Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 Tender Enquiry No: NEIGR/S&P/OT/E -62/2016 -17; Dated: 07/11/2016 F. No: NEIGR/S&P/M-02/2016 -17/Pt TENDER /BID DOCUMENT ONLINE OPEN TENDER RATE CONTRACT FOR PROCESSING OF CHEMICALS, REAGENTS, GLASSWARE, INSTRUMENTS, SURGICALS, CONTRAST, ETC FOR THE INSTITUTE, FOR A PERIOD OF ONE YEAR, EXTENDABLE UPTO 6 MONTHS, OR TILL THE FINALIZATION OF THE NEXT TENDER, WHICHEVER IS LATER. (e -Procurement) Bid Document Downloading Start Date: 14:00 hours of 07.11.2016 Last Date and Time for Submission of Bid Document Online: 14:00 hours of 07.12.2016 Pre-Bid Conference and Clarification Date: Last date and Time of Receipt of Earnest Money Deposit and Tender Fee (hard copies): Date and Time of Opening of Techno -Commercial Bids: Cost of Tender Fee: Cost of Earnest Money Deposit (EMD): 16:00 hours of 17.11.2016 14:00 hours of 07.12.2016 14:30 hours of 07.12.2016 Rs 1000.00 Rs 25,000.00 Bidders /Tenderers can download the tender /bid document from Central Public Procurement Portal website at www.eprocure.gov.in Bidders /Tenderers are required to submit their bid online by uploading all the relevant documents through www.eprocure.gov.in Tender document can also be downloaded from the Institute’s website at www.neigrihms.gov.in For further details regarding amendment /addendum /extension please visit website: www.eprocure.gov.in and www.neigrihms.gov.in In the event of the date being declared as a closed holiday for purchaser’s office, the due date for submission of bids online and opening of bids online will be the following working day at the appointed time. North Eastern Indira Gandhi Regional Institute of Health and Medical Sciences (An Autonomous Institute, Ministry of Health and Family Welfare, Government of India) Director’s Block, Mawdiangdiang, Shillong 793 018 (Meghalaya) Website: www.neigrihms.gov.in /E -mail: [email protected] Tele /Fax: (0364) 2538032 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 North Eastern Indira Gandhi Regional Institute of Health and Medical Sciences (An Autonomous Institute, Ministry of Health and Family Welfare, Government of India) Director’s Block, Mawdiangdiang, Shillong 793 018 (Meghalaya) Website: www.neigrihms.gov.in /E -mail: [email protected] Tele /Fax: (0364) 2538032 SECTION I: NOTICE INVITING TENDERS (NIT) Online tenders, in two-bid system, are invited by Director, NEIGRIHMS, Shillong for processing of stores /items for the Institute, as per enclosed specification and related terms and conditions. Sl. No. 1. Name of the Equipment Rate Contract for processing of Chemicals, Reagents, Glassware, Instruments, Surgical, Disposables, Contrast, etc for the Institute, for a period of one year, extendable upto 6 months, or till the finalization of the next tender, whichever is later. Earnest Money Deposit (EMD) Rs 25,000.00 (Rupees Twenty Five thousand only) 1. Bidders /Tenderers would be required to register on the Central Public Procurement Portal at www.eprocure.gov.in, using a valid Digital Signature Certificate (DSC) and valid email address to be able to participate in the bidding process. On registration with the Portal they will be provided with a user id and password by the system through which they can submit their bids online. 2. Digital Signature Certificate (DSC) may be obtained from any authorized agencies registered with the Certifying Authority (CA), through National Informatics Center (NIC) in India. 3. Bidders /Tenderers can download the bid document from Central Public Procurement Portal website at www.eprocure.gov.in Bidders /Tenderers are required to submit the bid online by scanning and uploading all the relevant documents through www.eprocure.gov.in 4. Tender document can also be downloaded from the Institute’s website at www.neigrihms.gov.in For further details regarding Amendment /Addendum /Extension please visit website: www.eprocure.gov.in and www.neigrihms.gov.in 5. Non –Refundable Tender Fee of Rs 1000.00 (Rupees One thousand only) in the form of Banker’s Cheque or Demand draft, drawn in favour of Deputy Director (Admn.), NEIGRIHMS, Shillong, shall be scanned and submitted online, along with the Techno-commercial bid (Un priced Bid), within the period of tender online submission date and time and the original (hard copy) should be sent to Store & Procurement Officer, Director’s Block, Mawdiangdiang, NEIGRIHMS, Shillong -793018 within the stipulated date and time. 6. Earnest Money Deposit (EMD) in the form of Call deposit, Banker’s Cheque, Fixed deposit or Demand draft, drawn in favour of Deputy Director (Admn.), NEIGRIHMS, Shillong or Bank Guarantee of any Scheduled Bank, shall be scanned and submitted online, along with the Techno-commercial bid (Un priced Bid), within the period of tender online submission date and time and the original (hard copy) should be sent to Store & Procurement Officer, Director’s Block, Mawdiangdiang, NEIGRIHMS, Shillong -793018 within the stipulated date and time. 7. In the event of the date being declared as a closed holiday for purchaser’s office, the due date for submission of bids online and opening of bids online will be the following working day at the appointed times. 8. Bidders/Tenderers need to scan and upload the required documents like VAT/Sales tax registration, PAN Number/Card, valid document regarding the existence and registration of the firm along with the with Technocommercial bid, as per Check List (Section XXI) 9. The technical bids will be opened online by a committee of members duly constituted for the purpose at the time and date as specified in the tender document. All statements, documents, certificates, proof of EMD /Tender fee /Affidavits, etc uploaded by the bidders will be verified and downloaded for technical evaluation and the result of technical bid evaluation will be displayed on www.eprocure.gov.in.in which can be seen by all bidders who participated in the tender. 10. The bidders should download the BoQ.xls from CPP Portal and filled in the blank spaces provided for mentioning the name of bidder and rates. Bidders need not modify any other text or background shown in the BOQ template or replace it with any other copy of same BOQ in .xls format. NEIGRIHMS /Central Public Procurement Portal (www.eprocure.gov.in) will accept the BOQ template only and hence the rate should not be quoted in any other place except BOQ template. 11. The Financial bid (price bid) i.e. Bill of Quantity (BOQ) of only technically qualified bidders will be opened online by a committee of members and the result will be displayed on the www.eprocure.gov.in which can be seen by all bidders who participated in the tender. 12. No work will be allotted to Non-tribal bidder, contractors, Suppliers, stockists, bonded warehouse, private carriage contractors, cooperative societies etc except under a valid trading license issued by the Khasi Hills Autonomous District Council, Shillong. Page 2 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 13. The firm has to give an affidavit duly attested by the Notary Public (in original) on a non-judicial stamp paper of Rs. 10/= that the firm is not supplying the same item at lower rates quoted in this tender to any Government/Private organization or any other institution during past one year, as per “FALL CLAUSE” adhered by DGS & D and other Government agencies. 14. The firm has to give an affidavit duly attested by the Notary Public (in original) on a non-judicial stamp paper of Rs. 10/= that there is no vigilance/CBI /FEMA case pending against the firm/supplier. 15. At any time prior to the date of submission of bid, Director, NEIGRIHMS may, for any reason, whether at his own initiatives or in response to a clarification from a prospective bidder, modify the bidding documents by an amendment. All prospective bidders/tenderer who have received the bidding document will be notified of the amendment in writing and the amendment shall be binding on them. In order to provide reasonable time to take the amendment into account in preparing the bid. Director, NEIGRIHMS, may at his discretion, extends the date and time for submission of bids. 16. The tendered rates and the validity of bids shall be for a period of one year, extendable upto 6 months, or till the finalization of the next tender, whichever is later. 17. NEIGRIHMS reserves all rights to make any changes in terms and conditions of the tender and also to reject any or all bids without assigning any reason thereof. 18. Settlement of disputes – Director, NEIGRIHMS or his authorized representative shall be the final authority in all disputes and decision will be binding on all concerned. For any clarification and further details please contact @ Telephone No: 0364 -2538032 or contact in person during office hours. Sd/Stores & Procurement Officer, For and on behalf of Director, NEIGRIHMS, Shillong Page 3 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 SECTION II: INSTRUCTIONS TO BIDDERS 1. Source of Funds 1.1 2. The Institute is an Autonomous Institute of Ministry of Health and Family Welfare, Government of India, funded by Government of India. 2.1 This Invitation for Bid is open to all eligible suppliers from source countries as defined herein. 2.2 Eligible Bidders Bidders should not be associated, or have been associated in the past, directly or indirectly, with a firm or any of its affiliates which have been engaged by the Purchaser to provide consulting services for the preparation of the design, specifications, and other documents to be used for the procurement of the goods to be purchased under this Invitation of Bid. 2.3 Bidders shall not be under a declaration of ineligibility for corrupt and fraudulent practices issued by the Bank in accordance with sub-clause 36.1. 3. Eligible Goods and Services 3.1 For purposes of this clause, "origin" means the place where the goods are mined, grown, or produced or from which the ancillary services are supplied. Goods are produced when, through manufacturing, processing or substantial and major assembling of components, a commercially recognized product results that is substantially different in basic characteristics or in purpose or utility from its components. 3.2 4. 4.1 5. 5.1 5.2 6. 6.1 7. The origin of goods and services is distinct from the nationality of the Bidder. Cost of Bidding The Bidder shall bear all costs associated with the preparation and submission of its bid, and Director, NEIGRIHMS, Mawdiangdiang, Shillong – 793018, Meghalaya hereinafter referred to as "the Purchaser", will in no case be responsible or liable for these costs, regardless of the conduct or outcome of the bidding process. Content of Bidding Documents The goods required, bidding procedures and contract terms are prescribed in the bidding documents. In addition to the Invitation for Bid, the bidding documents include: Instruction to Bidders (ITB) ; General Conditions of Contract (GCC) ; Special Conditions of Contract (SCC) ; Schedule of Requirements with technical Specifications; Bid Form and Price Schedules; Bid Security Form; Contract Form; Performance Security Form; Performance Statement Form; The Bidder is expected to examine all instructions, forms, terms, and specifications in the bidding documents. Failure to furnish all information required by the bidding documents or submission of a bid not substantially responsive to the bidding documents in every respect will be at the Bidder's risk and may result in rejection of its bid. Clarification of Bidding Documents A prospective Bidder requiring any clarification of the bidding documents may notify the Purchaser in writing or by telex or cable or fax at the Purchaser's mailing address indicated in the Invitation for Bid. The Purchaser will respond in writing to any request for clarification of the bidding documents, which it receives no later than 15 days prior to the deadline for submission of bid prescribed in ITB clause 19.1. Written copies of the Purchaser's response (including an explanation of the query but without identifying the source of inquiry) will be sent to all prospective bidders which have received the bidding documents. Amendment of Bidding Documents Page 4 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 7.1 At any time prior to the deadline for submission of bid, the Purchaser may, for any reason, whether at its own initiative or in response to a clarification requested by a prospective bidder, modify the bidding documents by amendment. 7.2 Deleted 7.3 In order to allow prospective bidders reasonable time in which to take the amendment into account in preparing their bid, the Purchaser, at its discretion, may extend the deadline for the submission of bid. 8. Language of Bid 8.1 9. The bid prepared by the Bidder, as well as all correspondence and documents relating to the bid exchanged by the Bidder and the Purchaser shall be written in English language. Supporting documents and printed literature furnished by the Bidder may be in another language provided they are accompanied by an accurate translation of the relevant passages in the English language in which case, for purposes of interpretation of the Bid, the translation shall govern. 9.1 The bid prepared by the Bidder shall comprise the following components: Documents Comprising the Bid (a) A Bid Form and a Price Schedule (BOQ) completed in accordance with ITB Clauses 10, 11 and 12; (c) Documentary evidence established in accordance with ITB Clause 14 that the goods and ancillary services to be supplied by the Bidder are eligible goods and services and conform to the bidding documents; and (b) (d) 10. Documentary evidence established in accordance with ITB Clause 13 that the Bidder is eligible to bid and is qualified to perform the contract if its bid is accepted; Bid security furnished in accordance with ITB Clause 15. Bid Form 10.1 The Bidder shall complete the Bid Form and the appropriate Price Schedule furnished in the bidding documents, indicating the goods to be supplied, and a brief description of the goods, their country of origin, quantity and prices. 11. Bid Prices The Bidder shall indicate on the Price schedule the unit price and total bid price of each item in the schedule it proposes to supply under the Contract. The Bidders are allowed the options to submit the bid for any one or more schedules specified in the "Schedule of Requirements" and to offer discounts for combined schedules. However, Bidders shall quote for the complete requirements of goods and services specified under each schedule on a single responsibility basis, failing which such bid will not be taken in to account for evaluation and will not be considered for award. Prices indicated on the Price Schedule shall be entered separately in the following manner: (i) The price of the good, quoted is inclusive of all duties and levies, delivery transport and installation charges, full warranty and on-site maintenance during warranty period after installation, if any. (ii) Sales and other taxes which will be payable on the goods if this Contract is awarded. 11.3 (iii) Free replacement of the stores in case the same remains unutilized or expires. The Bidder's separation of the price components in accordance with ITB Clause 11.2 above will be solely for the purpose of facilitating the comparison of bid by the Purchaser and will not in any way limit the Purchaser's right to contract on any of the terms offered. 11.4 Fixed Price. Prices quoted by the Bidder shall be fixed during the Bidder's performance of the Contract and not subject to variation on any account. A bid submitted with an adjustable price bid will be treated as non-responsive and rejected, pursuant to ITB Clause 24. Payment Terms Payment shall be made subject to recoveries, if any, by way of liquidated damages or any other charges as per terms & conditions of contract in the following manner. Page 5 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 A) Payment for Domestic Goods Or Foreign Origin Located Within India. Payment shall be made in Indian Rupees as specified in the contract in the following manner: a) On delivery: 90 % payment of the contract price shall be paid on receipt of goods in good condition and upon the submission of the following documents: (i) Four copies of supplier’s invoice showing contract number, goods description, quantity, unit price and total amount; (ii) Consignee Receipt Certificate as per Section XVII in original issued by the authorized representative of the consignee; (iii) Two copies of packing list identifying contents of each package; (iv) Inspection certificate issued by the nominated Inspection agency, if any. (v) Insurance Certificate; (vi) Certificate of origin. b) On Acceptance: Balance 10 % payment would be made against ‘Final Acceptance Certificate’ as per Section XVIII of goods to be issued by the consignees subject to recoveries, if any, either on account of non-rectification of defects/deficiencies not attended by the Supplier or otherwise. B) Payment for Imported Goods: I) Payment for foreign currency portion shall be made in the currency as specified in the contract in the following manner: FOB Contracts: a) On Shipment: (i) (ii) Ninety (90) % of the net FOB price (FOB price less Indian Agency commission) of the goods dispatched shall be paid through irrevocable, non-transferable Letter of Credit (LC) opened in favour of the Foreign Principal in a bank in his country and upon submission of documents specified hereunder/90 days credit: (iii) (iv) (v) (vi) (vii) (viii) (ix) Four copies of supplier’s invoice showing contract number, goods description, quantity, unit price and total amount; Original and four copies of the negotiable clean, on-board Bill of Lading, marked freight pre paid and four copies of non-negotiable Bill of Lading; Four Copies of packing list identifying contents of each package; Manufacturer’s/Supplier’s warranty certificate; Inspection certificate issued by the nominated inspection agency, if applicable as per contract; Manufacturer’s own factory inspection report; Certificate of origin by the chamber of commerce of the concerned country; Port of Loading and Port of Discharge The above documents (i - viii) shall also be received by the purchaser at least one week before arrival of goods at the port or place of arrival and, if not received, the Supplier will be responsible for any consequent expenses. b) On Acceptance: Balance payment of 10 % of net FOB price of goods would be made against ‘Final Acceptance Certificate’ as per Section XVIII to be issued by the consignees through irrevocable, non-transferable Letter of Credit (LC) opened in favour of the Foreign Principal in a bank in his country, subject to recoveries, if any. c) Payment of Incidental Services (including Installation & Commissioning, Supervision, Demonstration and Training) will be paid in Indian Rupees to the Indian Agent on proof of 100 % payment to the Foreign Principal. Page 6 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 d) Payment of Indian Agency Commission: Indian Agency commission will be paid to the manufacturer’s agent in the local currency for an amount in Indian rupees indicated in the relevant Price Schedule (as per prevailing rate of exchange ruling on the date of Contract) and shall not be subject to further escalation / exchange variation. Payment shall be paid in Indian Rupees to the Indian Agent on proof of 100 % payment to the Foreign Principal. II) DDP Contracts: a) On Shipment: Ninety (90) % of the net CIF price (CIF price less Indian Agency commission) of the goods shipped shall be paid through irrevocable, non-transferable Letter of Credit (LC) opened in favour of the supplier in a bank in his country and upon submission of documents specified in 1(a). b) On Acceptance: Balance payment of 10 % of net CIF price of goods would be made against ‘Final Acceptance Certificate’ as per Section XVIII to be issued by the consignees through irrevocable, non-transferable Letter of Credit (LC) opened in favour of the Foreign Principal in a bank in his country, subject to recoveries, if any. c) Payment of Custom Duty amount with CDEC (if applicable), Customs Clearance and handling charges, Loading/Unloading, Road permit charges, Inland Transportation, Incidental Costs till consignee site & Incidental Services (including Installation & Commissioning, Supervision, Demonstration and Training) will be paid in Indian Rupees to the Indian Agent on proof of 100 % payment to the Foreign Principal. d) Payment of Indian Agency Commission: Indian Agency commission will be paid to the manufacturer’s agent in the local currency for an amount in Indian rupees indicated in the relevant Price Schedule (as per prevailing rate of exchange ruling on the date of Contract) and shall not be subject to further escalation / exchange variation. Payment shall be paid in Indian Rupees to the Indian Agent on proof of 100 % payment to the Foreign Principal. 21.2 The supplier shall not claim any interest on payments under the contract. 21.4 Irrevocable & non – transferable LC shall be opened by the purchaser/consignees. However, if the supplier requests specifically to open confirmed LC, the extra charges would be borne by the supplier. If LC is required to be extended and/or amended for reasons not attributable to the purchaser/consignee, the charges thereof shall be borne by the supplier. 21.3 21.5 21.6 21.7 21.8 21.9 Where there is a statutory requirement for tax deduction at source, such deduction towards income tax and other tax as applicable will be made from the bills payable to the Supplier at rates as notified from time to time. The payment shall be made in the currency / currencies authorised in the contract. The supplier shall send its claim for payment in writing, when contractually due, along with relevant documents etc., duly signed with date, to respective consignees. While claiming payment, the supplier is also to certify in the bill that the payment being claimed is strictly in terms of the contract and all the obligations on the part of the supplier for claiming that payment has been fulfilled as required under the contract. While claiming reimbursement of duties, taxes etc. (like sales tax, excise duty, custom duty) from the purchaser, as and if permitted under the contract, the supplier shall also certify that, in case it gets any refund out of such taxes and duties from the concerned authorities at a later date, it (the supplier) shall refund to the purchaser forthwith. In case where the supplier is not in a position to submit its bill for the balance payment for want of receipted copies of Inspection Note from the consignee/user department and the consignee/user department has not complained about the non-receipt, shortage, or defects in the supplies made, balance amount will be paid by the paying authority without consignee’s receipt certificate after three months from the date of the preceding part payment for the goods in question, subject to the following conditions: Page 7 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 (a) The supplier will make good any defect or deficiency that the consignee (s) may report within six months from the date of despatch of goods. (b) Delay in supplies, if any, has been regularized. (c) The contract price where it is subject to variation has been finalized. (d) The supplier furnishes the following undertakings: 22. 22.1 “I/We, __________________ certify that I/We have not received back the Inspection Note duly receipted by the consignee or any communication from the purchaser or the consignee about non-receipt, shortage or defects in the goods supplied. I/We ______ agree to make good any defect or deficiency that the consignee may report within three months from the date of receipt of this balance payment. Delay in the supplier’s performance The supplier shall deliver of the goods and perform the services under the contract within the time schedule specified by the purchaser in the List of Requirements and as incorporated in the contract. 11.5 12. Bid Currencies 12.1 Prices shall be quoted in Indian Rupees: 13.1 Pursuant to ITB Clause 9, the Bidder shall furnish, as part of its bid, documents establishing the Bidder's eligibility to bid and its qualifications to perform the Contract if its bid is accepted. 13. 13.2 13.3 Documents Establishing Bidder's Eligibility and Qualifications The documentary evidence of the Bidder's eligibility to bid shall establish to the Purchaser's satisfaction that the Bidder, at the time of submission of its bid, is from an eligible country as defined under ITB Clause 2. The documentary evidence of the Bidder's qualifications to perform the Contract if its bid is accepted, shall establish to the Purchaser's satisfaction: (a) that the Bidder has the financial, technical, and production capability necessary to perform the Contract and meets the criteria outlined in the Qualification requirements specified herein . To this end, all bid submitted shall include the following information: (i) (ii) 14. 14.1 14.2 The legal status, place of registration and principal place of business of the company or firm or partnership, etc.; Details of experience and past performance of the bidder on equipment offered and on those of similar nature within the past three years and details of current contracts in hand and other commitments (suggested proforma given ); Documents Establishing Goods' Eligibility and Conformity to Bidding Documents Pursuant to ITB Clause 9, the Bidder shall furnish, as part of its bid, documents establishing the eligibility and conformity to the bidding documents of all goods and services which the Bidder proposes to supply under the contract. The documentary evidence of the goods and services eligibility shall consist of a statement in the Price Schedule on the country of origin of the goods and services offered which shall be confirmed by a certificate of origin at the time of shipment. The documentary evidence of conformity of the goods and services to the bidding documents may be in the form of literature, drawings and data, and shall consist of a detailed description of the essential technical and performance characteristics of the goods. (a) (b) Deleted an item-by-item commentary on the Purchaser's Technical Specifications demonstrating substantial responsiveness of the goods and services to those specifications or a statement of deviations and exceptions to the provisions of the Technical Specifications. Page 8 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 For purposes of the commentary to be furnished pursuant to ITB Clause 14 (a)(b) above, the Bidder shall note that standards for workmanship, material and goods, and references to brand names or catalogue numbers designated by the Purchaser in its Technical Specifications are intended to be descriptive only and not restrictive. The Bidder may substitute alternative standards, brand names and/or catalogue numbers in its bid, provided that it demonstrates to the Purchaser's satisfaction that the substitutions ensure substantial equivalence to those designated in the Technical Specifications. 15. Bid Security 15.1 Pursuant to ITB Clause 9, the Bidder shall furnish, as part of its bid, a bid security in the amount as specified in the Schedule of Requirements. 15.2 15.3 15.4 15.5 15.7 16. 16.1 16.2 16.3 The bid security is required to protect the Purchaser against the risk of Bidder's conduct which would warrant the security's forfeiture, pursuant to ITB Clause 15.7. The bid security shall be denominated in Indian Rupees and shall at the bidder’s option, be in the form of either Call deposit, deposit, a demand draft, or a bank guarantee from a nationalized/Scheduled Bank located in India or by a reputable banking institution selected by the bidder and located abroad in any eligible country; be substantially in accordance with one of the form of bid security or other form approved by the Purchaser prior to bid submission; be submitted in its original form; copies will not be accepted; and remain valid for a period of 45 days beyond the original validity period of bid, or beyond any period of extension subsequently requested under ITB Clause 16.2. Any bid not secured in accordance with ITB Clauses 15 above will be rejected by the Purchaser as non-responsive, pursuant to ITB Clause 24 Unsuccessful bidder's bid security will be discharged/returned as promptly as possible but not later than 90 days after the expiration of the period of bid validity prescribed by the Purchaser, pursuant to ITB Clause 16.The successful Bidder's bid security will be discharged upon the Bidder signing the Contract, pursuant to ITB Clause 34, and furnishing the performance security, pursuant to ITB Clause 35 or other wise may be accepted / extended in lieu of performance security/guarantee, at the discretion of the purchaser. The bid security may be forfeited if a Bidder: withdraws its bid during the period of bid validity specified by the Bidder on the Bid Form; or does not accept the correction of errors pursuant to ITB Clause 24; or in case of a successful Bidder, if the Bidder fails: (i) To sign the Contract in accordance with ITB Clause 34; or (ii) To furnish performance security in accordance with ITB Clause 35. Period of Validity of Bid The tendered rates and the validity of bids shall be for a minimum period of one year from the date, as the tender are finalized /awarded, etendable upto 6 months or till the finalization of next tender by the Institute, whichever is earlier. A bid valid for a shorter period shall be rejected by the Purchaser as non-responsive. In exceptional circumstances, the Purchaser may solicit the Bidder's consent to an extension of the period of validity. The request and the responses thereto shall be made in writing (or by cable). The bid security provided under ITB Clause 15 shall also be suitably extended. A Bidder may refuse the request without forfeiting its bid security. A Bidder granting the request will not be required nor permitted to modify its bid, except as provided in ITB Clause 16.3. In the case of fixed prices contracts, in the event that the Purchaser requests and the Bidder agrees to an extension of the validity period, the contract price, if the Bidder is selected for award shall be the bid price corrected as follows: “ In case of fixed price contracts, if the award is delayed beyond the expiry of the initial bid validity, no adjustment will be made in contract price (i.e. same as bid price)”. 16.4 17. Bid evaluation will be based on the bid prices without taking into consideration the above corrections. 17.1 The tenderers shall submit their tenders online as per the instructions Format and Signing of Bid 17.2 The original and other copies of the tender shall either be typed or written in indelible ink and the same shall be signed by the tenderer or by a person(s) who has been duly authorized to bind the tenderer to the contract, Page 9 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 18. scanned and upload online at www.eprocure.gov.in The letter of authorization shall be by a written power of attorney, which shall also be furnished along with the tender. 18.1 19. Deleted 19.1 20. Deleted 20.1 21. Deleted 21.1 The Bidder may modify or withdraw its bid online after the bid's submission 22. Opening of Bid by the Purchaser 22.1 The purchaser will open the tenders online at the specified date and time and at the specified place as indicated in the NIT. 21.3 22.2 22.3 Sealing and Marking of Bid Deadline for Submission of Bid Late Bid Modification and Withdrawal of Bid No bid may be modified subsequent to the deadline for submission of bid. In case the specified date of tender opening falls on / is subsequently declared a holiday or closed day for the purchaser, the tenders will be opened at the appointed time and place on the next working day. Authorized representatives of the tenderers may attend the online tender opening provided they bring with them letters of authority from the corresponding tenderers. The tender opening official(s) will prepare a list of the representatives attending the tender opening. The list will contain the representatives’ names & signatures and corresponding tenderers’ names and addresses. Two - Tender system as mentioned in para 21.6 above will be as follows. The Techno - Commercial Tenders are to be opened in the first instance, at the prescribed time and date as indicated in NIT. These Tenders shall be scrutinized and evaluated by the competent committee/ authority with reference to parameters prescribed in the TE document. During the Techno - Commercial Tender opening, the tender opening official(s) will read the salient features of the tenders like brief description of the goods offered, delivery period, Earnest Money Deposit and any other special features of the tenders, as deemed fit by the tender opening official(s). Thereafter, in the second stage, the Price Tenders of only the Techno - Commercially acceptable offers (as decided in the first stage) shall be opened for further scrutiny and evaluation on a date notified after the evaluation of the Techno – Commercial tender. The prices, special discount if any of the goods offered etc., as deemed fit by tender opening official(s) will be read out. 23. Clarification of Bid 23.1 24. 24.1 24.2 During evaluation of bid, the Purchaser may, at its discretion, ask the Bidder for a clarification of its bid. The request for clarification and the response shall be in writing and no change in prices or substance of the bid shall be sought, offered or permitted. Preliminary Examination The Purchaser will examine the bid to determine whether they are complete, whether any computational errors have been made, whether required sureties have been furnished, whether the documents have been properly signed, and whether the bid are generally in order. Arithmetical errors will be rectified on the following basis. If there is a discrepancy between the unit price and the total price that is obtained by multiplying the unit price and quantity, the unit price shall prevail and the total price shall be corrected. If there is a discrepancy between words and figures, the amount in words will prevail. If the supplier does not accept the correction of errors, its bid will be rejected and its bid security may be forfeited. Page 10 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 24.3 24.4 25. 24.5 26. 26.1 The Purchaser may waive any minor informality or non-conformity or irregularity in a bid, which does not constitute a material deviation, provided such a waiver, does not prejudice or affect the relative ranking of any Bidder. Prior to the detailed evaluation, pursuant to ITB Clause 26, the Purchaser will determine the substantial responsiveness of each bid to the bidding documents. For purposes of these Clauses, a substantially responsive bid is one which conforms to all the terms and conditions of the bidding documents without material deviations. Deviations from or objections or reservations to critical provisions such as those EMD/Bid security, General Conditions of Contract, Special Conditions of Contract and Taxes & Duties will be deemed to be a material deviation. The Purchaser's determination of a bid's responsiveness is to be based on the contents of the bid itself without recourse to extrinsic evidence. Non responsive Bid If a bid is not substantially responsive, it will be rejected by the Purchaser and may not subsequently be made responsive by the Bidder by correction of the non-conformity. Evaluation and Comparison of Bid The purchaser will evaluate and compare the bid previously determined to be substantially responsive, pursuant to ITB clause 24 for each schedule separately. Bidders are allowed the option to bid for any one or more schedules or all schedules and to offer discounts for combined schedules. These discounts will be taken in to account in the evaluation of the bid so as to determine the bid or combination of bid offering the lowest evaluated cost for the purchaser in deciding award(s) for each schedule. 26.2 The Purchaser's evaluation of a bid will exclude and not take into account in the case of goods manufactured in India or goods of foreign origin already located in India, sales and other similar taxes, which will be payable on the goods if a contract is awarded to the Bidder. 26.3 Bid evaluation will not take into account any allowance for price adjustment during the period of execution of the Contract, if provided in the bid. 26.4 The Purchaser's evaluation of a bid will take into account, in addition to the bid price (Ex-factory/exwarehouse/off-the-shelf price of the goods offered from within India, such price to include all costs as well as duties and taxes paid or payable on components and raw material incorporated or to be incorporated in the goods, and Excise duty on the finished goods, if payable) and price of incidental services, the following factors, in the manner and to the extent indicated in ITB Clause 26.5 and in the Technical Specifications: (a) (b) (c) 26.5 (d) cost of inland transportation, insurance and other costs within India incidental to the delivery of the goods to their final destination; Delivery schedule offered in the bid; Deviation in payment schedule from that specified in the Special Conditions of Contract; Onsite replacement warranty for a period of one year after supply/installation. Pursuant to ITB Clause 26.4, following evaluation methods will be applied: (a) Inland Transportation, ex-factory/from port-of-entry, Insurance and Incidentals: (b) Delivery Schedule: (i) (i) Inland transportation, insurance and other incidentals for delivery of goods to the final destination as stated in ITB Clause 11. The above costs will be added to the bid price. The Purchaser requires that the goods under the Invitation for Bid shall be delivered at the time specified in the Schedule of Requirements. The estimated time of arrival of the goods at the project site should be calculated for each bid after allowing for reasonable transportation time. Treating the bid offering the scheduled time of arrival as the base, a delivery "adjustment" will be calculated for other bid at 0.5% of the ex-factory price including excise duty for each week of part thereof of delay beyond the base and this will be added to the bid price for evaluation. No credit will be given to earlier deliveries and bid offering delivery beyond 60 (sixty days) of stipulated delivery period will be treated as non-responsive. Page 11 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 (c) 28. 28.1 28.2 29. 29.1 29.2 29.3 30. 30.1 31. 31.1 32. 32.1 33. 