ab reactivity with surface mucus. Thus, the pure green color
on the merged image in Fig. 6A identifies A20. Although A20 is
concentrated in the apical submembrane in villus enterocytes, it
localizes diffusely in the epithelium of the upper parts of the crypts
and crypt openings (Fig. 6A, arrowheads). A20 signal is largely
absent from the lower parts of the crypts. In villus enterocytes of
adult rodents, a sizeable fraction of A20 is found in the supranuclear spots, which were identified as Golgi bodies by colocalization with the Tgn38 marker (Fig. 7A). Localization of A20 to the
apical submembrane and Golgi may indicate association of this
protein with membrane-bound TLR signaling complexes. Since
the A20 target TRAF6 is a known member of TLR signaling complexes that associate with membranes (43), we examined localization of A20 and TRAF6 using two-color IF. The strongest TRAF6
signal was observed in the apical submembrane of villus enterocytes (Fig. 7B); a somewhat weaker signal was found in supranuclear punctate structures, presumably secretory vesicles or other
membranous organelles (supplemental Fig. S3). These results are
consistent with patterns of intracellular TRAF6 localization that
have been described previously (44 – 47). Submembrane TRAF6
colocalizes with A20 (Fig. 7B), which supports A20 recruitment to
the apical membrane-bound TLR signaling complexes.
The Journal of Immunology
1389
FIGURE 6. Localization of A20 in the small intestine. A, Immunostaining of ileal section of a conventionally housed adult mouse with A20 Ab (left),
Muc2 Ab (middle), and merged image (right). 4⬘,6-diamidino-2-phenylindole-stained nuclei appear in blue in the first two panels; nuclear staining is not
shown on the merged image. V, Villi; UC, upper parts of the crypts; and LC, lower parts of the crypts. Arrowheads indicate diffuse A20 localization in
the epithelium of upper parts of the crypts and crypt openings. B, Abrogation of specific IF by substitution of the primary Ab with preimmune chicken serum
(top) or preincubation of A20 Ab (20 ␮g/ml) with affinity-purified A20 protein (200 ␮g/ml; right) or purified mucus (200 ␮g/ml protein; right) for 30 min
at room temperature. C, Two-color IF for A20 (green) and actin (red). Bar, 100 ␮m. All images are representative of tissue samples from at least three
different animals.
FIGURE 7. Colocalization of A20 with a Golgi marker protein and
TRAF6 in the villus epithelium. A, Two-color IF for A20 (green) and
Tgn38 (red). 4⬘,6-diamidino-2-phenylindole-stained nuclei appear in blue
in the top and middle panels. The A20 image was taken at relatively high
exposure to reveal Golgi staining, which is significantly weaker than apical
submembrane staining. B, Two-color IF for A20 (green) and TRAF6 (red).
Mock staining with preimmune rabbit serum is shown to demonstrate the
specificity of TRAF6 IF. The A20 image was underexposed to show that
the A20 signal is strongest in the apical submembrane. Bar, 100 ␮m. All
images are representative of tissue samples from at least three different
animals.
sterile conditions and orally gavaged with LPS solution or water.
A20 protein and mRNA levels, respectively, were higher in the
ileal epithelium of the group that received LPS (Fig. 8A, middle,
and supplemental Fig. S4B), indicating A20 induction by oral LPS.
Because induction of A20 could have been due to systemic effects
of luminally administered LPS, we also performed LPS treatment
ex vivo. Rat ileal segments were excised immediately after birth
and treated with or without LPS. Ex vivo treatment with LPS increases A20 protein and mRNA levels in the epithelium (Fig. 8A,
right, and supplemental Fig. S4C), demonstrating that induction of
A20 by luminally administered LPS may be a local response that
does not require systemic inflammation.
We next examined, using antibiotic treatment, whether reduction of bacterial load of the lumen decreases expression of A20.
Gut decontamination with a mixture of antibiotics of limited oral
bioavailability in drinking water markedly reduces A20 protein
and mRNA levels in the ileal epithelium (Fig. 8, B and C). Partial
rather than complete abrogation of A20 expression is likely due to
incomplete elimination of intestinal bacteria by the antibiotic treatment. These results show that A20 expression in the epithelium
positively correlates with the bacterial load of the lumen.
To assess the effect of gut decontamination on the inflammatory
signaling, we examined the effect of antibiotic treatment on phosphorylation of p38 in the intestine. In conventionally housed mice
that received regular drinking water, moderate levels of phosphop38 were present in the epithelium of the upper crypts and lowermost parts of the villi. Somewhat lower levels were observed in
lower crypts, villus cores, and muscularis layer; no phospho-p38
was detected in most of the villus epithelium (Fig. 8D, upper).
Antibiotic treatment markedly reduces the levels of phospho-p38
(Fig. 8, B and D, middle). Phospho-p38 staining is specific because
it is not observed upon substitution of the primary Ab with preimmune serum (Fig. 8D, lower). Thus, p38 activation in the epithelium of adult small intestine is largely limited to the crypts and,
like A20 expression, it positively correlates with the bacterial load
of the lumen.
A20 induction is required for desensitization to LPS in the
neonatal epithelium
To examine the causal relationship between A20 induction and
establishment of tolerance to LPS in the intestinal epithelium, we
used siRNA transfection. Mucosal application of siRNA-cationic
lipid complexes allows effective gene silencing in the epithelium in
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
(Fig. 8A, left, and supplemental Fig. S4A, middle and right). In the
epithelium of 4-day-old rats, A20 localizes diffusely and is present
at high levels in the villi, but at relatively low levels in the nascent
crypts (supplemental Fig. S4A, middle). By 6 mo of age, the characteristic localization similar to that seen in Fig. 6A can be observed (supplemental Fig. S4A, right). Similar patterns were found
in the intestines of newborn, 3-day-old, and 12-wk-old mice (data
not shown). Therefore, levels of the intestinal A20 increase postnatally and remain high through adulthood.
Increased epithelial expression of A20 in 4-day-old rats suggested that this protein might be induced in vivo by LPS or other
TLR ligands of colonizing bacteria. To test this, we examined
LPS-induced expression of A20 in the naive neonatal intestine.
Newborn rats obtained by cesarean section at term were kept under
1390
A20 IN INTESTINAL TOLERANCE TO LPS
vivo (48, 49). We reasoned that this approach could be also applied
ex vivo. Mucosal scrapings or segments from small intestines of
term rat fetuses were transfected with A20 or LEU2 siRNAs complexed with Lipofectamine. Tissue samples were then pulsed with
LPS, washed, incubated without LPS, and subjected to the second
LPS challenge. Phosphorylation of p38 and levels of A20 at various time points were examined by Western blots, real-time RTPCR, and IF. Because mucosal scrapings contain significant numbers of nonenterocyte cell types, Western blot results were
interpreted in conjunction with IF data. The latter identify enterocytes as the cell type where expression of A20 or phosphorylation
of p38 occurs. Transfection with A20 siRNA, but not with LEU2
siRNA, prevents LPS-induced expression of A20 (Fig. 9 and supplemental Fig. S5). Initial LPS challenge increases levels of phospho-p38 (Fig. 9), with the bulk of the signal localized to the nuclei
(supplemental Fig. S5). Samples transfected with A20 siRNA, but
not LEU2 siRNA, displayed p38 activation following the second
LPS challenge (Fig. 9 and supplemental Fig. S5). Thus, A20 induction is required for the establishment of tolerance to LPS in the
epithelium of the neonatal small intestine ex vivo.
Discussion
FIGURE 9. A20 expression is necessary for the establishment of tolerance to LPS in the epithelium of the small intestine ex vivo. Mucosal
scrapings obtained from the whole small intestine of a full-term rat fetus
were transfected with 1 ␮g/ml LEU2 or A20 siRNAs for 30 min (first LPS
exposure, 0 time point), followed by a 15-min treatment with 1 ␮g/ml LPS
(first LPS exposure, 15 min), three washes with DMEM, a 75-min incubation in LPS-free medium (first LPS exposure, 90 min), and a second
15-min treatment with LPS (second LPS exposure). Levels of A20, phospho-p38, p38, ␤-actin proteins (top), and A20:Rps11 mRNA ratios (bottom) were determined by Western blotting and real-time RT-PCR. Western
blot data are representative of three animals in each transfection group. ⴱ,
Significant differences compared with all unmarked samples.