33.1 33.2 33.3 33.4 34. (d) The Special Conditions of Contract stipulate the payment schedule offered by the Purchaser. If a bid deviate the schedule and if such deviation is considered acceptable to the Purchaser, the bid will be evaluated by calculating interest earned for any earlier payments involved in the terms outlined in the bid as compared to those stipulated in this invitation, at a rate of 10 percent per annum. Deleted Contacting the Purchaser Subject to ITB Clause 23, no Bidder shall contact the Purchaser on any matter relating to its bid, from the time of the bid opening to the time the Contract is awarded. If the bidder wishes to bring additional information to the notice of the purchaser, it should do so in writing. Any effort by a Bidder to influence the Purchaser in its decisions on bid evaluation, bid comparison or contract award may result in rejection of the Bidder's bid. Post-qualification In the absence of pre-qualification, the Purchaser will determine to its satisfaction whether the Bidder that is selected as having submitted the lowest evaluated responsive bid meets the criteria specified in ITB Clause 13.3 and is qualified to perform the contract satisfactorily. The determination will take into account the Bidder's financial, technical and production capabilities. It will be based upon an examination of the documentary evidence of the Bidder's qualifications submitted by the Bidder, pursuant to ITB Clause 13, as well as such other information as the Purchaser deems necessary and appropriate. An affirmative determination will be a prerequisite for award of the Contract to the Bidder. Award Criteria Subject to ITB Clause 32, the Purchaser will award the Contract to the successful Bidder whose bid has been determined to be substantially responsive, has been determined as the lowest evaluated bid, provided further that the Bidder is determined to be qualified to perform the Contract satisfactorily. Purchaser's right to vary Quantities at Time of Award The Purchaser reserves the right at the time of Contract award to increase or decrease the quantity of goods and services originally specified in the Schedule of Requirements without any change in unit price or other terms and conditions. Purchaser's Right to Accept Any Bid and to Reject Any or All Bid The Purchaser reserves the right to accept or reject any bid, and to annul the bidding process and reject all bid at any time prior to award of Contract, without thereby incurring any liability to the affected Bidder or bidders or any obligation to inform the affected Bidder or bidders. Notification of Award Prior to the expiration of the period of bid validity, the Purchaser will notify the successful bidder in writing by registered letter or by cable or telex or fax, to be confirmed in writing by registered letter, that its bid has been accepted. The notification of award will constitute the formation of the Contract. Upon the successful Bidder's furnishing of performance security or otherwise decided pursuant to ITB Clause 35, the Purchaser will promptly notify each unsuccessful Bidder and will discharge its bid security, pursuant to ITB Clause 15. If, after notification of award, a Bidder wishes to ascertain the grounds on which its bid was not selected, it should address its request to the Purchaser. The Purchaser will promptly respond in writing to the unsuccessful Bidder. Signing of Contract Page 12 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 34.1 34.2 35. 35.1 35.2 36 36.1 At the same time as the Purchaser notifies the successful bidder that its bid has been accepted the Purchaser will send the bidder the Contract Form provided in the bidding documents, incorporating all agreements between the parties. Within 15 days of receipt of the Contract Form, the successful bidder shall sign and date the Contract and return it to the Purchaser. Performance Security Within 15 days of the receipt of notification of award from the Purchaser, the successful Bidder shall furnish the performance security in accordance with the Conditions of Contract, in the Performance Security Form provided in the bidding documents or in another form acceptable to the Purchaser. Failure of the successful bidder to comply with the requirement of ITB Clause 34.2 or ITB Clause 35.1 shall constitute sufficient grounds for the annulment of the award and forfeiture of the bid security, in which event the Purchaser may make the award to the next lowest evaluated bidder or call for new bid. Corrupt or Fraudulent Practices The Bank requires that Borrowers (including beneficiaries of Bank loans), as well as Bidders, Suppliers, Contractors, and Consultants under Bank-financed contracts, observe the highest standard of ethics during the procurement and execution of such contracts. In pursuit of this policy, the Bank: (a) defines, for the purposes of this provision, the terms set forth below as follows: (i) (ii) (iii) (iv) (b) (c) (d) (e) 36.2 “corrupt practice” means the offering, giving, receiving, or soliciting, directly or indirectly, of anything of value to influence the action of a public official in the procurement process or in contract execution; “fraudulent practice” means a misrepresentation or omission of facts in order to influence a procurement process or the execution of a contract; “collusive practice” means a scheme or arrangement between two or more Bidders, with or without the knowledge of the borrower, designed to establish bid prices at artificial, non competitive levels; and “coercive practice” means harming or threatening to harm, directly or indirectly, persons or their property to influence their participation in the procurement process or affect the execution of a contract; will reject a proposal for award if it determines that the Bidder recommended for award has, directly or through an agent, engaged in corrupt, fraudulent, collusive or coercive practices in competing for the Contract in question; will cancel the portion of the loan allocated to a contract if it determines at any time that representatives of the Borrower or of a beneficiary of the loan engaged in corrupt, fraudulent, collusive or coercive practices during the procurement or the execution of that contract, without the Borrower having taken timely and appropriate action satisfactory to the Bank to remedy the situation; will sanction a firm or individual, including declaring them ineligible, either indefinitely or for a stated period of time, to be awarded a Bank-financed contract if it at any time determines that they have, directly or through an agent, engaged, in corrupt, fraudulent, collusive or coercive practices in competing for, or in executing, a Bank-financed contract; and will have the right to require that a provision be included in Bidding Documents and in contracts financed by a Bank loan, requiring Bidders, Suppliers, Contractors and Consultants to permit the Bank to inspect their accounts and records and other documents relating to the bid submission and contract performance and to have them audited by auditors appointed by the Bank. Furthermore, Bidders shall be aware of the provisions stated in the General Conditions of Contract. Page 13 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 SECTION III: GENERAL CONDITIONS OF CONTRACT 1. Definitions 1.1 In this Contract, the following terms shall be interpreted as indicated: (a) "The Contract" means the agreement entered into between the Purchaser and the Supplier, as recorded in the Contract Form signed by the parties, including all the attachments and appendices thereto and all documents incorporated by reference therein; (b) "The Contract Price" means the price payable to the Supplier under the Contract for the full and proper performance of its contractual obligations; (c) "The Goods" means all the equipment, machinery, and/or other materials, which the Supplier is required to supply to the Purchaser under the Contract; (d) "Services" means services ancillary to the supply of the Goods, such as transportation and insurance, and any other incidental services, such as installation, commissioning, provision of technical assistance, training and other obligations of the Supplier covered under the Contract; (e) “GCC” means the General Conditions of Contract contained in this section. (f) “SCC” means the Special Conditions of Contract. (g) “The Purchaser” means the organization purchasing the Goods, as named in SCC. (h) “The Purchaser’s country” is the country named in SCC. (i) (j) “The Supplier” means the individual or firm supplying the Goods and Services under this Contract. “Shillong” means the state capital of the State of Meghalaya in India. (k) “The Project Site”, where applicable, means the place or places named in SCC. 2. 2.1 3. 3.1 3.2 (l) “Day” means calendar day. Application These General Conditions shall apply to the extent that provisions in other parts of the Contract do not supersede them. Country of Origin All Goods and Services supplied under the Contract shall have their origin in the member countries and territories eligible under the rules of the World Bank as further elaborated in SCC. For purposes of this Clause "origin" means the place where the Goods are mined, grown or produced, or from which the Services are supplied. Goods are produced when, through manufacturing, processing or substantial and major assembling of components, a commercially recognized new product results that is substantially different in basic characteristics or in purpose or utility from its components. 3.3 The origin of Goods and Services is distinct from the nationality of the Supplier. 4.1 The Goods supplied under this Contract shall conform to the standards mentioned in the Technical Specifications, and, when no applicable standard is mentioned, to the authoritative standard appropriate to the Goods' country of origin and such standards shall be the latest issued by the concerned institution. 4. 5. Standards Use of Contract Documents and Information Page 14 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 5.1 5.2 5.3 6. 6.1 7. 7.1 7.2 7.3 The Supplier shall not, without the Purchaser's prior written consent, disclose the Contract, or any provision thereof, or any specification, plan, drawing, pattern, sample/specimen or information furnished by or on behalf of the Purchaser in connection therewith, to any person other than a person employed by the Supplier in performance of the Contract. Disclosure to any such employed person shall be made in confidence and shall extend only so far as may be necessary for purposes of such performance. The Supplier shall not, without the Purchaser's prior written consent, make use of any document or information enumerated in GCC Clause 5.1 except for purposes of performing the Contract. Any document, other than the Contract itself, enumerated in GCC Clause 5.1 shall remain the property of the Purchaser and shall be returned (in all copies) to the Purchaser on completion of the Supplier's performance under the Contract if so required by the Purchaser. Patent Rights The Supplier shall indemnify the Purchaser against all third-party claims of infringement of patent, trademark or industrial design rights arising from use of the Goods or any part thereof in India. Performance Security Within 15 days of receipt of the notification of contract award, the Supplier shall furnish performance security in the amount specified in SCC. The proceeds of the performance security shall be payable to the Purchaser as compensation for any loss resulting from the Supplier's failure to complete its obligations under the Contract. The Performance Security shall be denominated in Indian Rupees and shall be in one of the following forms: (a) A Bank guarantee, Call deposit or irrevocable Letter of Credit, issued by a nationalized/scheduled bank located in India or a bank located abroad acceptable to the Purchaser, in the form provided in the bidding documents or another form acceptable to the Purchaser; or (b) A cashier's cheque, or demand draft. 7.4 The performance security will be discharged by the Purchaser and returned to the Supplier not later than 45 days following the date of completion of the Supplier's performance obligations, including any warranty obligations, unless specified otherwise in SCC. 8. Inspections and Tests 8.1 The Purchaser or its representative shall have the right to inspect and/or to test the Goods to confirm their conformity to the Contract specifications at no extra cost to the Purchaser. SCC and the Technical Specifications shall specify what inspections and tests the Purchaser requires and where they are to be conducted. The Purchaser shall notify the Supplier in writing in a timely manner of the identity of any representatives retained for these purposes. 8.2 8.3 8.4 8.5 9. The inspections and tests may be conducted on the premises of the Supplier or its subcontractor(s), at point of delivery and/or at the Goods final destination. If conducted on the premises of the Supplier or its subcontractor(s), all-reasonable facilities and assistance, including access to drawings and production data - shall be furnished to the inspectors at no charge to the Purchaser. Should any inspected or tested Goods fail to conform to the specifications, the Purchaser may reject the goods and the Supplier shall either replace the rejected Goods or make alterations necessary to meet specification requirements free of cost to the Purchaser. The Purchaser's right to inspect, test and, where necessary, reject the Goods after the Goods' arrival at Project Site shall in no way be limited or waived by reason of the Goods having previously been inspected, tested and passed by the Purchaser or its representative prior to the Goods shipment. Nothing in GCC Clause 8 shall in any way release the Supplier from any warranty or other obligations under this Contract. Packing Page 15 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 9.1 9.2 10. The Supplier shall provide such packing of the Goods as is required to prevent their damage or deterioration during transit to their final destination as indicated in the Contract. The packing shall be sufficient to withstand, without limitation, rough handling during transit and exposure to extreme temperatures, salt and precipitation during transit and open storage. Packing case size and weights shall take into consideration, where appropriate, the remoteness of the Goods' final destination and the absence of heavy handling facilities at all points in transit. The packing, marking and documentation within and outside the packages shall comply strictly with such special requirements as shall be provided for in the Contract including additional requirements, if any, specified in SCC and in any subsequent instructions ordered by the Purchaser. Delivery and Documents 10.1 Delivery of the Goods shall be made by the Supplier in accordance with the terms specified by the Purchaser in the SCC & Notification of Award. The details of shipping and/or other documents to be furnished by the supplier are specified in SCC. 10.2 10.3 11. For purposes of the Contract, “EXW”, “FOB”, “FCA”, “CIF”, “CIP”, and other trade terms used to describe the obligations of the parties shall have the meanings assigned to them by the current edition of Incoterms published by the International Chamber of Commerce, Paris. Documents to be submitted by the Supplier are specified in SCC. Insurance 11.1 The Goods supplied under the Contract shall be fully insured in Indian Rupees against loss or damage incidental to manufacture or acquisition, transportation, storage and delivery in the manner specified in SCC. 12. Transportation 12.1 Where the Supplier is required under the Contract to transport the Goods to a specified place of destination within India defined as Project site, transport to such place of destination in India including insurance, as shall be specified in the Contract, shall be arranged by the Supplier, and the related cost shall be included in the Contract Price. 13. Incidental Services 13.1 The supplier may be required to provide any or all of the following services, including additional services, if any, specified in SCC: (a) Performance or supervision of the on-site assembly and/or start-up of the supplied Goods; (b) Furnishing of tools required for assembly and/or maintenance of the supplied Goods; (c) Furnishing of detailed operations and maintenance manual for each appropriate unit of supplied Goods; (d) Performance or supervision or maintenance and/or repair of the supplied Goods, for a period of time agreed by the parties, provided that this service shall not relieve the Supplier of any warranty obligations under this Contract; and (e) training of the Purchaser's personnel, at the Supplier's plant and/or on-site, in assembly, start-up, operation, maintenance and/or repair of the supplied Goods. 13.2 Prices charged by the Supplier for incidental services, if not included in the Contract Price for the Goods, shall be agreed upon in advance by the parties and shall not exceed the prevailing rates charged for other parties by the Supplier for similar services. 14. Spare Parts 14.1 As specified in the SCC, the Supplier may be required to provide any or all of the following materials, notifications, and information pertaining to spare parts manufactured or distributed by the Supplier: (a) such spare parts as the Purchaser may elect to purchase from the Supplier, providing that this election shall not relieve the Supplier of any warranty obligations under the Contract; and (b) In the event of termination of production of the spare parts: Page 16 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 (i) (ii) 15. Warranty advance notification to the Purchaser of the pending termination, in sufficient time to permit the Purchaser to procure needed requirements; and following such termination, furnishing at no cost to the Purchaser, the blueprints, drawings and specifications of the spare parts, if requested. 15.1 The Supplier warrants that the Goods supplied under this Contract are new, unused, of the most recent or current models and that they incorporate all recent improvements in design and materials unless provided otherwise in the Contract. The Supplier further warrants that all Goods supplied under this Contract shall have no defect arising from design, materials or workmanship (except when the design and/or material is required by the Purchaser's Specifications) or from any act or omission of the Supplier, that may develop under normal use of the supplied Goods in the conditions prevailing in the country of final destination. 15.2 This warranty shall have minimum validity of 12 months after the Goods or any portion thereof as the case may be, have been delivered to and accepted at the final destination indicated in the Contract, or for 18 months after the date of shipment from the place of loading whichever period concludes earlier, unless specified otherwise in the SCC. 15.3 The Purchaser shall promptly notify the Supplier in writing of any claims arising under this warranty. 15.4 Upon receipt of such notice, the Supplier shall, within the period specified in SCC and with all reasonable speed, repair or replace the defective Goods or parts thereof, without cost to the Purchaser other than, where applicable, the cost of inland delivery of the repaired or replaced Goods or parts from ex-works or ex-factory or ex-showroom to the final destination. 15.5 If the Supplier, having been notified, fails to remedy the defect(s) within the period specified in SCC within a reasonable period, the Purchaser may proceed to take such remedial action as may be necessary, at the Supplier's risk and expense and without prejudice to any other rights which the Purchaser may have against the Supplier under the Contract. 16. Payment 16.1 The method and conditions of payment to be made to the Supplier under this Contract shall be specified in the SCC. 16.2 The Supplier's request(s) for payment shall be made to the Purchaser in writing, accompanied by an invoice describing, as appropriate, the Goods delivered and the Services performed, and by documents, submitted pursuant to GCC Clause 10, and upon fulfillment of other obligations stipulated in the contract. 16.3 The Supplier shall make promptly remit payments after submission of the invoice and other related documents. 16.4 Payment shall be made in Indian Rupees. 17. Prices 17.1 Prices charged by the Supplier for Goods delivered and Services performed under the Contract shall not vary from the prices quoted by the Supplier in its bid, with the exception of any price adjustments authorized in SCC or in the Purchaser’s request for bid validity extension, as the case may be. 18. Change Orders 18.1 The Purchaser may at any time, by written order given to the Supplier pursuant to GCC Clause 31, make changes within the general scope of the Contract in any one or more of the following: (a) Drawings, designs, or specifications, where Goods to be furnished under the Contract are to be specifically manufactured for the Purchaser; (b) The method of shipping or packing; (c) The place of delivery; and/or (d) The Services to be provided by the Supplier. Page 17 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 18.2 If any such change causes an increase or decrease in the cost of, or the time required for, the Supplier's performance of any provisions under the Contract, an equitable adjustment shall be made in the Contract Price or delivery schedule, or both, and the Contract shall accordingly be amended. Any claims by the Supplier for adjustment under this clause must be asserted within thirty (30) days from the date of the Supplier's receipt of the Purchaser's change order. 19. Contract Amendments 19.1 Subject to GCC Clause 18, no variation in or modification of the terms of the Contract shall be made except by written amendment signed by the parties. 20. Assignment 20.1 The Supplier shall not assign, in whole or in part, its obligations to perform under the Contract, except with the Purchaser's prior written consent. 21. Subcontracts 21.1 The Supplier shall notify the Purchaser in writing of all subcontracts awarded under this Contract if not already specified in the bid. Such notification, in his original bid or later, shall not relieve the Supplier from any liability or obligation under the Contract. 21.2 Subcontracts must comply with the provisions of GCC Clause 3. 22. Delays in the Supplier's Performance 22.1 Delivery of the Goods and performance of the Services shall be made by the Supplier in accordance with the time schedule specified by the Purchaser in the Schedule of Requirements. 22.2 If at any time during performance of the Contract, the Supplier or its sub-contractor(s) should encounter conditions impeding timely delivery of the Goods and performance of Services, the Supplier shall promptly notify the Purchaser in writing of the fact of the delay, its likely duration and its cause(s). As soon as practicable after receipt of the Supplier’s notice, the Purchaser shall evaluate the situation and may, at its discretion, extend the Supplier’s time for performance with or without liquidated damages, in which case the extension shall be ratified by the parties by amendment of the Contract. 22.3 Except as provided under GCC Clause 25, a delay by the Supplier in the performance of its delivery obligations shall render the Supplier liable to the imposition of liquidated damages pursuant to GCC Clause 23, unless an extension of time is agreed upon pursuant to GCC Clause 22.2 without the application of liquidated damages. 23. Liquidated Damages 23.1 Subject to GCC Clause 25, if the Supplier fails to deliver any or all of the Goods or to perform the Services within the period(s) specified in the Contract, the Purchaser shall, without prejudice to its other remedies under the Contract, deduct from the Contract Price, as liquidated damages, a sum equivalent to the percentage specified in SCC of the delivered price of the delayed Goods or unperformed Services for each week or part thereof of delay until actual delivery or performance, up to a maximum deduction of the Percentage specified in SCC. Once the maximum is reached, the Purchaser may consider termination of the Contract pursuant to GCC Clause 24. 24. Termination for Default 24.1 The Purchaser may, without prejudice to any other remedy for breach of contract, by written notice of default sent to the Supplier, terminate the Contract in whole or part: (a) if the Supplier fails to deliver any or all of the Goods within the period(s) specified in the Contract, or within any extension thereof granted by the Purchaser pursuant to GCC Clause 22; or (b) If the Supplier fails to perform any other obligation(s) under the Contract. (c) If the Supplier, in the judgment of the Purchaser has engaged in corrupt or fraudulent practices in competing for or in executing the Contract. For the purpose of this Clause: Page 18 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 “Corrupt practice” means the offering, giving, receiving or soliciting of any thing of value to influence the action of a public official in the procurement process or in contract execution. “Fraudulent practice” means a misrepresentation of facts in order to influence a procurement process or the execution of a contract to the detriment of the Borrower, and includes collusive practice among Bidders (prior to or after bid submission) designed to establish bid prices at artificial non-competitive levels and to deprive the Borrower of the benefits of free and open competition. 24.2 In the event the Purchaser terminates the Contract in whole or in part, pursuant to GCC Clause 24.1, the Purchaser may procure, upon such terms and in such manner as it deems appropriate, Goods or Services similar to those undelivered, and the Supplier shall be liable to the Purchaser for any excess costs for such similar Goods or Services. However, the Supplier shall continue the performance of the Contract to the extent not terminated. 25. Force Majeure 25.1 Notwithstanding the provisions of GCC Clauses 22, 23, 24, the Supplier shall not be liable for forfeiture of its performance security, liquidated damages or termination for default, if and to the extent that, its delay in performance or other failure to perform its obligations under the Contract is the result of an event of Force Majeure. 25.2 For purposes of this Clause, "Force Majeure" means an event beyond the control of the Supplier and not involving the Supplier's fault or negligence and not foreseeable. Such events may include, but are not limited to, acts of the Purchaser either in its sovereign or contractual capacity, wars or revolutions, fires, floods, epidemics, quarantine restrictions and freight embargoes. 25.3 If a Force Majeure situation arises, the Supplier shall promptly notify the Purchaser in writing of such conditions and the cause thereof. Unless otherwise directed by the Purchaser in writing, the Supplier shall continue to perform its obligations under the Contract as far as is reasonably practical, and shall seek all reasonable alternative means for performance not prevented by the Force Majeure event. 26. Termination for Insolvency 26.1 The Purchaser may at any time terminate the Contract by giving written notice to the Supplier, if the Supplier becomes bankrupt or otherwise insolvent. In this event, termination will be without compensation to the Supplier, provided that such termination will not prejudice or affect any right of action or remedy which has accrued or will accrue thereafter to the Purchaser. 27. Termination for Convenience 27.1 The Purchaser, by written notice sent to the Supplier, may terminate the Contract, in whole or in part, at any time for its convenience. The notice of termination shall specify that termination is for the Purchaser's convenience, the extent to which performance of the Supplier under the Contract is terminated, and the date upon which such termination becomes effective. 27.2 The Goods that are complete and ready for shipment within 30 days after the Purchaser shall accept the Supplier’s receipt of notice of termination at the Contract terms and prices. For the remaining Goods, the Purchaser may elect: (a) To have any portion completed and delivered at the Contract terms and prices; and/or 28. 28.1 28.2 28.3 (b) To cancel the remainder and pay to the Supplier an agreed amount for partially completed Goods and for materials and parts previously procured by the Supplier. Settlement of Disputes If any dispute or difference of any kind whatsoever shall arise between the Purchaser and the Supplier in connection with or arising out of the Contract, the parties shall make every effort to resolve amicably such dispute or difference by mutual consultation. If, after thirty (30) days, the parties have failed to resolve their dispute or difference by such mutual consultation, then either the Purchaser or the Supplier may give notice to the other party of its intention to commence arbitration, as hereinafter provided, as to the matter in dispute, and no arbitration in respect of this matter may be commenced unless such notice is given. Any dispute or difference in respect of which a notice of intention to commence arbitration has given in accordance with this Clause shall be finally settled by arbitration. Arbitration may be commenced prior to or after delivery of the Goods under the Contract. Page 19 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 28.4 29. 29.1 Arbitration proceedings shall be conducted in accordance with the rules of procedure specified in the SCC. Notwithstanding any reference to arbitration herein, the parties shall continue to perform their respective obligations under the Contract unless they otherwise agree; and the purchaser shall pay the Supplier any monies due the Supplier. Limitation of Liability Except in case of criminal negligence or willful misconduct, and in the case of infringement pursuant to Clause 6,the supplier shall not be liable to the Purchaser, whether in contract, tort, or otherwise, for any indirect or consequential, loss or damage, loss of use, loss of production, or loss of profit or interest costs, provided that this exclusion shall not apply to any obligation of the Supplier to pay liquidated damages to the Purchaser and the aggregate liability of the Supplier to the Purchaser, whether under the Contract, in tort or otherwise, shall not exceed the total Contract Price, provided that this limitation shall not apply to the cost of repairing or replacing defective equipment. 30. Governing Language 30.1 The contract shall be written in the language specified in ITB/SCC. Subject to GCC Clause 30, the version of the Contract written in the specified language shall govern its interpretation. All correspondence and documents pertaining to the Contract which are exchanged by the parties shall be written in that same language. 31. Applicable Law 31.1 The Contract shall be interpreted in accordance with the laws of the Union of India. 32. Notices 32.1 Any notice given by one party to the other pursuant to this Contract shall be sent to other party in writing or by cable, telex or facsimile and confirmed in writing to the other Party’s address specified in SCC. 32.2 A notice shall be effective when delivered or on the notice's effective date, whichever is later. 33 Taxes and Duties 33.1 Suppliers shall be entirely responsible for all taxes, duties, license fees, octroi, road permits, etc., incurred until delivery of the contracted Goods to the Purchaser. 34. Fraud and Corruption 34.1 The Bank requires that Borrowers (including beneficiaries of Bank loans), as well as Bidders, Suppliers, Contractors, and Consultants under Bank-financed contracts, observe the highest standard of ethics during the procurement and execution of such contracts. In pursuit of this policy, the Bank: (a) Defines, for the purposes of this provision, the terms set forth below as follows: (i) (ii) (iii) (iv) (b) “corrupt practice” means the offering, giving, receiving, or soliciting, directly or indirectly, of anything of value to influence the action of a public official in the procurement process or in contract execution; “fraudulent practice” means a misrepresentation or omission of facts in order to influence a procurement process or the execution of a contract; “collusive practice” means a scheme or arrangement between two or more Bidders, with or without the knowledge of the borrower, designed to establish bid prices at artificial, non competitive levels; and “coercive practice” means harming or threatening to harm, directly or indirectly, persons or their property to influence their participation in the procurement process or affect the execution of a contract; will cancel the portion of the loan allocated to a contract if it determines at any time that representatives of the Borrower or of a beneficiary of the loan engaged in corrupt, fraudulent, collusive or coercive practices during the procurement or the execution of that contract, without the Borrower having taken timely and appropriate action satisfactory to the Bank to remedy the situation; Page 20 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 (c) (d) will sanction a firm or individual, including declaring them ineligible, either indefinitely or for a stated period of time, to be awarded a Bank-financed contract if it at any time determines that they have, directly or through an agent, engaged, in corrupt, fraudulent, collusive or coercive practices in competing for, or in executing, a Bank-financed contract; and will have the right to require that Suppliers to permit the Bank to inspect their accounts and records and other documents relating to the bid submission and contract performance and to have them audited by auditors appointed by the Bank. Page 21 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 SECTION IV: SPECIAL CONDITIONS OF CONTRACT 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. On receipt of bidder orders and after supply, Bills shall be submitted in Quadruplicate along with a receipted copy of challan/stores receipt note duly endorsed in the desk of the Security Officer in this Institute. Installation, demonstration, operational techniques and associated services, if any, to be provided by the supplier/vendor/bidder within the cost indicated. The bidders/ representatives who are present in the opening shall sign evidencing their attendance. The Price/Financial bid of the bidders whose bid is found technically suitable (after the selection of samples, if any) only will be opened. The decision of the committee on technical suitability shall be final and shall not be opened for discussion. Every bidder must go through the terms and conditions of bid carefully and understand them before submitting the Bid. No excuse that the conditions have not been read or understood will be entertained later. Orders will be placed with the selected bid parties and payment will be made to them directly. In case the selected company wants to supply and raise the bill through their authorized distributor, the name and address should be given while submitting the bid itself. Each supply and batch should be accompanied with photocopy of quality certificate from Government approved stores testing laboratory. Samples for testing the stores should have been collected by the stores testing laboratory. Rates (separately mention the CST/ST/VAT and its percentage) should be quoted in the BOQ separately for each item. The Percentage of Excise Duty may also be mentioned under Post Script. The rate mentioned in words will be taken while finalizing the bid. Hence, special care should be taken to write the rates in figures as well as in words in such a way that interpolation is not possible. The total amount should be written before the figures and “Ps" after the decimal figures (for eg. Rs.2.15Ps) and in the case words ‘Paise” should be written at the end. Unless the rate is in whole rupees and followed by the word only, it should invariably be upto two decimal places. Rates (separately mentioning the VAT/ Sales Tax) should be quoted separately for each item according to the unit asked. The contract rates should include charge for the door delivers of the goods at the Stores/Department, NEIGRIHMS Hospital. Bid not stipulating period of delivery with price variation clause and merely indicating that items will be supplied at present market rates and subject to prior sale conditions are liable to be rejected. Bidders are requested to retain a copy of the Bid Schedule indicating the rates offered by them for various items in the Schedule. Every correction in the Bid should invariably be initiated by the Bidders, failing which the Bid will be liable to be rejected. No Bidder shall be allowed at any time and on any ground whatsoever, any claim for revision or modification of the rate quoted by them during the contract period. The prices quoted by the Bidder shall not, if any case, exceed the controlled price, if any, fixed by the Govt. at the time of the supply of the articles to the Institute. If the price quoted is found to be in excess of the controlled price permissible under the Hoarding and Profiteering Prevention Ordinance. 1943 as amended from time to time, the bidder will specifically mention this fact in his bid along with reasons for having quoted such higher price. This discretion will be exercised without prejudice to any other action that may be taken against the Bidder. No interest will be allowed in this Deposit. Bid not accompanied by the Earnest Money Deposit in the form specified above will not be considered. The bidder which fails to honour the supply order for two or more times in the bid period, the EMD of the bidder will be forfeited. In addition to the recovery of Risk Purchase involved for the above purchase. Further, the bidder will also be blacklisted for 3 years to trade with this institute. The quantities mentioned in the bid schedule may be increased or decreased at the discretion of the Director. The bidder shall also execute an agreement within seven days from the date of receipt of communication for the due fulfillment of the contract within the contract period in the letter of acceptance. The bidder shall have to pay the expenses for the execution of the agreement. Failure to execute the agreement within the contract period on the part of the successful bidder or withdrawal of his bid after the intimation of acceptance of bid has been sent to him or failure to comply with the contract owing to any other reason will entail cancellation of his contract. The Earnest Money Deposit paid by him along with his bid will be forfeited and the bidder will also be liable for all damages sustained by the Director, by reason of such breach and ultimately paid by the Director for the items purchased at the current Market Rate. Such damages shall be assessed by the Director whose decision is final and the amount so assessed is recoverable. In the event of such amounts being insufficient, the balance may be recovered personally from the bidder from his properties. The EMD/Security deposit shall be refunded to the bidder within three months after the expiry of the contract but in the event of any dispute arising between the Institute and the Bidder, the Director shall be entitled to deduct out of the deposits or the balance thereof until such dispute is determined, the amount of such damages, costs, charges and expenses as may be claimed. Page 22 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 18. Stores etc. supplied to the Institute should be good quality and the decision of the Director in this regard is final and binding on the Bidder. If the Drug/accessories quality is not satisfactory and they do not meet the requirements, the same will be rejected and has to be removed by the Bidder or by the Bidder from the Institute immediately after receipt of intimation at their own expenses. 19. The Director will be at liberty to terminate, without assigning any reason contract either wholly or in part on one month’s Notice. The bidder will not entitled to any compensation whatsoever in respect of such termination. The contracts shall also be renewed for a further period beyond the contract time in cases where such renewal is necessary. 20. The Successful Bidder may not sublet without the permission of Director. 21. In case any difference of dispute arises in connection with this contract, all legal proceedings relating to the matter, shall be instituted in the courts in Shillong, within whose jurisdiction, the purchasing officers voluntarily resides. 22. Any attempt on the part of the Bidders or their agents to influence the department in their favour by personal canvassing with the officers concerned will disqualify the bid. 23. SELECTION OF BID WOULD VERY MUCH DEPEND UPON THE LOWEST RATE. (INCLUDING THE TAX) (VAT/ST OR CST) EFFICACY AND QUALITY OF THE PRODUCTS OFFERED SAMPLES SHOULD THEREFORE BE SUBMITTED FOR THE ITEMS CALLED FOR BY THE DIRECTOR AT THEIR OWN COST FAILURE TO SUBMIT SAMPLES WILL LEAD TO REJECTION OF BID. 24. Prices quoted should be inclusive of all charges like packing, forwarding and duties, cess etc. (separately mentioning the Sales Tax), which are or may become payable by the bidder under existing or future laws or rules of the country of origin/supply of delivery during the course of execution of the contract. The Bidder will invariably furnish the following certificate with their bills for payment. “Certified that the goods on which Sales Tax have been charged have not been exempted from the Central Sales Tax Act or the State Sales Tax Act and or the rules made there-under and that the amount charged on account of Sales Tax on these goods are correct under the provision of relevant act or the rules made there under; ”Certified that we___________________________________________________________ are registered under Central Registration No._____________________________________ for purpose of Sales Tax. 25. All Stores, Chemical should conbidder to the standard required. I.P. denotes Indian Pharmacopoeia B.P. denotes British Pharmacopoeia, INF denotes Indian national Formulary. The stores should also comply with the standards required under rule 124 of the Stores Act 1945. Minimum content of active ingredients should not be less than the labeled amount at the time of delivery of stores. 26. In case of Stores with life: a. Stock should be supplied to this Institute from the latest batch and such a stock should have a minimum life period of two years, depending upon the normal potency prescribed thereof. b. In the event of such stores not being utilized within their life period, the bidder should undertake to replace the unexpended stock by fresh stock without any extra cost. c. Bidders should clearly mention the Brand name of the stores, etc., offered by them in their bid.The composition of the formulations, wherever possible should be furnished. 27. The contract shall remain in force for a period of one year and may be extended, if necessary at the discretion of the competent authority. 28. The Bidder will invariably inscribe/stamp on each supply pack “NEIGRIHMS SUPPLY” – “NOT FOR SALE/ RESALE OR EXCHANGE” along with Batch No., Manufacturing Date & Expiry Date of Stores. 29. Colour photographs of both sides of the tablets/capsules/drug and strips may be asked for by the Director, NEIGRIHMS or his authorized representative. 30. If the strip and tablets are not visibly different in color, size and shape from the other tablets/capsules quoted by the bidder, the bidder may not be selected, even if this price is lowest. Hence bidders are requested to make sure the tablets/capsules do not physically reassemble each other. 31. All I.V. fluids & eye/ear drops unless otherwise indicated should be supplied in FFS technology. The bottles should be well packed in sturdy boxes to withstand stacking. If packing is not satisfactory and the cardboard boxes flimsy, the supply will be rejected. Proper maintenance of the cold chain during transport is essential. Packages received without proper cool packs and whose temperature is not within stipulated range will be rejected. 32. Settlement of disputes – Director, NEIGRIHMS or his authorized representative shall be the final authority in all disputes and decision will be binding on all concerned. 33. NEIGRIHMS reserves all rights to make any changes in terms and conditions of the bid and also to reject any or all bid without assigning any reason thereof. Deleted 34. Covering letter in the prescribed format (Ref: Annexure-I-A) All bid must accompanied by Bid Security /Earnest Money deposit (EMD) of an amount for each schedule as shown in the list of items, in the form of Call Deposit/Demand Draft in favour of Deputy Director (Admnistration), NEIGRIHMS, Shillong. EMD submitted in any other form or bid without EMD shall not be accepted. Page 23 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 The EMD of the successful bidder shall be retained till completion of the bid period but shall not carry any interest. If the successful bidder fails to execute the agreement and / or fails to deposit the performance security within the specified time, or withdraws his bid within the validity period of the bid, the EMD shall be forfeited. Duly attested photocopies of valid manufacturing license for the products offered. Declaration on details of manufacturing/trading unit, installed capacity of the item quoted, testing facilities and nearest after sales service facility with details of technical personnel, along with non – conviction certificate / declaration for the past 3 years. (Refer Annexure I) Details of supplies made during the last 3 years with summary of Purchase Orders and performance certificates issued by clients in the specific format (Refer Annexure II). Items supplied to Govt. institutions and other institutions etc., if any for the last 3 years with copies of Supply Order/Purchase Order and Performance certificates are to be separately highlighted. Annual Turnover Statement for the last 3 financial year with statement of concurrent commitment in the tentatively specified format (Refer Annexure III) certified by the Auditor / Chartered Accountant/ Gazetted Officer. Current & Valid Sales Tax Clearance Certificate / VAT Certificate .Authorization like Power of Attorney or Resolution of the Board for the officer of the company who has signed the bid document and the bid. Undertaking in the form at Annexure IV confirming acceptance of all terms and conditions of the bid including special condition. An undertaking on fraud and corruption as per Annexure V. Authorization from the manufacturer/Importer for the items quoted in Annexure VI. Catalogue, literature and schematic diagrams (where applicable) of all the equipment being offered. The list of items quoted shall be furnished in Annexure VII. The list shall specifically indicate the make / model no., manufacturer and brand name (if any) along with technical specifications. In the technical bid, the bidder shall confirm that, in case he becomes the successful bidder he shall abide by the following stipulations which shall also form a part of his undertaking. PRICE/ FINANCE BID- “COVER B” a) Bid shall be submitted by uploading all the relevant document online at www.eprocure.gov.in b) The rate quoted per unit shall be the landed cost at destination, inclusive of packing, forwarding, Excise Duty, Sales Tax / VAT, Freight, Insurance, Installation / Commissioning etc. showing the break – up of cost on % age basis separately for each item as shown in Annexure VIII. c) The landed price per unit shall be the criteria for determining the L1 rate. 35. BID EVALUATION -Bids will be evaluated with reference to various criteria and one of such criteria is that the rate per unit (landed price) for determining the L1 rate (lowest rate). Conditional discounts shall not be taken into account for price comparison. However same shall be considered in case of placing order if the bidder happens to be L1. 36. VALIDITY OF BID - The tendered rates and the validity of bids shall be for a minimum period of one year from the date, as the tender are finalized /awarded extendable upto 6 months or till the finalization of next tender by the Institute, whichever is earlier. Bid with shorter validity shall be rejected. Purchaser may solicit bidders’ consent to an extension of bid Validity period. A bidder may refuse extension request without forfeiting the bid Security. 37. REASONABILITY OF RATES / FIRM PRICE-The bidder shall certify that the rates quoted are the lowest ones for any institution in the country. If the bidder is stockiest / distributor / dealer, he shall confirm that the price quoted are based on manufacture’s list price with appropriate discount & shall enclose manufacture’s price list or priced bid in support of his claim. During the period of the contract, if the price of any bided items is reduced due to any reason including any Law or Act of the Central / State Government, the bidder shall be statutorily bound to intimate the reduced rates immediately to the Director, NEIGRIHMS and shall charge the reduced rates. The Director, NEIGRIHMS is empowered to unilaterally effect such reduction as is necessary in rates, in case the bidder fails to notify or fail to agree to such reduction of rates. Subject to the condition stipulated above, the prices shall remain firm for the validity period of bid and on no account any increase in price shall be entertained till the completion of the bid period. No bidder will be allowed at any time on any ground whatsoever, to claim revision of or modification in the rates quoted by him. The Page 24 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. representation of the bidder that computation / typographical or clerical error etc. has been committed in the bid and request for reversion on such plea shall not be entertained after opening of the bid. STATUTORY TAXES / DUTIES -In case of any enhancement of Taxes and / or duties or levy of fresh Taxes / duties due to Statutory Act of the Government, after date of submission of the bids and during the contractual delivery period, additional or fresh levies so imposed will be allowed to be claimed as extra without any change in the price structure approved under the bid. For this purpose, the supplier shall produce a certificate from the authority concerned certifying that the item supplied falls under particular tariff resulting in additional / fresh levies for the supplied item. However, the same shall not be borne by the purchaser in case such levies become applicable after expiry of the contractual delivery period stipulated in the contract. Further, in case a successful bidder has been enjoying Excise Duty exemption on any criteria like turnover etc. and at a later date, during currency of the contract, even if excise Duty beco mes chargeable on goods manufactured, the same shall be to the supplier’s account and shall not be borne by the purchaser. PERFORMANCE SECURITY DEPOSIT: The successful bidder, within 30 days of receipt of award/Purchase Order, shall be required to submit Performance Security Deposit of 5 % of the order value in the form of Performance Bank Guarantee in favour of the Financial Adviser, NEIGRIHMS valid till the end of the contract period. The Bank Guarantee shall be returned on completion of the Warranty period of the goods supplied. However, if the supplier fails to execute the order or fails to perform he services as per contract, in addition to other penal actions, the Bank Guarantee shall be encashed & the amount forfeited. AGREEMENT: The successful bidder shall execute an agreement on non – judicial stamp paper of value of Rs. 100/- (stamp duty to be paid by the bidder) as per proforma in “Annexure X” within 15 days from the date of the intimation from Bid Inviting Authority informing that his bid has been accepted. NON – ASSIGNMENT: The bidder shall not, at any time, assign, sub-let or make over the contract or the benefit thereof or any part thereof to any person or persons what so ever. COMMUNICATION: All notices or communications relating to or arising out of this agreement or any of the terms thereof shall be considered duly served on or given of the bidder if delivered to him or left at his premises, places of business or abode. ANNULMENT OF AWARD, FORFEITURE OF SECURITY DEPOSIT & FRESH AWARD: Failure of the successful bidder to comply with the requirements of signing of contract and / or submission of performance security within the time schedule as stipulated above shall constitute sufficient grounds for the annulment of the award and forfeiture of the bid security. TENTATIVE QUANTITY: The quantity mentioned is only the tentative requirement and may increase or decrease as per the decision of the Bid Inviting Authority. The rates quoted should not vary with the quantum of the order or the destination. INSPECTION & QUALITY ASSURANCE: The Director, NEIGRIHMS and / or his authorized representative(s) have the right to inspect the manufacturing facilities of those bidders/ companies who have quoted or whose items have been quoted for this bid, before accepting their rates or before awarding the contract, or at any point of time during the continuance of the bid and has also the right to reject the bid or not to reorder based on facts brought out during such inspections. During the process of manufacture / fabrication of the ordered items, stage wise as well as random inspections may be carried out by authorized technical personnel to ensure compliance to specification / quality. However, such inspection shall not absolve the supplier from his responsibility of strictly adhering to the specifications & other conditions spelt out in the bid. DELIVERY CONDITION: The supply of items and successful commissioning shall be completed within thirty days from the receipt of the Supply Order. The supply, installation, commissioning of the equipment and trial run have to be done by the supplier or his authorized agent. No additional charges for these services shall be paid. The supplier or the Indian agent shall be responsible for these responsible for these services for imported items. The units as per order shall be handed over to the authorized representative(s) of Director at the specified location and the same shall be duly receipted after installation, commissioning and satisfactory demonstration. PAYMENT TERMS: No advance payment shall be made. 90 % payment for the supplied items shall be made after receipt of the fully functional stores and completion of all codal formalities subject to submission of Bank Guarantee for Performance Security, relevant documents, test certificates, warranty certificates etc. Balance 10 % payment shall be released on final acceptance of stores. Page 25 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 48. PENALTY FOR DELAY IN DELIVERY: In case there is delay in delivery beyond the stipulated period as mentioned in delivery clause, there shall be reduction in price @0.5 % of the value of delayed goods per week of delay or part thereof subject to a maximum of 10 % of the total order value. Once the maximum price is reached, termination of the contract may be considered. Non-performance of the contract provisions shall make the successful bidder liable to be disqualified to participate in any bid for the next 3 years. In addition to forfeiture of EMD and Bank Guarantee for Performance Security and other penal provisions. 49. FORCE MAJUERE: The above condition of delivery period, reduction & termination etc. are subject to majuere conditions which are beyond the control of the supplier, do not involve fault or negligence of the supplier and are not anticipated. Such events may include but are not limited to riots, mutinies, war, fire, storm, tempest, flood, epidemics, or other exceptional causes like quarantine restrictions, freight embargoes. On specific request made by the bidder the time period of supply may be extended by the Director, NEIGRIHMS at his discretion for such period as may be considered reasonable. However, the condition shall not include scarcity of raw materials, power cut, labour dispute, failure of sub-vendor and increase in cost of raw material. 50. FRAUD & CORRUPTION: The bidders, suppliers & contractors shall observe the highest standard of ethics during bidding and during performance of the contract. For the purpose of this provision, the following acts shall be considered a corrupt and / or fraudulent practice “Corrupt Practice” means offering, giving, receiving or soliciting directly or indirectly, of any thing of value to influence the action of an official in the procurement process or in contract execution. “Fraudulent Practices” means misrepresentation or omission of facts in order to execute of contract. “Collusive Practice” means a scheme or arrangement between two or more bidders, with or without the knowledge of the purchaser, designed to establish bid prices at artificial, non-competitive level. “Coercive Practices” means harming or threatening to harm, directly or indirectly, person or their property to influence their participation in a procurement process or in execution of a contract. During the process of evaluation of a bid or proposal for award of a contract, if it is detected that a bidder directly or through agents has engaged in corrupt, fraudulent, collusive or coercive practice in competing for the contract in question, then The bid shall be rejected, and Declare the firm ineligible for a specific period or indefinitely to participate in a bidding process. In the bid document itself, an undertaking from the bidder may be obtained in the format at Annexure – V. 51. LOCAL CONDITIONS :It will be imperative on each bidder to fully acquaint himself of all local conditions and factors that would have any effect on performance of the contract. The purchaser shall not entertain any request for clarifications from the bidder regarding such local conditions nor shall accept any offer conditional to the local factors. No request for any change of price extension of time schedule of delivery of goods shall be entertained after purchaser accepts the bid. 52. WAIVAR / ALTERATION : Bidders request for waiver, alteration etc in respect of bid document fee. EMD, performance security etc. shall not be entertained and hence no formal reply shall be given for such requests. The Un-priced bid shall not be opened of those bidders who have not compiled with the provisions of the bid Document Fee and / or EMD clause of the Bid Document. 53. ADJUDICATION / REVIEW BOARD: Any dispute arising out of or during execution of the contract shall be settled with mutual agreement through an Adjudication/Review Board appointed by the Director, NEIGRIHMS having officers belonging to other departments not related to the purchasing department. 54. SAVING CLAUSE: No suit, prosecution or any legal proceedings shall lie against Bid Inviting Authority or any person for anything that is done in good faith or intended to be done in pursuance of bid. 55. LAWS GOVERNING THE CONTRACT & JURISDICTION: The contract shall be governed by the laws in force in India. In the event of any dispute arising out of the bid such dispute would be subject to the jurisdiction of the Civil Court within the city of Shillong only. Page 26 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 SECTION V: BID FORM , PRICE SCHEDULE, BID SECURITY , PERFORMANCE AND CONTRACT FORM ANNEXURE I-A-(SPECIMEN PROFORMA OF COVERING LETTER OF THE BIDDER)-TO BE PLACED IN TECHNOCOMMERCIAL BID ANNEXURE I-A The Director, North Eastern Regional Institute of Health and Medical Sciences, Mawdiangdiang, Shillong-793018 Dear Sir, I/We hereby submit our bid for the Bid No. NEIGR/S&P/OT- /2009-10 in the prescribed format along with all the associated and supporting documents._________________________________________ _______________________________________________________________________________________ I/We now enclosing herewith the Call Deposit No…………………… dated……………. for Rs. ________/- drawn in favour of the “FINANCIAL ADVISER, NEIGRIHMS, SHILLONG” towards EMD/Bid Security (Scheduled bank should have branch in Shillong. Bids not accompanied with EMD/Bid Security (along with Technical Bid in case of two-bid system) shall be summarily rejected. I/We hereby agree to all the terms and conditions, stipulated by the N E I G R I H M S in this connection including delivery, penalty etc. Bid for each group are being submitted under separate covers and sheets and shall be considered on their face value. I/We have noted that over written entries shall be deleted unless duly re-written and initialed. I/We undertake to sign the contract/agreement if required within 15 (fifteen days) from the issue of the letter of acceptance, failing which our/my security money deposited may be forfeited and our/my name may be removed from the list of suppliers at the NEIGRIHMS , Shillong-793018. I/We have gone through all terms and conditions of the bid documents before submitting the same. Yours faithfully, Witness: Signature of the Bidder 1. 2. Page 27 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 ANNEXURE I (SPECIMEN DECLARATION FORM ON MANUFACTURING FACILITIES /AFTER SALES SERVICE)TO BE PLACED IN TECHNO-COMMERCIAL BID Annexure – I Declaration on Bidder facilities / after Service Bid Enquiry no: ______________________________________ For supply of: ___________________________________________ 1. Name of the Bidder : 2. Full postal Address: 3. Telephone No./Fax No.: 4. Email Address: 5. Date of inception of business: 6. Registration no. & date: 7. Issued by: 8. Valid till: 9. Details of manufacturing activity: & item wise capacity 10. Detail of after Sales & Service & AMC facilities available locally: a) Name of the Agency: b) Full Postal Address: c) Phone / Fax / E-mail: 11. Name of the Person responsible for 10 above: Sl. Name Designation Age Residential Address with No. Contact numbers, fax, e-mail 12. Name of Govt. Department / Pvt. Institutions As per enclosure to which the Bidder already supplied the items with quantity, value and supply period i. Has the bidder ever been black listed by any Govt. agency? If yes, give details. ii. Are any cases pending in the court related to any supplies? If yes, give details. iii. Does the firm have the adequate facilities for Inspection and quality control? Please give details. I,____________________________________________________ Prop. / Partner / Director M/s___________________________________________________________________ ____ of Hereby declare that the information given in this form is true and correct to the best of my knowledge & belief. I / We agree to the bid inviting Authority forfeiting the Earnest Money Deposit and/or Performance Security Deposit and blacklisting us for a period of 3 years, if any information furnished by us to be false at the time of inspection and non-compliance with the terms and condition of the contract. I offer to supply the items mentioned in the schedule (enclosed in price bid) at the rates quoted therein. I agree to hold this offer for one year after finalization of rate contract Dated: Signature________________________ Name of bidder________________________________ Address________________________________________ _________________________________________ Page 28 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 ANNEXURE II (SPECIMEN PROFORMA FOR PERFORMANCE STATEMENT)-TO BE PLACED IN TECHNOCOMMERCIAL BID Annexure - II PROFORMA FOR PERFORMANCE STATEMENT (For a period of last 3 years) Bid No. Date of opening Name of the Firm Order placed by (full address of Purchaser) 1 Order No. and Date 2 Description and quantity of ordered goods 3 Time Value of order 4 Date of completion of delivery As per Actual contract 6 5 Hours Remarks indicating reasons for late delivery, if any 7 Has the supply of goods been satisfactory performance?* (Attach a certificate from the Purchaser/Consignee) 8 Signature and seal of the Bidder * The Bidder shall also furnish the following documents in connection with their past performance: For supplies within India /Exports For supplies made to public sector units in India, an Affidavit confirming that the performance statement given is correct. However in case of supplies to private sector units, an Affidavit confirming that the performance statement is correct along with following supporting evidence:Copy of Supply/Purchase Order (s) Copy of Invoice (s) Proof of Payment received from Purchaser (s) Certificate from the purchaser(s) in support of satisfactory completion of the Contract for the supplies made. Page 29 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 ANNEXURE III(TENTATIVE SPECIMEN PROFORMA FOR ANNUAL TURN OVER STATEMENT)-TO BE PLACED IN TECHNO-COMMERCIAL BID ANNUAL TURN OVER STATEMENT Annexure – III The Annual Turnover of M/s ____________________________________ for the past three years and concurrent commitment for the current financial years are given below and certified that the statement is true and correct Sl. No. 1. Year 200 – 200 - 3. 200 – 200 - 2. 200 – 200 Turnover in Lakhs (Rs) - ______________________________________________________________________________ Total - Rs.____________________ lakhs. ……………………………………………………………………………………………………… Average Turn Over per annum Rs. ______________________lakhs. Concurrent Committee Sl. No. Dated: Seal: Contract ref. Purchaser Total Contract Value Outstanding Value Estimated delay in completion date Signature of Auditor / Chartered Accountant (Name in Capital) Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 ANNEXURE IV-(SPECIMEN PROFORMA FOR UNDERTAKING BY THE BIDDER)-TO BE PLACED IN TECHNO-COMMERCIAL BID Annexure – IV UNDERTAKING To, The Director, NEIGRIHMS, Mawdiangdiang, Shillong – 793018 Bid Enquiry No.______________________________ For supply of ___________________________________ Sir, I, Shri_____________________________________________________, on behalf of M/s ________________________________________________ having registered office at __________________________________________, do hereby declare that I have gone through the terms and conditions mentioned for the above and undertake to comply with all bid terms and conditions. The rates quoted by me/us are valid and binding on me/us for acceptance for a period of one year from the date of award of contract to us. I / We undersigned hereby bind myself/ourself to the Office of the Director, NEIGRIHMS, Shillong to supply stores as ordered by NEIGRIHMS, Shillong. The rates quoted by me/us for the items bided for are specified against each. It is certified that rates quoted are lowest quoted for any institution in India and not higher than MRP / prevailing market rate. The articles shall be strictly as per specification and of the best quality as per requirement of the institution. The decision of the office of the Director, NEIGRIHMS, Mawdiangdiang, Shillong – 793018 (herein after called the said Director) as regard to the quality and specification of article shall be final and binding on me/us. We agree to the conditions of the bid which the EARNEST MONEY DEPOSITS and PERFORMANCE SECURITY DEPOSIT shall be forfeited by us. We hereby undertake to pay the penalty as per the terms and conditions of the contract for delayed supply of the ordered items. We agree to accept the amount of the bill to be paid by the purchaser after completion of all codal formalities and should any amount of the bill found by the purchaser/auditors to have been overpaid; the amount so found shall be refunded by me/us. We hereby undertake to supply the items during the validity of the bid as per direction given in supply order within the stipulated period. The Director, NEIGRIHMS has the right to accept or reject any or all the bid without assigning any reason. We understand all the terms and conditions of the contract and bind myself / ourselves to abide by them. We hereby declare that there is no vigilance/CBI or court case pending/ against us at the moment. SIGNATURE: NAME & DESIGNATION: DATE: NAME & ADDRESS OF: THE FIRM SEAL: Page 31 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 ANNEXURE V (SPECIMEN PROFORMA FOR ANNUAL TURN OVER STATEMENT)-TO BE PLACED IN TECHNO-COMMERCIAL BID Annexure – V UNDERTAKING ON FRAUD AND CORRUPTION We M/s ________________________________________________________ do hereby undertake that, in competing for (and, if the award is made to us, in executing) the subject contract for supply of _____________________________ under bid reference no.________________ dated__________________ we shall strictly observe the laws against fraud and corruption in force in the country. Sd/- Signature of Proprietor/Partner/ Director Designation: Seal: Page 32 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 ANNEXURE VI (SPECIMEN MANUFACTURER’S AUTHORISATION FORM)-TO BE PLACED IN TECHNO-COMMERCIAL BID Annexure – VI MANUFACTURER’S AUTHORIZATION FORM No. _________________________ dated______________________ To, The Director, NEIGRIHMS, Mawdiangdiang, Shillong – 793018 Dear Sirs, Ref. Your TE document No ____________, dated _____________ We, ___________________________________ who are proven and reputable manufacturers of___________________________(name and description of the goods offered in the tender) having factories at_______________________________, hereby authorise Messrs______________________________( name and address of the agent) to submit a tender, process the same further and enter into a contract with you against your requirement as contained in the above referred TE documents for the above goods manufactured by us. We further confirm that no supplier or firm or individual other than Messrs. __________________________ (name and address of the above agent) is authorised to submit a tender, process the same further and enter into a contract with you against your requirement as contained in the above referred TE documents for the above goods manufactured by us. We also hereby extend our full warranty, CMC as applicable as per clause 15 of the General Conditions of Contract, read with modification, if any, in the Special Conditions of Contract for the goods and services offered for supply by the above firm against this TE document. Our other responsibility include:i) We undertake that we will provide service/spares/accessories etc. though our agent as per terms and conditions of contract ii) We undertake that in case of any change of Dealer/Agent, we will inform the Purchaser about the award of dealership to new agent with address and telephone no. Yours faithfully, ___________________________ ___________________________ [Signature with date, name and designation] for and on behalf of Messrs___________________________ [Name & address of the manufacturers] Note: This letter of authorisation should be on the letter head of the manufacturing firm and should be signed by a person competent and having the power of attorney to legally bind the manufacturer. Original letter may be sent. Page 33 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 ANNEXURE VII (SPECIMEN FORM FOR DETAILS OF SPECIFICATION OF ITEMS/ STORES OFFERED BY BIDDERS FORM)-TO BE PLACED IN TECHNO-COMMERCIAL BID Annexure – VII FOR COVER ‘A’ – UNPRICED BID Bid No._____________________ Sl.No Scheduled No. Items Technical Specifications Manufacturer Remark 1 2 Page 34 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 Annexure – VIII: (TO BE PLACED IN THE COVER ‘B’ – PRICED BID) Annexure – VIII Sample/specimen Break – up of Price Basic price Packing & Forwarding % Excise Duty % Sales % In case of Import Customs Duty against CDEC % Counter rating Duty % Inspection & Certification changes (if applicable) % Freight % or L.S. Insurance % Handling Charges at site % or L.S. Total Landed Cost at NEIGRIHMS Stores/Department: ***NOTE: PRICE BID ALSO TO BE PROVIDED IN EXCEL FORMAT ON A COMPACT DISC / WRITTEN ON THE CD, TO BE PLACED IN THE PRICE BID ALONG WITH SIGNED HARD COPY. Note-I: Any other component of Cost left out above may be included Note-II Page 35 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 Annexure – IX: (TO BE PLACED IN THE COVER ‘B’ – PRICED BID) ***NOTE: PRICE BID OF STORES TO BE PLACED IN A SEPARATE SEALED ENVELOPE AND ALSO TO BE PROVIDED IN EXCEL FORMAT ON A COMPACT DISC / WRITTEN ON THE CD, TO BE PLACED IN THE PRICE BID ALONG WITH SIGNED HARD COPY. PRICE SCHEDULE Schedule No. Item Description Maximu m Retail Price (MRP) Basic Price per Item /unit/No Sales and other taxes payable if contract is awarded Total Price per unit including Sales Tax, transportation etc. DPP/FOR NEIGRIHMS, Shillong ( Final price per unit in words) 1) Evaluation will be done as per price of each of the items. 2) We agree to supply and provide necessary services at consignee’s place (site) in accordance with the technical specifications of bid document for a total contract price indicated above, within a period specified in the bid document. 3) We confirm that the above contract price is inclusive of all duties and levies. 4) The quoted cost should include transport, delivery, loading /unloading and incidental charges. 5) Sample /specimen to be provide within 7 days of closing of the bid. No columns in the above proforma should be left blank. If any of the column is not applicable, it should be marked as NA. If rate for any of the item is not quoted it should be marked as NO OR NOT QUOTED. Place: Date: Name:-_____________________ Address:-____________________ Seal:- Page 36 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 Annexure – IX: (TO BE PLACED IN THE COVER ‘B’ – PRICED BID) PRICE SCHEDULE FOR ANNUAL COMPREHENSIVE MAINTENANCE AND REPAIR COST AFTER WARRANTY PERIOD Not required in the present category. ***NOTE: PRICE BID ALSO TO BE PROVIDED IN EXCEL FORMAT ON A COMPACT DISC / WRITTEN ON THE CD, TO BE PLACED IN THE PRICE BID ALONG WITH SIGNED HARD COPY. Signature of Bidder ……………………………… Name ……………………………………………. Business address ………………………………... Place: Date: Page 37 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 ANNEXURE X (SPECIMEN CONTRACT AGREEMENT FORM)-TO BE PLACED IN TECHNOCOMMERCIAL BID FORM OF CONTRACT AGREEMENT CONTRACT AGREEMENT FORMAT THIS AGREEMENT made the ___________________________________, between North Eastern Indira Gandhi Regional Institute of Health & Medical Sciences, Mawdiangdiang, Shillong – 793018, (”hereinafter called the “purchaser“) ___________________________________________________________________________________________________________________________________________ (”hereinafter called the “supplier“) of the other part. WHEREAS the Purchaser is desirous that _____________________________________________________________________ certain vide Goods and Tender ancillary services Enquiry and viz ., No: _______________________________________________________________________) and has accepted a bid by the Supplier for the supply of those goods in the sum of “______________________________________________________________________” (Hereinafter called “the Contract Price") NOW THIS AGREEMENT WITNESSETH AS FOLLOWS: 1. 2. In this Agreement words and expressions shall have the same meanings as are respectively assigned to them in the Conditions of Contract referred to. The following documents shall be deemed to form and be read and construed as part of this Agreement, viz.: (a) The Bid Form and the Price Schedule submitted by the Bidder: - _____________________________________________ (c) The Technical Specifications: - ______________________________________________________________________________________ (b) (d) (e) 3. 4. (f) The Schedule of Requirements: - __________________________________________________________________________________ The General Conditions of Contract: - ______________________________________________________________________________ The Special Conditions of Contract: - _______________________________________________________________________________ The Purchaser's Notification of Award: –__________________________________________________________________________ In consideration of the payments to be made by the Purchaser to the Supplier as hereinafter mentioned, the Supplier hereby covenants with the Purchaser to provide the goods and services and to remedy defects therein in conformity in all respects with the provisions of the Contract. The Purchaser hereby covenants to pay the Supplier in consideration of the provision of the goods and services and the remedying of defects therein, the Contract Price or such other sum as may become payable under the provisions of the Contract at the times and in the manner prescribed by the Contract. Brief particulars of the goods / services, which shall be supplied /provided by the Supplier, are as under: Sl. No. Description of Goods Unit Rate per unit Total Amount (DDP at Consignee Site) IN WITNESS whereof the parties hereto have caused this Agreement to be executed in accordance with their respective laws the day and year first above written. Signed, Sealed and Delivered by the said...................................................................................... (For the Purchaser) In the presence of: ............................................................................................ Signed, Sealed and Delivered by the said......................................................................................................................... (For the Supplier / Manufacturer) In the presence of: .............................................................................................. Counter Signed /Confirmed by ........................................................................................................ (Principal /Manufacturer) Note: The courts at Shillong will have the jurisdiction to try any matter, dispute or reference between the parties arising out of the contract. It is specifically agreed that no court outside and other than Shillong court shall have jurisdiction in the matter. Page 38 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 ANNEXURE XI (SPECIMEN PERFORMANCE SECURITY BANK GUARANTEE)-TO BE PLACED IN TECHNOCOMMERCIAL BID (unconditionl) Date: [ insert: date ] BID: [ insert: name or number of BID ] Contract: [ insert: name or number of Contract ] To: [ insert: name and address of Purchaser] Dear Sir or Madam: We refer to the Contract Agreement (“the Contract”) signed on [ insert: date ] between you and [ insert: name of Supplier ] (“the Supplier”) concerning the supply and delivery of [ insert: a brief description of the Goods]. By this letter we, the undersigned, [ insert: name of bank], a bank (or company) organized under the laws of [ insert: country of bank ] and having its registered/principal office at [ insert: address of bank ], (hereinafter, “the Bank”) do hereby jointly and severally with the Supplier irrevocably guarantee payment owed to you by the Supplier, pursuant to the Contract, up to the sum of [ insert: amount in numbers and words ]. This guarantee shall be reduced or expire as provided for by GCC . We undertake to make payment under this Letter of Guarantee upon receipt by us of your first written demand signed by your duly authorized officer declaring the Supplier to be in default under the Contract and without cavil or argument any sum or sums within the above-named limits, without your need to prove or show grounds or reasons for your demand and without the right of the Supplier to dispute or question such demand. Our liability under this Letter of Guarantee shall be to pay to you whichever is the lesser of the sum so requested or the amount then guaranteed under this Letter in respect of any demand duly made under this Letter prior to expiry of this Letter of Guarantee, without being entitled to inquire whether or not this payment is lawfully demanded. This Letter of Guarantee shall be valid from the date of issue until the date of expiration of the guarantee, as governed by the Contract. Except for the documents herein specified, no other documents or other action shall be required, notwithstanding any applicable law or regulation. Our liability under this Letter of Guarantee shall become null and void immediately upon its expiry, whether it is returned or not, and no claim may be made under this Letter after such expiry or after the aggregate of the sums paid by us to you shall equal the sums guaranteed under this Letter, whichever is the earlier. All notices to be given under this Letter shall be given by registered (airmail) post to the addressee at the address herein set out or as otherwise advised by and between the parties hereto. We hereby agree that any part of the Contract may be amended, renewed, extended, modified, compromised, released, or discharged by mutual agreement between you and the Supplier, and this security may be exchanged or surrendered without in any way impairing or affecting our liabilities hereunder without notice to us and without the necessity for any additional endorsement, consent, or guarantee by us, provided, however, that the sum guaranteed shall not be increased or decreased. No action, event, or condition that by any applicable law should operate to discharge us from liability hereunder shall have any effect, and we hereby waive any right we may have to apply such law, so that in all respects our liability hereunder shall be irrevocable and, except as stated herein, unconditional in all respects. For and on behalf of the Bank Signed:_____________________ Date: ______________________ in the capacity of: [ insert: title or other appropriate designation ] Common Seal of the Bank Page 39 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 ANNEXURE XII (SPECIMEN BID SECURITY FORM)-TO BE PLACED IN TECHNO-COMMERCIAL BID Date: [ insert: date ] BID: [ insert: name and number of BID ] Contract: [ insert: name and number of Contract ] To: [ insert: name and address of Purchaser ] WHEREAS [ insert: name of Bidder ] (hereinafter called “the Bidder”) has submitted its bid dated [ insert: date of bid ] for the performance of the above-named Contract (hereinafter called “the Bid”) KNOW ALL PERSONS by these present that WE [ insert: name of bank ] of [ insert: address of bank ] (hereinafter called “the Bank”) are bound unto [ insert: name of Purchaser ] (hereinafter called “the Purchaser”) in the sum of: [ insert: amount ], for which payment well and truly to be made to the said Purchaser, the Bank binds itself, its successors and assigns by these presents. Sealed with the Common Seal of the said Bank this [ insert: number ] day of [ insert: month ], [ insert: year ]. THE CONDITIONS of this obligation are the following: 1. 2. If, after the bid submission deadline, the Bidder (a) withdraws its bid during the period of bid validity specified by the Bidder in the Bid Form, or (b) does not accept the Purchaser’s corrections of arithmetic errors in accordance with the Instructions to Bidders; or If the Bidder, having been notified of the acceptance of its bid by the Purchaser during the period of bid validity (a) (b) fails or refuses to sign the Contract Agreement when required; or fails or refuses to issue the performance security in accordance with the Instructions to Bidders. (c) In case of any false, incorrect or misleading information provided in the bid. We undertake to pay to the Purchaser up to the above amount upon receipt of its first written demand, without the Purchaser having to substantiate its demand, provided that in its demand the Purchaser will note that the amount claimed by it is due it, owing to the occurrence of any one of the two above-named CONDITIONS, and specifying the occurred condition or conditions. This guarantee will remain in full force up to and including [ insert: the date that is 45 days after the period of bid validity ], and any demand in respect thereof must reach the Bank not later than the above date. For and on behalf of the Bank Signed:_______________________________________________ Date: _______________________________________________ in the capacity of: [ insert: title or other appropriate designation ] Common Seal of the Bank Page 40 of 277 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 ANNEXURE XIII (SPECIMEN PROFORMA OF AFFIDAVIT FOR CLAIMING PAYMENT)-TO BE PLACED IN TECHNOCOMMERCIAL BID I ---------------------- son/daughter of --------------------------- resident of ------------------------------- solemnly undertake that I am an authorized signatory of M/s ------------------------------------(insert name of the company with full address) and I hereby undertake that the supplies for which payments are being made have been correctly made to the respective consignees. I take full responsibility for the correctness of the documents submitted for which the payment has been claimed. I further undertake that without prejudice to the rights of purchaser as per the contract, I shall be solely responsible if any of the document is found to be fake even to make good any loss suffered by the purchaser due to incorrectness of the documents submitted by us claiming payment against invoice(s) no(s).-----------------------. Further I hereby certify that I haven’t received/claimed any payment earlier against these invoice(s). Name:-------------------------------- Address:----------------------------Witness 1----------------------------Address:------------------------------ Witness 2----------------------------Address:------------------------------ 41 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 LIST OF REQUIREMENT: Sl. No. Description of Stores /Items Unit Disposable & Consumables 1.01 Franseen Lung Biopsy needles- length 15 cm to 20 cm; gauge 16 to 20. 1.03 Intravenous Extension Tube with Male and Female lock connector 100 cm Intravenous Extension Tube with Male and Female lock connector 50 cm 1.02 1.04 1.05 1.06 1.07 1.08 1.09 1.1 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.2 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.3 1.31 1.32 Intravenous Extension Tube with Male and Female lock connector Intravenous Extension Tube with Male and Female lock connector KIRAN Green sensitive Intensifying screens 15” x12” (For support of cervical spine during Emergency) (For support of cervical spine during Emergency) (For support of cervical spine during Emergency) 200 cm 150 cm Large Small Each Each Each Each Each Large (HDPE/HMPE (High Density / High Molecular Polyethylene) -Size : 14x17 (Intima II BD) Each Each (HDPE/HMPE (High Density / High Molecular Polyethylene) -Size : 10x12 (Intima II BD) Each 22G 24G Each Each Each Each Each (Intima II BD) 20G Each 10 Lead Patient Cable (TMT Machine - CS-200) Each 10 leads ECG Cable (For TMT Machine - CS 200) Each 10% Sodium Hydroxide (NaDH) Each 102-1 Oygen sensor 102-1 Each 15mm double swivel with port & extension Each 407030500 Expiratory Filter (Reusable) Each 407460000 Inspiratory Filter Filter reusable Each 407460100 Inspiratory Filter (Disposable) Each 407464700 Expiratory Filter (Reusable) 41525400 Reusable Simplified Breathing Circuit with Water Trap (Adult) 5- Leads ECG Patient Cable (For M6 Aster MediAid) 72 hours CLOSED VENTILATION SUCTION CATHETER Must have double - lumen siliconised catheter Swivel connector uncoupling wedge, Lockable thumb –Valve end Cap, Softer Sleeve material, 72 hour recommended during of use. Size: 12F, 14F, 16F Each Each Each Each 80-217-02-04 + 80-51504-04 Monopolar Cable with Knife St Each 80-217-02-04 + 80-56004-04 Monopolar Cable with Ball St Each 80-217-02-04 + 80-52004-04 Monopolar Cable with Needle St Each 80-217-02-04 + 80-582-04-04 Monopolar Cable with Ball St Each 80-217-05-04 + 80-510-04-04 Monopolar Cable with Lancet St Each 80-287-33-04 + 80-912-18-04 Bipolar Cable with Forceps Each 42 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 1.33 80-287-33-04 + 80-913-18-04 Bipolar Cable with Forceps Angled Each 1.35 A.V. Fistulla Needle 17G Each 1.34 1.36 1.37 1.38 1.39 1.4 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.5 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 A.V. Fistulla Needle 16G Each Abdominal drainage Kit 20 Each Abdominal drainage Kit 24 Each Abdominal drainage Kit 28 Each Abdominal Sponge with X-ray Opaque(10cm x 10cmx1ply) Each Abdominal Sponge with X-ray Opaque(15 cmx 15cm x 6ply) Each Abdominal Sponge with X-ray Opaque(20cm x 20cm x 6ply) Each Abdominal Sponge with X-ray Opaque(25cm x 25cm x 6ply) Each Abdominal Sponge with X-ray Opaque(30cm x 30cm x 6ply) Each Abdominal Sponge with X-ray Opaque(30cm x 30cm x 8ply) Each Abrasive proximal strips Each Absorber Connector Each Accessories/Consumables for Bone View T8 Cardiac Monitor Each Accessories/Consumables for Diathermy Machine KLS Martin Each Accessories/Consumables for PB 840 Ventilator (TYCO) Each Acrylic mixing jar Each Acrylic teeth set (all sizes and shades) Each Additional Items Adhesive Plaster - 1.25 cm x 1 mtr - Specification: >2.5mtr upstretched&>5mtr stretchable length,100% Latex Free coating, No latex allergies and skin irritation Porous adhesive, permeable to air and moisture Leaves no traces of adhesive on skin after removal. European CE/ US FDA Approved. High quality extensible cloth Each Each Adhesive Plaster - 1.25 cm X 5 mtr - Specification: >2.5mtr upstretched&>5mtr stretchable length,100% Latex Free coating, No latex allergies and skin irritation Porous adhesive, permeable to air and moisture Leaves no traces of adhesive on skin after removal. European CE/ US FDA Approved. High quality extensible cloth Each Adhesive plaster 5cm x 5mtr - Specification: >2.5mtr upstretched&>5mtr stretchable length,100% Latex Free coating, No latex allergies and skin irritation Porous adhesive, permeable to air and moisture Leaves no traces of adhesive on skin after removal. European CE/ US FDA Approved. High quality extensible cloth Adhesive plaster 10cm x 10mtr - Specification: >2.5mtr upstretched&>5mtr stretchable length,100% Latex Free coating, No latex allergies and skin irritation Porous adhesive, permeable to air and moisture Leaves no traces of adhesive on skin after removal. European CE/ US FDA Approved. High quality extensible cloth Adhesive plaster 10cmx5mtr - Specification: >2.5mtr upstretched&>5mtr stretchable length,100% Latex Free coating, No latex allergies and skin irritation Porous adhesive, permeable to air and moisture Leaves no traces of adhesive on skin after removal. European CE/ US FDA Approved. High quality extensible cloth Each Adhesive Plaster - 2.5 cm X 1 mtr - Specification: >2.5mtr upstretched&>5mtr stretchable length,100% Latex Free coating, No latex allergies and skin irritation Porous adhesive, permeable to air and moisture Leaves no traces of adhesive on skin after removal. European CE/ US FDA Approved. High quality extensible cloth Each Each Each Each 1.61 Adhesive plaster 2.5cm x 5mtr - Specification: >2.5mtr upstretched&>5mtr stretchable length,100% Latex Free coating, No latex allergies and skin irritation Porous adhesive, permeable to air and moisture Leaves no traces of adhesive on skin after removal. European CE/ US FDA Approved. High quality extensible cloth Adhesive plaster 7.5cm x 5mtr - Specification: >2.5mtr upstretched&>5mtr stretchable length,100% Latex Free coating, No latex allergies and skin irritation Porous adhesive, permeable to air and moisture Leaves no traces of adhesive on skin after removal. European CE/ US FDA Approved. High quality extensible cloth Adjustable circle breathing system (2 Litre bag, 2 metre length and 1.5 metre limb) 1.63 Adult curved flared prong with tube1.8m length Each 1.6 1.62 1.64 Adjustable circle breathing system (2 mts length) Adult curved nasal prong with tube1.8m length Each Each Each Each 43 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 1.65 Adult oxygen mask with nose clip and oxygen tube Each 1.67 Ag. Amalgam Each 1.66 1.68 1.69 1.7 1.71 1.72 1.73 1.74 1.75 1.76 1.77 1.78 1.79 1.8 1.81 1.82 1.83 1.84 1.85 1.86 1.87 1.88 1.89 1.9 1.91 1.92 1.93 1.94 Adult Respi-Check high concentration oxygen mask with oxygen tube Each Sterile disposable HIV prevention kit Specifications: 1. 3ply Face Mask 2. Astronaut type cap of non-woven material 49-53 gsm. 3. Goggle with adjustable temple arms. 4. Surgeon Gown SMS (specified as in Sl. no. 398) 5. Shoe Cover - with long leg covers to reach on to the mid leg region - with elastic fittings. 6. Waste carry bag of adequate size. Each Sterile disposable swine flu prevention kit covering whole body and wide helmet hood for head. Specifications: 1. N-95 respirator mask. 2. Astronaut type head cover of non-woven material. 3. Wide Goggle preferably fixed in the head protection hood. 4. HIN1protection gown for whole body coverage with long midline zips. 5. Shoe cover with long leg covers to reach on to the mid-leg region with elastic fittings. 6. Waste carry bag of adequate size. Each Air polisher Each Air Compressor Rubber Gasket of High Pressure High Vacuum Sterilizer with Boiler (Fully Automatic) size:600x600x1200mm with sliding doors Each Air Probe Each Airmotor Each Alginate Each Amalgam carrier Each Amalgam condenser Each Amalgam curver Each Amalgam squeezer Each Amalgamator Each Aneurysm needle Each Angiographic trays Each Angiography Drape (Disposable) Each Femoral Angiography Drape Each Radial Angiography Drape Each Angiography straight catheters and guide wires Each Angle Mount: 15F/22M, 15M/22F, 22F/22F, 22M/23F Anti Bacterial Mattress ANTI-EMBOLISM STOCKING Each Each Mediven Struva 35 ANTI-EMBOLISM STOCKING for differentiated thrombosis prophylaxis ANTI-EMBOLISM STOCKING Pressure from foot to thigh Mediven Struva 23 Mediven thrombexin 18 Anti-microbial circle breathing system (1.6 metre length and 0.8 metre limb) Anti-microbial circle breathing system (2 litre bag, 1.6 metre Length, 0.8 metre limb) Anti-microbial circle breathing system (2 litre bag, 2.4 metre Length, 0.8 metre limb) Apex cocator 44 Each Each Each Each Each Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 1.95 Apexit plus Each 1.97 Applicator tips for light body Each 1.96 1.98 1.99 2 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.1 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.2 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 Applicator tips Each Apron : COAT TYPE Size : S/M/B (Zero Lead) (Kiran) Each Apron : DOUBLE -SIDED Size : S/M/B (Zero Lead) (Kiran) Each Apron Cloth (Sterile) Each Apron Plastic Disposable (Sterile) Each Arteral Embolectomy Catheter(Ref-120803F) 80cm # 3F Each Arteral Embolectomy Catheter(Ref-120804F) 80cm # 4F Each Arteral Embolectomy Catheter(Ref-120806F) 80cm # 6F Each Artery forcep /Mosquito forcep Each Arthroscopy pump set Each Articulating paper Each Artificial Eye Ball Implant : Adult Each Artificial Eye Ball Implant : Paediatrics Each Artificial Eye Ball Implant : Infant Each Arm Pouch Medium Each Arm Pouch Large Each Aspiration Needle Each Aspiration Needle Luer Lock 16G to 19G x 2` to 4` Each Attest 1292 E Biological Indicator Each Attest Biological Indicator (for styeam) 3M Attest Rapid Auto Reader Incubator (For Steam) (Early result for biological test) Auto Processor Developer Pkts. (To make 19 lit. Solution) Auto Processor Fixer Pkts. (To make 19 lit. Solution Each Each Each Each Autoclavable (fully automatic with triple vacuum with dryer Each Automatic Biopsy gun. Each Auxiliary Oxygen Connector Each Axila Temperature Cable Each Axillary crutch Bag Mounts: 23mm, 22mm, 22mm female male pair, 23mm female male pair Balanced Salt Solution (BSS) Ball barnisher Each Each Each Each Band aid Bandage rolled 10 cm x 3m - specification: Simple woven strip of material Cotton cloth of plain weave, bleached good white Highly absorbent Manufactured as per B/P Standard 45 Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 2.3 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.4 2.41 2.42 2.43 2.44 2.45 2.46 2.47 2.48 2.49 2.5 2.51 2.52 2.53 2.54 2.55 2.56 2.57 2.58 2.59 2.6 2.61 2.62 2.63 Bandage rolled 15 cm x 3m - specification: Simple woven strip of material Cotton cloth of plain weave, bleached good white Highly absorbent Manufactured as per B/P Standard Each Bandage rolled 3 cm x 3m - specification: Simple woven strip of material Cotton cloth of plain weave, bleached good white Highly absorbent Manufactured as per B/P Standard Each Barium Powder 92% W/V for Enema 3.5 Kg. Each Barium Sulphate Enema Kit Single use Complete pack Each Bandage rolled 2.5 cm x 3m - specification: Simple woven strip of material Cotton cloth of plain weave, bleached good white Highly absorbent Manufactured as per B/P Standard Each Bandage rolled 5 cm x 3m - specification: Simple woven strip of material Cotton cloth of plain weave, bleached good white Highly absorbent Manufactured as per B/P Standard Each Barium Sulphate 9.5 W/V 1 ltr (Flavoured) Each Barium Sulphate HD 100% W/V(high density), single use pack with effervescent powder Barium sulphate Powder BP/IP – 5 Kg Basic Bain coaxial breathing systems (2 litre bag, 1.6 metre length and 0.8 metre limb) BD Veca -C TM Belt for Cable (For TMT Machine - CS 200) Each Each Each Each Each Belt for Cable TMT Machine CS-200) Each Bilbao-Dotter tube with guide wire Each Biosy Needle 14G Each Biosy Needle 16G Each Biosy Needle 18G Each BIS Electrodes Each Bladder Syringe 50ml Each Bladder Syringe 100ml Each Bladder Syringe 150ml Each Bladder Syringe 200ml Each Blood Bag- Double 350ml Each Blood Bag- Double 450ml Each Blood Bag- Pediatric (Penta bags) Each Blood Bag- Penta Bags 450ml Each Blood Bag- Quadruple SAGM 350ml Each Blood Bag- Quadruple SAGM 450ml Each Blood Bag- Quadruple SAGM 350ml Top & Top Each Blood Bag- Quadruple SAGM 450ml Top & Top Each Blood Bag- Quadruple SAGM 350ml Top & Bottom Each Blood Bag- Quadruple SAGM 450ml Top & Bottom Each Blood Bag- Triple 350ml Each Blood Bag- Triple 450ml Each 46 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 2.64 Transfer Blood Bags (100 ml) Each 2.66 Blood Transfusion (BT) set - with airvent and a regulator. (Non-toxic, pyrogen free; non-kinking quality; Pack without any risk of breach in sterility, ETO/ Gamma sterilized). Each 2.65 2.67 2.68 2.69 2.7 2.71 2.72 2.73 2.74 2.75 2.76 2.77 2.78 2.79 2.8 2.81 2.82 2.83 2.84 2.85 2.86 2.87 2.88 2.89 2.9 2.91 2.92 2.93 2.94 2.95 2.96 2.97 2.98 Transfer Blood Bags (300 ml) Each Bone curetteBP handle with handle Each Bone cutting burs (for micromotor and handpiece) Each Bone cutting bur Each Bone file Each Bone marrow needle 14 Each Bone marrow needle 16 Each Bone marrow needle 18 Each Bone ronger Each Bowiedick test paper 3M Each BP blade with handle (no 15 & 17) Each BP Cuff (Adult) Each BP Cuff (Adult) Each BP Cuff (Child) Each BP Cuff Child Each Brack (Surgical Mesh) 15 x 15 cm Each Brack (Surgical Mesh) 15 x 30 cm Each Brack (Surgical Mesh) 30 x 30 cm Each Brack (Surgical Mesh) 6 x 11 cm Each Brack (Surgical Mesh) 8 x 15 cm Breathing Filters (filters out MS-2 coliphage, Hepatitis C, M. tuberculosis Bacillus subtilis Pseudomonas diminuta) Model 1844003 BRONCHOCATH (Left) Double Lumen Endotracheal Tube 32 BRONCHOCATH (Left) Double Lumen Endotracheal Tube 35, 37 Each Each Each Each BRONCHOCATH (Right) Double Lumen Endotracheal Tube 35, 37 Each Brown covers for X-ray films (27 x 22 cms) 10” x 8” Each Brown covers for X-ray films (32 x 27 cms) 12” x 10” Each Brown covers for X-ray films (32 x 32 cms) 12” x 12” Each Brown covers for X-ray films (37 x 37 cms) 14” x 14” Each Brown covers for X-ray films (39 x 37 cms) 15” x 12” Each Brown covers for X-ray films (45 x 37 cms) 17” x 14” Each Burner Each Burs (diamond) -all sizes and shape Each C.T. Laser film (Kodak or equivalent) 17” x 14” 100 sheets Each 47 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 2.99 C.U Diaphragms of High pressure High vacuum steam sterilizer size:600x900x1500) Code No:408 and S.No 7g-1192 Each 3.01 Cardiac Troponin T kit Each 3 3.02 3.03 3.04 3.05 3.06 3.07 Cacron curver Cartridge for ACT Machine Each Each Cassette Pass Box 4 door system Each CASSETTEE GRID 10” x 8” Each CASSETTEE GRID 15” x 12” Each CASSETTEE GRID 17” x 14” Catheter introducer with haemostatic valve tray Content: handling sleeve (Asept Cath) 1 Introducer needle 1 J Guide wire 1 Dilator and sheath 1149.06 1 non - touch 1149.08 Each Each 3.08 Catheter Mount: 23F Each 3.1 Catheter Mount:, 23.5F, Each 3.09 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 3.19 3.2 3.21 3.22 3.23 3.24 3.25 3.26 3.27 3.28 3.29 3.3 3.31 3.32 3.33 Catheter Mount: 23M Each Catheter Mount: 23.5M Each Catheter Mount: 22F Each Catheter Mount: 22M Each Catheter Mount: 15F Each Catheter Mount: 15M Each Catheter Mounts-Flexible (Fletube with fixed elbow) Model 2500 Catheter Mounts-Superset(superset withfixed elbow + luer lock port) Model 3514 Catheter, plain - size 10 Catheter, plain - size 12 Each Each Each Each Catheter, plain - size 4 Each Catheter, plain - size 5 Each Catheter, plain - size 6 Each Catheter, plain - size 8 Each Cement condenser Each Cement spatula Each Center hole towel Each Cerebral catheters Each Cervical Spatula (Wooden) for papsmear (Sterile) Each Cervical Spatula (Wooden) for papsmear (Sterile) Each Chair bulbs (Ocero; Infinity) Each Check-flow accessory adapters Each Chemical Indicator Tape (for steam) 3M Each Chest drainage bag water seal Each 48 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 3.34 Chest drainage tube - size 10 Each 3.36 Chest drainage tube - size 14 Each 3.35 3.37 3.38 3.39 3.4 3.41 3.42 3.43 3.44 3.45 3.46 3.47 3.48 3.49 3.5 3.51 3.52 3.53 3.54 3.55 3.56 3.57 3.58 3.59 3.6 3.61 3.62 3.63 3.64 3.65 3.66 3.67 3.68 3.69 Chest drainage tube - size 12 Each Chest drainage tube - size 16 Each Chest drainage tube - size 18 Each Chest drainage tube - size 20 Each Chest drainage tube - size 22 Each Chest drainage tube - size 24 Each Chest drainage tube - size 26 Each Chest drainage tube - size 28 Each Chest drainage tube - size 30 Each Chest drainage tube - size 32 Each Chiba Biopsy needles- length 15 to 20 cms, Gauge 18 to 22. Each Jhamsdi Bone Marrow Biopsy Needle 11G Each Jhamsdi Bone Marrow Biopsy Needle 13G Circle 15 mm breathing systems (with luer lock and 1.6 metre length) for Paediatrics Circuit Adaptor: 15/15M/M, Circuit Adaptor: 15/22M Circuit Adaptor: Circuit Adaptor: Circuit Adaptor: Circuit Adaptor: Circuit Adaptor: Circuit Adaptor: 15/22F/F, Each Each 22/22M/M; Each 22/23F/F, Each 22/23M/F, Circuit Adaptor: 5/15F/F, Circuit Adaptor: Each Each 23/23F/F,, Clear hood facemask transparent silicone cuff Clear hood facemask transparent silicone cuff Each Each 22/22M/F, 22/23M/M, Each Each 22/22F/F, Circuit Adaptor: Each Each Each 4 Each 5 Each Clear hood facemask transparent silicone cuff 2 Each Clear hood facemask transparent silicone cuff 3 Clear hood facemask transparent silicone cuff 1 Closed Ventilation suction catheter system for ET Tube suction Each 10 Fr Closed Ventilation suction catheter system for ET Tube suction 6 Fr Closed Ventilation suction catheter system for ET Tube suction 12 Fr Closed Ventilation suction catheter system for ET Tube suction 8 Fr 49 Each Each Each Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 3.7 Closed Ventilation suction catheter system for ET Tube suction 3.72 Closed Wound Suction unit 10FG (Romavac Set) 3.71 3.73 3.74 3.75 3.76 3.77 3.78 3.79 3.8 3.81 3.82 3.83 3.84 3.85 3.86 3.87 3.88 3.89 3.9 3.91 3.92 3.93 3.94 3.95 3.96 3.97 3.98 3.99 4 4.01 Closed Ventilation suction catheter system for ET Tube suction 14 Fr Each 16 Fr Each Each Closed Wound Suction unit 12FG (Romovac Set) Each Closed Wound Suction unit 14FG (Romovac Set) Each Closed Wound Suction unit 16FG (Romovac Set) Each Closed Wound Suction unit 18FG (Romovac Set) Each Closed Wound Suction Unit 8FG (Romovac Set) Each Co2 Adaptor (Adult) Each Co2 Adaptor (Child) Each Co2 Module Each Co-axial infusion sets Each COBAN Tm 4" Each Cobra visceral catheters Each Coe -pack Each Cold cure (pink) powder Each Cold cure Acrylic) powder with Liquid (white) Each Pits and Fissure Sealant Each Cold cure liquid Each Cold mold seal Each GIC Fuji type iX Each GIC type -II Restorative materials Each Desenstising varnish) Each Colo Bag Each Colostomy kit Each Colostomy 55mm Each Colostomy bag, acitve life tail closer Each Colostomy bag, acitve life one piece clostomy (box of 10) Each Colostomy plastic Disposable pouch 100 Each Colostomy Stomasive paste Each Colostomy Stomasive powder Colour-Coded Reusable Blood Pressure Cuffs (Cleen-able) adaptable to all NIBP monitors 44-60cm (Thigh) 4.02 Colour-Coded Reusable Blood Pressure Cuffs (Cleen-able) adaptable to all NIBP monitors Colour-Coded Reusable Blood Pressure Cuffs (Cleen-able) adaptable to all NIBP monitors 10-17cm (Infant) 13-19cm (Child) 4.04 Colour-Coded Reusable Blood Pressure Cuffs (Cleen-able) adaptable to all NIBP monitors 23-25cm (Adult) 4.03 50 Each Each Each Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 4.05 Colour-Coded Reusable Blood Pressure Cuffs (Cleen-able) adaptable to all NIBP monitors 33-45cm (Adult L) Each 4.06 Colour-Coded Reusable Blood Pressure Cuffs (Cleen-able) adaptable to all NIBP monitors 17-25cm (S. adult) Each 4.07 Cols light source for transillumination Each 4.09 COMBINED SPINAL & EPIDURAL SET Contents: Spinal needle pencil point 26g Epidural needle 16g 0.5mm graduation marking from 0-15mm on the hub with twist lock device Epidural catheter with closed ended 3 lateral eyes, Flat filter 0.2microns Luer lock connector, Catheter fixation device Catheter guide, graduated Loss of resistance device 27G(Minipack) Each Combined spinal Epidural kit (full Pack) (Tuohy needle, spinal needle, catheter closed end, filter, Syringe) 27G Each 4.08 4.1 4.11 4.12 4.13 4.14 4.15 4.16 4.17 4.18 4.19 4.2 4.21 4.22 COMBINED SPINAL & EPIDURAL SET Contents: Spinal needle pencil point 26g Epidural needle 16g 0.5mm graduation marking from 0-15mm on the hub with twist lock device Epidural catheter with closed ended 3 lateral eyes, Flat filter 0.2microns Luer lock connector, Catheter fixation device Catheter guide, graduated Loss of resistance device 18G(Minipack) Each Combined spinal Epidural kit (full Pack) (Tuohy needle, spinal needle, catheter closed end, filter, Syringe) 18G Each Compact extension tube (2 metre length) Each Compo roller (Assorted kit) Each Condom (Disposable) Each Condom Non Spermicidal (Disposable) Each Condom catheter - large Each Condom catheter - medium Each Condom catheter - pediatric Consumables compatible with Automated Peritoneal Dialysis Cycler Machine (1) Cassetes and tubings (2) 5Ltr PD fluid 1.5% (3) 5 Ltr PD Fluid 2.5% (4) Drain bag 15 Ltr (5) Port clamp (6) Mini cap (7) Single cuff adult size soft catheters with peel apart she Each Each Consumables for Radiant Warmer (Meditrin) Each Contrast media for Oral Use Diatrizoate Meglumine-66% diatrizoate & sodium 10% W/V Iodine 370 mg/ml – 30ml. Each Contra angle hand piece Each 4.23 CONTRAST MEDIA: Each 4.25 Corrugated Rubber Drainage Each 4.24 4.26 4.27 4.28 4.29 4.3 4.31 4.32 4.33 4.34 4.35 4.36 4.37 Corrugated Drainage Sheet with X-Ray opaque Each Cover for films with cover printing 10" x 12" Each Cover for films with cover printing 14" x 17" Each CR cassettes 10" x 12"(KODAK) Each CR cassettes 14" x 17" (KODAK) Each CR cassettes 8" x 10"(KODAK) Each crammer Wires Crepe Bandage (10cm x 4/6mtr) - Non fraying edges. As per BP specifications Crepe Bandage (15cm x 4/6mtr) - Non fraying edges. As per BP specifications Crepe bandage (5 cm x 4mtr) - Non fraying edges. As per BP specifications Crepe Bandage (7.5cm x 4mtr)- Non fraying edges. As per BP specifications Crepe Bandage (8cm x 4mtr) - Non fraying edges. As per BP specifications Crown cutting kit 51 Each Each Each Each Each Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 4.38 Crown remover Each 4.4 Cuff-able and Cleencuff Blood Pressure Cuffs with universal adaptor system compatible with NIBP monitor and Manual Sphygmomanometry 10-17cm (Infant) Each 4.39 4.41 4.42 4.43 4.44 4.45 4.46 4.47 4.48 4.49 4.5 4.51 4.52 4.53 4.54 4.55 4.56 4.57 4.58 4.59 4.6 4.61 4.62 4.63 4.64 4.65 CT Film 14” x 17” Each Cuff-able and Cleencuff Blood Pressure Cuffs with universal adaptor system compatible with NIBP monitor and Manual Sphygmomanometry 23-25cm (Adult) Each Cuff-able and Cleencuff Blood Pressure Cuffs with universal adaptor system compatible with NIBP monitor and Manual Sphygmomanometry 44-60cm (Thigh) Each Cuff-able and Cleencuff Blood Pressure Cuffs with universal adaptor system compatible with NIBP monitor and Manual Sphygmomanometry 33-45cm (Adult L) Each Cutter set Each Cuff-able and Cleencuff Blood Pressure Cuffs with universal adaptor system compatible with NIBP monitor and Manual Sphygmomanometry 17-25cm (S. adult) Each Cuff-able and Cleencuff Blood Pressure Cuffs with universal adaptor system compatible with NIBP monitor and Manual Sphygmomanometry 13-19cm (Child) Each Cuting cement Each D /Syringe 10ml with needle- should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized. Each D /Syringe 1m with needle- should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized. Each D /Syringe 2ml with needle- should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized. Each D /Syringe 20ml with needle- should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized. Each D /Syringe 50ml - should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized. Each D /Syringe 5ml with needle- should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized. Each Sterile Disposable syringe with Luer-Lock tip & without needle (should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized.)-5ml Each Sterile Disposable syringe with Luer-Lock tip & without needle (should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized.)-20ml Each Sterile Disposable syringe with Luer-Lock tip & without needle (should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized.)-1ml Each Disposable Cap Buffant type of non woven material with hemmed elastic seam -49-53cm top side dimension Each Sterile Disposable syringe with Luer-Lock tip & without needle (should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized.) 2ml Each Sterile Disposable syringe with Luer-Lock tip & without needle (should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized.)-10ml Each Sterile Disposable syringe with Luer-Lock tip & without needle (should be of good quality material and pack without any risk of breach in sterility. ETO/ Gamma sterilized.)-50ml Each Disposable Cap Beret type of non woven material - specification; top side diameter -18to 20cm; height 9 to 10 cm Each D/Needle 16G Each D/Needle 18G Each D/Needle 20G Each D/Needle 21G Each 52 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 4.66 D/Needle 22G Each 4.68 D/Needle 24G Each 4.67 4.69 4.7 4.71 4.72 4.73 4.74 4.75 4.76 4.77 4.78 4.79 4.8 4.81 4.82 4.83 4.84 4.85 4.86 4.87 4.88 4.89 4.9 4.91 4.92 4.93 4.94 4.95 4.96 4.97 D/Needle 23G Each D/Needle 26G Each D/Needle 27G Deluxe Anti-microbial Bain coaxial breathing systems (2 litre bag, 1.6 metre length and 0.8 metre limb) Dental stone Desenstising varnish) Each Each Each Each Destructive Operation Set Each Diamond cone shape bur Each Diamond round bur Each Diamond straight fissure bur Each Diathermy Pencil (Disposable Electro Surgical Pencil) Each Die stone Each Diposable Jet Nebuliser with T Piece (EO sterile) Each Disposable apron Plastic 17 x 48 Each Disposable Barium Enema Kit Disposable Dome Disposable dome, low priming volume, lock system and compatible with reusable transducer, with integrated flush system Each Each Disposable Draping sheet - Plain Each Disposable Draw Sheet 160cmx140cm) Each Disposable Draping sheet with central hole Each Disposable Ear buds Each Disposable Toothpick Each Disposable Eye drape - plain Each Diposable Eye Drape plain (Sterile) Each Disposable Face Mask (Cloth) Disposable 2 ply layered & multipleated mask with nose clip (green or blue) Particulate filtration efficiency (PFE) – 0.1 µ, Proven Bacterial filtration efficiency (BFE) & non-penetration to blood. Each Each Disposable 3 ply layered & multipleated mask with nose clip (green or blue) Particulate filtration efficiency (PFE) – 0.1 µ, Proven Bacterial filtration efficiency (BFE) & non-penetration to blood. Each Disposable Head Positioning Device for the Prone Position – Made of latex- free foam with mirror for providing the clinician a clear view of face, eye & endotrachael tube plus sloted design for positioning of Endotracheal on either side of the patient face 8000HDP Each Disposable glass Each Disposable Intraosseous Infusion Needle (Dieckmann Modification-Stainless Steel Hub Design/ Adjustable Flange) G10722 G07698 Each Disposable Kelly's Pad 53 Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 4.98 4.99 5 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.1 5.11 5.12 5.13 5.14 5.15 Disposable Mask (filtering Virus/Bacteria/Mycobacteria conforming to CDC guidelines) 3M mask N95 health care particulate respirator + surgical mask N95 Model 1870 Each Disposable Plastic Drape Sheet (plain) Each Disposable napkins Each Disposable Pressure Infusor Bags Large Squeeze Bulb, Three way stop cock, Crystal Clean Material for Maximum visibility of fluid levels, Sizes: 500ml Extension sets for Two & three ltr bags Each Disposable Pressure Infusor Bags Large Squeeze Bulb, Three way stop cock, Crystal Clean Material for Maximum visibility of fluid levels, Sizes: 1000ml, Extension sets for Two & three ltr bags Each DISPOSABLE REINFORCED TRACHEAL TUBE CUFFED Should have reinforced wire, Thermo sensitive clear PVC, Murphy eye, Profile Soft Seal Cuff, sensitive pilot balloon with one way valve ID of tube clearly marked on pilot balloon and tube, intubations depth marker, clear tube marking 15 mm connector with ISO 5356 and ISO 7228, CE marks. SIZE: 5 TO 9.0mm ID Each Disposable Shoe Cover -specification: Water repellent. Lint free material. Supple and non-irritating. Strong yet light in weight. Purpose oriented designs & colors. Superior bacteria filtration efficiency Each Disposable sterile surgical Gown for operating team - air permeable, fluid resistant, skin friendly, non-woven fabric - in a double sealed pack. Specification: 1. It should be made up of multi-layered fabric of high quality with outer thin fluid repellant layer, middle layers for fluid and bacterial control and the inner layer for overall strength. 2. It also should be of light weight material - 43 to 45 gsm. 3. It should be of stanadard adult size & below knee. 4. It should have adjustable neckline. 5. It should have easy hand entry features. 6. It should have overlapping back features. 7. The side tie should have a lengthy paper tag. 8. It should have ultrasonic bonded seams . 9. A hand towel made up of spun lace. 10. It should be of EN13795 compliant in standards. 