Our findings provide multiple lines of evidence for the key role of
the ubiquitin-editing enzyme A20 in the development of tolerance
to TLR ligands in the small intestine. Unlike many other innate
immune response proteins, A20 is induced by LPS and enteric
bacteria in cultured enterocytes and in the neonatal ileal epithelium. LPS-induced A20 expression temporally coincides with the
establishment of hyporesponsiveness to repeated stimulation with
LPS. Ectopic expression of A20 dramatically decreases LPS-induced activation of p38, c-Jun, and NF-␬B, whereas siRNA silencing of A20 prevents desensitization to LPS, indicating that
A20 is necessary and sufficient for the development of tolerance to
LPS. High levels of A20 attained by exposure to LPS or transfection with A20 plasmid block responses to LPS and CpG DNA, but
not to IL-17 or UV; therefore, A20 specifically inhibits TLR signaling. A20 levels are high in bacteria-colonized intestine, but low
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 8. Effect of age and antibiotic treatment on levels of A20 and phospho-p38. A, A20 protein in ileal mucosal scrapings from newborn, 4-day-old,
and 6-mo-old rats (left); A20 protein (middle top), and A20:Rps11 mRNA ratios (middle bottom) in ileal mucosal scrapings from newborn rats gavaged
with 200 ␮l of sterile water or 1 ␮g/ml LPS and sacrificed 2 h later; A20 protein (right top) and A20:Rps11 mRNA ratios (right bottom) in ileal mucosal
scrapings obtained from a newborn rat immediately after birth and incubated in DMEM or DMEM plus 1 ␮g/ml LPS for 1 h. B, A20, phospho-p38, and
p38 (top) and A20:Rps11 mRNA ratios (bottom) in ileal mucosal scrapings from a conventionally housed mouse that received regular drinking water and
a mouse kept in a specific pathogen-free environment with antibiotics in drinking water. ␤-Actin blots are shown to demonstrate equal lane load. ⴱ,
Significant differences compared with control samples. C, Two-color IF for A20 (green) and Muc2 (red) in the ileum of a conventionally housed mouse
that received regular drinking water (top) and a mouse kept in a specific pathogen-free environment with antibiotics in drinking water (bottom). D,
Phospho-p38 IF (green) in the ileal sections of mice treated as in C (top and middle); control staining of a section from the conventionally housed mouse
with preimmune rabbit serum (bottom). To distinguish between autofluorescence and relatively weak phospho-p38 signal, an additional image was taken
in red (nonspecific) channel and merged with the image in green channel; on the merged images shown, autofluorescence appears in yellow-brown hues,
whereas phospho-p38 IF appears in green. Bar, 100 ␮m. Data are representative of at least 3 different animals in each group.
The Journal of Immunology
also localizes diffusely in undifferentiated enterocytes, but is concentrated at the apical pole following differentiation (52). This observation is consistent with the proposed association of A20 with
TLR signaling complexes. Diffuse localization of A20 in the epithelium of 3- to 4-day rodents may reflect incomplete epithelial
differentiation at the early postnatal stages.
LPS-induced expression of A20, localization patterns of this
protein along the crypt-villus axis, and sequestration of bacteriadependent activation of p38 to upper crypts and crypt openings
suggest a mechanism whereby the intestinal epithelium may sense
commensal bacteria while avoiding dramatic inflammation. Because bacteria have limited access to lower parts of the crypts,
emerging enterocyte precursors may be sensitive to TLR ligands.
As these cells progress toward crypt openings, their exposure to
luminal bacteria may activate TLR signaling, leading to production
of inflammatory factors necessary for the gut homeostasis. However, concomitant induction of A20 would rapidly block TLR signaling. Consequentially, the epithelial response to luminal bacteria
may be benign because it is limited spatially to upper crypts and
crypt openings and temporally to the time needed to induce A20 or
other negative regulators. Since t ⁄ of the A20 protein is comparable to the life span of villus enterocytes, the latter maintain tolerance to LPS until they shed off at the villus tip. The continued
renewal of the intestinal epithelium thus may allow both the limited homeostatic response to commensal bacteria and the suppression of TLR signaling at the luminal interface. Because the whole
intestinal epithelium is naive with regard to TLR signaling at birth,
the onset of bacterial colonization may involve a quasi-inflammatory episode, which is expected to resolve fast due to rapid downregulation of the innate immune responses in enterocytes. Dynamic bacteria-induced development of tolerance in initially
sensitive epithelial cells, as opposed to constitutive unresponsiveness, is supported by the fact that enterocytes isolated from adult
germfree animals are sensitive to stimulation with bacteria (53).
Contribution of A20 into the establishment of dynamic epithelial tolerance to bacteria warrants investigation of the role this
protein in the pathogenesis of the intestinal disorders characterized
by abnormal hypersensitivity to the commensals.
12
Acknowledgments
We thank Dr. Averil Ma for A20 Ab, Dr. Hua Xu for RIE-1 cells, Drs.
Timothy Billiar, Mitchell Fink, Wei Shi, and David Warburton for critiques, and Kerstin Goth for expert technical assistance.
Disclosures
The authors have no financial conflict of interest.
References
1. Fukata, M., and M. T. Abreu. 2007. TLR4 signalling in the intestine in health and
disease. Biochem. Soc. Trans. 35: 1473–1478.
2. Lee, J., J. H. Mo, C. Shen, A. N. Rucker, and E. Raz. 2007. Toll-like receptor
signaling in intestinal epithelial cells contributes to colonic homoeostasis. Curr.
Opin. Gastroenterol. 23: 27–31.
3. Michelsen, K. S., and M. Arditi. 2007. Toll-like receptors and innate immunity in
gut homeostasis and pathology. Curr. Opin. Hematol. 14: 48 –54.
4. Rakoff-Nahoum, S., and R. Medzhitov. 2006. Role of the innate immune system
and host-commensal mutualism. Curr. Top. Microbiol. Immunol. 308: 1–18.
5. Sanderson, I. R., and W. A. Walker. 2007. TLRs in the gut: I. The role of
TLRs/Nods in intestinal development and homeostasis. Am. J. Physiol. 292:
G6 –G10.
6. Stenson, W. F. 2008. Toll-like receptors and intestinal epithelial repair. Curr.
Opin. Gastroenterol. 24: 103–107.
7. Vijay-Kumar, M., J. D. Aitken, and A. T. Gewirtz. 2008. Toll like receptor-5:
protecting the gut from enteric microbes. Semin. Immunopathol. 30: 11–21.
8. Yamamoto-Furusho, J. K., and D. K. Podolsky. 2007. Innate immunity in inflammatory bowel disease. World J. Gastroenterol. 13: 5577–5580.
9. Lotz, M., D. Gutle, S. Walther, S. Menard, C. Bogdan, and M. W. Hornef. 2006.
Postnatal acquisition of endotoxin tolerance in intestinal epithelial cells. J. Exp.
Med. 203: 973–984.
10. Abreu, M. T. 2003. Immunologic regulation of Toll-like receptors in gut epithelium. Curr. Opin. Gastroenterol. 19: 559 –564.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
in naive intestinal epithelium; they are also high in bacteria-exposed villi, crypt openings, and upper crypts, but low in protected
lower crypts. Moreover, A20 levels in the small intestine decrease
following antibiotic treatment. Although our data do not rule out
induction of A20 during postnatal development of the intestine or
enterocyte differentiation, they argue for TLR ligand-induced expression. Prominent localization of A20 to the apical submembrane of villus enterocytes in conventionally housed adult rodents
is consistent with the role of A20 in the suppression of TLR signaling at the luminal interface. The facts that A20-deficient mice
develop severe gut inflammation early in life (36) and that this
inflammation can be alleviated by antibiotics or knockout of the
TLR signaling mediator myeloid differentiation factor MyD88 (37)
further support the key role of A20 in the intestinal tolerance to the
intestinal microbiota.