11. The entire gown should have double pack after ETO sterilization. Each Disposable sterile surgical Gown for short ICU-procedures : air permeable, fluid resistant, skin friendly, non-woven fabric - in a double sealed pack - large size. With long sleeves and cuff of adequate size with 2 or 3 ties for the back side Each Sterile disposable surgical drapes (OT sheet - non-woven material - 70 x 70 cm with adhesive area of 14 x 18 cm in the centre. Each Disposable pressure transducer (full set) with Flush Device IV set and connection tube monitors in O.T. and ICU (invasive) Compatible with all regular Each Disposable surgeon Gown (Non- Sterile) Each Disposable syringes 1ml Heparinized Each Disposable Twin Bore Nasal Prone (EO Sterile) Adult Each Disposable Tongue depressor (wooden) Each Disposable Twin Bore Nasal Prone (EO Sterile) Pediatric Each Disposables Eye Towel with Drainage Bag DOUBLE LUMEN ENDOBRONCIAL TUBES (DISPOSABLE) Clear thermosensitive PVC, large smooth bore Lumina Low pressure SOFT SEAL CUFFS, non toxic implantation tested radio opaque line clear distance marking, colour coded & printed pilot balloons one way valves and must indicate bronchial and tracheal cuff Colour coded connector sealing caps, bifurcation adaptor and printed extension limbs must have Swivel connector, suction catheters and stylet Size: 28,32,35,37,39,41f RIGHT & LEFT 54 Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 5.16 Double Surface Phototherapy (CFL) Each 5.18 Draw sheet: size 72 inch x 36 inch (Blue colour) Each 5.17 5.19 5.2 5.21 5.22 5.23 5.24 5.25 5.26 5.27 5.28 5.29 5.3 5.31 5.32 5.33 5.34 5.35 5.36 5.37 5.38 5.39 5.4 5.41 5.42 5.43 5.44 5.45 5.46 5.47 5.48 5.49 5.5 Drape for knee arthroscopy Each Drive Gas Tube Each Dry view film (10 x 12)" - Kodak (100 sheets) Each Dry view film (10 x 12)" - Kodak (125 sheets) Each Dry view Film (8 x 10)" - Kodak (100 sheets) Each Dry view Film (8 x 10)" - Kodak (125 sheets) Each Dry View Films 14" x 17" - Kodak (100 sheets) Each Dry View Films 14" x 17" - Kodak (125 sheets) Each Durable fluoride -releasing coating Each DVT prevention stockings for legs Each DVT Pump disposable components/ accessories Each E.C.G Chest Bell (Adult) Each E.C.G Chest Bell (Pediatric) Each E.C.G Electrode (Kenny-1000) Each E.C.G Electrode (Kenny-1800) Each E.C.G Electrode (Kenny-3000) Each ECG Cable Connector Each ECG Cable with Lead Each ECG Chest Ball (Adult) Each ECG Chest Ball (Pediatric) ECG electrode 3M Disposable - Specification: Should be backing with breathable and flexible micropore tap; should be patented with solid gel; minimal skin irritation and premature dryout; pre-jelled/Lead lock. Each Each ECG electrode Disposable - Specification: Should be backing with breathable and flexible micropore tap; should be patented with solid gel; minimal skin irritation and premature dryout; pre-jelled/Lead lock. Each ECG Graph Paper (80 mm x 20 mtrs) Each ECG Graph Paper (63 mm x 20 mtr) Each ECG Thermal paper (210 x 295)mm for ECG Machine 12 Channels - Mindray - Beneheart R12 Each ECG Jelly (250 ml) ECG monitoring Electrode (Solid Hydrogel) ECG monitoring Electrode with foam backing ECG monitoring Electrode with foam backing ECG Paper - Z fold for AT-1 (90 x 90 x 400 shts) Each Each 2223 Each Large Each Each ECG paper (dot cart) 50 mm x 30 meteres for 6108T machine Each ECG Paper for BPL Cardiant ECG Machine Each ECG paper for BPL Cardiart 6208 (50 mm x 15 mtrs) Each 55 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 5.51 ECG paper for BPL Cardiart 8108R Each 5.53 ECG Paper Schiller AT-2/AT-2/Plus Each 5.52 5.54 5.55 5.56 5.57 5.58 5.59 5.6 5.61 5.62 5.63 5.64 5.65 5.66 5.67 5.68 5.69 5.7 5.71 5.72 5.73 5.74 5.75 5.76 5.77 5.78 5.79 5.8 5.81 5.82 5.83 5.84 5.85 5.86 ECG paper for BPL Cardiart ECG machine Model: 6208 view Each ECG paste 250ml /5 kg Each ECG Patient Cable (Adult) - BPL Cardiart 6208 Each ECG Patient cable (Adult) - Schiller AT1 Machine Each ECG Patient Cable (Pediatric) - BPL Cardiart 6208 Each ECG Patient cable (Pediatric) - Schiller AT1 Machine Echo tip needles for Ultrasound biopsy- length 10 cm to 20 cm. Gauge 18 to 24. EEG Gel paste efficient reading of mammogram Elastometric Infusion Pump for Analgesia Elastometric Infusion Pump for Analgesia Elbow crutch Each Each Each Elasto Adhesive Bandage 10cm x 4/6m Elasto Adhesive Bandage 8cm x 4/6m Each Each 5ml/hour 2ml/hour Each Model SV2 Elevators (Straight and Periostal) Elevators (Straight, W.gems, Apex, Periostac, Glass Burr, Cryers, Periostal) Eliza Printing paper (110 mm x 20 mtrs) Emergency Cricothyrotomy Device Adult 4mm ID Children 2mm ID Each Each Each Each Each Each Each Endomotor Each Endotracheal Tube 2.5mm (uncuffed) Each Endotracheal Tube 2mm (uncuffed) Each Endotracheal Tube 3.0mm (cuffed) Each Endotracheal Tube 3.0mm (uncuffed) Each Endotracheal Tube 3.5mm (cuffed) Each Endotracheal Tube 3.5mm (uncuffed) Each Endotracheal Tube 4.0mm (cuffed) Each Endotracheal Tube 4.0mm (uncuffed) Each Endotracheal Tube 4.5mm (cuffed) Each Endotracheal Tube 4.5mm (uncuffed) Each Endotracheal Tube 5.0mm (cuffed ) Each Endotracheal Tube 5.0mm (uncuffed ) Each Endotracheal Tube 5.5mm (cuffed) Each Endotracheal Tube 5.5mm (uncuffed) Each Endotracheal Tube 6.0mm (cuffed) Each 56 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 5.87 Endotracheal Tube 6.0mm (uncuffed) Each 5.89 Endotracheal Tube 6.5mm (uncuffed) Each 5.88 5.9 5.91 5.92 5.93 5.94 5.95 5.96 5.97 5.98 5.99 6 Endotracheal Tube 6.5mm (cuffed) Each Endotracheal Tube 7.0mm (cuffed) Each Endotracheal Tube 7.0mm (uncuffed) Each Endotracheal Tube 7.5mm (cuffed) Each Endotracheal Tube 7.5mm (uncuffed) Each Endotracheal Tube 8.0mm (cuffed) Each Endotracheal Tube 8.0mm (uncuffed) Each Endotracheal Tube 8.5mm (cuffed) Each Endotracheal Tube 8.5mm (uncuffed) Each Endotracheal Tube 9.0mm (cuffed) Each Endotracheal Tube 9.0mm (uncuffed ) ENDOTRACHEAL TUBE CUFFED Thermosencitive clear PVC, radio-opaque blue-line, Murphy eye, Profile Soft Seal Cuff, sensitive pilot balloon with one way valve ID of tube clearly marked on pilot balloon and tube, distinctive blue inflation line, intubations depth marker, clear tube marking 15 mm connector with ISO 5356 and ISO 7228, CE marks.SIZE: 5 TO 9.5mm ID Each Each 6.01 ENDOTRACHEAL TUBE CUFFED WITH SUCTION DEVICE Thermosensitive clear PVC, radio-opaque blue-line, Murphy eye, colored suction lumen with suction hole located above the cuff Profile Soft Seal Cuff, larger cuff resting diameter, sensitive pilot balloon with one way valve ID of tube clearly marked on pilot balloon and tube, distinctive blue inflation line, intubations depth marker, clear tube marking 15 mm connector with ISO 5356 and ISO 7228, CE marks.SIZE: 6, 6.5, 7, 7.5, 8, 8.5, 9mm ID Each 6.02 Endotracheal Tube Stylet (Big) Each 6.04 Endotracheal Tube Stylet (Small) Each 6.03 6.05 6.06 6.07 6.08 6.09 6.1 6.11 6.12 6.13 6.14 6.15 6.16 6.17 Endotracheal Tube Stylet (Medium) Each Endotracheal Tube without cuff 2 Endotracheal Tube without cuff Endotracheal Tube without cuff Each 2.5 3 Endotracheal Tube without cuff 3.5 Endotracheal Tube without cuff 4.5 Endotracheal Tube without cuff Each Each Each 4 Each Each Endotracheal Tube without cuff 5 ENDOTRACHEAL TUBES UNCUFFED SILICONISED PVC, non-toxic to tissues Implantation tested Should have 15mm connector confirming to ISO 5356-1 1cm marking on both side of tube Bevel with Murphy eye Radiopaque line with CE mark Size from 2.0 to 6.0mm ID Each Each EndotrachealTube 2.5mm (cuffed) Each Endowash Each EndotrachealTube 2mm (cuffed) Each Envelop for keeping X-Ray Film (Large) Each Epidural Needle Size. 16G Each 57 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 6.18 Epidural Needle Size. 17G Each 6.2 Ergo Belt (For TMT Machine - CS 200) Each 6.19 6.21 6.22 6.23 6.24 6.25 6.26 6.27 6.28 6.29 6.3 6.31 6.32 6.33 6.34 6.35 6.36 6.37 6.38 6.39 6.4 6.41 6.42 6.43 6.44 6.45 6.46 6.47 6.48 6.49 6.5 6.51 6.52 6.53 Epidural Needle Size. 18G Each Ergo Belt (TMT Machine CS-200) ET tube (Latex) cuffed, flexometallic Armoured Ch 30 ET tube (Latex) cuffed, flexometallic Armoured Ch 34 ET tube (Latex) cuffed, flexometallic Armoured Each Ch 32 ET tube (Latex) cuffed, flexometallic Armoured Each Each Ch 36 ET tube (Latex) cuffed, flexometallic Armoured Flexo-metallic cuff endotracheal tube ( size 6mm Each Each Ch 38 Each Each Flexo-metallic cuff endotracheal tube ( size 7.5mm) Each Flexo-metallic cuff endotracheal tube ( size 7mm) Each Flexometallic edotrachael Tubes size 6 Each Flexometallic edotrachael Tubes size 6.5 Each Flexometallic edotrachael Tubes size 7 Flexometallic edotrachael Tubes size 7.5 ET tube (PVC) cuffed, flexometallic Armoured. ET tube (PVC) cuffed 5 ET tube (PVC) cuffed 5.5 ET tube (PVC) cuffed 6.5 ET tube (PVC) cuffed ET tube (PVC) cuffed Each 3.0 mm to 8.5 mm Each Each Each 6 Each Each 7 ET tube (PVC) cuffed 7.5 ET tube (PVC) cuffed 8.5 ET tube (PVC) cuffed Each Each Each 8 Each Each ET Tube Cuff Pressure Detector Manometer Each Excavator (Small ) Each Excavator (Big) Each Extraction forcep for adult (Set of 14) Each Extraction forcep for pedo (Set of 6) EYE PAD/Dress (Adhesive Dressing Absorbent Cotton pad in an absorbent overwrap) Eye wear for composite fillings Face guard Each Each Each Each N-95 Mask for protection against swine flu Each Face Mask with Shield ( FS1818) Each Female catheters C.P. Each 58 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 6.54 Tracheostomy set 6.56 Fenestrated low-pressure cuffed Tracheostomy tube 6.55 6.57 6.58 6.59 6.6 6.61 6.62 6.63 6.64 6.65 6.66 6.67 6.68 6.69 6.7 6.71 6.72 6.73 6.74 6.75 6.76 6.77 6.78 6.79 6.8 6.81 6.82 6.83 6.84 6.85 Fenestrated low-pressure cuffed Tracheostomy tube Fenestrated low-pressure cuffed Tracheostomy tube Fenestrated low-pressure cuffed Tracheostomy tube Each 5.0 mm ID Each 6.5 mm ID Each 7.5mm ID Each 5.0 mm ID 6.5 mm ID 7.5mm ID FENESTRATED TRACHEOSTOMY KIT • Should have Blue Line Ultra Fenestrated Tracheostomy Tube with Profile Soft Seal Cuff • Should have Speaking Valve • Should have two Inner Cannula • Should have Cleaning Brush and Tracheostomy StrapSensitive pilot balloon, it should indicate tube size• size:7 Each Each FENESTRATED TRACHEOSTOMY KIT • Should have Blue Line Ultra Fenestrated Tracheostomy Tube with Profile Soft Seal Cuff • Should have Speaking Valve • Should have two Inner Cannula • Should have Cleaning Brush and Tracheostomy StrapSensitive pilot balloon, it should indicate tube size• size:7.5 Each FENESTRATED TRACHEOSTOMY KIT • Should have Blue Line Ultra Fenestrated Tracheostomy Tube with Profile Soft Seal Cuff • Should have Speaking Valve • Should have two Inner Cannula • Should have Cleaning Brush and Tracheostomy StrapSensitive pilot balloon, it should indicate tube size• size:9 Each Fibre Optic Phototherapy Lamp (Billi Blanket) Each FENESTRATED TRACHEOSTOMY KIT • Should have Blue Line Ultra Fenestrated Tracheostomy Tube with Profile Soft Seal Cuff • Should have Speaking Valve • Should have two Inner Cannula • Should have Cleaning Brush and Tracheostomy StrapSensitive pilot balloon, it should indicate tube size• size:8 Each Fever Patch (Cooling Theraphy) Each Fibre Optic Phottotherapy Lamp Each Fibre post (yellow, red & blue) Each Fibre splint Each Files (all sizes) Each Film dryer for 50 films Each Fixed Elbows for direct connection Model 1993 Each Fixed Elbows for direct connection Model 2714 Each Fixer /Developer Powder for manual processing for 5 gallon each –pk Each Flame shaped diamond bur (Polishing bur) Each Flame shaped file (Polishing bur) Flexitip Laryngoscope blade compatible with macintosh handle MAC-2 blade Flowable composite Fluid Warming Cassette (Disposable) WF-250 MAC-3 blade Mac-4 blade Each Each Each Each Fluid Warming Cassette (Disposable) WF-100 Each Foley’s Catheter size 6 FG Each Foley’s Catheter size 8 FG Each Foley’s Catheter size 10 FG Each Foley’s Catheter size 12 FG Each Foley’s Catheter size 14 FG Each Foley’s Catheter size 16 FG Each Foley’s Catheter size 18 FG Each 59 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 6.86 Foley’s Catheter size 2-way 10 FG Each 6.88 Foley’s Catheter size 2-way 14 FG Each 6.87 6.89 6.9 6.91 6.92 6.93 6.94 6.95 6.96 6.97 6.98 6.99 7 7.01 7.02 7.03 7.04 7.05 7.06 7.07 7.08 7.09 7.1 7.11 7.12 7.13 7.14 7.15 7.16 7.17 7.18 7.19 7.2 Foley’s Catheter size 2-way 12 FG Each Foley’s Catheter size 2-way 16 FG Each Foley’s Catheter size 2-way 18 FG Each Foley’s Catheter size 2way 6 FG Each Foley’s Catheter size 2-way 8 FG Each Foley’s Catheter size 3-way 10 FG Each Foley’s Catheter size 3-way 12 FG Each Foley’s Catheter size 3-way 14 FG Each Foley’s Catheter size 3-way 16 FG Each Foley’s Catheter size 3-way 18 FG Each Foley’s Catheter size 3-way 8 FG Each Foley Catheter size 20 FG (3 way) Each Foley Catheter size 22 FG (3 way) Each Foot operated suction machine Each for ICU/Anesthesiology Dept (Bone View T8 Cardiac Monitor – Mindray) Each Forcep for adult (set of 14) Each Forcep for pedo (set of 6) Each Formalin Chamber Formocresol /Cresophene Freka Nasoduodenal Tube Freka Nasoduodenal Tube Each Each 12 CH/FR 15 CH/FR Frova Intubating Introducers (with rapi-fit adapters) G -coat plus Each Each G12591 G13307 Each Each G06052600 Expiratory Filter (Disposable Each G06122300 Reusable Simplified Breathing Circuit With Water Trap (Pediatric) Galileo/Raphael/Arabella Oxygen Cell (catalyst) compatible for Galileo Ventilator Gas Sampling/Monitoring line (ETCO2) – male/male Luer Lock connectors, Gauze - than 36" x 20 yds Gauze swabs 7.5 X 7.5 cm -12 Ply 2 metre Gauze than 90cm x 18 m - specification; Threads Per d/m :- Warp not less than 75 and weft not less than 55; Weight in g/ms2 :- 30+_5; Length and Width :- Not less than 98% each of the length and width stated; Absorbency :- Average sinking time not more than 10 seconds. Each Each Each Each Each Each GIC Cement (Light cure) A2 shade Each Fiber Optics Air Motor Hand Pieces with Coupling Unit Each GIC filling instrument set Each 60 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 7.21 RC CAL (Intra Canal Dressing Paste) Each 7.23 Gingival retraction cord Each 7.22 7.24 7.25 7.26 7.27 7.28 Gigly Saw Each Glass bead sterilizer Each Glass Syringe 100cc Each Glass Syringe 5cc Each Glossy paper for Endoscopy (UPC 2000 series) - SONY Sterile disposable polymer coated and (polyurethane) siliconated powder-free natural latex surgical glove of standard color designed for long hour operations. (The original brochure containing all the properties must be attached with the quote) Specifications a) Should be polymer coated and (polyurethane) siliconated powder-free natural latex surgical glove with low protein levels of 50 µg / dm2 or less. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa iii) Force at break - 12 N and also should have the qualities of : iv) ease of donning and double gloving (ultimate elongation to 750% before ageing and 560% after ageing) iv) Reduction of reflective glare. Size 6 Each Each 7.29 Sterile disposable polymer coated and (polyurethane) siliconated powder-free natural latex surgical glove of standard color designed for long hour operations. (The original brochure containing all the properties must be attached with the quote) Specifications a) Should be polymer coated and (polyurethane) siliconated powder-free natural latex surgical glove with low protein levels of 50 µg / dm2 or less. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa iii) Force at break - 12 N and also should have the qualities of : iv) ease of donning and double gloving (ultimate elongation to 750% before ageing and 560% after ageing) iv) Reduction of reflective glare. Size 6.5 Each 7.3 Sterile disposable polymer coated and (polyurethane) siliconated powder-free natural latex surgical glove of standard color designed for long hour operations. (The original brochure containing all the properties must be attached with the quote) Specifications a) Should be polymer coated and (polyurethane) siliconated powder-free natural latex surgical glove with low protein levels of 50 µg / dm2 or less. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa iii) Force at break - 12 N and also should have the qualities of : iv) ease of donning and double gloving (ultimate elongation to 750% before ageing and 560% after ageing) iv) Reduction of reflective glare. Size 7 Each 61 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 7.31 7.32 7.33 Sterile disposable polymer coated and (polyurethane) siliconated powder-free natural latex surgical glove of standard color designed for long hour operations. (The original brochure containing all the properties must be attached with the quote) Specifications a) Should be polymer coated and (polyurethane) siliconated powder-free natural latex surgical glove with low protein levels of 50 µg / dm2 or less. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa iii) Force at break - 12 N and also should have the qualities of : iv) ease of donning and double gloving (ultimate elongation to 750% before ageing and 560% after ageing) iv) Reduction of reflective glare. Size 7.5 Each Sterile disposable polymer coated and (polyurethane) siliconated powder-free natural latex surgical glove of standard color designed for long hour operations. (The original brochure containing all the properties must be attached with the quote) Specifications a) Should be polymer coated and (polyurethane) siliconated powder-free natural latex surgical glove with low protein levels of 50 µg / dm2 or less. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa iii) Force at break - 12 N and also should have the qualities of : iv) ease of donning and double gloving (ultimate elongation to 750% before ageing and 560% after ageing) iv) Reduction of reflective glare. Size 8 Each Sterile disposable polymer coated powder-free natural latex surgical glove of standard colour used for general routine operations. (The original brochure containing all the properties must be attached with the quote) Each Sterile disposable polymer coated powder-free natural latex surgical glove of standard colour used for general routine operations. (The original brochure containing all the properties must be attached with the quote) Each Specifications a) Should be polymer powder-free natural latex surgical glove with low protein levels of 50 µg / dm2 or less and powder residue < 2mg per glove. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa iii) Force at break - 9 N and also should have the qualities of: iv) ultimate elongation to 750% before ageing and 560% after ageing Size 6 7.34 Specifications a) Should be polymer powder-free natural latex surgical glove with low protein levels of 50 µg / dm2 or less and powder residue < 2mg per glove. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa iii) Force at break - 9 N and also should have the qualities of: iv) ultimate elongation to 750% before ageing and 560% after ageing Size 6.5 62 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 7.35 Sterile disposable polymer coated powder-free natural latex surgical glove of standard colour used for general routine operations. (The original brochure containing all the properties must be attached with the quote) Each Sterile disposable polymer coated powder-free natural latex surgical glove of standard colour used for general routine operations. (The original brochure containing all the properties must be attached with the quote) Each Sterile disposable polymer coated powder-free natural latex surgical glove of standard colour used for general routine operations. (The original brochure containing all the properties must be attached with the quote) Each Sterile disposable polymer coated powder-free natural latex surgical 'brown / green / blue COLORED UNDER GLOVE for alerting holes in the next glove- hand specific, curved finger type with beaded cuff and micro rough texture (The original brochure containing all the properties must be attached with the quote) Specifications: a) Should be polymer powder-free natural latex surgical glove with low protein levels of 50 µg/dm2 or less and powder residue < 2mg per glove. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa, iii) Force at break - 9 N, and also should have the iv) Ultimate elongation to 750% before ageing and 560% after ageing. Size 6 Each Specifications a) Should be polymer powder-free natural latex surgical glove with low protein levels of 50 µg / dm2 or less and powder residue < 2mg per glove. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa iii) Force at break - 9 N and also should have the qualities of: iv) ultimate elongation to 750% before ageing and 560% after ageing Size 7 7.36 Specifications a) Should be polymer powder-free natural latex surgical glove with low protein levels of 50 µg / dm2 or less and powder residue < 2mg per glove. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa iii) Force at break - 9 N and also should have the qualities of: iv) ultimate elongation to 750% before ageing and 560% after ageing Size 7.5 7.37 Specifications a) Should be polymer powder-free natural latex surgical glove with low protein levels of 50 µg / dm2 or less and powder residue < 2mg per glove. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa iii) Force at break - 9 N and also should have the qualities of: iv) ultimate elongation to 750% before ageing and 560% after ageing Size 8 7.38 63 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 7.39 7.4 Sterile disposable polymer coated powder-free natural latex surgical 'brown / green / blue COLORED UNDER GLOVE for alerting holes in the next glove- hand specific, curved finger type with beaded cuff and micro rough texture (The original brochure containing all the properties must be attached with the quote) Specifications: a) Should be polymer powder-free natural latex surgical glove with low protein levels of 50 µg/dm2 or less and powder residue < 2mg per glove. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa, iii) Force at break - 9 N, and also should have the iv) Ultimate elongation to 750% before ageing and 560% after ageing. Size 6.5 Each Sterile disposable polymer coated powder-free natural latex surgical 'brown / green / blue COLORED UNDER GLOVE for alerting holes in the next glove- hand specific, curved finger type with beaded cuff and micro rough texture (The original brochure containing all the properties must be attached with the quote) Each Sterile disposable polymer coated powder-free natural latex surgical 'brown / green / blue COLORED UNDER GLOVE for alerting holes in the next glove- hand specific, curved finger type with beaded cuff and micro rough texture (The original brochure containing all the properties must be attached with the quote) Each 7.42 Sterile disposable polymer coated powder-free natural latex surgical 'brown / green / blue COLORED UNDER GLOVE for alerting holes in the next glove- hand specific, curved finger type with beaded cuff and micro rough texture (The original brochure containing all the properties must be attached with the quote) Specifications: a) Should be polymer powder-free natural latex surgical glove with low protein levels of 50 µg/dm2 or less and powder residue < 2mg per glove. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa, iii) Force at break - 9 N, and also should have the iv) Ultimate elongation to 750% before ageing and 560% after ageing. Size 8 Each 7.43 Sterile disposable polymer coated powder-free natural latex gloves for medical examination (Individually packed ambidextrous, powder-free) -Large Each Sterile disposable polymer coated powder-free natural latex gloves for medical examination (Individually packed ambidextrous, powder-free) -Small Each Specifications: a) Should be polymer powder-free natural latex surgical glove with low protein levels of 50 µg/dm2 or less and powder residue < 2mg per glove. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa, iii) Force at break - 9 N, and also should have the iv) Ultimate elongation to 750% before ageing and 560% after ageing. Size 7 7.41 Specifications: a) Should be polymer powder-free natural latex surgical glove with low protein levels of 50 µg/dm2 or less and powder residue < 2mg per glove. b) Should have high level of tactile sensitivity, secure grip and good resistance to tear with: i) Tensile strength of 24 Mpa before ageing and 18 Mpa after ageing ii) Stress at 500% elongation - 5.5 Mpa, iii) Force at break - 9 N, and also should have the iv) Ultimate elongation to 750% before ageing and 560% after ageing. Size 7.5 7.44 7.45 7.46 Sterile disposable polymer coated powder-free natural latex gloves for medical examination (Individually packed ambidextrous, powder-free) -Medium Each Sterile Single Use Rubber Examination Gloves -Specification :Single Use Sterile Rubber Examination Gloves conforming to IS:15354/2003 with Amdt. No. 1 - Size 6 Each 64 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 7.47 7.48 7.49 7.5 7.51 7.52 7.53 7.54 7.55 7.56 7.57 7.58 7.59 7.6 7.61 7.62 7.63 7.64 7.65 7.66 7.67 7.68 7.69 7.7 7.71 7.72 7.73 7.74 Sterile Single Use Rubber Examination Gloves -Specification :Single Use Sterile Rubber Examination Gloves conforming to IS:15354/2003 with Amdt. No. 1 - Size 6.5 Each Sterile Single Use Rubber Examination Gloves -Specification :Single Use Sterile Rubber Examination Gloves conforming to IS:15354/2003 with Amdt. No. 1 - Size 7.5 Each Non Sterile Single Use Rubber Examination Gloves - Specification: Single Use Non-Sterile Rubber Examination Gloves conforming to IS:15354/2003 with Amd. No.1 -Size Large Each Non Sterile Single Use Rubber Examination Gloves - Specification: Single Use Non-Sterile Rubber Examination Gloves conforming to IS:15354/2003 with Amd. No.1 -Size Small Each Disposable PVC (plastic) gloves - of 45 G thickness - (Transparent, Universal fitting size, soft & flexible, latex free, powder free. ) -Size Medium Each Gluma densitizer Each GP cutter Each Sterile Single Use Rubber Examination Gloves -Specification :Single Use Sterile Rubber Examination Gloves conforming to IS:15354/2003 with Amdt. No. 1 - Size 7 Each Sterile Single Use Rubber Examination Gloves -Specification :Single Use Sterile Rubber Examination Gloves conforming to IS:15354/2003 with Amdt. No. 1 - Size 8 Each Non Sterile Single Use Rubber Examination Gloves - Specification: Single Use Non-Sterile Rubber Examination Gloves conforming to IS:15354/2003 with Amd. No.1 -Size Medium Each Disposable PVC (plastic) gloves - of 45 G thickness - (Transparent, Universal fitting size, soft & flexible, latex free, powder free. ) -Size Large Each Disposable PVC (plastic) gloves - of 45 G thickness - (Transparent, Universal fitting size, soft & flexible, latex free, powder free. ) -Size Small Each Gonad shield (Kiran) Each Tungsen Carbide Burs for Air Rotor and Micro Motor Hand Pieces Each GP holder GP Single Cone (F2 to F6) Green PVC tubing for oxygen Each Each 6 mm, Length in metres Green sensitive double sided emulsion coated X-ray films for medical Photography in sheet form in the nominal sizes -10” x 8” 100 sheets Each Each Green sensitive double sided emulsion coated X-ray films for medical Photography in sheet form in the nominal sizes -12” x 10” 100 sheets Each Green sensitive double sided emulsion coated X-ray films for medical Photography in sheet form in the nominal sizes -14” x 14” 100 sheets Each Green sensitive double sided emulsion coated X-ray films for medical Photography in sheet form in the nominal sizes -17” x 14” 100 sheets Each Green Stick Each Green sensitive double sided emulsion coated X-ray films for medical Photography in sheet form in the nominal sizes -12” x 12” 100 sheets Each Green sensitive double sided emulsion coated X-ray films for medical Photography in sheet form in the nominal sizes -15” x 12” 100 sheets Each Green sensitive double sided emulsion coated X-ray films for medical Photography in sheet form in the nominal sizes -8.5”x 6.5” 125 sheets Each Griggs dilating forceps Kit for Percutaneous Tracheostomy Each Griggs dilating forceps Kit for Percutaneous Tracheostomy Guedel Airway 0.00 7 8 Each Each 65 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 7.75 Guedel Airway 0 Each 7.77 Guedel Airway Size 2 Each 7.76 7.78 7.79 7.8 7.81 7.82 7.83 7.84 7.85 7.86 7.87 7.88 7.89 7.9 7.91 7.92 7.93 7.94 7.95 7.96 7.97 7.98 7.99 8 8.01 8.02 8.03 8.04 8.05 8.06 8.07 8.08 8.09 8.1 Guedel Airway Size 1 Each Guedel Airway Size 3 Each Guedel Airway Size 4 Each Guedel Airway with integral bite (Safar by design) 0 Each Guedel Airway with integral bite (Safar by design) 2 Each Guedel Airway with integral bite (Safar by design) 00 Each Guedel Airway with integral bite (Safar by design) 000 Each Guedel Airway with integral bite (Safar by design) 1 Each Guedel Airway with integral bite (Safar by design) 3 Each Guedel Airway with integral bite (Safar by design) 4 Each Guide - wire (PTFE coated) Size: 0.025″, 150 cm long, straight tip Each Guide - wire (PTFE coated) Size: 0.035″, 150 cm long, straight tip Each Guide wire (70cm) Each Guide wire (70cm) Rounded Each Guide wire (J Curve) Each Guide wire (St Curve) Each Gum Boot - Half - Size- 5,6,7,8,9,10 Each Gum Boot - Knee length - Size - 5,6,7,8,9,10 Each Gynae sheet 105cmx75cm Each Gynaecological sterile glove ( Elbow length) Each H files (all sizes) Each Polishing Rubber cups and Bristle Each Applicator Tips for LC Each Hack saw with blade medium Each Hack saw with blade small Each Hand operated suction machine Each Hand piece lubricant Each Hand protaper file (Sx to F6) Each Hand scaler set Each Handpiece for airotor Each Handpiece lubricant Each Handyplast Each Head Halter Frame for Cervical spine Each Head Protection (Kiran) Each 66 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 8.11 8.12 8.13 8.14 8.15 8.16 8.17 8.18 8.19 8.2 8.21 8.22 8.23 8.24 8.25 8.26 8.27 8.28 8.29 8.3 8.31 8.32 8.33 8.34 8.35 8.36 8.37 8.38 8.39 8.4 8.41 8.42 8.43 8.44 Heat & Moisture Exchanger for Tracheostomy Tube Light Weight, Not More than 15gm HME output 25 mg H2O/L Low Space, Resistance 2mmH2O for Spontaneously Obreathing Patients Can be use for Paediatric and Adult Patients Each Heat and Moisture Exchanging Filter (HME) for Tracheostomy Tracheolite Each Heat and Moisture Exchanging Filter (HME) – Efficiency 99.999% Model 1941001 Each Heat and Moisture Exchanging Filter (HME) with Flexible catheter mount and Luer lock port Model 1541351 Each Heater Coil Heating Element 6 KW Each Heating Element with Lead (Capacity: 6KW) Hi-lo evac Endotracheal Tube Size 7.5 Hi-lo evac Endotracheal Tube Size 8.5 Hi-lo evac Endotracheal Tube Hi-Low Evac ET Tube 6.5mm Each Each Each Size 8 Each Each Each Hi-Low Evac ET Tube 7.00mm Each Hi-Low Evac ET Tube 7.5mm Each Hi-Low Evac ET Tube 8.00mm Each Hi-Low Evac ET Tube 8.5mm Each Haemmo Dialysis Catheter 10 Size Each Haemmo Dialysis Catheter 12Size Each Haemmo Dialysis Catheter 14 Size Each Haemmo Dialysis Catheter 16 Size HME with Filter Should have pleated, hydrophobic elements, gas sampling port Transparent housing, 15/22mm connector IOS 5356 standard Bacterial filtration = 99.99999% Viral flirtation = 99.999% dead space 45ml, tidal volume 150 to 1200ml. Sterile, with CE marks. Can be used for adult & paed. Each Each Horizontal Pre vacuum steam sterilizer (Manual) size:diametre 500mmx1200mm Each Hot plate Each Hose Mounts: 22mm female male pair, 15mm female male pair HTF SPM Each Each Humbreys skin grafting knife (frame) Humidifier with accessories (Temperature Sensor ) Compatible with Galeleo Gold Ventilator I U I Catheter I.V. Cannula 10FG Each Each Each Each I.V. Cannula 12FG Each I.V. Cannula 14FG Each I.V. Cannula 16FG Each I.V. Cannula 18FG Each I.V. Cannula 20FG Each I.V. Cannula 22FG Each 67 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 8.45 I.V. Cannula 23FG Each 8.47 I.V. Cannula 8FG Each 8.46 8.48 8.49 8.5 8.51 8.52 8.53 8.54 8.55 8.56 8.57 8.58 8.59 8.6 8.61 8.62 8.63 8.64 8.65 8.66 8.67 8.68 8.69 8.7 8.71 8.72 8.73 8.74 8.75 8.76 8.77 8.78 I.V. Cannula 24FG Each I.V. Cannula Without wings & port, FEP material with radiopaque catheter Sizes: 14Gx50mm, 16Gx50mm, 18Gx45mm, 18Gx32mm, 20Gx45mm, 20Gx32mm, 22Gx25mm, 24Gx19mm Each I.V. Drip Set with Y connector set - with airvent and a regulator. (Non-toxic, pyrogen free; non-kinking quality; Pack without any risk of breach in sterility, ETO/ Gamma sterilized). Each Sterile disposable infusion (IV) set - with airvent and a regulator. (Non-toxic, pyrogen free; non-kinking quality; Pack without any risk of breach in sterility, ETO/ Gamma sterilized). Each IBP sensor port Each I.V. Drip Set without Y connector set - with airvent and a regulator. (Non-toxic, pyrogen free; non-kinking quality; Pack without any risk of breach in sterility, ETO/ Gamma sterilized). Each IBP Cable Each ICG Electrodes Each ICG Leads Each Impression compound Each Impression tray (0 -4 size) Each Impression trays Each Indirect Laryngoscope Mirror Each Infant Bonnet 17-22cm (Fisher & Paykel) Each Infant Bonnet 22-25cm (Fisher & Paykel) Each Infant Bonnet 25-30cm (Fisher & Paykel) Each Infant feeding tube 10 FG Each Infant feeding tube 4 FG Each Infant feeding tube 5 FG Each Infant feeding tube 6 FG Each Infant feeding tube 7 FG Each Infant feeding tube 8 FG Each Infant feeding tube 9 FG Each Infant flow Sensor box of 10 (compatible for Galileo Gold Ventilator) Each Infantometer Each Inj HAM F10 Each Inj Plastic Pallet Each Instrument tray - plastic Each Insulin syringe 1ml Intravascular retrieval sets Intravenous Extension tube with 3-way stop cork Introducer Needle Each Each 200cms Each Each 68 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 8.79 Ioban - 2 Each 8.81 Ioban 6650 Each 8.8 8.82 8.83 8.84 8.85 8.86 8.87 8.88 8.89 8.9 Ioban 6640 Each Iodixannol 320 mg Iodine/ml-100 ml. Each Iohexol 300 mg-Iodine/ml 100 ml Each Iomeron 400 mg/ml – 50 ml. Each Ioversol/Iopamide/Iopamidol – 50 ml. ISO Green Standard Laryngoscope System (Disposable plastic blades) 7 sizes of MAC and Miller blades IUI Cannula IV Cannula with side port IV Cannula with side port Size 14 Size 16 8.91 8.93 Jetvent Catheters 8.94 8.95 8.96 8.97 8.98 8.99 9 9.01 9.02 9.03 9.04 9.05 9.06 9.07 9.08 9.09 9.1 9.11 9.12 9.13 9.14 JESS fixtators pediatric/large Each Each Karman Cannula 12G Each Karman Cannula 14G Each Karman Cannula 16G Each Karman Cannula 6G Each Karman Cannula 8G Each Kehr’s T-Tube 8 Each Kehr's "T" tube 10 Each Kehr's "T" tube 12 Each Kehr's "T" tube 14 Kidney/Liver Biopsy Needle Adult Each Each Karman Cannula 10G Kendall SCD Express (Knee Length Medium) Each Each K files (all sizes) Kendall SCD Express (Knee Length Medium) Each Each Kinesiology Color Tap/Taping for Orthopaedic used Kendall SCD Express (Knee Length Medium) Each Each Jobson's Probe Kehr's "T" tube 16 Each Each Jackson-Rees Paediatric T-piece anaesthetic breathing circuit (Breathing system with 0.5 litre open tail bag, 1.8 metre length) Jelly for Ultrasound 8.92 Each Each Each 73012 Each 73022 Each 73023 Each Each Kidney/Liver Biopsy Needle Child Each Killian's Nasal Speculum KIRAN Green sensitive cassette with Intensifying Screens– High Speed Only -10” x 8” 69 Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 9.15 KIRAN Green sensitive cassette with Intensifying Screens– High Speed Only -12” x 10” Each 9.17 KIRAN Green sensitive cassette with Intensifying Screens– High Speed Only -12” x 6” Each 9.16 9.18 9.19 9.2 9.21 9.22 9.23 9.24 9.25 9.26 9.27 9.28 9.29 9.3 9.31 9.32 9.33 9.34 9.35 9.36 9.37 9.38 9.39 9.4 9.41 9.42 9.43 9.44 9.45 9.46 9.47 9.48 9.49 9.5 KIRAN Green sensitive cassette with Intensifying Screens– High Speed Only -12” x 12” KIRAN Green sensitive cassette with Intensifying Screens– High Speed Only -14” x 14” KIRAN Green sensitive cassette with Intensifying Screens– High Speed Only -15” x 12” KIRAN Green sensitive cassette with Intensifying Screens– High Speed Only -15” x 6” KIRAN Green sensitive cassette with Intensifying Screens– High Speed Only -17” x 14” KIRAN Green sensitive cassette with Intensifying Screens– High Speed Only -8.5” x 6.5” KIRAN Green sensitive Intensifying screens 10” x 8” KIRAN Green sensitive Intensifying screens 12” x 10” Each Each Each Each Each Each Each Each KIRAN Green sensitive Intensifying screens 12” x 12” Each KIRAN Green sensitive Intensifying screens 12” x 6” Each KIRAN Green sensitive Intensifying screens 14” x 14” Each KIRAN Green sensitive Intensifying screens 15” x 6” Each KIRAN Green sensitive Intensifying screens 17” x 14” Each KIRAN Green sensitive Intensifying screens 8.5” x 6.5” Each Klik Clamp/Vascular Cord Clamp Each K-Wires: 1.8mm Each K-Wires: 4mm Each K-Wires: 1.5 mm Each K-Wires: 2.5 mm Each K-Wires: 2mm Each K-Wires: 3mm Each Laryngoscope (Standard Reusable) All size Blades Each Laryngoscope Bulb long thread short thread Each Laser compatible ET & Tubes Each LCD X-ray film view box of various sizes Each Lead apron : COAT TYPE Size : S/M/B ( Lead) (Kiran) Each Lead apron : COAT TYPE Size : S/M/B ( Leadlite) (Kiran) Each Lead apron : DOUBLE -SIDED Size : S/M/B ( Leadlite) (Kiran) Each Lead apron : DOUBLE -SIDED Size : S/M/B ( Lead) (Kiran) Each Lead Aprons (shirt type) Each Lead Aprons (skirt type) Each LEAD DENTAL APRON (Kiran) Each Lead divider 14" x 7" Each Lead divider 15" x 6" Each 70 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 9.51 Lead Divider 15” x 6” Each 9.53 Lead Free Radiation Protection Gloves GLF 35 (Disposable) (Kiran) Each 9.52 9.54 9.55 9.56 9.57 9.58 9.59 9.6 9.61 9.62 9.63 9.64 9.65 9.66 9.67 9.68 9.69 9.7 9.71 9.72 9.73 9.74 9.75 9.76 9.77 9.78 9.79 9.8 9.81 9.82 9.83 9.84 9.85 9.86 Lead Divider 17” x 9” Each Lead Numbers (Numerical & Alphabet) Each LEAD SKIRT & VEST Size : S/M/B (Zero Lead/Leadlite) (Kiran) Each Lifetrack(500ml) pressure bag Each Light body Each Light cure composite nano-filling materials Each Light cure base cement Each Light cure bulbs Each Light cure machine Each Light cure machine (cordless) Each Light curing nano ionomer restorative Light wand for oral tracheal intubation (Illuminating stylet for single-patient use with reusable hand) Light weight lead apron of various sizes - Kiran Liquid Fixer and developer-20 liters each. Local Brands supplied till date are woefully substandard and put the patient’s life at risk Macet /Hammer Macintosh Style blades 2, 4 Magill’s forceps Adult Magnet for ECG child Medi Crossed Corset Lumbamed basic Each Each Each Each Each Each infant Each Each Male catheters Each Malecot Catheter 10F (Nephrostomy Catheter) Each Malecot Catheter 12F (Nephrostomy Catheter) Each Malecot Catheter 18F length 30cm Each Malecot Catheter 20F length 30cm Each Malecot Catheter 22F length 30cm Each Malecot Catheter 24F length 30cm Each Malecot Catheter 8F (Nephrostomy Catheter) Malleable ready to use plaster for disaster preparedness Crammer wire Malleable Stylet for ET Tube Small, medium, large Manitol 20% Each Each Lithium Electrode Lumbosacral support belt Each Each Liquid fixer/developer for auto processor Lumbosacral support belt Each Menitol 20%+B4545 Each Each Each Each 71 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 9.87 Manual Plaster cutting saw Each 9.89 Manual Torniquet (cuff & Pump) Each 9.88 9.9 9.91 9.92 9.93 9.94 9.95 9.96 9.97 9.98 9.99 10 10.01 10.02 10.03 10.04 10.05 10.06 10.07 10.08 10.09 10.1 10.11 10.12 10.13 10.14 10.15 10.16 Manual Plaster spreader Each Master Tank: Master tank thermostat (Temperature controlled) Size of master tank: 30" x 24" x 24" Capacity: Developer 5 gallons, Rinser 5 gallons, Fixer 10 gallons, Washer 10 gallons Each Matrix band Each Matrix strips (cellophene) Each Matrix retainer Each Mayo stand cover Each Mercury Each Micro -Drip Infusion Set Each Micro motor hand piece Each Microbar Barium emulsion (95 % weight/volume) Each Microbar HD Barium Glasses Each Microbar Suspension – 1 liter MICROLARYNGEAL TUBE CUFF • Should have Ivory PVC, Flexible and Kink Resistant • Radio – Opaque Blue Line• 15 MM Connector Conforming to ISO 5356 – 1• Black Intubation Depth Marker Should be located 3cm to the Cuff • Size of Tracheal Tube Internal Diameter should be printed on Pilot Balloon Size:5 Each Each Micromotor drill bits Each Micropore plaster 0.5"- Specification: A latex-free, hypoallergenic paper tape; gentle to the skin yet adheres well and leaves minimal adhesive residue upon removal; should be made of breathable surgical tape. Each Micronized Barium sulphate 05% IL (sus). Each Micropore Plaster 1" - Specification: A latex-free, hypoallergenic paper tape; gentle to the skin yet adheres well and leaves minimal adhesive residue upon removal; should be made of breathable surgical tape. Each Micropore Plaster 2" - Specification: A latex-free, hypoallergenic paper tape; gentle to the skin yet adheres well and leaves minimal adhesive residue upon removal; should be made of breathable surgical tape. Each Micropore Plaster 3 “ - Specification: A latex-free, hypoallergenic paper tape; gentle to the skin yet adheres well and leaves minimal adhesive residue upon removal; should be made of breathable surgical tape. Each Micropore Plaster 6” - Specification: A latex-free, hypoallergenic paper tape; gentle to the skin yet adheres well and leaves minimal adhesive residue upon removal; should be made of breathable surgical tape. Each Miller style blades 1 Each Miller style blades 0, Each Mini head high speed air turbine hand piece Each Mini Tracheostomy set(Cooks) MINITRACHEOTOMY KIT (CRICOTHYROIDOTOMY KIT) 16G needle, Curved dilator, guarded scalpel, Flexible guidwire, Syringe Introducer, 4.0mm ID PVC cannula, 15mm connector, 10F suction catheter Each Each Miracle mix Each Formcresol Each Miracle mix cement Each 72 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 10.17 Mirror top with handle Each 10.19 Mobile Storage Rack 5 hangers & 1 gloves (Kiran) Each 10.18 10.2 10.21 10.22 10.23 10.24 10.25 10.26 10.27 10.28 10.29 10.3 10.31 10.32 10.33 10.34 10.35 10.36 10.37 10.38 10.39 10.4 10.41 10.42 10.43 10.44 10.45 10.46 10.47 10.48 10.49 10.5 10.51 10.52 Mobile Storage Rack 10 hangers & 2 gloves (Kiran) Each Model No: 8408 view Each Modelling wax Each Modified Macintosh Laryngoscope Blade Each Mortar and Pestle Each Motorized X-ray viewer with vertical belt system for Each Motorized X-ray viewer with vertical belt system for Each Mought prod chain Each Mouth & Cheek retractor Mouth mirror MRI compatible ET tube Each Each All sizes MRI compatible Laryngoscopes MRI Film 14” x 17” Each All sizes Each Each Mucus Sucker/Extractor (Adult) Each Mucus Sucker/Extractor (Child) Multi-purpose, closed, needle-free connector for blood sampling, intermittent injections or continuous infusion of fluids or drugs. 