The critical contribution of A20 into the intestinal tolerance to
LPS raises an important question about the relationship between
A20 and other known inhibitors of TLR signaling in the gut. One
possibility is that some of the mechanisms, for example, posttranslational down-regulation of IRAK-1 (9), depend on A20. Indeed,
IRAK-1 is regulated by K63 polyubiquitination (50) and thus may
be an A20 target. Another possibility is that A20’s role is limited
to the small intestine, whereas the large intestine, with its higher
bacterial burden, utilizes different mechanisms. Because Tollip is
mostly expressed in the large intestine and is induced by LPS in
colonic enterocyte cell lines (15), but not in the small intestinederived IEC-6 (this study), or m-ICcl2 (9), tolerance via induction
of Tollip may be colon specific. It is also possible that other negative regulators of inflammatory signaling are redundant with A20.
Examples of such mechanisms could be down-regulation of TLR
in villus enterocytes, ligand-induced TLR internalization, NF-␬Bmediated resynthesis of I␬B, or degradation of MD-2 by trypsin.
Furthermore, intestinal tolerance to bacteria involves a variety of
specialized innate immune cells with their specific regulatory
mechanisms (51). It is not surprising that such critical function as
tolerance to commensal bacteria is supported by multiple
mechanisms.
Rapid development of tolerance to LPS via induced expression
of A20 appears to be enterocyte specific. Indeed, development of
tolerance to LPS in macrophages takes a longer time and does not
require A20 (28). In addition to its cytosolic localization, A20
localizes to late endocytic vesicles in HEK293, COS-7, and HeLa
cells (42), whereas in adult villus enterocytes it localizes to apical
submembrane and Golgi bodies. Golgi localization in villus enterocytes and association with particulate structures in IEC-6 cells
may reflect inclusion of A20 into membrane-associated TLR signaling complexes. Because A20 lacks membrane-spanning domains or lipid modification sites, its association with membranes
likely depends on interaction with membrane-tethered proteins.
One such protein could be the A20 target TRAF6, which is associated with membranes in unstimulated cells (43). The unique
physiology of A20 in the intestine may be relevant to the fact that
enterocytes are the only cell type in the body that is continuously
exposed to high concentrations of bacteria under normal conditions. Accordingly, in enterocytes A20 may facilitate establishment and maintenance of tolerance to commensal bacteria,
whereas in other cell types it may blunt responses to inflammatory
cytokines and invading pathogens.
In adult villus enterocytes, A20 localizes to apical submembrane
and Golgi bodies. By contrast, enterocytes in the upper parts of the
crypts display diffuse A20, which resembles localization in IEC-6
cells. Crypt-villus differences in A20 localization may be related to
the establishment of apical-basolateral polarity during differentiation of crypt precursors into villus enterocytes. Interestingly, TLR4
1391
1392
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
requires a dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain. Cell 103: 351–361.
Lamothe, B., A. Besse, A. D. Campos, W. K. Webster, H. Wu, and B. G. Darnay.
2007. Site-specific Lys-63-linked tumor necrosis factor receptor-associated factor
6 auto-ubiquitination is a critical determinant of I␬B kinase activation. J. Biol.
Chem. 282: 4102– 4112.
Li, H., M. Kobayashi, M. Blonska, Y. You, and X. Lin. 2006. Ubiquitination of
RIP is required for tumor necrosis factor ␣-induced NF-␬B activation. J. Biol.
Chem. 281: 13636 –13643.
Lee, E. G., D. L. Boone, S. Chai, S. L. Libby, M. Chien, J. P. Lodolce, and A. Ma.