5897.01 Each Each Multiside Oxygen sensor with ear clip (Dura -Y D-YS) Each Musuc Extension Catheter Each Multiside Oxygen sensor without ear clip (Dura -Y D-YS) Each Nasal Prong 3020 (Fisher & Paykel) Each Nasal Prong 3520 (Fisher & Paykel) Each Nasal Prong 4030 (Fisher & Paykel) Each Nasal Prong 4540 (Fisher & Paykel) Each Nasal Tubing 70mm (Fisher & Paykel) Nasogastric (Ryle’s) Tube Each All Sizes Each Nasogastric Feedinf tubes - size 14 Each Nasogastric Feeding tube 8 Each Nasogastric Feeding tubes - size 10 Each Nasogastric Feeding tubes - size 12 Each Nasogastric Feeding tubes - size 16 Each Nasogastric Feeding tubes - size 18 Each Nasogastric Feeding tubes - size 5 Each Nasogastric Feeding tubes - size 6 Each Nasogastric Feeding tubes - size 8 Each 73 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 10.53 10.54 10.55 10.56 10.57 10.58 10.59 10.6 10.61 10.62 10.63 10.64 10.65 10.66 10.67 10.68 10.69 10.7 10.71 10.72 10.73 10.74 10.75 10.76 10.77 10.78 10.79 10.8 10.81 10.82 10.83 10.84 10.85 10.86 NASOPHARYNGEAL AIRWAY Implant tested material IVORY PVC Material which conforms the nasopharyngeal anatomy Size: 6, 7, 8, 9mm ID Each Neopuff (Neonatal Resuscitator) Each Needle holder Each Nephrostomy Tube 10FG Each Nephrostomy Tube 12FG Each Nephrostomy Tube 14FG Each Nephrostomy Tube 16FG Each Nephrostomy Tube 18FG Each Nephrostomy Tube 8FG Each NIBP cuff connector (Adult) Each NIBP cuff connector (Neonatal) Each NIBP cuff connector (Pediatric) North Nasal Preformed Cuffed TubeCuffed Must have IVORY PVC Profile Soft Seal Cuff, implantation tested Black intubations depth marker, 15mmconnector with 1S0 5356-1 Larger cuff resting diameter Size: 6To 8mm ID & length 27cm to 30.5 tips to nares Each Each NST Paper Each Oesophageal intubation detection device (transparent) Bulb type Each NST Paper (Baby Duplex Monitor - 6" Plain Paper) Each OT Bulb with socket (150W/24VDC) Martin Mar Lux HB Each OT shoes - Size 5/6 Each OT shoes - Size 7/8 Each OT shoes - Size 9/10 Each OVARIAN SHIELD (Kiran) Each Over head pulleys for Balkan frame Oxygen Supply Tubing for Heat & Moisture Exchanger Oxygen Supply Tubing for Heat & Moisture Exchanger with Connector to attach HME for Tracheostomy Tube Length 15cm Each Each Oxygen Analyser Each Oxygen Cell (compatible for Galileo Gold ventilator Each Oxygen Blenders Each Oxygen face mask (Adult) Each Oxygen face mask (Child) Each Oxygen face mask (Infant) Each Oxygen face mask (Neonatal) Each Oxygen Head box/hood Each Oxygen Hood (Child) Each Oxygen Hood (Infant) Each Oxygen Hood (Neonatal) Each 74 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 10.87 Oxygen mask with Nibuliser (Adult) Each 10.89 Oxygen mask with Nibuliser (Paediatrics) Each 10.88 10.9 10.91 10.92 10.93 10.94 10.95 10.96 10.97 10.98 Oxygen mask with Nibuliser (Neonatal) Each Oxygen Mask with Tube (Adult) Each Oxygen MOX connector with tube Each Oxygen nebulizer mask with tubing Each Oxygen Pipeline Each Oxygen sensor - PB 840 Each Oxygen set (twin bore) - Adult Each Oxygen set (twin bore) - Child Each Oxygen set (twin bore) - Neonatal 10.99 Oxygen T-Piece used for delivering oxygen in weaning from ventilator with 40% venturi valve (Oxygen Recovery Kit) Model 1040-013 Paedia Drip Set (Measured Volume) 11.01 Paediatrics oxygen mask with nose clip and oxygen tube 11 11.02 11.03 11.04 11.05 11.06 11.07 11.08 11.09 11.1 11.11 11.12 11.13 11.14 11.15 11.16 11.17 11.18 11.19 11.2 Paediatric anaesthetic breathing system with Paediatric APL valve (Infant T-piece system with APL valve) Pain -off Each Each Each Each Each Each Paper points Each Paper points (all sizes) Each Para film roll (size 10cmx125cm) 3 “ dia Each Parafilm, roll Patiernt Breathing set, Single water trap, Infant Reusable (include 5nos of Exhalation membrane, 1 no of Exhalation cover, 1 no of Reusable Bacterial Filter)compatible for Galileo Gold Ventilator Each Each PC Board Each PCN Catheter (Malecot) 12F Each PCN Catheter (Malecot) 10F Each PEDIATRIC & ADULT TRACHEAL INTUBATION STYLET Malleable, metal with PVC Sheath Single use sterile Size: 2.2, 4.2, 5mm OD Length 225 to 365mm Each Pencil torch Each Rechargeable Batteries AA Size (Pencil) - 2000 mah and above Each Wrap Vest 84cm-109cm (Medium) Each Pencil Battery Charger (4 nos capacity) Each Penta blood collection bag 350ml(CPDA) Each Percutaneous biliary drainage sets Each Percutaneous nephrostomy sets Percutaneous Tracheostomy Introducer Set (with Shiley Percutaneous Dual Cannula Cuffed Tracheostomy Tubes and EZPass Hydrophilic Coating) Size 6 (G13165) size (G12523) Percutaneous Tracheostomy Set Size 7 size 8 75 Each Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 11.21 11.22 PERCUTANEOUS TRECHEOSTOMY KIT: Including Guide wire, Dilating Forceps, Introducer needle, syringe, Tracheostomy tube, Scalpel & Introducer. Size: 7, 8, 9mm ID Each Each 11.23 Perineural catheter for continuous plexus and peripheral nerve blocks. Content: 118 G lacoplex needle with centimeter graduation 1 perinueral Pebax catheter (0.45 x 0.85mm – 50cm long) with centimeter distance markings and open distal tip 1 0.22 antibacterial filter 1 additional extension tube, 50cm long, 1.5 x 2.5 mm dia, priming volume 1.10ml 1 10ml syringe for the aspiration test 1 10 x 15 cm Dermafilm transparent adhesive dressing Periodontal probe 11.25 Peripheral Electrode (Adult) Each 11.24 11.26 11.27 11.28 11.29 11.3 11.31 11.32 11.33 11.34 11.35 11.36 11.37 11.38 11.39 11.4 11.41 11.42 11.43 11.44 11.45 11.46 11.47 11.48 11.49 Periostal elevators (small and big) Peripheral Electrode (Pediatric) Each Peritoneal Dialysis Catheter Child Each Peritoneal Dialysis Catheter Set Each Peritoneal Dialysis Infusion Set Adult Each Peritoneal Dialysis Infusion Set Paediatric Philadelphia Tracheotomy Collar Philadelphia Tracheotomy Collar Each Each Peritoneal Dialysis Catheter Adult Peritoneal Dialysis Transfusion Set Each Each Each Medium Each X Small Each Phototheraphy Spec for Neonates (Eye Cover) Each Phototherapy Blue Tube CFL Each Phototherapy Bulb Holder Each Phototherapy Choke Each Phototherapy White Tube CFL Implantable port-intermediate size, single lumen,MRI compatible,Attachable 9.6 FR Silicon Catheter(Adult Patients) Implantable low profile port, single lumen,open ended, MRI compatible,port with 6.6Fr silicon Catheter(Pediatrics Patients) Implantable low profile port, single lumen,open ended, MRI compatible,port with 6.0Fr silicon Catheter(Pediatrics Patients) Implantable low profile port, single lumen,open ended, MRI compatible,port with 4.2Fr silicon Catheter(Pediatrics Patients) Winged infusion set- Non coring needles with injection site to access ports,20G X 1.00(needle) Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-7fr,65cm length(Ped) Hickman-Broviac 4.2Fr(or smaller) single lumen pediatric cath w STIC PAPAIS Hickman-Broviac 6.6Fr single lumen pediatric cath w STIC 90cm Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-9fr,90cm length(Adult) PICC-Single Lumen catheter set for catheterization of the vena cava according to the catheter through cannula technique set consisting of introducer cannula, single lumne made o polyurethane(14G,70cm length), X-ray detectable, opaque with catheter marking and catheter length embossed on fiting: Luer-Lock Fitting: Catheter" Protective cathter sheath. Each Each Each Each Each Each Each Each Each Each Each 11.5 PICC Catheter 18G Each 11.52 PICC Catheter 22G Each 11.51 PICC Catheter 20G Each 76 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 11.53 PICC Catheter 24G Each 11.55 PICC Catheter 28G Each 11.54 11.56 11.57 11.58 11.59 11.6 11.61 11.62 11.63 11.64 11.65 11.66 11.67 11.68 11.69 11.7 11.71 11.72 11.73 11.74 11.75 11.76 11.77 11.78 11.79 11.8 11.81 11.82 11.83 11.84 11.85 11.86 11.87 11.88 PICC Catheter 26G Each Pigtail catheters Each Pipeline Connector Each Pipiline Hose((Oxygen) Each Plain Rubber Catheter 6FR Each Plain Rubber Catheter 7FR Each Plaster Cutter Electric Each Plaster saw Each Plastic filling instruments Each Pleural biopsy needles (Adult size) Each Plier long nose Each Pneumatic Compression Stocking Each Polar strips Each Polishing cups and brushes for scaling Each Polishing paste (flavoured) Polyurethane Intravenous Cannula (IV XRO Catheter Seldinger Technique) Polyurethane Intravenous Cannula (IV XRO Catheter Seldinger Technique) Each Diameter 1.7mm- Each 16G-Length 20 cm Each Portable Autoclave Electrically Operated Made of Aluminium size:300mm x 300mm capacity 24 litres Each Portable Autoclave Electrically Operated Made of Aluminium size:350mm x 300mm-325mm Depth: 1.5 Kw Portex Percutaneous Cricothyrotomy Kit Portex Tracheostomy Tube (Blueline Ultra)- Only this tube can pass over the dilator set currently available Each Size 7 Portex Tracheostomy Tube (Blueline Ultra)- Only this tube can pass over the dilator set currently available Size 8 Portex Tracheostomy tubes 6.5mm Portex Tracheostomy tubes 6mm Each Portex Tracheostomy tubes 8mm Each Portex Tracheostomy tubes 9mm Each Pott's Scissors Angle 45° Each Pott's Scissors Angle 90° Pressure Bag (pressure infusion cuff) with pressure gauge Each Each Portex Tracheostomy tubes 8.5mm Paediatric Each Each Portex Tracheostomy tubes 7mm Pregel Electrodes Each Each Portex Tracheostomy tubes 7.5mm Pott's Scissors straight Each Each Each 1 litre 77 Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 11.89 11.9 11.91 11.92 11.93 11.94 11.95 11.96 11.97 11.98 11.99 12 12.01 12.02 12.03 12.04 12.05 12.06 12.07 12.08 12.09 12.1 12.11 12.12 12.13 12.14 12.15 12.16 12.17 12.18 12.19 12.2 12.21 12.22 Pressure Monitoring Kit With disposable dome, low priming volume, lock system and compatible with reusable transducer, with integrated flush system, IV Set, P.M. Lines & stop cock. Each Pressure Monitoring Kit With disposable transducer, compatible with integrity check system cable by 100mmhg pressure, with integrated flush system, IV Set, P.M. Lines & stop cock. Each Pressure Reusable Transducer With integrity check system by 100mmhg pressure, with microchip technology, with reusable clamp Each Protaper (all sizes and shades) Each Pressure Monitoring Kit With disposable transducer, compatible with integrity check system cable by 100mmhg pressure, with integrated flush system, IV Set, P.M. Lines & stop cock. Each Pressure Monitoring Kit With disposable transducer, compatible with integrity check system cable by 100mmhg pressure, with integrated flush system, IV Set, P.M. Lines & stop cock. Each Probe Each PROTECTIVE EYE WEAR (FRONT & SIDE PROTECTION) (Kiran) Each Protemp with tips and gun Each Pulse Oximetre Neonatal Each Pulse Oximetre Pediatric Each Pumptun Dillator Each Pure Sodium Chloride Nacl) 500gm Each Pyridin Each Radial Distracters Multipurpose Gloves Elbow Length (Rubber Latex) RADIATION PROTECTION GLOVES WITH LEATHER COVER Each Each (Kiran) RADIATION PROTECTION GLOVES ( SMALL /MEDIUM /LARGE) (Kiran) Radioprotective Gloves: ALL SIZES Radioprotective Goggles: MEDIUM & LARGE SIZES RAE endotracheal tubes (PVC) 3.5 RAE endotracheal tubes (PVC) 5 RAE endotracheal tubes (PVC) RAE endotracheal tubes (PVC) RAE endotracheal tubes (PVC) RAE endotracheal tubes (PVC) RAE endotracheal tubes (PVC) RAE endotracheal tubes (PVC) Each Each Each Each 5.5 Each 6 Each 6.5 Each 3 RAE endotracheal tubes (PVC) cuffed RAE endotracheal tubes (PVC) cuffed RAE endotracheal tubes (PVC) cuffed reading & demonstrating 120 films Each Each 4 4.5 Each Each Radioprotective gown fot OT Radioprotective Thyroid shield Each Each Each 7 Each 7.5 Each 8 Each Each 78 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 12.23 Ready mix (temporary restin) Each 12.25 REINFORCED TRACHEAL TUBES (CUFFED) Must have SILICONE RUBBER multiple reusable’s, AUTOCLAVABLE Wire reinforced, non-kink able, Size: 5.5, ID Each REINFORCED TRACHEAL TUBES (CUFFED) Must have SILICONE RUBBER multiple reusable’s, AUTOCLAVABLE Wire reinforced, non-kink able, Size: 6.5 ID Each REINFORCED TRACHEAL TUBES (CUFFED) Must have SILICONE RUBBER multiple reusable’s, AUTOCLAVABLE Wire reinforced, non-kink able, Size: 7.5 ID Each REINFORCED TRACHEAL TUBES (CUFFED) Must have SILICONE RUBBER multiple reusable’s, AUTOCLAVABLE Wire reinforced, non-kink able, Size: 8.5 ID Each Remin pro (protective dental cream) Each Reprocessable clear silicone anaesthetic breathing systems 1.5 metre length Each 12.24 12.26 12.27 12.28 12.29 12.3 12.31 12.32 12.33 12.34 12.35 12.36 12.37 12.38 12.39 12.4 12.41 12.42 12.43 12.44 12.45 12.46 12.47 12.48 12.49 12.5 12.51 12.52 12.53 REINFORCED TRACHEAL TUBES (CUFFED) Must have SILICONE RUBBER multiple reusable’s, AUTOCLAVABLE Wire reinforced, non-kink able, Size: 5 ID Each REINFORCED TRACHEAL TUBES (CUFFED) Must have SILICONE RUBBER multiple reusable’s, AUTOCLAVABLE Wire reinforced, non-kink able, Size: 6 ID Each REINFORCED TRACHEAL TUBES (CUFFED) Must have SILICONE RUBBER multiple reusable’s, AUTOCLAVABLE Wire reinforced, non-kink able, Size: 7 ID Each REINFORCED TRACHEAL TUBES (CUFFED) Must have SILICONE RUBBER multiple reusable’s, AUTOCLAVABLE Wire reinforced, non-kink able, Size: 8 ID Each REINFORCED TRACHEAL TUBES (CUFFED) Must have SILICONE RUBBER multiple reusable’s, AUTOCLAVABLE Wire reinforced, non-kink able, Size: 9mm ID Each Renal double curve visceral catheters Each Reprocessable clear silicone tube for breathing circuit 0.8 metre length Reprocessable Reservoir bags (Green Colour with hook) Each 0.5 litre with 15 F neck Each Reprocessable Reservoir bags (Green Colour with hook) 1 litre with 15 F neck Each Reprocessable Reservoir bags (Green Colour with hook) 2 litre with 22 F neck Each Reservoir bag Large Each Reservoir bag Small Each Reservoir bags (Green Colour) 2 litre with 22 F neck Each Reservoir bags (Green Colour, Teddy bear design) 0.5 litre with 15 F neck Each Reservoir bags (Green Colour, Teddy bear design) 1 litre with 15 F neck Reservoir mask Retrograde Intubation Sets (with rapi-fit adapters) G09727 G10554 Reusable AMBU Resuscitator bag with mask, Oxygen Line and Reservoir Bag (Silicone) Autoclavable Reusable AMBU Resuscitator bag with mask, Oxygen Line and Reservoir Bag (Silicone) Autoclavable Reusable AMBU Resuscitator bag with mask, Oxygen Line and Reservoir Bag (Silicone) Autoclavable Each Each Neonate Adult Paediatric Reusable Pressure Infusor Bags Durable , Easy to clean, Accurate Pressure Gauge, Large Squeeze Bulb, Three way stop cock, Crystal Clean Material for Maximum visibility of fluid levels, Sizes: 500ml, 1000ml, Extension sets for Two & three ltr bags Each Each Each Each Each Reusable Pressure Infusor Bags Durable , Easy to clean, Accurate Pressure Gauge, Large Squeeze Bulb, Three way stop cock, Crystal Clean Material for Maximum visibility of fluid levels, Sizes: 500ml, 1000ml, Extension sets for Two & three ltr bags Each Reusable Pressure Monitoring cable With integrity check system by 100mmhg pressure and with reusable modular clamp Each Reusable Pressure Infusor Bags Durable , Easy to clean, Accurate Pressure Gauge, Large Squeeze Bulb, Three way stop cock, Crystal Clean Material for Maximum visibility of fluid levels, Sizes: 500ml, 1000ml, Extension sets for Two & three ltr bags 79 Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 12.54 12.55 Reusable Pressure Transducer With integrity check system by 100mmhg pressure, with microchip technology, Reusable cable, and with reusable clamp Reusable Preventation Syringe with Detachable Needle 10ml Each 12.57 Reusable Preventation Syringe with Detachable Needle 5ml Each 12.56 12.58 12.59 12.6 12.61 12.62 12.63 12.64 12.65 12.66 12.67 12.68 12.69 12.7 12.71 12.72 12.73 12.74 12.75 12.76 12.77 12.78 12.79 12.8 12.81 12.82 12.83 12.84 12.85 12.86 12.87 12.88 12.89 Reusable Preventation Syringe with Detachable Needle 2ml RHI, RS (for selection hepatic/splenic) Each RM accessory Kit Romo ABK Romo ABK Each Each Ring Forceps RM Cable Each Each Each No. 28 Each No. 20 Each Romo ABK No. 24 Each Romo Drain Each Romo Seal (Adult) Each Romo Seal (Child) Each Ronguers(down cutter) Each Ronguers(up cutter) Each RT206 Adult Ventilator Circuit Each RT225 Infant /Neonatal Ventilator Circuit Each Rubber base putty Each Rubber bowl & Spatula Each Rubber dam kit Rubber gasket and Pressure Gauge for High Pressure high Vacuum steam Autoclave size:600mmx900mmx1500mm Rubber Macintosh Rubber polishing burs (for Ag. Amalgam) Each Each Each Each Rug Each Russian Forceps Each Ryles tube size 16 FG Each Ryles tube size 10 FG Each Ryles tube size 12 FG Each Ryles tube size 14 FG Each Ryles Tube Size 18 FG Each Ryles tube size 6 FG Each Ryles tube size 8 FG Salient Syringe connector for CT Scan contrast Injector- 150cm 300PSI extension Tube T-Connect Dual for use with salient CT contrast Injector (IMAXEON) Salient Syringe with QPF-190ml (IMAXEON) Sample probe for easylyte Each Each Each Each 80 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 12.9 Salicylic Acid Each 12.92 Saturated Solution of Glucose Each 12.91 12.93 12.94 12.95 12.96 12.97 12.98 12.99 13 13.01 13.02 13.03 13.04 13.05 13.06 13.07 13.08 13.09 13.1 13.11 Glycolic Acid Each Scaler tips set Each Scalp Vein Size- 20G Each Scalp vein size - 22G Each Scalp vein size – 24G Each Scavenging tube (22 mm, cuffed every 0.4 metre) Each Light Weight Hernia Mesh,PGA Polypropylene 11 x 15 Each Light Weight Hernia Mesh,PGA Polypropylene 6 x 11 Each SCD Express Stocking - Knee length Large Each SCD Express Stocking - Knee length Medium Each SCD Express Stocking - Knee length Small Each SCD Express Stocking - Thigh length Large Each SCD Express Stocking - Thigh length Medium Each SCD Express Stocking - Thigh length Small Each Scissor (curved ) Each Scissor (Straight) Each SD Check Glucose Test Strip - 50's Sectional trays Seldinger Minitracheotomy Kit Each Each Mini-Trach II Seldinger technique catheter for arterial puncture Content: /(PTFE) 1 Intruducer needle 1 straight wire 115.092 115.118 5118.702 5118.703 1 Transparent and XPO cathter (PE) 115.094 Each Each 13.12 Self curing Acrylic Tooth colour temporary crown and bridge Material(Powder) Each 13.14 Self Holding retractors for Spine surgery Each 13.13 13.15 13.16 13.17 13.18 13.19 13.2 13.21 Self curing Acrylic Tooth colour temporary crown and bridge Material(Liquid) Shade guide Each Each Shanz pins 4.5mm Each Side Support Each Silver aluminium foil Single Dilator Percutaneous Tracheostomy Kit Should have Scalpel, 14G Needle & Cannula, Guidewire & Introducer, 10ml Syringe , 14Fr Dilator pre-lubricated Singe Stage Dilator, Blue, line ,Ultra ,Tracheostomy Tube, Tracheostomy Tube Introducer, two pcs Inner cannula Swabs Tracheostomy tube holder Sterile Lubricating Jelly 5G , Guiding Catheter Size: 7, 8, 9 Single use Bougie(Disposable) Disposable E.T.Tube introducer for difficult intubation, made of IVORY PVC,Size:15Fr Length: 700mm Single Use Resuscitation Mask for CPCR (Non-return valve, Integral Bacterial/Viral filter) 81 Each Each Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 13.22 Skin Probe Each 13.24 Skin Stapler Remover Each 13.23 13.25 13.26 13.27 13.28 13.29 13.3 13.31 13.32 13.33 13.34 13.35 13.36 13.37 13.38 13.39 13.4 13.41 13.42 13.43 13.44 13.45 13.46 13.47 Vitrectomy cutter Laureate anterior Each Slide Mailer 1 slide Each Slide Mailer 2 slide Each Soap Dispenser Soda Lime (Imported) – changes from White to Violet on exhaustion 5kg Sodium diatrizoate Meglumine diatriozate 60% - 50 ml vial. Sodium diatrizoate Meglumine diatriozate 76% - 50 ml vial. Each Each Each Each Sodium hypochloride solution 5Litre Each Spares for AV900 Ventilator (AV9080713) Each Spares for AV900 Ventilator (AV9080716) Spares for Multipara monitors compatible with (Mediaid) Model: M-6 Aster Spares for phototherapy ( Meditrin Company) (2) Phototherapy bulb holder Spares for phototherapy( Meditrin Company) (1) Phototherapy choke Special OT mask with ocular protection against Spalshes Sterile Disposable Spinal needle with Whitacre pencil point individually packed. Specifications: with graduated metal introducer & translucent hub with color coding; should be of good quality material and pack without any risk of breach in sterility. ETO/Gamma sterilized. 25G, Each Each Each Each Each Each Sterile Disposable Spinal needle with Whitacre pencil point individually packed. Specifications: with graduated metal introducer & translucent hub with color coding; should be of good quality material and pack without any risk of breach in sterility. ETO/Gamma sterilized. 26G, Each Sterile Disposable Spinal needle with Whitacre pencil point individually packed. Specifications: with graduated metal introducer & translucent hub with color coding; should be of good quality material and pack without any risk of breach in sterility. ETO/Gamma sterilized. 16G, Each Sterile Disposable Spinal needle with Whitacre pencil point individually packed. Specifications: with graduated metal introducer & translucent hub with color coding; should be of good quality material and pack without any risk of breach in sterility. ETO/Gamma sterilized. 20G, Each Sterile Disposable Spinal needle with Whitacre pencil point individually packed. Specifications: with graduated metal introducer & translucent hub with color coding; should be of good quality material and pack without any risk of breach in sterility. ETO/Gamma sterilized. 22G, Each Sterile Disposable Spinal needle with Whitacre pencil point individually packed. Specifications: with graduated metal introducer & translucent hub with color coding; should be of good quality material and pack without any risk of breach in sterility. ETO/Gamma sterilized. 24G, Each Sterile Disposable Spinal needle with Whitacre pencil point individually packed. Specifications: with graduated metal introducer & translucent hub with color coding; should be of good quality material and pack without any risk of breach in sterility. ETO/Gamma sterilized. 27G, Each Sterile Disposable Spinal needle with Whitacre pencil point individually packed. Specifications: with graduated metal introducer & translucent hub with color coding; should be of good quality material and pack without any risk of breach in sterility. ETO/Gamma sterilized. 18G, Each Sterile Disposable Spinal needle with Whitacre pencil point individually packed. Specifications: with graduated metal introducer & translucent hub with color coding; should be of good quality material and pack without any risk of breach in sterility. ETO/Gamma sterilized. 21G, Each Sterile Disposable Spinal needle with Whitacre pencil point individually packed. Specifications: with graduated metal introducer & translucent hub with color coding; should be of good quality material and pack without any risk of breach in sterility. ETO/Gamma sterilized. 23G, Each 82 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 13.48 Sterile disposable Spinal Needle with Quinke tip individually packed. Specifications: with translucent hub with color coding; should be of good quality material and pack without any risk of breach in sterility. ETO/Gamma sterilized. 23G/25G Each 13.49 Sterile disposable Spinal Needle with introducer Each 13.51 spinal needle 22G(15cm) 13.5 13.52 13.53 13.54 13.55 13.56 13.57 13.58 13.59 13.6 13.61 13.62 13.63 13.64 13.65 13.66 13.67 13.68 13.69 13.7 13.71 13.72 13.73 13.74 13.75 13.76 13.77 13.78 13.79 13.8 13.81 13.82 spinal needle 27G 27G Each Each Spirometry Mouthpiece Each Spirometry paper (110 mm x 20 mtr) Each SPO2 probe Extension (for L & T Stellar Pulse Oxymeter) Each SPO2 Probe for Pulse Oxymeter - L & T Stellar Each SPO2 Probe with Extension Each SPO2 Probe with Extension Each SPO2 sensor port Each Spoon excavator Each Spot Band aid Each Spreader /Plugger Each Spreaders /Plugger (all sizes) Each Standard walker Each Steinman pins:4.5mm Each Steinmann Pins Each Steridrape (60cmx45cm) Each Sterigage Chemical Indicator (for Steam) 3M Each Steripore(Microporous tape) 6" X 8mtr Stockinette (Anti DVT stocking) Straight catheters for pediatrics Each Medium Size Each Each Straight elevators (light & heavy) Each Straight probe Each Suctin Connection Tube with Yankauer handle( Standard Tips) Each Suction Catheter 10 FG Each Suction Catheter 12 FG Each Suction Catheter 14 FG Each Suction Catheter 16 FG Each Suction Catheter 18 FG Each Suction Catheter 6 FG Each Suction Catheter 8 FG Each Suction Catheter with Thumb Impression 14 FG Each Suction Catheter with Thumb Impression 10 FG Each 83 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 13.83 Suction Catheter with Thumb Impression 12 FG Each 13.85 Suction Catheter with Thumb Impression 18 FG Each 13.84 13.86 13.87 13.88 13.89 13.9 13.91 13.92 13.93 13.94 13.95 13.96 13.97 13.98 13.99 14 14.01 14.02 14.03 14.04 14.05 14.06 14.07 14.08 14.09 14.1 14.11 14.12 14.13 14.14 14.15 14.16 14.17 14.18 Suction Catheter with Thumb Impression 16 FG Each Suction Catheter with Thumb Impression 6 FG Each Suction Catheter with Thumb Impression 8 FG Each Suction cup electrode (Adult) - Schiller AT-1 machine Each Suction cup electrode (Pediatric) - Schiller AT-1 machine Each Suction cup electrode (Pediatric) - Schiller AT-1 machine Each Suction Set Size 10 Curves Each Suction Set Size 10 straight Each Suction Set Size 1Curves Each Suction Set Size 1straight Each Suction Set Size 2 Curves Each Suction Set Size 2 straight Each Suction Set Size 3 Curves Each Suction Set Size 3 straight Each Suction Set Size 4 Curves Each Suction Set Size 4 straight Each Suction Set Size 5 Curves Each Suction Set Size 5 straight Each Suction Set Size 6 Curves Each Suction Set Size 6 straight Each Suction Set Size 7 Curves Each Suction Set Size 7straight Each Suction Set Size 8 Curves Each Suction Set Size 8 straight Each Suction Set Size 9 Curves Each Suction Set Size 9 straight Each Suction tips Each Surgical Clipper Each Surgical Micromotor Each Surgical Preparation Razor Each T Connector 22M, 22/15 Swivel type with port Each T -Shape Bandage Each T.E.D. Anti-Embolism Stocking - Knee length Large Each T.E.D. Anti-Embolism Stocking - Knee length Medium Each 84 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 14.19 T.E.D. Anti-Embolism Stocking - Knee length Small Each 14.21 T.E.D. Anti-Embolism Stocking - Thigh length Medium Each 14.2 14.22 14.23 14.24 14.25 14.26 14.27 14.28 14.29 14.3 14.31 14.32 14.33 14.34 14.35 14.36 14.37 14.38 14.39 14.4 14.41 14.42 14.43 14.44 14.45 14.46 14.47 14.48 14.49 14.5 14.51 T.E.D. Anti-Embolism Stocking - Thigh length Large Each T.E.D. Anti-Embolism Stocking - Thigh length Small Each TEMP 1detector port Each TEMP 2 detector port Each Test Tube Cleaning Brush Each Test Tube Warmer Each Thermal paper for Re-Agent (ABG) Each Thermal paper for Ultrasound (Type: 1 -5) Each Thermal paper for USG - Glossy paper (110 mm x 20 mtrs) - SONY Each Thermal paper roll for Screen Master Photometer Each Thermal paper rolls for US thermal printer Each Thermal Videographic Printer (Black & White) (Sony, Latest UP series) Each Disposable Sterile Three - Way Stop Cock Each Thyroid Guard (Lead Guard) Each Thyroid shield (Kiran) Each Tilley's Nasal Each Tissue paper for Ultrasound Each Titanium post TMT Recording Paper for Mortora X Scribe II TMT Machine (210 mm x 280 mm) Tommy syringe Tongue Depressor (Wooden) Each Each Each Each Tracheal Dilator TRACHEAL TUBE Changer Gum elastic bougie designed to assist difficult intubation with markings,indicators of intubations depth, reusable, Straight tip Each Each TRACHEAL TUBE INTRODUCER Gum elastic bougie designed to assist difficult intubation with markings,indicators of intubations depth, reusable, coude tip Size: 15ch ×700mm Each TRACHEAL TUBES: (FOR HEAD & NECK SURGERY) South oral: Distal end should be curved, clear PVC implantation tested Black intubations depth marker, 15mmconnector with 1S0 5356-1 Larger cuff resting diameter Size: 3 to 5.5mmUncuff & 6.0 to 8.0mm ID cuffed Each Tracheal Tube Restraint Length-700 mm Model 330 Each TRACHEAL TUBES: (FOR HEAD & NECK SURGERY) South oral: Distal end should be curved, clear PVC implantation tested Black intubations depth marker, 15mmconnector with 1S0 5356-1 Larger cuff resting diameter Size: 3 to 5.5mmUncuff & 6.0 to 8.0mm ID cuffed Each Tracheostomy mask Each Tracheostomy Dressing Each Tracheostomy Tube 2.5mm (Cuffed) Each Tracheostomy Tube 2.5mm (Uncuffed) Each 85 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 14.52 Tracheostomy Tube 2mm (Uncuffed) Each 14.54 Tracheostomy Tube 3 mm (Cuffed) Each 14.53 14.55 14.56 14.57 14.58 14.59 14.6 14.61 14.62 14.63 14.64 14.65 14.66 14.67 14.68 14.69 14.7 14.71 14.72 14.73 14.74 14.75 14.76 14.77 14.78 14.79 14.8 14.81 14.82 14.83 14.84 14.85 14.86 14.87 Tracheostomy Tube 2mm (Uncuffed) Each Tracheostomy Tube 3.5 mm (Uncuffed) Each Tracheostomy Tube 3.5mm (Cuffed) Each Tracheostomy Tube 3mm (Uncuffed) Each Tracheostomy Tube 4 mm (Cuffed) Each Tracheostomy Tube 4 mm (Uncuffed) Each Tracheostomy Tube 4.5 mm (Cuffed) Each Tracheostomy Tube 4.5mm (Uncuffed) Each Tracheostomy Tube 5 mm (Cuffed) Each Tracheostomy Tube 5 mm (Uncuffed) Each Tracheostomy Tube 5.5 mm (Cuffed) Each Tracheostomy Tube 5.5 mm (Uncuffed) Each Tracheostomy Tube 6 mm (Cuffed) Each Tracheostomy Tube 6 mm (Uncuffed) Each Tracheostomy Tube 6.5 mm (Cuffed) Each Tracheostomy Tube 6.5 mm (Uncuffed) Each Tracheostomy Tube 7 mm (Uncuffed) Each Tracheostomy Tube 7 mm (Cuffed) Each Tracheostomy Tube 7.5 mm (Cuffed) Each Tracheostomy Tube 7.5 mm (Uncuffed) Each Tracheostomy Tube 7.5 mm (Uncuffed) Each Tracheostomy Tube 8 mm (Cuffed) Each Tracheostomy Tube 8 mm (Uncuffed) Each Tracheostomy Tube 8.5 mm (Cuffed) Each Tracheostomy Tube 8.5 mm (Uncuffed) Each Tracheostomy Tube 9 mm (Cuffed) Each Tracheostomy Tube 9 mm (Uncuffed) Each Tracheostomy Tube PVC 2.5mm (Cuffed) Each Tracheostomy Tube PVC 2.5mm (Uncuffed) Each Tracheostomy Tube PVC 2mm (Cuffed) Each Tracheostomy Tube PVC -3 mm (Cuffed) Each Tracheostomy Tube PVC -3.5 mm (Uncuffed) Each Tracheostomy Tube PVC -3.5mm (Cuffed) Each Tracheostomy Tube PVC 3mm (Uncuffed) Each 86 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 14.88 Tracheostomy Tube PVC -4 mm (Cuffed) Each 14.9 Tracheostomy Tube PVC -4.5 mm (Cuffed) Each 14.89 14.91 14.92 14.93 14.94 14.95 14.96 14.97 14.98 14.99 15 15.01 15.02 15.03 15.04 15.05 15.06 15.07 15.08 15.09 15.1 15.11 15.12 15.13 15.14 15.15 15.16 15.17 15.18 15.19 15.2 Tracheostomy Tube PVC -4 mm (Uncuffed) Each Tracheostomy Tube PVC -4.5mm (Uncuffed) Each Tracheostomy Tube PVC -5 mm (Cuffed) Each Tracheostomy Tube PVC -5 mm (Uncuffed) Each Tracheostomy Tube PVC -5.5 mm (Cuffed) Each Tracheostomy Tube PVC -5.5 mm (Uncuffed) Each Tracheostomy Tube PVC -6 mm (Cuffed) Each Tracheostomy Tube PVC -6 mm (Uncuffed) Each Tracheostomy Tube PVC -6.5 mm (Cuffed) Each Tracheostomy Tube PVC -6.5 mm (Uncuffed) Each Tracheostomy Tube PVC -7 mm (Uncuffed) Each Tracheostomy Tube PVC -7 mm (Cuffed) Each Tracheostomy Tube PVC -7.5 mm (Cuffed) Each Tracheostomy Tube PVC -7.5 mm (Uncuffed) Each Tracheostomy Tube PVC -7.5 mm (Uncuffed) Each Tracheostomy Tube PVC -8 mm (Cuffed) Each Tracheostomy Tube PVC -8 mm (Uncuffed) Each Tracheostomy Tube PVC -8.5 mm (Cuffed) Each Tracheostomy Tube PVC -8.5 mm (Uncuffed) Each Tracheostomy Tube PVC -9 mm (Cuffed) Each Tracheostomy Tube PVC -9 mm (Uncuffed) Tracheostomy tube PVC with low pressure high volume cuff, adjustable flange 15mm Connectors Tracheostomy tube PVC with low pressure high volume cuff, adjustable flange 15mm Connectors 6 7 Tracheostomy tube PVC with low pressure high volume cuff, adjustable flange 15mm Connectors 5 Tracheostomy tube PVC with low pressure high volume cuff, adjustable flange 15mm Connectors 7.5 Tracheostomy tube PVC with low pressure high volume cuff, adjustable flange 15mm Connectors 8 Tracheostomy tube PVC with low pressure high volume cuff, adjustable flange 15mm Connectors 8.5 TRACHEOSTOMY TUBE WITH SUCTION DEVICE With inbuilt suction catheter to remove upper cuff secretions transparent tube & flange Non toxic, implantation tested siliconised and clear PVC with a radio opaque line Thermo sensitive PVC, 105º angle Cuff-Tapered membrane cuff, low pressure, should have SOFT SEAL CUFF Large resting diameter must have sensitive pilot balloon and indicates Soft seal cuff, resting diameter, tube size, clear and soft flange, obturator with hole can be used with Guide wire, with tapes Size: 7, 7.5, 8, 8.5, 9mmID TRACHEOSTOMY TUBE CUFFED Non toxic, implantation tested siliconised and clear PVC With a radio opaque line Thermo sensitive PVC, 105º angle Cuff-Tapered membrane cuff, low pressure should have SOFT SEAL CUFF Large resting diameter must have sensitive pilot balloon and indicates Soft seal cuff, resting diameter, tube size, clear and soft flange, obturator with hole can be used with Guide wire, with tapes Size:6,7,7.5,8,8.5,9,10mm ID Tracheotomy metal tube No 22 Each Each Each Each Each Each Each Each Each Each Tracheotomy metal tube No 26 Each 87 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 15.21 TRACHESTOMY TUBE (UNCUFFED) Non plastic implantation tested, siliconised PVC Radio opaque line Soft flange with holes for Fixation tape, 15mm termination smooth & rounded tip with an inner tube not extend more than 1.5mm beyond the patient end. Air flow rate in pressure of 1cm H2O (0.1kpa) & 5cm H2O (0.5kpa) Prestirilised Size-3.0 to 6.0mm ID (pediatric) Each 15.22 TRACHESTOMY TUBE with speaking device Non plastic implantation tested, siliconised PVC Radio opaque line soft flange with holes for Fixation tape, 15mm termination smooth & rounded tip with obturator not extend more than 1.5mm beyond the patient end. Air flow rate in pressure of 1cm H2O (0.1kpa) & 5cm H2O (0.5kpa) Prestirilised Size-7,7.5,8,9mm ID Each 15.23 Trans pac I/V Monitoring kit Each 15.25 Transpore 1" -(3M) - Specification: Hypoallergenic Tape; transparent and perforated ; strong adhesion; bi directional tears; transparent; should holds well in wet and dry skin; porous and breathable. Each 15.24 15.26 15.27 15.28 15.29 15.3 15.31 15.32 15.33 15.34 15.35 15.36 15.37 15.38 15.39 15.4 15.41 15.42 15.43 15.44 15.45 15.46 15.47 15.48 Transformer Each Transpore 2" -(3M) - Specification: Hypoallergenic Tape; transparent and perforated ; strong adhesion; bi directional tears; transparent; should holds well in wet and dry skin; porous and breathable. Each Transpore Plaster 1 inch - Specification: Hypoallergenic Tape; transparent and perforated ; strong adhesion; bi directional tears; transparent; should holds well in wet and dry skin; porous and breathable. Each Transpore Plaster 3 inch - Specification: Hypoallergenic Tape; transparent and perforated ; strong adhesion; bi directional tears; transparent; should holds well in wet and dry skin; porous and breathable. Each Triangular Sling bandage Each Transpore 3" -(3M) - Specification: Hypoallergenic Tape; transparent and perforated ; strong adhesion; bi directional tears; transparent; should holds well in wet and dry skin; porous and breathable. Each Transpore Plaster 2 inch - Specification: Hypoallergenic Tape; transparent and perforated ; strong adhesion; bi directional tears; transparent; should holds well in wet and dry skin; porous and breathable. Each Triangular Bandage Each TRU KUT Biopsy Needle 14 F Each TRU KUT Biopsy Needle 16 F Each TRU KUT Biopsy Needle 18 F Each TRU KUT Biopsy Needle 20 F Each TUR set (Irrigation set or Endoscopic T.U.R) Turner Biopsy needles for aspiration-length 15 to 20 cms, gauge 16 to 22. Tusu forcep Tweezer Each Each Each Each Ultra violet cabinet (800/500 x 2000 mm) Each Ultrapore 7 Each Ultrapore 7.5 Each Ultrapore 8 Each Ultrasound Gel 250 ml. Each Ultrasound Jelly Each Ultrasound Medical Imaging film 10” x 8” 100 sheets Each Umbilical Catheter 5 Each 88 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 15.49 Umbilical Catheter 6 Each 15.51 Universal Cervical Collar (For support of cervical spine during Emergency) Each 15.5 15.52 15.53 15.54 15.55 15.56 15.57 15.58 15.59 Umbilical Catheter 7 Ureteral Catheter (Closed End) 4F Ureteral Catheter (Closed End) 5F Each Each Each Ureteral Catheter (Closed End) 6F Each Ureteral Catheter (Open End) 4F Each Ureteral Catheter (Open End) 5F Each Ureteral Catheter (Open End) 6F Each Urine Drainage bag (Capacity 1000 ml) Urobag -specifiaction: Urine Bag With Measured Volume Chamber should be designed for measurement of hourly urine output. Clear and transparent measured volume chamber should provides accurate measurement. Urine Meter should directly attached to two litre capacity Urine Bag with overflow facility. Completely closed circuit must eliminates the risk of contamination. Universal tapered connector should be facilitates asceptic catheter & urine bag connection - Size Adult Each Each 15.6 Urobag -specifiaction: Urine Bag With Measured Volume Chamber should