2000. Failure to regulate TNF-induced NF-␬B and cell death responses in A20deficient mice. Science 289: 2350 –2354.
Turer, E. E., R. M. Tavares, E. Mortier, O. Hitotsumatsu, R. Advincula, B. Lee,
N. Shifrin, B. A. Malynn, and A. Ma. 2008. Homeostatic MyD88-dependent
signals cause lethal inflammation in the absence of A20. J. Exp. Med. 205:
451– 464.
Weng, M., W. A. Walker, and I. R. Sanderson. 2007. Butyrate regulates the
expression of pathogen-triggered IL-8 in intestinal epithelia. Pediatr. Res. 62:
542–546.
Grishin, A. V., J. Wang, D. A. Potoka, D. J. Hackam, J. S. Upperman, P. Boyle,
R. Zamora, and H. R. Ford. 2006. Lipopolysaccharide induces cyclooxygenase-2
in intestinal epithelium via a noncanonical p38 MAPK pathway. J. Immunol. 176:
580 –588.
Marshall, T., and A. Allen. 1978. The isolation and characterization of the highmolecular-weight glycoprotein from pig colonic mucus. Biochem. J. 173:
569 –578.
Sun, J., P. E. Fegan, A. S. Desai, J. L. Madara, and M. E. Hobert. 2007. Flagellininduced tolerance of the Toll-like receptor 5 signaling pathway in polarized intestinal epithelial cells. Am. J. Physiol. 292: G767–G778.
Li, L., D. W. Hailey, N. Soetandyo, W. Li, J. Lippincott-Schwartz, H. B. Shu, and
Y. Ye. 2008. Localization of A20 to a lysosome-associated compartment and its
role in NF␬B signaling. Biochim. Biophys. Acta 1783: 1140 –1149.
Jiang, Z., J. Ninomiya-Tsuji, Y. Qian, K. Matsumoto, and X. Li. 2002. Interleukin-1 (IL-1) receptor-associated kinase-dependent IL-1-induced signaling complexes phosphorylate TAK1 and TAB2 at the plasma membrane and activate
TAK1 in the cytosol. Mol. Cell. Biol. 22: 7158 –7167.
Gentry, J. J., N. J. Rutkoski, T. L. Burke, and B. D. Carter. 2004. A functional
interaction between the p75 neurotrophin receptor interacting factors, TRAF6 and
NRIF. J. Biol. Chem. 279: 16646 –16656.
Nakamura, I., Y. Kadono, H. Takayanagi, E. Jimi, T. Miyazaki, H. Oda,
K. Nakamura, S. Tanaka, G. A. Rodan, and T. Duong le. 2002. IL-1 regulates
cytoskeletal organization in osteoclasts via TNF receptor-associated factor 6/cSrc complex. J. Immunol. 168: 5103–5109.
Sanz, L., M. T. Diaz-Meco, H. Nakano, and J. Moscat. 2000. The atypical PKCinteracting protein p62 channels NF-␬B activation by the IL-1-TRAF6 pathway.
EMBO J. 19: 1576 –1586.
Schultheiss, U., S. Puschner, E. Kremmer, T. W. Mak, H. Engelmann,
W. Hammerschmidt, and A. Kieser. 2001. TRAF6 is a critical mediator of signal
transduction by the viral oncogene latent membrane protein 1. EMBO J. 20:
5678 –5691.
Palliser, D., D. Chowdhury, Q. Y. Wang, S. J. Lee, R. T. Bronson, D. M. Knipe,
and J. Lieberman. 2006. An siRNA-based microbicide protects mice from lethal
herpes simplex virus 2 infection. Nature 439: 89 –94.
Zhang, Y., P. Cristofaro, R. Silbermann, O. Pusch, D. Boden, T. Konkin,
V. Hovanesian, P. R. Monfils, M. Resnick, S. F. Moss, and B. Ramratnam. 2006.
Engineering mucosal RNA interference in vivo. Mol. Ther. 14: 336 –342.
Newton, K., M. L. Matsumoto, I. E. Wertz, D. S. Kirkpatrick, J. R. Lill, J. Tan,
D. Dugger, N. Gordon, S. S. Sidhu, F. A. Fellouse, et al. 2008. Ubiquitin chain
editing revealed by polyubiquitin linkage-specific antibodies. Cell 134: 668 – 678.
Packey, C. D., and R. B. Sartor. 2008. Interplay of commensal and pathogenic
bacteria, genetic mutations, and immunoregulatory defects in the pathogenesis of
inflammatory bowel diseases. J. Intern. Med. 263: 597– 606.
Cario, E., D. Brown, M. McKee, K. Lynch-Devaney, G. Gerken, and
D. K. Podolsky. 2002. Commensal-associated molecular patterns induce selective
Toll-like receptor-trafficking from apical membrane to cytoplasmic compartments in polarized intestinal epithelium. Am. J. Pathol. 160: 165–173.
Haller, D., M. P. Russo, R. B. Sartor, and C. Jobin. 2002. IKK ␤ and phosphatidylinositol 3-kinase/Akt participate in non-pathogenic Gram-negative enteric
bacteria-induced RelA phosphorylation and NF-␬B activation in both primary
and intestinal epithelial cell lines. J. Biol. Chem. 277: 38168 –38178.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
11. Cario, E., and D. K. Podolsky. 2005. Intestinal epithelial TOLLerance versus
inTOLLerance of commensals. Mol. Immunol. 42: 887– 893.
12. Abreu, M. T., P. Vora, E. Faure, L. S. Thomas, E. T. Arnold, and M. Arditi. 2001.
Decreased expression of Toll-like receptor-4 and MD-2 correlates with intestinal
epithelial cell protection against dysregulated proinflammatory gene expression
in response to bacterial lipopolysaccharide. J. Immunol. 167: 1609 –1616.
13. Lenoir, C., C. Sapin, A. H. Broquet, A. M. Jouniaux, S. Bardin, I. Gasnereau,
G. Thomas, P. Seksik, G. Trugnan, J. Masliah, and M. Bachelet. 2008. MD-2
controls bacterial lipopolysaccharide hyporesponsiveness in human intestinal epithelial cells. Life Sci. 82: 519 –528.
14. Cario, E., D. T. Golenbock, A. Visintin, M. Runzi, G. Gerken, and
D. K. Podolsky. 2006. Trypsin-sensitive modulation of intestinal epithelial MD-2
as mechanism of lipopolysaccharide tolerance. J. Immunol. 176: 4258 – 4266.
15. Otte, J. M., E. Cario, and D. K. Podolsky. 2004. Mechanisms of cross hyporesponsiveness to Toll-like receptor bacterial ligands in intestinal epithelial cells.
Gastroenterology 126: 1054 –1070.
16. Didierlaurent, A., B. Brissoni, D. Velin, N. Aebi, A. Tardivel, E. Kaslin,
J. C. Sirard, G. Angelov, J. Tschopp, and K. Burns. 2006. Tollip regulates proinflammatory responses to interleukin-1 and lipopolysaccharide. Mol. Cell Biol. 26:
735–742.
17. Shibolet, O., and D. K. Podolsky. 2007. TLRs in the gut: IV. Negative regulation
of Toll-like receptors and intestinal homeostasis: addition by subtraction.
Am. J. Physiol. 292: G1469 –G1473.
18. Krikos, A., C. D. Laherty, and V. M. Dixit. 1992. Transcriptional activation of the
tumor necrosis factor ␣-inducible zinc finger protein, A20, is mediated by ␬B
elements. J. Biol. Chem. 267: 17971–17976.
19. Opipari, A. W., Jr., M. S. Boguski, and V. M. Dixit. 1990. The A20 cDNA
induced by tumor necrosis factor ␣ encodes a novel type of zinc finger protein.
J. Biol. Chem. 265: 14705–14708.
20. Funakoshi, M., K. Tago, Y. Sonoda, S. Tominaga, and T. Kasahara. 2001. A
MEK inhibitor, PD98059 enhances IL-1-induced NF-␬B activation by the enhanced and sustained degradation of I␬B␣. Biochem. Biophys. Res. Commun.
283: 248 –254.
21. Grey, S. T., M. B. Arvelo, W. Hasenkamp, F. H. Bach, and C. Ferran. 1999. A20
inhibits cytokine-induced apoptosis and nuclear factor ␬B-dependent gene activation in islets. J. Exp. Med. 190: 1135–1146.
22. Heyninck, K., and R. Beyaert. 1999. The cytokine-inducible zinc finger protein
A20 inhibits IL-1-induced NF-␬B activation at the level of TRAF6. FEBS Lett.
442: 147–150.
23. Jaattela, M., H. Mouritzen, F. Elling, and L. Bastholm. 1996. A20 zinc finger
protein inhibits TNF and IL-1 signaling. J. Immunol. 156: 1166 –1173.
24. Johnson, K., S. Hashimoto, M. Lotz, K. Pritzker, and R. Terkeltaub. 2001. Interleukin-1 induces pro-mineralizing activity of cartilage tissue transglutaminase
and factor XIIIa. Am. J. Pathol. 159: 149 –163.
25. Liuwantara, D., M. Elliot, M. W. Smith, A. O. Yam, S. N. Walters, E. Marino,
A. McShea, and S. T. Grey. 2006. Nuclear factor-␬B regulates ␤-cell death: a
critical role for A20 in ␤-cell protection. Diabetes 55: 2491–2501.
26. Shembade, N., N. S. Harhaj, D. J. Liebl, and E. W. Harhaj. 2007. Essential role
for TAX1BP1 in the termination of TNF-␣-, IL-1- and LPS-mediated NF-␬B and
JNK signaling. EMBO J. 26: 3910 –3922.
27. Song, H. Y., M. Rothe, and D. V. Goeddel. 1996. The tumor necrosis factorinducible zinc finger protein A20 interacts with TRAF1/TRAF2 and inhibits
NF-␬B activation. Proc. Natl. Acad. Sci. USA 93: 6721– 6725.
28. Boone, D. L., E. E. Turer, E. G. Lee, R. C. Ahmad, M. T. Wheeler, C. Tsui,
P. Hurley, M. Chien, S. Chai, O. Hitotsumatsu, et al. 2004. The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses.
Nat. Immunol. 5: 1052–1060.
29. Wang, Y. Y., L. Li, K. J. Han, Z. Zhai, and H. B. Shu. 2004. A20 is a potent
inhibitor of TLR3- and Sendai virus-induced activation of NF-␬B and ISRE and
IFN-␤ promoter. FEBS Lett. 576: 86 –90.
30. Hitotsumatsu, O., R. C. Ahmad, R. Tavares, M. Wang, D. Philpott, E. E. Turer,
B. L. Lee, N. Shiffin, R. Advincula, B. A. Malynn, et al. 2008. The ubiquitinediting enzyme A20 restricts nucleotide-binding oligomerization domain containing 2-triggered signals. Immunity 28: 381–390.
31. Lin, S. C., J. Y. Chung, B. Lamothe, K. Rajashankar, M. Lu, Y. C. Lo, A. Y. Lam,
B. G. Darnay, and H. Wu. 2008. Molecular basis for the unique deubiquitinating
activity of the NF-␬B inhibitor A20. J. Mol. Biol. 376: 526 –540.
32. Wertz, I. E., K. M. O’Rourke, H. Zhou, M. Eby, L. Aravind, S. Seshagiri, P. Wu,
C. Wiesmann, R. Baker, D. L. Boone, et al. 2004. De-ubiquitination and ubiquitin
ligase domains of A20 downregulate NF-␬B signalling. Nature 430: 694 – 699.
33. Deng, L., C. Wang, E. Spencer, L. Yang, A. Braun, J. You, C. Slaughter,
C. Pickart, and Z. J. Chen. 2000. Activation of the I␬B kinase complex by TRAF6
A20 IN INTESTINAL TOLERANCE TO LPS