be designed for measurement of hourly urine output. Clear and transparent measured volume chamber should provides accurate measurement. Urine Meter should directly attached to two litre capacity Urine Bag with overflow facility. Completely closed circuit must eliminates the risk of contamination. Universal tapered connector should be facilitates asceptic catheter & urine bag connection - Size Paediatric Each 15.61 Urometer Each 15.63 Vaccutrend Needle/Syringe 21" x 15" Each 15.62 15.64 15.65 15.66 15.67 15.68 15.69 15.7 15.71 15.72 15.73 15.74 15.75 15.76 15.77 15.78 15.79 Vaccu Suck Suction Set Each Vaccutrend Needle/Syringe 22" x 15" Each Vaccutrent Needle /Syringe Each Vaccutrent Needle /Syringe 5" Each Vacuum assisted dressing system Each Vascular Debeky Angle (Medium) Each Vascular Debeky Straight (Medium) Each Vaseline gauze Ventilator 15 mm breathing systems (with luer lock, 1.6 metre length and resealable water trap) for Paediatrics Ventilator Breathing System with resealable water traps (smooth lumen) Ventilator Delivery Hose Ventilator to Absorber Hose Each Each Each Each Each Ventilator to Absorber Hose Each Ventricular cannula Each Ventricular puncture needle Vertebral Bone Biopsy needles with introducer length 15 to 20 cm; gauge 16 to 20. Visceral catheters 89 Each Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 15.8 Walking stick Each 15.82 Wax knife Each 15.81 15.83 15.84 15.85 15.86 15.87 15.88 15.89 15.9 15.91 15.92 15.93 15.94 15.95 15.96 15.97 15.98 15.99 16 16.01 16.02 16.03 16.04 16.05 16.06 16.07 16.08 16.09 16.1 16.11 16.12 16.13 16.14 Waste Management Wheeled Bins. (660Lit ; 300lit; 1100 lit) Each Weight for traction (including Hook) 1 kg Each Weight for traction (including Hook) 1/2 kg Each Weight for traction (including Hook) 2 kg Each Weight for traction (including Hook) 3 kg Each Weight for traction (including Hook) 5 kg Each Weight for traction (including Hook)10 kg Each Wire cutter Each Wound and Bed Sore debriding agent Each X -ray developer Each X –ray developer liquid 5L Each X –ray developer powder 13.5L Each X –ray developer powder 9L Each X -ray film hanger Each X -ray fixer Each X –ray Fixer liquid 5L Each X –ray fixer powder 13.5L Each X –ray Fixer powder 9L Each X –ray view box –Single, Double & Triple) Each X -ray viewer Each X-Ray film (10 x 12)" - Kodak - 100 Shts Each X-Ray film (12 x 12)" - Kodak - 100 Shts Each X-Ray film (12 x 15)" - Kodak - 100 Shts Each X-Ray film (14 x 14)" - Kodak - 100 Shts Each X-Ray film (14 x 17)" - Kodak - 100 Shts Each X-Ray film (6.5 x 8.5)" - Kodak - 100 Shts Each X-Ray film (8 x 10)" - Kodak - 100 Shts Each X-ray film (Dental) Each Yaunkee Suction Each Y-connector for chest drainage suction Y-pieces for Breathing Circuit Each Each Surgical Ayres T 15mm modified Each Absorbable Gelatin Sponge U.S.P (Ab-Gel) 10 X 10 Each 90 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 16.15 Alginate impression materials(Dust free) Each 16.17 Frontalis suspension set Each 16.16 16.18 16.19 16.2 16.21 16.22 16.23 16.24 16.25 16.26 16.27 16.28 16.29 16.3 16.31 16.32 16.33 16.34 16.35 Double swivel with port 15mm Each Green PVC tubing 6mm for oxygen / per meter Each Bain Circuit (Neonate) Each Bain Circuit (Paediatric) Each Bain Circuit (Adult) Each I.V. Burette set Each Needle for shoe making Each Roas tracheal connectors 5 mm set in box Each 2 mm Osteotomes Each 20% Glycolic Acid Peel 59ml 25% Insulin LISPRO and 75% Insulin LISPRO Protamine Suspension 100 I.U/ml(n-DNA origin) 3ml Cartridge 5 Cart/Pack 3 mm Osteotomes 35% Glycolic Acid Peel 59ml 50% Insulin LISPRO and 50% Insulin LISPRO Protamine Suspension 100 I.U/ml(n-DNA origin) 3ml Cartridge 5 Cart/Pack 6F Bipolar pacing catheter Abdominal Sheet Absorbable Gelatin based Tropical Absorbable Hemostat: Absorbable Gelatin based Tropical Absorbable Hemostat with syringe pre-filled with hemostatic matrix with various length applicator and flexible application tips, specila storage if required should be provided, should have a shelf minimum 1 year from date of supply. Each Each Each Each Each Each Each Each Absorbable Gelatin Powder based Tropical Absorbable hemostat without formaldehyde. Should be sterilised by Dry Heat size:1mg Each Absorbable Gelatin Sponge should not be Cross linked by Formaldehyde.Should be streilised by Dry Heat size:7cm x 5cm x 1.0cm Each Absorbable Gelatin Sponge based Tropical Absorbable Hemostat without Formaldehyde. Should be sterilised by Dry Heat Size:20cm x 7cm x 0.05cm Each Absorbable Gelatin Sponge based Tropical Absorbable hemostat without formaldehyde.Should be streilised by Dry Heat size:3cm x 8cm Each Absorbablee Gelatin Sponged based Tropical Absorbable hemostat without formaldehyde.Should br sterilised by Dry Heat. Size: 7cm x 5cm x 0.5cm Each All Human Fibrin Sealant: Package should contain(different sku's-1ml,2ml,5ml)containing:one vial each of 55-85mg/ml fibrogen and 800-1200 IU/ml human thrombin as frozen solution. All human formulation free of Bovine Aprotinin. Triple lumen tip to prevent clogging inside the applicator. Maintain predictable fibrogen viscosity in a range of temperatures. Maintain fibronectin/fibrinogen ratio within physiological ranges. Adequate devices(in refrigeration etc) should be provided for storage at least 1 year from the date of supply. Each 16.4 Alterna 1-pc easy close maxi trans(transparent bag for colostomy custom cut 75 mm) Each 16.42 Alterna 2 pc easy close SF 60mm Each 16.36 16.37 16.38 16.39 16.41 16.43 Alterna 2 pc easy close SF 50mm Alterna longwear plate 40mm Each Each 91 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 16.44 Alterna longwear plate 50mm Each 16.46 Amikasin(0.016-256ug/ml Each 16.45 16.47 16.48 16.49 16.5 16.51 16.52 16.53 16.54 16.55 16.56 16.57 16.58 16.59 16.6 16.61 16.62 16.63 16.64 16.65 16.66 16.67 16.68 16.69 16.7 16.71 16.72 16.73 16.74 16.75 16.76 16.77 16.78 16.79 Alterna longwear plate 60mm Each Anaesthesia Mask Anti Static Size – 1 Each Anaesthesia Mask Anti Static Size – 2 Each Anaesthesia Mask Anti Static Size – 3 Each Anaesthesia Mask Anti Static Size – 4 Each Anaesthetic Mask (Non PVC) Size # 0 Each Anaesthetic Mask (Non PVC) Size # 1 Each Anaesthetic Mask (Non PVC) Size # 2 Each Anaesthetic Mask (Non PVC) Size # 3 Each Anaesthetic Mask (Non PVC) Size # 4 Each Anaesthetic Mask (Non PVC) Size # 5 Each Anaesthetic Face Mask (Clear non-PVC with colour coded seal) 1 Each Anaesthetic Face Mask (Clear non-PVC with colour coded seal) 2 Each Anaesthetic Face Mask (Clear non-PVC with colour coded seal) 0 Each Anaesthetic Face Mask (Clear non-PVC with colour coded seal) 3 Each Anaesthetic Face Mask (Clear non-PVC with colour coded seal) 5 Each Anaesthetic Face Mask (Clear non-PVC with colour coded seal) 4 Each Anaesthetic Face Mask (Economy) 0 Each Anaesthetic Face Mask (Economy) 1 Each Anaesthetic Face Mask (Economy) 2 Each Anaesthetic Face Mask (Economy) 4 Each Anaesthetic Face Mask (Economy) 5 Each Anaesthetic Face Mask (Economy) 3 Each Anaesthetic Scented Face Mask 3 Each Anaesthetic Scented Face Mask 4 Each Anaesthetic Scented Face Mask 0 Each Anaesthetic Scented Face Mask 1 Each Anaesthetic Scented Face Mask 2 Each Disposable Anaesthetic Mask Size 2 (EO Sterile) Each Disposable Anaesthetic Mask Size 3 (EO Sterile) Each Disposable Anaesthetic Mask Size 4 (EO Sterile) Each Disposable Anaesthetic Mask Size 5 (EO Sterile) Each Disposable nasal canula child Each Disposable Nebulizer Mask (EO Sterile) Adult Each 92 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 16.8 Disposable Nebulizer Mask (EO Sterile) Pediatric Each 16.82 Disposable Oxygen mask adult and child plane with tubing's Each 16.81 16.83 16.84 16.85 16.86 16.87 16.88 16.89 16.9 16.91 16.92 16.93 16.94 16.95 16.96 16.97 16.98 16.99 17 17.01 17.02 17.03 17.04 17.05 17.06 17.07 17.08 17.09 17.1 17.11 17.12 17.13 17.14 17.15 Disposable Oxygen Mask Adult (sterile) Each Disposable Oxygen mask adult and child with % control Each Disposable Oxygen Mask Pediatric (sterile) Each Anatomical Face Mask (Green colour without hook ring) 1 Each Anatomical Face Mask (Green colour without hook ring) 0 Each Anatomical Face Mask (Green colour without hook ring) 2 Each Anatomical Face Mask (Green colour without hook ring) 3 Each Anatomical Face Mask (Green colour without hook ring) 4 Each Anatomical Face Mask (Green colour without hook ring) 5 Each Anatomical face mask with inflatable pad size 2 Each Anatomical face mask with inflatable pad size 3 Each Anatomical face mask with inflatable pad size 5 Each Anatomical face mask with inflatable pad size 0 Each Anatomical face mask with inflatable pad size 4 Each Anatomical face mask with inflatable pad l size 1 Each Air Entrainment( Venturi) Mask high concentration white 35% Each Air Entrainment( Venturi) Mask high concentration white 40% Each Air Entrainment( Venturi) Mask high concentration white 50% Each Air Entrainment( Venturi) Mask low concentration blue 24% Each Air Entrainment( Venturi) Mask low concentration blue 26% Each Air Entrainment( Venturi) Mask low concentration blue 30% Each Cylindrical Silicone Face Mask 0 Each Cylindrical Silicone Face Mask 1 Each Cylindrical Silicone Face Mask 2 Each Oxygen-Air Entertainment Mask (Adult) Each Oxygen-Air Entertainment Mask (Child) Each Laryngeal Mask Airway (LMA) – MRI Compatible 3 Each Laryngeal Mask Airway (LMA) – MRI Compatible 4 Each Laryngeal Mask Airway (LMA) – MRI Compatible 1 Each Laryngeal Mask Airway (LMA) – MRI Compatible 1.5 Each Laryngeal Mask Airway (LMA) – MRI Compatible 2 Each Laryngeal Mask Airway (LMA) – MRI Compatible 2.5, Each Laryngeal Mask Airway (LMA) – MRI Compatible 5 Each LMA (Laryngeal mask airway) disposable size 1 Each 93 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 17.16 LMA (Laryngeal mask airway) disposable size 1.5 Each 17.18 LMA (Laryngeal mask airway) disposable size 2.5 Each 17.17 17.19 17.2 17.21 17.22 17.23 17.24 17.25 17.26 17.27 17.28 17.29 17.3 17.31 17.32 17.33 17.34 17.35 17.36 17.37 17.38 17.39 17.4 17.41 17.42 17.43 17.44 17.45 17.46 17.47 17.48 17.49 17.5 17.51 LMA (Laryngeal mask airway) disposable size 2 Each LMA (Laryngeal mask airway) disposable size 3 Each LMA (Laryngeal mask airway) disposable size 4 Each LMA (Laryngeal mask airway) disposable size 5 Each LMA (Laryngeal mask airway) silicon size 1 Each LMA (Laryngeal mask airway) silicon size 1.5 Each LMA (Laryngeal mask airway) silicon size 2 Each LMA (Laryngeal mask airway) silicon size 2.5 Each LMA (Laryngeal mask airway) silicon size 3 Each LMA (Laryngeal mask airway) silicon size 4 Each LMA (Laryngeal mask airway) silicon size 5 Each LMA (Laryngeal mask airway) Reusable size 1 Each LMA (Laryngeal mask airway) Reusable size 1.5 Each LMA (Laryngeal mask airway) Reusable size 2 Each LMA (Laryngeal mask airway) Reusable size 2.5 Each LMA (Laryngeal mask airway) Reusable size 3 Each LMA (Laryngeal mask airway) Reusable size 4 Each LMA (Laryngeal mask airway) Reusable size 5 Each Proseal Laryngeal Mask Airway (LMA) 2 Each Proseal Laryngeal Mask Airway (LMA) 3 Each Proseal Laryngeal Mask Airway (LMA) 1 Each Proseal Laryngeal Mask Airway (LMA) 1.5 Each Proseal Laryngeal Mask Airway (LMA) 2.5 Each Proseal Laryngeal Mask Airway (LMA) 3.5 Each Proseal Laryngeal Mask Airway (LMA) 4 Each Proseal Laryngeal Mask Airway (LMA) 5 Each Reinforced Laryngeal Mask Airway (LMA) 2 Each Reinforced Laryngeal Mask Airway (LMA) 1 Each Reinforced Laryngeal Mask Airway (LMA) 1.5 Each Reinforced Laryngeal Mask Airway (LMA) 2.5 Each Reinforced Laryngeal Mask Airway (LMA) 3 Each Reinforced Laryngeal Mask Airway (LMA) 3.5 Each Reinforced Laryngeal Mask Airway (LMA) 4 Each Reinforced Laryngeal Mask Airway (LMA) 5 Each 94 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 17.52 Randell Baker soucet face mask silicon (0) Each 17.54 Randell Baker soucet face mask silicon (2) Each 17.53 17.55 17.56 17.57 17.58 17.59 17.6 17.61 17.62 17.63 17.64 17.65 17.66 17.67 17.68 17.69 17.7 17.71 17.72 17.73 17.74 17.75 17.76 17.77 17.78 17.79 17.8 17.81 17.82 17.83 17.84 17.85 17.86 17.87 Randell Baker soucet face mask silicon ( 1) Each Randell Baker soucet face mask silicon (3) Each Non Invasive Mask (disposable) size:1 Each Non Invasive Mask (disposable) size:2 Each Non Invasive Mask (disposable) size:3 Each Non Invasive Mask (disposable) size:4 Each Non Invasive Mask (disposable) size:5 Each Non Invasive Mask (disposable) size:6 Each Non Invasive Mask (Reusable) Size: 1 Each Non Invasive Mask (Reusable) Size: 2 Each Non Invasive Mask (Reusable) size:3 Each Non Invasive Mask (Reusable) size:4 Each Non Invasive Mask (Reusable) size:5 Each Non Invasive Mask (Reusable) size:6 Each NIV silicon strap Small Each NIV silicon strap Big Each Nasopharyngeal airways silicon 9 mm Each Nasopharyngeal airways silicon 4mm Each Nasopharyngeal airways silicon 5mm Each Nasopharyngeal airways silicon 6mm Each Nasopharyngeal airways silicon 7mm Each Nasopharyngeal airways silicon 8mm Each Colour Coded Nasopharyngeal airway (Silicone) 6 (Green) Each Colour Coded Nasopharyngeal airway (Silicone) 7 (orange) Each Colour Coded Nasopharyngeal airway (Silicone) 8 (Red) Each Colour Coded Nasopharyngeal airway (Silicone) 9 (Purple) Venturi Valves 22F 6mm oxygen system, 24% venturi valve (Blue colour) Venturi Valves 22F 6mm oxygen system, 28% venturi valve (White) Venturi Valves 22F 6mm oxygen system, 31% venturi valve (Orange) Each Each Each Each Venturi Valves 22F 6mm oxygen system, 35% venturi valve (yellow) Each Venturi Valves 22F 6mm oxygen system, 40% venturi valve (Red) Each Venturi Valves 22F 6mm oxygen system, 60% venturi valve (Green) Each venturi mask yellow Each Venturi mask Blue Each 95 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 17.88 Venturi mask Green Each 17.9 Venturi mask white Each 17.89 17.91 17.92 17.93 17.94 17.95 17.96 17.97 17.98 17.99 18 18.01 18.02 18.03 18.04 18.05 18.06 18.07 18.08 18.09 18.1 18.11 18.12 18.13 18.14 18.15 18.16 18.17 18.18 18.19 18.2 18.21 18.22 18.23 Venturi mask Red Each Supraglottic Airway (I-Gel) 5 (Large Adult) Each Supraglottic Airway (I-Gel) 4 (Medium Adult) Each Supraglottic Airway (I-Gel) 1 (Neonate) Each Supraglottic Airway (I-Gel) 2.5 (Large Pedia.) Each Supraglottic Airway (I-Gel) 1.5 (Infant) Each Supraglottic Airway (I-Gel) 3 (Small Adult) Supraglottic Airway (I-Gel) Each (Small Pedia.) Each SAM (Sanjivini Airway Mask) disposable 4.5 Each SAM (Sanjivini Airway Mask) disposable 5 Each SAM (Sanjivini Airway Mask) disposable 2.5 Each SAM (Sanjivini Airway Mask) disposable 3 Each SAM (Sanjivini Airway Mask) disposable 3.5 Each SAM (Sanjivini Airway Mask) disposable 4 Each Snuggy all silicon face mask size 1 Each Snuggy all silicon face mask size 2 Each Snuggy all silicon face mask size 3 Each Snuggy all silicon face mask size 4 Each Snuggy all silicon face mask size 0 Each Snuggy all silicon face mask e size 5 Each Nasopharyngeal airways silicon 9 mm Each Nasopharyngeal airways silicon 4mm Each Nasopharyngeal airways silicon 5mm Each Nasopharyngeal airways silicon 6mm Each Nasopharyngeal airways silicon 7mm Each Nasopharyngeal airways silicon 8mm Each Angle Mount 15F Each Angle Mount 15M Each Angle Mount 22F, Each Angle Mount 22M Each Angle Mount 23F Each Angle Mount 23M Each Aortic Vascular Grafts (Double Veloure Woven) Straight, Size:18 m Each Aortic Vascular Grafts (Double Veloure Woven) Straight, Size:20m Each 96 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 18.24 Aortic Vascular Grafts (Double Veloure Woven) Straight, Size:22m Each 18.26 Arotic Vascular graft (Double Veloure Woven) Bifarcated Y Vascular Graft- 16 X8 X8 Each 18.25 18.27 18.28 18.29 18.3 18.31 18.32 18.33 18.34 18.35 18.36 18.37 18.38 18.39 18.4 18.41 18.42 18.43 18.44 18.45 18.46 18.47 18.48 18.49 18.5 18.51 18.52 18.53 18.54 18.55 18.56 18.57 18.58 18.59 Applicator Sticks Arotic Vascular graft (Double Veloure Woven) Bifarcated Y Vascular Graft- 18 X9 X 9 Arotic Vascular graft (Double Veloure Woven) Bifarcated Y Vascular Graft- 20X10 X10 Arterial cannula 18G with cork Arterial cannula 20G with cork Each Each Each Each Each Arterial line leader cath 18G Each Arterial Line Leadercath 20G Each Artficial implant- Child Each Artificial implant - Adult Each Artificial Eyes Adult Each Artificial Eyes Child Each Artificial Eyes Infant Each Artificial implant- Infant Each Asepto Pump Each AT1 ECG paper Each Autoclavable biohazard plastic bag 10liter Each Autoclavable biohazard plastic bag 20liter Each Autoclavable biohazard plastic bag 30liter Each Autoclave Level (Steam Chemical Indicator Tape) 50mtr Roll Each Automizer Each Ayres T -piece (Anaesthetic Beathing System) -Adult Each Ayres T -piece (Anaesthetic Beathing System) -Child Each Ayres T -piece (Anaesthetic Beathing System) -Neonatal Each Ayres T pieces Each Blood Tubing Line Bacterial Filter, Round for DC 20 SU Suction Machine Make: Simex, Germany Bags Mount 22mm female male pair Bags Mount 23mm female male pair Each Each Each Each Barrier Cream (for soothing dry/crack skin around stomache Each Biological Indicator for Plasma Sterilizer. Each Biological Indicator (Attest) for ETO -3M Each Biological Indicator (Attest) for Steam -3M Each BIPP packs Each Bone Cement(Plain) Each 97 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 18.6 Bone Cement(Antibiotics) Each 18.62 BP Rubber pump Each 18.61 18.63 18.64 18.65 18.66 18.67 18.68 18.69 18.7 18.71 18.72 18.73 18.74 18.75 18.76 18.77 18.78 18.79 18.8 18.81 18.82 18.83 18.84 18.85 18.86 18.87 18.88 18.89 18.9 18.91 18.92 18.93 18.94 18.95 Bougie(stylet) Each Breathing Bag 0.5ltr Each Breathing Bag 1.5ltr Each Breathing Bag 1ltr Each Breathing Bag 2ltr Each Bronchial Stapler Size 60mm Each Broncho Cath Left # 28 Fr/Ch Each Broncho cath left # 29Fr/Ch Each Broncho cath left # 31Fr/ch Each Broncho cath left # 35fr/ch Each Broncho cath Left # 27Fr/Ch Each Broncho cath left # 30Fr/ch Each Broncho Cath Left # 32 Fr/Ch Each Broncho Cath Left # 33Fr/Ch Each Broncho Cath Left # 34Fr/Ch Each Broncho Cath Left # 36 Fr/Ch Each Broncho Cath Left # 37 Fr/Ch Each Broncho Cath Left # 38Fr/Ch Each Broncho Cath Left # 39Fr/Ch Each Broncho Cath Left # CPAP System Each Broncho cath Right-27Fr/Ch Each Broncho cath Right-28Fr/Ch Each Broncho cath Right-29Fr/Ch Each Broncho cath Right-30Fr/Ch Each Broncho cath Right-31Fr/Ch Each Broncho cath Right-32Fr/CH Each Broncho cath Right-33Fr/Ch Each Broncho cath Right-34Fr/Ch Each Broncho cath Right-35Fr/Ch Each Broncho cath Right-36Fr/Ch Each Broncho cath Right-37Fr/Ch Each Broncho cath Right-38Fr/Ch Each Broncho cath Right-39Fr/Ch Each Burretta Each 98 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 18.96 Camel hair brush Each 18.98 Capsular Tension Rings Each 18.97 18.99 19 19.01 19.02 19.03 19.04 19.05 19.06 19.07 19.08 19.09 19.1 19.11 19.12 19.13 19.14 19.15 19.16 19.17 19.18 19.19 19.2 19.21 19.22 19.23 19.24 19.25 19.26 19.27 19.28 19.29 19.3 19.31 CAPD Catheter Tenckhoff with 2 felt cuffs SA 1242 (420 mm) Each Carbon brush. Each Carbon paper Each C-Arm Cover (disposable) Each Cast Taper Mandrel Each Catheter mount Each Catheter Mount (Plastic) 15F Each Catheter Mount (Plastic) 15M Each Catheter Mount (Plastic) 22F Each Catheter Mount (Plastic)22M Each Catheter Mount (Plastic)23.5F Each Catheter Mount (Plastic)23F Each Catheter Mount (Plastic)23M Each Cefotaxim + clavulanin( 0.004-128 ug/ml) Each Cefotaxim 0.016-256 ug/ml Each Femoral Catheter Single lumen Each C VP Manometer Catheter Single lumen Each Central venous Catheter Single lumen 2Fr 30cm X18G Each Central venous Catheter Single lumen 2Fr 30cm x16G Each Central venous Catheter Single lumen 2Fr 30cm x20G Each Central venous Catheter Single lumen 2Fr 30cm x22G Each Central venous Catheter Single lumen 2Fr 30cm x24G Each Central venous Catheter Single lumen 2Fr 30cm x26G Each Central venous Catheter Single lumen 5Fr 30cm X 18G Each Central venous Catheter Single lumen 5Fr 30cm X 20G Each Central venous Catheter Single lumen 5Fr 30cm X 22G Each Central venous Catheter Single lumen 5Fr 30cm X 24G Each Central venous Catheter Single lumen 5Fr 30cm X 26G Each Central venous Catheter Single lumen 7Fr 30cm X 16G Each Central venous Catheter Single lumen 7Fr 30cm X 18G Each Central venous Catheter Single lumen 7Fr 30cm X 20G Each Central venous Catheter Single lumen 7Fr 30cm X 22G Each Central venous Catheter Single lumen 7Fr 30cm X 24G Each Central venous Catheter Single lumen 7Fr 30cm X 26G Each 99 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 19.32 Femoral catheter double lumen Each 19.34 Central venous Catheter Double lumen 5Fr 30cmX 16G, 16G Each 19.33 19.35 19.36 19.37 19.38 19.39 19.4 19.41 19.42 19.43 19.44 19.45 19.46 19.47 19.48 19.49 19.5 19.51 19.52 19.53 19.54 19.55 19.56 19.57 19.58 19.59 19.6 19.61 19.62 19.63 19.64 19.65 19.66 19.67 C VP Manometer Catheter Double lumen Each Central venous Catheter Double lumen 5Fr 30cmX 18G, 18G Each Central venous Catheter Double lumen 5Fr 30cmX 20G, 20G Each Central venous Catheter Double lumen 5Fr 30cmX 22G, 22G Each Central venous Catheter Double lumen 5Fr 30cmX 24G, 24G Each Central venous Catheter Double lumen 5Fr 30cmX 26G, 26G Each Central venous Catheter Double lumen 2Fr 30cmX 16G, 16G Each Central venous Catheter Double lumen 2Fr 30cmX 18G, 18G Each Central venous Catheter Double lumen 2Fr 30cmX 20G, 20G Each Central venous Catheter Double lumen 2Fr 30cmX 22G, 22G Each Central venous Catheter Double lumen 2Fr 30cmX 24G, 24G Each Central venous Catheter Double lumen 2Fr 30cmX 26G, 26G Each Central venous Catheter Double lumen 7Fr 30cmX 16G, 16G Each Central venous Catheter Double lumen 7Fr 30cmX 18G, 18G Each Central venous Catheter Double lumen 7Fr 30cmX 20G,20G Each Central venous Catheter Double lumen 7Fr 30cmX 22G,22G Each Central venous Catheter Double lumen 7Fr 30cmX 24G,24G Each Central venous Catheter Double lumen 7Fr 30cmX 26G,26G Each Femoral catheter triple lumen Each C VP Manometer Catheter triple lumen Each Central venous Catheter Triple lumen 2Fr 30cm X 16G, 18G,18G Each Central venous Catheter Triple lumen 2Fr 30cm X 16G, 20G,20G Each Central venous Catheter Triple lumen 2Fr 30cm X 16G, 22G,22G Each Central venous Catheter Triple lumen 2Fr 30cm X 16G, 24G,24G Each Central venous Catheter Triple lumen 2Fr 30cm X 16G, 26G,26G Each Central venous Catheter Triple lumen 5Fr 30cm X 16,18G,18G Each Central venous Catheter Triple lumen 5Fr 30cm X 16,20G,20G Each Central venous Catheter Triple lumen 5Fr 30cm X 16,22G,22G Each Central venous Catheter Triple lumen 5Fr 30cm X 16,24G,24G Each Central venous Catheter Triple lumen 5Fr 30cm X 16,26G,26G Each Central venous Catheter Triple lumen 7Fr 30cm X 16,18G,18G Each Central venous Catheter Triple lumen 7Fr 30cm X 16,20G,20G Each Central venous Catheter Triple lumen 7Fr 30cm X 16,22G,22G Each Central venous Catheter Triple lumen 7Fr 30cm X 16,24G,24G Each 100 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 19.68 Central venous Catheter Triple lumen 7Fr 30cm X 16,26G,26G Each 19.7 Cervical Spatula ( Wooden) Each 19.69 19.71 19.72 19.73 19.74 19.75 19.76 19.77 19.78 19.79 19.8 19.81 19.82 19.83 19.84 19.85 19.86 19.87 19.88 19.89 19.9 19.91 19.92 19.93 19.94 19.95 19.96 19.97 19.98 19.99 20 20.01 20.02 20.03 Cerebellum Each Chiesel Each Circuit Adaptor Each Circuit Mount Each Circular pediatrics silicon mask size 0 Each Circular pediatrics silicon mask size 00, Each Circular pediatrics silicon mask size 0A Each Circular pediatrics silicon mask size 0B Each Circular pediatrics silicon mask with cuff size 0 Each Circular pediatrics silicon mask with cuff size 00 Each Circular pediatrics silicon mask with cuff size 0A Each Circular pediatrics silicon mask with cuff size 0B Each Cleaning Brush Each Cleaning solution Each Clinical Thermometer Each Cloth Face mask, reusable Each Coloplast strip paste Each Coloring Pigment- Cinnamon Each CPR manikin Each Stomahesive 45MM Each Stomahesive 57MM Each Stomahesive 70MM Each Durahesive 45MM Each Durahesive 57MM Each Stoma Flatmoldable Small 45MM Each Stoma Flatmoldable Medium 45MM Each Stoma Flatmoldable Regular 57MM Each Stoma Flatmoldable Large 70MM Each Moldable convex 12/22MM Each Moldable convex 22/33MM Each Moldable convex 33/57MM Each Ostomy Appliance Accessories Belt Each Cased 4" Edge Blade UN-INS Each Coloured Ph indicator Paper Each 101 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 20.04 colouring pigment- cinnamon Each 20.06 Combitube 39Fr Each 20.05 20.07 20.08 20.09 20.1 20.11 20.12 20.13 20.14 20.15 20.16 20.17 20.18 20.19 20.2 20.21 20.22 20.23 20.24 20.25 20.26 20.27 20.28 20.29 20.3 20.31 20.32 20.33 20.34 20.35 20.36 20.37 20.38 20.39 combi bag Each Combitube 40Fr Each Combitube 37Fr Each Combitube 41 Fr. Each Comfeel plus ulcer dressing 15cm x 15cm Each Comfeel plus ulcer cream 10cm x 10cm Each conformer- adult Each Conformer- Child Each Conformer -Infant Each Conformer Shell Adult Each Conformer Shell Child Each Conformer Shell Infant Each Contrast for Myelography Omnipaque -10 ml Each Corrugated breathing tubes silicon 105cm x 22mm Each Corrugated breathing tubes silicon 10cm x 11mm Each Corrugated breathing tubes silicon 15cm x 11mm Each Corrugated breathing tubes silicon 30cm x 11mm Each Corrugated breathing tubes silicon 30cm x 22mm Each Corrugated Drainage Sheet with X-Ray Opaque Line Each Cortex graft Size 4 Each Cortex graft Size 3.5 Each Cortex graft Size 6 Each Cosmetic Shell Adult Each Cosmetic Shell Child Each Cosmetic Shell Infant Each Cotton Roll 50gm (Net weight) Each Cotton Roll 100gm (Net weight) Each Cotton roll 500gm (Net weight) Each Cotton sheet, Double 30 x 30 Each Cotton sheet, Double 40 x 40 Each Cotton sheet, Double 50 x 50 Each Cotton sheet, Single 70 x 58 Each Cotton tape (umbilical tape) Each CPTFE Cardiovascular Patch(W:30m , L:60m , T:0.4mm) Each 102 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 20.4 Cresent Blade Angled Each 20.42 Cricothyroidtomy set (cooks) Each 20.41 20.43 20.44 20.45 20.46 20.47 20.48 20.49 20.5 20.51 20.52 20.53 20.54 20.55 20.56 20.57 20.58 20.59 20.6 20.61 20.62 20.63 20.64 20.65 20.66 20.67 20.68 20.69 20.7 20.71 20.72 20.73 20.74 20.75 Cresent Knife bevel up Each Cutting needle (curve) No. 12 Each Cervical Punch Biopsy Each Desicator with cover 150mm Each Desicator with cover 200mm Each Desicator with cover 300mm Each Dettol solution ml Savlon Solution liter Diacetate Hollow Fiber Dialyzer Each Disposable Biopsy Punch 1.5mm Each Disposable Biopsy Punch 1mm Each Disposable Biopsy Punch 2mm Each Disposable Biopsy Punch 2.5mm Each Disposable Biopsy Punch 3mm Each Disposable Biopsy Punch 3.5mm Each Disposable Biopsy Punch 4mm Each Disposable Biopsy Punch 4.5mm Each Disposable Biopsy Punch 5mm Each Disposable Biopsy Punch 5.5mm Each Disposable Biopsy Punch 6mm Each Disposable Biopsy Punch 6.5mm Each Disposable breathing circuit for circle absorber Disposable Clips M L for open & Laprosopic Surgery (pilling - wack type) Disposable eye drape with drainage bag Disposable Falcon T-30 flasks Each Each Each Each Disposable Incentive Spirometer Each Disposable Iris Hooks/Retractor Each Disposable Kelly" Pad Each Disposable microtome knife Each Disposable Surgical 2.8mm keratome knifes Each Disposable Surgical 3.2mm keratome knifes Each Disposable Surgical 5mm keratome knifes Each Disposable Surgical 5.25mm keratome knifes Each Disposable Surgical 5.5mm keratome knifes Each 103 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 20.76 Disposable Surgical crescent knifes, angled Each 20.78 Disposable Trucut Biopsy Gun 14F Each 20.77 20.79 20.8 20.81 20.82 20.83 20.84 20.85 20.86 20.87 20.88 20.89 20.9 20.91 20.92 20.93 20.94 20.95 20.96 20.97 20.98 20.99 21 21.01 21.02 21.03 21.04 21.05 21.06 21.07 21.08 21.09 21.1 21.11 Disposable Surgical MVR knifes, straight Each Disposable Trucut Biopsy Gun 16F Each Disposable Trucut Biopsy Gun 18F Each Disposable Trucut Biopsy Gun 20F Each Disposables piles band applicator with transparent anoscope Each Dissecting Instrument Box Each Dome set (Arterial/CVP monotoring pressure kit) Each Domes with 2 Port (Luer Lock) P10EZ Heart Each Double swivel with port 15 mm x 22mm Each Douderm 30gm Each Drape Formers Trans femoral Each Drape Formers Trans tibial Each Drape Frame 342mm Sq. Blank Each Drape Frame 406mm Sq. Blank Each Draping sheet with central hole Each DT Printer Paper Each DVT Prevention Stockings for legs Each E T Tube exchanger Each Easy Pump (Pressure Infusion Bag) 125ml. Each Easylite Printer Paper Roll 79mm x 13meters Each ECG Graph paper 80mm x 20meters Each ECG Jelly 250ml Each ECG paper (dot cart) 50mmx30meteres for 6108T machine Each ECG paper (Z fold) - (5 pkt per box) Each ECG paper for BPL Cardiart 6208 Each ECG paper for BPL Cardiart 8108R Each ECG Paper Schiller AT-2/AT-2/Plus Each ECG patient cable (Adult) Schiller AT-1 Machine Each ECG patient cable (Pediatric) Schiller AT-1 Machine Each Electric Drill Each Eliza Printing paper 110mm x 20meter Each Embolectomie Arterielle 4 Each Embolectomie Arterielle 5 Each Epidural Catheter full set 16G Each 104 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 21.12 Epidural Catheter full set 18G Each 21.14 Epidural Catheter 16G(Catheter only) Each 21.13 21.15 21.16 21.17 21.18 21.19 21.2 21.21 21.22 Epidural catheter full set 19G Each Epidural Catheter 18G(Catheter only) Each Epidural Catheter 19G(Catheter only) Each Epidural Catheter Set Mini Pack 16G Each Epidural Catheter Set Mini Pack 18G Each Epidural Catheter Set Mini Pack 19G Paediatric Epidural Minipak Each 19G PEAD. EPIDURAL CATHETER SET Must have 23G catheter, Tuohy needle 19G length 50mm Flat filter, loss of resistance device Epidural tray/kit Tuohy needle with lateral eyes, catheter connector, filter with syringe guide wire for introducer 18G Each Each Each 21.23 EPIDURAL CATHETER SET With Needle, Catheter & Bacterial filter, with L.O.R, Epidural line label Catheter guide, Must have Polyether Catheter closed tip with 3 lateral eyes Within 4mm and 200mm from the tip with BS6196 standard Catheter Size: 19G Catheter for 16G Needle & 20G Catheter For 18G Needle -OD1.1mm length 915mm -Touhy needle 16g &18g with length 80mm Each 21.24 Espocan with Docking System Each 21.26 ETO packing sleeves roll (3M) 12' Each 21.25 21.27 21.28 21.29 ETO chemical Indicator tape -3M Each ETO packing sleeves roll (3M) 4' Each ETO packing sleeves roll (3M) 6' Evicel 1ml( All-Human(Bovine Aprotinin free)Fibrin sealant)(a) Apackage containing one vial each of BAC2(5585mg/mlfibrinogen) andThrombin(800-1200IU/ml human Thrombin) frozen solutions.(b) All-Human formulation free of bovine Aprotinin. ©Triple lumen tip to prevent clogging inside the applicatore.(d) Maintains predictable fibrinogen viscosity in a range of temperatures. (e) Mainatains fibronectin/fibrinogen ratio within physiologic ranges. Each Each 21.3 Evicel 2ml( All-Human(Bovine Aprotinin free)Fibrin sealant)(a) Apackage containing one vial each of BAC2(5585mg/mlfibrinogen) andThrombin(800-1200IU/ml human Thrombin) frozen solutions.(b) All-Human formulation free of bovine Aprotinin. ©Triple lumen tip to prevent clogging inside the applicatore.(d) Maintains predictable fibrinogen viscosity in a range of temperatures. (e) Mainatains fibronectin/fibrinogen ratio within physiologic ranges. Each 21.31 Evicel 5ml( All-Human(Bovine Aprotinin free)Fibrin sealant)(a) Apackage containing one vial each of BAC2(5585mg/mlfibrinogen) andThrombin(800-1200IU/ml human Thrombin) frozen solutions.(b) All-Human formulation free of bovine Aprotinin. ©Triple lumen tip to prevent clogging inside the applicatore.(d) Maintains predictable fibrinogen viscosity in a range of temperatures. (e) Mainatains fibronectin/fibrinogen ratio within physiologic ranges. Each 21.32 Surgicel Fibrillar 1963 Each 21.34 Exipiratory filter Adult For PB840 (Reusable) Each 21.33 21.35 21.36 21.37 21.38 Exipiratory filter Adult For PB840 (Disposable) Each Exipiratory filter Neonate For PB840 (Disposable) Each Exipiratory filter Neonate For PB840 (Reusable) Each Expiratory filter Pediatric(PB 840) (Disposable) Each Expiratory filter Pediatric(PB 840) (Reusable) Each 105 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 21.39 External fixator smaller components:SCHANZ PINS(CORTICAL AND CANCELLOUS) Each 21.41 finger Aluminium splint(Vesco/Alimco) Each 21.4 21.42 21.43 21.44 21.45 21.46 21.47 21.48 21.49 21.5 21.51 21.52 21.53 21.54 21.55 21.56 21.57 21.58 21.59 21.6 21.61 21.62 21.63 21.64 21.65 21.66 21.67 21.68 21.69 21.7 21.71 21.72 21.73 21.74 Eye shield First aid box Each Each Flexible Cath Mount 22F Each Flow Weave Bioseal (L:30cm D:18mm) Each Flow Weave Bioseal (L:30cm D:20mm) Each Flow Weave Bioseal (L:30cm D:22mm) Each Flow Weave Bioseal (L:45cm D:16 x 8mm) Each Flow Weave Bioseal (L:45cm D:18 x 9mm) Each Flow Weave Bioseal (L:45cm D:20 x 10mm) Each Fluroracil 10ml Each Fog-artery Catheter Size 3F Each Fog-artery Catheter Size 4F Each Fog-artery Catheter Size 5F Each Fog-artery Catheter Size 6F Each Fogatery Arterial Embolectomic Catheter 2F Each Fogatery Arterial Embolectomic Catheter 3F Each Fogatery Arterial Embolectomic Catheter 4F Each Fogatery Arterial Embolectomic Catheter 5F Each Fogatery Arterial Embolectomic Catheter 6F Each Fogatery Arterial Embolectomic Catheter 7F Each Foot piece(Ranger) Each Frenck Chalk Each Frontalis Suspension Set Each G- Bone Each Ginevri Capillary tube (Heperinised) Each Ginevri sealing wax Each Glass connector "T" Each Glass connector "Y" Each Gloves wrapper Each Glycerine I.P 450ml Each Gonad shield Each Laparoscopic Aspiration needle Each Green cloth Each Guide Wire (J Curve) Each 106 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 21.75 Guidewire Curved Tube Each 21.77 Heat connector (Blower) Each 21.76 21.78 21.79 21.8 21.81 21.82 21.83 21.84 21.85 Gum elastic bougie Each Hemorrhoids and Prolapsed Stapler with Detachable Anvil 3.5mm Each Hemorrhoids and Prolapsed Stapler with Detachable Anvil 4.8mm Each Hip-U drape Hollow Fibre Dialyser 1300 &1500 (1.3 &1.5 sq. mtr) Ster by Gamma Irradition Hose Mount 15mm female male pair Hose Mount 22mm female male pair Humalog Cartridge - Insulin lispro injection(rDNA origin) 21.87 21.89 Hygrobaby/HME Filter (Infant) 21.88 21.9 21.91 21.92 21.93 21.94 21.95 21.96 21.97 21.98 21.99 22 22.01 22.02 22.03 22.04 22.05 22.06 22.07 22.08 22.09 22.1 Each Each Each Humalog Cartridge for patients taking carbohydrates rich meals, mix50, 50% Insulin lispro((rDNA origin) injection,50 % insulin lispro protamine suspension. Humalog Cartridge for Insulin-naïve patients mix25, 25% Insulin lispro((rDNA origin) injection, 75 % insulin lispro protamine suspension. Humapen ERGO II Insulin Delivery Pen will be provided free 5 Cart/Pack 21.86 Each Hydroquinone crystal photography quality Each Each Each Each Each Each Hygroboy/HME Filter (Paediatric) Each Hygrostar/HME Filter (Adult) Each hygrobac S Each ILeum Each Improvised orbital implant size child No 20 Each Improvised orbital implant size Adult No 22 Each Improvised orbital implant size Adult No 20 Each Improvised orbital implant size Adult no 24 Each Improvised orbital implant size child No 18 Each Improvised orbital implant size infant - No 18 Each Improvised orbital implant size infant- No16 Each Improvised orbital implant sizers Each Improvised orbital implant sizers - No 22 Each Improvised orbital implant sizers - No 24 Each Improvised orbital implant sizers Adult Each Improvised orbital implant sizers child Each Improvised orbital implant sizers infant Each Improvised orbital implant sizers- No 16 Each Improvised orbital implant sizers- No 18 Each Improvised orbital implant sizers- No 20 Each Infant bonnet 17-22cm Each 107 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 22.11 Infant bonnet 19-22cm Each 22.13 Infant bonnet 25-30cm Each 22.12 22.14 22.15 22.16 22.17 22.18 22.19 22.2 22.21 22.22 22.23 22.24 22.25 22.26 22.27 22.28 22.29 22.3 22.31 22.32 22.33 22.34 22.35 22.36 22.37 22.38 22.39 22.4 22.41 22.42 22.43 22.44 22.45 Infant bonnet 22-25cm Each Infant T-piece with in built oxygen blender and CPAP Each Inoculatin wire (straight & 100p), with holder, 100p size – 0.01 ml Each Inspiratory Filter for PB 840(Disposable) Each Inspiratory Filter for PB 840(Reusable)) Each Intima II Y Each Intraocular lense 6mm optics foldable, square edge, Hydrophobic Each Intraocular lense rigid 5.25mm optics,PMMA, square edge Each Intraocular lense rigid 5.5mm optics Each Intraocular lense rigid 5.5mm optics foldable Each Intraocular lense rigid 6mm optics Each Intraocular lense rigid 6mm optics foldable Each Intraocular lense rigid 6mm optics, PMMA, square edge Each Rigid Anterior Chamber Intraocular Lens: Lens Power +16D(6.00mm) Each Rigid Anterior Chamber Intraocular Lens: Lens Power +19D(6.00mm) Each Rigid Anterior Chamber Intraocular Lens: Lens Power +18D(6.00mm) Each Rigid Anterior Chamber Intraocular Lens: Lens Power +20D(6.00mm) Each Rigid Anterior Chamber Intraocular Lens: Lens Power +21D(6.00mm) Each Rigid Anterior Chamber Intraocular Lens: Lens Power +22D(6.00mm) Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm) Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.5D(5.50mm) Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm) Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.0D(5.50mm) Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.5D(5.50mm) Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.0D(5.50mm) Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.5D(5.50mm) Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.0D(5.50mm) Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.5D(5.50mm) Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.0D(5.50mm) Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.5D(5.50mm) (a) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +10.0D 6.0mm (b) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +113.5D 6.0mm (c) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+14.0D 6.0mm 108 Each Each Each Each Each Each Each Each Each Each Each Each Each Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 22.46 22.47 22.48 22.49 22.5 22.51 22.52 22.53 22.54 22.55 22.56 22.57 22.58 22.59 22.6 22.61 22.62 22.63 22.64 22.65 22.66 22.67 22.68 22.69 22.7 (d) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.0D 6.0mm Each (f) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.0D 6.0mm Each (h) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.0D 6.0mm Each (j) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.0D 6.0mm Each (l) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19..0D 6.0mm Each (n) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.0D 6.0mm Each (p) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.0D 6.0mm Each (r) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.0D 6.0mm Each (t) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+23.0D 6.0mm Each (v) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.0D 6.0mm Each (x) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.0D 6.0mm Each (z) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+26.0D 6.0mm Each Isolyte P Each (e) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.5D 6.0mm Each (g) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.5D 6.0mm Each (i) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.5D 6.0mm Each (k) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.5D 6.0mm Each (m) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19.5D 6.0mm Each (o) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.5D 6.0mm Each (q) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.5D 6.0mm Each (s) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.5D 6.0mm Each (u)Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +23.5D 6.0mm Each (w) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.5D 6.0mm Each (y) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.5D 6.0mm Each Isolyte M Each 109 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 22.71 Knee-O drape Each 22.73 K-Wires 2.5mm Each 22.72 22.74 22.75 22.76 22.77 22.78 22.79 22.8 22.81 22.82 22.83 22.84 22.85 22.86 22.87 22.88 22.89 22.9 22.91 22.92 22.93 22.94 22.95 22.96 22.97 22.98 22.99 23 23.01 23.02 23.03 23.04 23.05 23.06 K-Wires 1.5mm Each K-Wires 2mm Each K-Wires 3mm Each K-Wires 4mm Each Labels for Micro centrifuge tubes white Size ½” Each Lacrimal Plugs Each Lacrimal SAC Intubation set(Silicon) Each Larygoscope 0 size blade Each Larygoscope 1 size blade Each Larygoscope 2 size blade Each Laryngeal Tube (LT # 3) Each Laryngeal Tube (LT # 4) Each Laryngeal Tube with Cuffed Pressure Gauge Universal (Portex) Each Latex tube Each Leg O-Drape (disposable) Each Leg U-Drape (disposable) Each Lid Imported quality-CE certified Each Light weight lead Apron (Big) Each Light weight lead Apron (Medium) Each Light weight lead Apron (Small) Each Linisher Machine Each Lipiodol 10ml Each Mayo trolly cover (disposable) Each Medicinal Droppers – 1ml, 2ml capacity Each Membrane Assembly Each Merocel Nasal Packs( with strings,with tubes) Each Merocel Nasal Packs( with strings,without tubes) Each Meroceli eye spear sponge Each Micro Centrifuge Tube 1.5ml Each Micro Centrifuge Tube 15ml Each micro centrifuge tubes-.2ml (with thin wall for PCR) Each micro centrifuge tubes-.5ml (with thin wall for PCR) Each micro centrifuge tubes-2ml Each Microscope Bulb- 6V 20W Each 110 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 23.07 Microscope fumigator Each 23.09 MLS E.T tubes Each 23.08 23.1 23.11 23.12 23.13 23.14 23.15 23.16 23.17 23.18 23.19 23.2 23.21 23.22 23.23 23.24 23.25 23.26 23.27 23.28 23.29 23.3 23.31 23.32 23.33 23.34 23.35 23.36 23.37 23.38 23.39 23.4 23.41 23.42 Mini & micropates with screw Each Mono Component Insulin LISPRO 100 i.u./ml(N-dna ORIGIN)3ml Cartridge 5 Cart/Pack MRI compatible biopsy needles/guns (9cm/15cm MRI compatible ECG chest leads Each Each Each MRI compatible Spo2 monitor Each Multi Load CU375 (Multi Uterine Device) Each Multisite Oxygen sensor with ear clip (Dura-Y D-YS) - Neonates Each Multisite Oxygen sensor with ear clip (Dura-Y D-YS) - Pediatric Each Multisite Oxygen sensor without ear clip (Dura-Y D-YS) - Neonates Each Multisite Oxygen sensor without ear clip (Dura-Y D-YS) - Pediatric Each Nasal Spee Each Nasal splints Each Nasal Tubing 70mm Each NBCA glue Each Nebuliser kit with face mask Each Nebulization kit for Galileo gold Ventilator Each Needle (cutting) big Each Needle (cutting) medium Each Needle (cutting) small Each Needle (round body) big Each Needle (round body) medium Each Needle (round body) small Each Needle and hub destroyer Each Neonatal circuit reusable(for Ventilator Galileo gold) Each Neonatal Dialysis set with Infusion set Neonatal Dialysis set with Infusion set + Neonatal exchange transfusion set Non invasive cardiac output monitoring electrode Non invasive cardiac pacing electrode Each Each Each Each Non Rebreathing Mask Neonatal Each Non Rebreathing Mask Pediatric Each Non Rebreathing Mask Adult Each Non woven collagen based bio-prosthetics 8 layer tissue graft 13 X 15 Each Non woven collagen based bio-prosthetics 8 layer tissue graft 13 X 22 Non woven collagen based bio-prosthetics 8 layer tissue graft 20 X 130 111 Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 23.43 Non woven collagen based bio-prosthetics 8 layer tissue graft 20 X 22 Each 23.45 Non woven collagen based bio-prosthetics inguinal hernia graft 10 X 15 Each 23.44 23.46 23.47 23.48 23.49 23.5 23.51 23.52 23.53 23.54 23.55 23.56 23.57 23.58 23.59 23.6 23.61 23.62 23.63 23.64 23.65 23.66 23.67 23.68 23.69 23.7 23.71 23.72 23.73 23.74 23.75 23.76 23.77 23.78 Non woven collagen based bio-prosthetics Anal Fistula Plug Non woven collagen based bio-prosthetics inguinal hernia graft 6 X 15 Non woven collagen based bio-prosthetics inguinal hernia graft 8 X 15 NST paper ( Baby Duplex Monitor 6" plain paper) Ointment Pot Porcelain 50gms capacity Omnex(Synthetic tissue adhesive consisting of 0.5ml blend of two monomers,2-Octyl cyanoacrylate(2-OCA) and butyl lactoyl cyanoacrylate(BLCA) Each Each Each Each Each Each Opsite (10cmX14cm) Each Opsite (30cmX28cm) Each Opsite (15cmX28cm) Each Opsite (40cmX42cm) Each Opsite (45cmX28cm) Each Opsite (45cmX55cm) Each Orbital Implants adults Each Orbital Implants size child Each Orbital Implants size infant Each oropharyngeal mask 0 Each oropharyngeal mask 00 Each oropharyngeal mask 000 Each oropharyngeal mask 1 Each oropharyngeal mask 2 Each oropharyngeal mask 3 Each oropharyngeal mask 4 Each Ostomy powder 25gm Each Oxford red rubber ET tube (3 to 6 mm) Each Oxygen cells for Galileo gold ventilator Each Oxygen sensor for Galileo gold ventilator Each Oxygen sensor PB 840 Each Oxygen T-Piece(Plastic)/Oxygen recovery kit(Trache tee gold) Each Trachee tee Each P P I Drape Each Pace Maker Drape Each Paediatric bone staples Each Paladey Each Plain Gauge Each 112 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 23.79 Paraffin Gauge Dressing BP (Sterile) 10cm X 10cm Each 23.81 PD Dialysis Solution IP -1.5 /2.5 /4.5 /7.5 (2 liters) Each 23.8 23.82 23.83 23.84 23.85 23.86 23.87 23.88 23.89 23.9 23.91 23.92 23.93 23.94 23.95 23.96 23.97 23.98 23.99 24 24.01 24.02 24.03 24.04 24.05 24.06 24.07 24.08 24.09 24.1 24.11 24.12 24.13 24.14 Cuticell C Plus dressing tulle Each PD Dialysis Solution IP -1.5 /2.5 /4.5 /7.5 (2 liters) + PD catheters-Neonatal/Pediatric Percutaennous Endoscopic Gastrotomy Device Plain glass rods (3 feet long) Each Each Each Pneumatic Compression Stocking Each Povidone Iodine Scrub ml Povidone Iodine Solution (5%) ml Povidone Iodine Solution (10%) ml Pressure Infusion Bags (Disposable) Each Pressure infusion Cuff (50 ml) Each Pressure Infusion Bags (Disposable)Easy pump 5.5 day Each Pressure Infusion Cuff (Pressure Bag) - Reusable (500 ml) Each Pressure Infusion Cuff (Pressure Bag) - Reusable (1000 ml) Pressure monitoring kit with three way disposable pressure( For CVP & Atrerial) Pressure Monitoring Tube 100cm(high Pressure extention line) Pressure Monitoring Tube 150cm(High Pressure Extenion line) Each Each Each Each Pressure Monitoring Tube 200cm(High Pressure Extention Line) Each Hi line (Spiral) 200cm Each Hi line 100cm Each Hi line 150cm Each Hi line 200cm Each Prosthetic Button with Hole Each Protector Each Pulsatile lavage kit Each Q syte I.V. attachment three way 100cm Each Q syte I.V. attachment three way 200cm Each Q syte I.V. attachment two way 100cm Each Q syte I.V. attachment two way 200cm Each Q. Syte Pediatric Extension set Each Q. Syte Mono Each Q. Syte Duo Each Q. Syte Trio Each RAE tub 7.5 Each RAE Tube 6 Each 113 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 24.15 RAE Tube 6 Oral Plain Each 24.17 RAE Tube 6.5 oral plain Each 24.16 24.18 24.19 24.2 24.21 24.22 24.23 24.24 24.25 24.26 24.27 24.28 24.29 24.3 24.31 24.32 24.33 24.34 24.35 24.36 24.37 24.38 24.39 24.4 24.41 24.42 24.43 24.44 24.45 24.46 24.47 24.48 24.49 24.5 RAE Tube 6.5 Each RAE Tube 7 Each RAE Tube 7 Oral Plain Each Rectal thermometer Adult Each Rectal thermometer Paediatric Renalin 100 Cold Sterilant Concentrated (10 liters) for Cold Sterilant for Dialyzer Reprocessing Reservior Face mask Retrograde intubation set (Cooks) Each Each Each Each Rubber hand gloves Size 6 Each Rubber hand gloves Size 7 Each Rubber hand gloves size 8 Each Schirmer's strips Each Self adhesive urine sample bag - Pediatric Each Semi circle air ring mackintosh for drainage Each Sepgard Dressing Tulle Each Sewing Thread Black Color Each Sheet galatine (high grade) Shiley Fenestrated Low Pressure Tracheostomy Tube(with cuffed)-4FEN Shiley Fenestrated Low Pressure Tracheostomy Tube(with cuffed)-6FEN Shiley Fenestrated Low Pressure Tracheostomy Tube(with cuffed)-8FEN Shiley Fenestrated Tracheostomy Tube(cuffless)-4CFN Shiley Fenestrated Tracheostomy Tube(cuffless)-8CFN Each Each Each Each Each Each Shirmer's Strips Each SIRE Kit Each Skin Graft Knife Blade (REF: HG-215-01-Q) Each Skin Grafting blade Each Surgical Skin blade Each Skin Traction Kit Each sofratulle Each Spacer Each Spare lamp for Opthalmoscope + Otoscope Each Spare parts for: Easylyte,911 , 912 & others Each Spatulae Powder Each Spinal cord Each 114 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 24.51 Spirit surgical Each 24.53 Spirometry paper roll (110mm x 20 meter) Each 24.52 24.54 24.55 24.56 24.57 24.58 24.59 24.6 24.61 24.62 24.63 24.64 24.65 24.66 24.67 24.68 24.69 24.7 24.71 24.72 24.73 24.74 24.75 24.76 24.77 24.78 24.79 24.8 24.81 24.82 24.83 24.84 24.85 24.86 Spirit swabs Each Spongiostan Each Spoon Each Sprit Lamp glass/ metal Each Stapes teflon piston Each Staplers Remover (PSX) Each Stationary Grid 10" x 12" Each Stationary Grid 12" x 15" Each Stationary Grid 14" x 14" Each Stationary Grid 14" x 17" Each Stationary Grid 8" x 10" Each Steam inhaler Each Steinman Pin 4.5mm Each Sterigage (for steam) Each Sterile antibiotic Each Sterile culture bottle ( screw capped) Each Sterile universal containers (for urine, sputum, etc) 50ml Each Sterile swab sticks Each Sterile Transducer Dome Hewlett Packard Each Steri-Stripes Each Stylet Infant(neonatal) Each Stylet Child Each Stylet Adult Each LRS Each Esmarch 4" Each Esmarch 6" Each Cotton Stockinette Roll of 30mm X 10mt Each Cotton Stockinette Roll of 60mm X 10mt Each Cotton Stockinette Roll of 80mm X 10mt Each Cotton Stockinette Roll of 100mm X 10mt Each Gypsona plaster of paris 4" Each Gypsona plaster of paris 6" Plaster of Paris (Bandage) - Roll of 7.5 cm x 2.7 mt (Rapidur/Good Quality) Plaster of Paris 4"(Bandage )Roll of 10cm X 2.7mt)(Rapidur/Good Quality) 115 Each Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 24.87 Plaster of Paris 6"(Bandage) Roll of 15cm X 2.7mt)(Rapidur/Good Quality) Each 24.89 Fibre glass Velcast-Roll of 10cmX3.6mt(2inches) Each 24.88 24.9 24.91 24.92 24.93 24.94 24.95 24.96 24.97 24.98 24.99 25 25.01 25.02 25.03 25.04 25.05 25.06 25.07 25.08 25.09 25.1 25.11 25.12 25.13 25.14 25.15 25.16 25.17 25.18 25.19 25.2 25.21 25.22 Plaster of paris Powder -Kg Fibre glass Velcast-Roll of 12.5cmX3.6mt(3inches) Each Each Fibre glass Velcast-Roll of 15cmX3.6mt(5inches) Each Banyan Cloth- metre Each Epoxy resin -Kg Each Epoxy hardner-Kg Each Epoxy powder-Kg Each Hardener-Kg Each PVC film 50 micron 1.2mm X metre Each PVC film 125 micron 1.2mm X metre Each PVC film 150 micron 1.2mm X metre Each Fibre Glass-Kg Each Thinner- litres Ranger Foot (SACH Foot of Size 22cm - 27cm with separate great toe, injection moulded strong wooden keel with wt limitupto 100kg) Each Each Prosthetic Button with Hole Each surfoam blade round 10" Each French chalk Pkt of How many Numbers Each Surfoam Blade Flat - 2"X10" Each Surfoam blade Half Round - 10" Each Surfoam Blade Round - 10" Each Surfoam File Flat with Frame - 10" Each Polypropylene Sheet ORTHO Co-pp 2mt X 1.25mt X 3mm( Jassud) Each Polypropylene Sheet ORTHO Co-pp 2mt X 1.25mt X 4mm (Jassud) Each Polypropylene Sheet ORTHO Co-pp 2mt X 1.25mt X 5mm (Jassud) Each Polypropylene Sheet ORTHO Co-pp 2mt X 1.25mt X 6mm (Jassud) Each Aluminium Rivets Material Size 1" X 1/8" in Kg Each Aluminium Rivets Material Size 1" X 5/32" in Kg Each Aluminium Rivets Material Size 1" X 3"/4" in Kg Each Copper Rivits Size 1" X 3"/4" in Kg Each Copper Rivits Size 1" X 1"/8" in Kg" Each Copper Rivits Size 1" X 5"/32" in Kg" Each Press Button Double Headed 1/4" Each Press Button Double Headed 1/8" Each Press Button Double Headed 1/16" Each 116 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 25.23 Press Button Double Headed 5/32" Each 25.25 Ethaflex foam Sheet of 2mt X 1mt X 3m Each 25.24 25.26 25.27 25.28 25.29 25.3 25.31 25.32 25.33 25.34 25.35 25.36 25.37 25.38 25.39 25.4 25.41 25.42 25.43 25.44 25.45 25.46 25.47 25.48 25.49 25.5 25.51 25.52 25.53 25.54 25.55 25.56 25.57 25.58 Ethaflex foam Sheet of 2mt X 1mt X 2m Each Ethaflex foam Sheet of 2mt X 1mt X 4m Each Ethaflex foam Sheet of 2mt X 1mt X 5m Each Evathane Foam 4mm Each Evathane Foam 5mm Each Sach Foot(Imported) Size of 15cm-27cm Each Velcro strip(Hook) Each Velcro strip(loop) Each Plastic D-Ring 1" without loop Each Teflon Sheet (sheet of 150cm X 100cm) Each Hide Leather- Dimension with meter Each Leather Orthotic Knee Cap Each AK Silesian Belt Each BK Suspension Sleeve Each BK Leather Knee Suspension Each AK Leather Knee Suspension Each Below Knee Modular Prosthetic Kit Each Above Knee Modular Prosthetic Kit Each Rubber Bowl Small & Spatula Each Rubber Bowl Large & Spatula Each Drape Formers Trans Tibial (for Below knee socket) Each Drape Formers Trans Femoral (for Below knee socket) Each Drape Frame 406mm Sq blank(for aboveknee socket) Each Drill bits 1/2" Each Drill bits 1/4" Each Drill Bits 1/8" Each Drill bits 5/32" Each Drill bits 8/4" Each Drill bits 3/4" Each Kit HKAFO Modular Medium (Left) Each Kit HKAFO Modular Medium (Right) Each Kit HKAFO Modular small (Left) Each Kit HKAFO Modular small (Right) Each Kit KAFO Modular small (Left) Each 117 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 25.59 Kit KAFO Modular Medium (Left) Each 25.61 Kit KAFO Modular small (Right) Each 25.6 25.62 25.63 25.64 25.65 25.66 25.67 25.68 25.69 25.7 25.71 25.72 25.73 25.74 25.75 25.76 25.77 25.78 25.79 25.8 25.81 25.82 25.83 25.84 25.85 25.86 25.87 25.88 25.89 25.9 25.91 25.92 25.93 Kit KAFO Modular Medium (Right) Each LTTP Sheet (sheet of 2mm X 60cm X 90cm) Each LTTP Sheet (sheet of 3mm X 60cm X 90cm) Each LTTP sheet-(sheet of 4mm X 60cm X 90cm) Rubber sole 4mm( Nitrile rubber,Buna-N, perbunan,possess a tensile strength of >10N/mm2,good resistant to mineral oils,petrol,ordenary diluted acids and alkalines,ability to withstand a ranf\ge of temp. from-40 to 108deg. Celsius. Each Each MCR rubber Micro cellular rubber,1000X1000X6mm Compression set(Micro cellular rubber,1000X1000X6mm Compression set=30%) Each Scotchcast plaster material 4 inches Each Adhesive solution(Fevicol Made)- litre Each Scotchcast plaster material 6 inches Each aluminium strips( Strips of 2cm X 40 cm X 0.5mm) Each Steel grip (Black Tape/ Adhesive Tape) Each Glass marking pencil (Different colour) Each Canvas cloth in metres Each Jig Saw blade (Bosh made wood and metal) Each Nut & Srew 1/8" Each Vacuum bench for draping (18" X 24" X 32" for AK and Bk sockets Each Cone sander(Fine) Each Cone sander(Coarse) Each silicone socket pads 6mm/12mm thickness Each silicone socket liners Each trans tibial silicone liners Each trans femoral silicone liners Each TES suspension belt trans femoral Each TES suspension belt trans tibial Each trans tibial Prosthetic socks Each Trans femoral Prosthetic socks Each Polyester Synthetic Cast padding Each Soft roll cotton for orthopaedic plaster applications Each Soft Roll 3" Each Soft Roll 4" Each Soft padding Material/Softroll 4" Each Soft padding Material/Softroll 6" Each Suction activated hemorrhoids ligator Each 118 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 25.94 Suction Cannula ‘POOLE’ Each 25.96 Suction cannula for MTP size purandre Each 25.95 25.97 25.98 25.99 26 26.01 26.02 26.03 26.04 26.05 26.06 26.07 26.08 26.09 26.1 26.11 26.12 26.13 26.14 26.15 26.16 26.17 26.18 26.19 26.2 26.21 26.22 26.23 26.24 26.25 26.26 26.27 26.28 26.29 Suction Cannula ‘YANKAUER’ Each Suction Machine Electronic Each Suction Machine Filter (Make: Symex) Each Supplement Kit Each Surgical blades Size 1 Each Surgical blades Size 2 Each Surgical blades Size 3 Each Surgical blades Size 4 Each Surgical blades Size 5 Each Surgical blades Size 6 Each Surgical blades Size 7 Each Surgical blades Size 8 Each Surgical blades Size 9 Each Surgical blades Size 10 Each Surgical blades Size 11 Each Surgical blades Size 12 Each Surgical blades Size 13 Each Surgical blades Size 14 Each Surgical blades Size 15 Each Surgical blades Size 16 Each Surgical blades Size 17 Each Surgical blades Size 18 Each Surgical blades Size 19 Each Surgical blades Size 20 Each Surgical blades Size 21 Each Surgical blades Size 22 Each Surgical blades Size 23 Each Surgical blades Size 24 Each Surgical blades Size 25 Each Surgical blades Size 26 Each Surgical blades Size 27 Each Surgical blades Size 28 Each Surgical blades Size 29 Each Surgical Skin Marker Pen Each 119 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 26.3 26.31 Surgicel NU-Knit(Oxidized Regenerated Cellulose,Thicker Weave, can be sutured through, with Bactericidal property. Approved by US FDA) Size:1"X1" Each Surgicel NU-Knit(Oxidized Regenerated Cellulose,Thicker Weave, can be sutured through, with Bactericidal property. Approved by US FDA) Size:3"X4" Each Surgicel Original(Oxidized Regenerated Cellulose based topical Absorbable Hemostat Regular, with Bactericidal property. Approved by US FDA) Size:2"X14" Each Surgicel Original(Oxidized Regenerated Cellulose based topical Absorbable Hemostat Regular, with Bactericidal property. Approved by US FDA) Size:4"X8" Each Surgicel NU-Knit(Oxidized Regenerated Cellulose,Thicker Weave, can be sutured through, with Bactericidal property. Approved by US FDA) Size:1"X3.5" Each Surgicel NU-Knit(Oxidized Regenerated Cellulose,Thicker Weave, can be sutured through, with Bactericidal property. Approved by US FDA) Size:6"X9" Each Surgicel Original(Oxidized Regenerated Cellulose based topical Absorbable Hemostat Regular, with Bactericidal property. Approved by US FDA) Size:2"X3" Each Surgicel Snow(Oxidized Regenerated Cellulose based topical Absorbable Hemostat,Structured Non- Woven material with Bactericidal property. Ease-of-use in both open and minimally invasive procedures. Approved by US FDA) Size:1"X2" Each 26.38 Surgicel Snow(Oxidized Regenerated Cellulose based topical Absorbable Hemostat,Structured Non- Woven material with Bactericidal property. Ease-of-use in both open and minimally invasive procedures. Approved by US FDA) Size:2"X4" Each 26.39 Surgicel Snow(Oxidized Regenerated Cellulose based topical Absorbable Hemostat,Structured Non- Woven material with Bactericidal property. Ease-of-use in both open and minimally invasive procedures. Approved by US FDA) Size:4"X4" Each 26.4 Surgiflo (Absorbable Gelatin Based Topical Absorbable flowable hemostat with 6cc syringes pre-filled with hemostatic matrix with 14.3cm white applicator tip & 14.6cm blue flexible applicator tip) Each 26.41 Ostomy Appliance Accessories Belt Each 26.43 Stomahesive Powder Each 26.32 26.33 26.34 26.35 26.36 26.37 26.42 26.44 26.45 26.46 26.47 26.48 26.49 26.5 26.51 26.52 26.53 26.54 26.55 Stomahesive Paste Each Stomadress Plus Single Pouch - Opaque Each ActiveLife One Pc Drainable Pouch Each Natura+DRN PCH TANWF INVISI 45MM or Equivalent Each Natura+DRN PCH TANWF INVISI 57MM or Equivalent Each Natura+DRN PCH TANWF INVISI 70MM or Equivalent Sur Fit Natura Urostomy Pouch with Accuseal Tap with Valve - Transparent with 1-sided comfort Panel 45mm or Equivalent Each Each Sur Fit Natura Urostomy Pouch with Accuseal Tap with Valve - Transparent Standard with 1-sided comfort Panel 57mm or Equivalent Each Sur Fit natura Drainable Pouch - 12" transparent with 1-sided comfort panel 45mm or Equivalent Each Sur Fit natura Drainable Pouch - 12" transparent with 1-sided comfort panel 70mm or Equivalent Each Sur Fit Natura Urostomy Pouch with Accuseal Tap with Valve - Transparent Standard with 1-sided comfort Panel 70mm or Equivalent Each Sur Fit natura Drainable Pouch - 12" transparent with 1-sided comfort panel 57mm or Equivalent Each Hydrofiber Dressing with Carboxyl Methyl Celulose with Locking Properties & Micro Contouring to Wound Bed 15cm x 15cm (US FDA & CE Approved) 120 Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 26.56 Hydrofiber Dressing with Carboxyl Methyl Celulose with Locking Properties & Micro Contouring to Wound Bed 10cm x 10cm (US FDA & CE Approved) Each Hydrofiber Dressing 1.2% Silver in Sustain release (Silver In Ionic Form) with Locking and Micro Contouring Characteristics Provide Sustained and Effective Anti Microbial Action against Aerobic, Anaerobic and Antibiotic Resistant Micro Organism , Prevent Excess Silver Deposits on Wounds 10cm x10cm (US FDA /CE Approved) Each 26.58 Hydrofiber Dressing 1.2% Silver in Sustain release (Silver In Ionic Form) with Locking and Micro Contouring Characteristics Provide Sustained and Effective Anti Microbial Action against Aerobic, Anaerobic and Antibiotic Resistant Micro Organism , Prevent Excess Silver Deposits on Wounds 15cm x15cm (US FDA /CE Approved) Each 26.59 Hydrofiber Dressing with matrix knitting containing 1.2% Silver in Sustain release (Silver In Ionic Form) with Locking and micro Contouring Characteristics Provide Sustained and Effective Anti Microbial Action against Aerobic, Anaerobic and Antibiotic Resistant Micro Organism , Prevent Excess Silver Deposits on Wounds 23cm x30cm (US FDA /CE Approved) Each 26.6 Hydrofiber Dressing 1.2% Silver In Sustain Release (Silver In ionic Form)with Locking & Micro Contouring Characteristics , Provide Sustained and Effective Anti Microbial Action Against Aerobic, Anaerobic and Anti biotic resistant Micro Organism, Prevent Excess Silver Deposits on Wounds Covered with Occlusive and Triple Hydrocolloids Transparent dressing - Pectin , Gelatin and Carboxyl MethylCellulose, Water Impermissible Extra Thin dressing with Bacteria Viral Film Layer on Top - 9 x 25cm (US FDA/CE approved) Each 26.61 Self Adhesive Four Layered Hydrofiber Dressing 1.2% Silver In Sustain release in Ionic Form with Locking and MicroContouring Characteristics , Provide Sustained and EfffectiveAnti Microbial Action against Aerobic, Anaerobic and Antibiotic Resistant Micro Organisms, Prevent Excess Silver Deposits on Wounds 10cm x 10cm (US FDA/CE approved) Each 26.62 Self Adhesive Four Layered Hydrofiber Dressing 1.2% Silver In Sustain release in Ionic Form with Locking and MicroContouring Characteristics , Provide Sustained and EfffectiveAnti Microbial Action against Aerobic, Anaerobic and Antibiotic Resistant Micro Organisms, Prevent Excess Silver Deposits on Wounds 17.5cm x 17.5cm (US FDA/CE approved) Each 26.63 Self Adhesive Four Layered Hydrofiber Dressing 1.2% Silver In Sustain release in Ionic Form with Locking and MicroContouring Characteristics , Provide Sustained and EfffectiveAnti Microbial Action against Aerobic, Anaerobic and Antibiotic Resistant Micro Organisms, Prevent Excess Silver Deposits on Wounds 15cm x 15cm (US FDA/CE approved) Each 26.64 Self Adhesive Four Layered Hydrofiber Dressing 1.2% Silver In Sustain release in Ionic Form with Locking and MicroContouring Characteristics , Provide Sustained and EfffectiveAnti Microbial Action against Aerobic, Anaerobic and Antibiotic Resistant Micro Organisms, Prevent Excess Silver Deposits on Wounds 20cm x 14cm HEEL (US FDA/CE approved) Each 26.65 Self Adhesive Four Layered Hydrofiber Dressing 1.2% Silver In Sustain release in Ionic Form with Locking and MicroContouring Characteristics , Provide Sustained and EfffectiveAnti Microbial Action against Aerobic, Anaerobic and Antibiotic Resistant Micro Organisms, Prevent Excess Silver Deposits on Wounds 20cm x 18cm SACRAL (US FDA/CE approved) Each 26.66 Pectin and Carboxyl Methyl Celluose, for Removing Necrotictissue Each 26.68 Occulusive and Tripple Hydrocolloid Transparent Dressing - Pectin, Gelatin and carboxylMethyl Cellulose, water Impermissible extra Thin dressing with bacteria Viral Film Layer on Top 10cm x10cm (US FDA/CE Approved) Each 26.57 26.67 26.69 26.7 26.71 26.72 Sodium Calcium Alginate dressing 10cm x 20cm (US FDA/CE Approved) Each Occulusive and Tripple Hydrocolloid Transparent Dressing - Pectin, Gelatin and carboxylMethyl Cellulose, water Impermissible extra Thin dressing with bacteria Viral Film Layer on Top 52cm x20cm (US FDA/CE Approved) Each Occlusive and Triple Hydrocolloid Controlled Gel Formulation Dressing-Pectin , Gelatin & Carboxyl Methyl cellulose, Water Impermissible Dressing with Flexible Foam Padding and Bacteria Viral Barrier for Optimum Healing 15cm x 15cm (US FDA/CE Approved) Each Occlusive and Triple Hydrocolloid Controlled Gel Formulation Dressing-Pectin , Gelatin & Carboxyl Methyl cellulose, Water Impermissible Dressing with Flexible Foam Padding and Bacteria Viral Barrier for Optimum Healing 10cm x 10cm (US FDA/CE Approved) Each Swanganz 5F Each 121 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 26.73 Swanganz 6F Each 26.75 T.Piece (plastic) Each 26.74 26.76 26.77 26.78 26.79 26.8 26.81 26.82 26.83 26.84 26.85 26.86 26.87 26.88 26.89 26.9 26.91 26.92 26.93 26.94 26.95 26.96 26.97 26.98 26.99 27 27.01 27.02 27.03 27.04 27.05 27.06 27.07 27.08 T- Connector(Plastic) Each TCBS(DIFCO) Each tegaderm cvp line. Each Tegaderm dressing -3582(Transparent Film Dressing 5cm x 7.5cm) Each Tegaderm dressing -1610(Transparent Film Dressing 6cmx 5cm) Each Tegaderm dressing-8584(Transparent Film Dressing 6cm x 10cm) Each Tegaderm dressing -1623W(Transparent Film Dressing 7cm x 8.5cm) Each Tegaderm Dressing- 1633(Transparent Film Dressing 8.5cm x 7cm) Each Tegaderm dressing -1635(Transparent Film Dressing 8.5cm x 10cm) Each Tegaderm dressing-3589(Transparent Film Dressing 8cm x 15cm) Each Tegaderm dressing --8526(Transparent Film Dressing 10cm x 12cm) Each Tegaderm dressing -1627(Transparent Film Dressing 10cm x 25cm) Each Tegaderm dressing-3590(Transparent Film Dressing 10cm x 20cm) Each Tegaderm dressing-3591(Transparent Film Dressing 10cm x 25cm) Test Sieves Minimum of 8” (20) dia, brass frame, without joint and S.S cloth any range. THC(20NG/ML) Urine Cal Thermal paper Thin – Flex Single Storage Venous Drainage Cannula 22Fr 7.3cm x 35cm – TF 022L Thin – Flex Single Storage Venous Drainage Cannula 24Fr 8.0cm x 35cm – TF 024L Thin – Flex Single Storage Venous Drainage Cannula 26Fr 8.7cm x 35cm – TF 026L Thin – Flex Single Storage Venous Drainage Cannula 28Fr 9.3cm x 35cm – TF 028L Thin – Flex Single Storage Venous Drainage Cannula 30Fr 10mm x 40cm – TF 030L Thin – Flex Single Storage Venous Drainage Cannula 32Fr 10 x 40cm – TF 032L Thomas splint(Pediatric)-42cm Thomas splint(Pediatric)-46cm Each Each Each Each Each Each Each Each Each Each Each Each Thomas splint(Pediatric)-50cm Each Thomas splint(Pediatric)-52cm Each Thomas splint(Pediatric)-56cm Each Thoracoport 11.5mm (Auto suture) Each Thoracoport 5.5 mm (Auto suture) Each Extention Tubing with 3 way stop cork 10cm Each Extention Tubing with 3 way stop cork 25cm Each Extention Tubing with 3 way stop cork 50cm Each Extention Tubing with 3 way stop cork 100cm Each 122 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 27.09 Extention Tubing with 3 way stop cork 200cm Each 27.11 Three - Way Extension Cannula 10cm Each 27.1 27.12 27.13 27.14 27.15 27.16 27.17 27.18 27.19 27.2 27.21 27.22 27.23 27.24 27.25 27.26 27.27 27.28 27.29 27.3 27.31 27.32 27.33 27.34 27.35 27.36 27.37 27.38 27.39 27.4 27.41 27.42 27.43 27.44 Three - Way Extension Cannula 100cm Each Three - Way Extension Cannula 25cm Each Three - Way Extension Cannula 50cm Each Thyroid shield Each Tincture Benzoin Each Tincture Iodine Each TMT recording paper for Mortora X scribe II TMT Each Tracheoslife II (HME Filter for Tracheostomised) Each transducer dome set Each Transparency paper Each Triple dis H2O 5ltr x 1 Each Trocar & Cannula set of 4 Each Trocar drain for pleural drainage 8FR Each Trocar drain for pleural drainage 10FR Each Trocar drain for pleural drainage (Pediatrics) Each Tubing harness without dilutor Each Tubing Kit Each Tubular Rods 300ms Each Twine Each Tygon T-3.17*6.35*2M for 911 & 912 Each U-Drape (disposable) Each Umbilical Cord Clamp 15mm wide Each Umbilical Cord Clamp(Plastic) Each Umbilical Cotton Tape (15mm white tape) Each urianalyser Each Urine Control A360 Each Double J Sten( closed end) size#5.5 Each Double J Stents(closed end) 6 F, 30 cms Each Double J Stents(closed end): 5 F, 30 cms Uro trac DJ stent close end renal (Radio opaque) size:FG 5.0 length 26cm guide wire 0.035 Uro trac DJ stent close end renal (Radio opaque) size:FG 5.5 length 26cm guide wire 0.035 Uro trac DJ stent close end renal (Radio opaque) size:FG 6 length 26cm guide wire 0.035 Vacuum Bench Variceal Ligation Band Device Each Each Each Each Each Each 123 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 27.45 Varta Battery (6V) Each 27.47 Vascular Graft (3x10mm) Straight Thin Wall. Each 27.46 27.48 27.49 27.5 27.51 27.52 27.53 27.54 27.55 27.56 27.57 27.58 27.59 27.6 27.61 27.62 27.63 27.64 27.65 27.66 27.67 27.68 27.69 27.7 27.71 27.72 27.73 27.74 27.75 27.76 27.77 27.78 27.79 Vascular Graft (3.5x10mm) Plain/Straight. Each Vascular Graft (4x10mm) Plain/Straight. Each Vascular Graft (5x10mm) Plain/Straight. Each Vaseline Gauge (Gelloret 10mm) Each Ventilating Airway Bougies Each Ventilation tubes (Grommets) Ventilator Breathing Circuit , Adult Reusable ( for ventilator nelcor PB 840) Ventilator Breathing Circuit , Neonatal Reusable ( for ventilator nelcor PB 840) Ventilator Breathing Circuit , Paediatric Reusable ( for ventilator nelcor PB 840) Ventilator Circuit (Neonate) with water trap Ventilator Circuit (Peadiatric) with water trap Each Each Each Each Each Ventilator Circuit (Adult) with water trap Each Breathing circuit disposable Neonatal Each Ventilator Circuit (Neonate) without water trap Each Breathing circuit disposable peadiatric Each Ventilator Circuit (Peadiatric) without water trap Each Breathing circuit disposable Adult Each Ventilator Circuit (Adult) without water trap Circle Breathing System 15mm Circle with luer lock and 1.6 mtr length for paediatric Close end circuit Jackson Rees pediatric circuit (Inter Surgical) Basic Bain Co-axial Breathing System( 2.5lit Bag 1.6mt length 10.8 limb) Ventilator Circuit (T-piece Inter Surgical Anaesthetic Breathing System)paed Ventilator Tubing W/1 (venti breathing system with reseable water trap) Venturi Valve 60%(Green Colour) Viscoelastic Injection Each Each Each Each Each Each Each Each Each W/H/R tubing CRT4 Each Wall Frame Each Welding Mirror Each Wood RASP File (half round smooth) Y-pieces Each Each Instruments & Forceps (A) Cervical collars hard large Each Each (A)Cervical collars hard medium Each 124 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 27.8 (A)Cervical collars hard small Each 27.82 (B)Cervical collars soft large Each 27.81 27.83 (B)Cervical collars soft small Each (B)Cervical collars soft medium Each 27.84 10 leads ECG Cable (For TMT Machine - CS 200) 27.86 27.87 3 Leads Holter with Yoke for 3 Leads 48 hrs Holter Study compatible with Holter system (Make: Spacelabs Healthcare; Model: eVO 5- Leads ECG Patient Cable (For M6 Aster MediAid) 27.89 Abdominal Binder Size 32 27.85 27.88 27.9 27.91 27.92 27.93 27.94 27.95 27.96 27.97 27.98 27.99 28 28.01 28.02 28.03 28.04 28.05 28.06 28.07 28.08 28.09 28.1 28.11 28.12 28.13 28.14 28.15 10 Leads Holter Cable compatible with Holter system (Make: Spacelabs Healthcare; Model: eVO 6mm Green PVC tubing for oxygen Each Each Each Each Each Each Abdominal Binder Size 36 Each Abdominal sheet Size 38 Each Above elbow kit Adult Each Above elbow kit Child Each Adapter (Simex) Each Adaptor compatible with High end suction machine (Simex) Each Adson Non toothed 4" Each Adson toothed 4" Each Air cushion 35cm Each Air cushion 40cm Each Air cushion 45cm Each Air Probe (RW Meditrin) Each Air pump Each Allies Forcep Large 10" Each Allies Forcep Large 6" Each Allies Forcep Large 8" Each Allies tissue clamp 6" Each Allis Tissue forceps 5" Each Allis tissue forceps, 6″ Each Allis tissue forceps, 8″ Each Alpha mattress Each Ambu bag 250cc with mask Each Ambu bag 500cc with mask Each Ambu bag 750 cc with mask Each Analspeculum Size: 25 Each Analspeculum Size: 36 Each 125 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 28.16 Aneroid Sphygmomanometer with an Adult Cuff Each 28.18 AO universal clamps Each 28.17 28.19 28.2 28.21 28.22 28.23 28.24 28.25 28.26 28.27 28.28 28.29 28.3 28.31 28.32 28.33 28.34 28.35 28.36 28.37 28.38 28.39 28.4 28.41 28.42 28.43 28.44 28.45 28.46 28.47 28.48 28.49 28.5 28.51 Aneroid Sphygmomanometer with an Paediatric Cuff Each Artery forceps (curved) 6" Each Artery forceps (straight) 6" Each Artery forceps ‘CRILE’ Size 14 cm curved Each Artery Forceps ‘CRILE’ Size 14 cm Straight Each Artery Forceps ‘HALSTED’ Mosquito 12.5 cm Curved Each Artery Forceps ‘HALSTED’ Mosquito 12.5 cm Straight Each Artery forceps ‘KELLY’ 15 cm Curved Each Artery Forceps ‘KELLY’ 15 cm Straight Each Artery Forceps ‘KELLY’ 8" cm Straight Each Artery forceps ‘KELLY’ 8" Curved Each Artery Forceps ‘KIRKETT’ 19 cm Curved Each Artery Forceps ‘KOCHER’ Size 10" Straight Each Artery Forceps ‘KOCHER’ (OSCHSNER) Size 12.5 cm Curved Each Artery Forceps ‘KOCHER’ (OSCHSNER) Size 12.5 cm Straight Each Artery Forceps ‘KOCHER’ (OSCHSNER) Size 15 cm Curved Each Artery Forceps ‘KOCHER’ (OSCHSNER) Size 15 cm Straight Each Artery Forceps ‘KOCHER’ (OSCHSNER) Size 17.0 cm Curved Each Artery Forceps ‘KOCHER’ (OSCHSNER) Size 17.0 cm Straight Each Artery Forceps ‘KOCHER’ (OSCHSNER) Size 20.0 cm Curved Each Artery Forceps ‘KOCHER’ (OSCHSNER) Size 20.0 cm Straight Each Artery Forceps ‘KOCHER’ Size 10" Curved Each Artery forceps ‘LAREY’ 23 cm Each Artery Forceps ‘MIXER’ 23 cm Each Artery Forceps ‘NEGUS’ 19 cm Each Artery forceps ‘SPENCERSWELLS’ 12.5 cm Curvred Each Artery forceps ‘SPENCERSWELLS’ 12.5 cm Straight Each Artery Forceps ‘SPENCERSWELLS’ Size 15.0 cm Curved Each Artery Forceps ‘SPENCERSWELLS’ Size 15.0 cm Straight Each Artery Forceps ‘SPENCERSWELLS’ Size 17.5 cm Curved Each Artery Forceps ‘SPENCERSWELLS’ Size 17.5 cm Straight Each Artery Forceps ‘SPENCERSWELLS’ Size 20.0 cm Straight Each Artery Forceps ‘SPENCERSWELLS’ Size 20.0 cm Curved Each Artery Forceps ‘SPENCERSWELLS’ Size 25.0 cm Curved Each 126 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 28.52 Artery Forceps ‘SPENCERSWELLS’ Size 25.0 cm Straight Each 28.54 Axillary Crutches Each 28.53 28.55 28.56 28.57 28.58 28.59 28.6 28.61 28.62 28.63 28.64 28.65 28.66 28.67 28.68 28.69 28.7 28.71 28.72 28.73 28.74 28.75 28.76 28.77 28.78 28.79 28.8 28.81 28.82 28.83 28.84 28.85 28.86 28.87 Axila temperature cable - for Mindray Beneview T8 Monitor Each Titanium plate for Mandibular reconstruction Each B.P Cuff with rubber bag (Neonatal) Each B.P. Cuff with rubber bag(Adult) Each B.P. Cuff with rubber bag(Paediatric) Each B.P. Cuff (Adult) - for Mindray Beneview T8 Monitor Each B.P. Cuff (Neonatal) - Cuff Size - 4 x 6 cm Each B.P. Cuff (Pediatric) - Cuff Size - 10 x 24 cm Each B.P. Cuff (Pediatric) - Cuff Size - 6 x 12 cm Each B.P. Cuff (Pediatric) - Cuff Size - 9 x 18 cm Each B.P. Cuff (Pediatric) - for Mindray Beneview T8 Monitor Each Babcock forcep Large 10" Each Babcock forcep 7" Each Babcock Forcep Medium 8" Each Babcock Forcep Small 6" Each Baby Cradle with mattress and Net Each Baby Warmer Each Baby weighing machine Each Bacterial Filter (Simex) Each Bacterial Filter for suction machine Simex DC20SU Each Barraquer –Needle holder, Curved jaws, 14cm (5 ½”) long Each Basin SS 12" diameter Each Basin SS 14" diameter Each Basin SS 18" diameter Each Basin trolly. Each Bath thermometre Battery pack for indirect Ophthalmoscope (Heine, Model: Sigma 150K) Battery compatible with High end suction machine (Simex) Battery for Ultrasound Therapy (Make: Enraf Nonius Sonoplus 490U) Each Each Each Each Battery for Ultrasound Therapy (Make: Enraf Nonius Sonoplus 491) Each Battery operated power saw Each Bed Pan with Lid (with handle) Each Below elbow kit Adult Each Below elbow kit Child Each 127 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 28.88 Belt for Cable (For TMT Machine - CS 200) Each 28.9 BGA 4 130ml (ABG) Each 28.89 28.91 28.92 28.93 28.94 28.95 28.96 28.97 28.98 28.99 29 29.01 29.02 29.03 29.04 29.05 29.06 29.07 29.08 29.09 29.1 29.11 29.12 29.13 29.14 29.15 29.16 29.17 29.18 29.19 29.2 29.21 29.22 29.23 BGA 3 130ml (ABG) Each Binocular Microscope Each Bipolar Cable (Laparascopic cable) for Karl Storz Each BIS Electrodes - for Mindray Beneview T8 Monitor Each BIS Sensor Each Blood Gas Quality Control (30x1.7ml) Level 1 (ABG) Each Blood Gas Quality Control (30x1.7ml) Level 2 (ABG) Each Blood Gas Quality Control (30x1.7ml) Level 3 (ABG) Each Boiler Each Bone Cutter Each Bone cutter Big size Each Bowl 150ml (S.S) Each Bowl 3" Diametre (S.S) Each Bowl 4" Diametre (S.S) Each Bowl 6" diametre (S.S) Each BP Apparatus Adult Each BP Apparatus Aneroid type (adult) Each BP Apparatus Aneroid type (Paediatric) Each BP Apparatus Paediatric Each BP knife handle No 3 Each BP knife handle No 4 Each BP Rubber pump Each BUCK'S PULLEY Each Bulb 22, 8v 40w lrc Ceramic Base Each Bull Dog Clamp 3.8 cm Each Bull Dog Clamp 5.0 cm Each Bull Dog Clamp 6.2 cm Each Bull's Eye Lamp Each Burn Shield (Frame) Each Ca++ - conducting systems (ABG) Each Ca++ mebrane shell (ABG) Each CAL 3 150ml (ABG) Each CAL 4+M 150ml (ABG) Each Calibration Gas (962-187) Each 128 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 29.24 Calibration Gas (962-187) for Transcutaneous PO2/PCO2 (Make: Radiometer, Model: TCM 40) Each 29.26 Castroviejo Micro Needle Holder –Needle holder with very delicate jaws 0.6mm, smooth jaws, curved ended, 14.5cm Each 29.25 29.27 29.28 29.29 29.3 29.31 29.32 29.33 29.34 29.35 29.36 29.37 29.38 29.39 29.4 29.41 29.42 29.43 29.44 29.45 29.46 29.47 29.48 29.49 29.5 29.51 29.52 29.53 29.54 29.55 29.56 29.57 Cardboard boxes for storing plasma in freezer Castroviejo Micro Needle Holder –Needle holder with very delicate jaws 0.6mm, smooth jaws, curved ended, 14.5cm (5 ¾ ”) long Each Each Castroviejo Needle Holder –Tungsten carbide inserts, German Stainless Steel, Serrated Ends, Fine serration on jaws, 14cm (5 ½”) long straight ended Each Castroviejo Needle Holder –Tungsten carbide inserts, German Stainless Steel, Serrated Ends, Fine serration on jaws, 17cm (6 ¾”) long straight ended Each Castroviejo Needle Holder without Catch (Straight) 185mm Each Castroviejo Needle Holder –Tungsten carbide inserts, German Stainless Steel, Serrated Ends, Fine serration on jaws, 17cm (6 ¾”) long straight ended Each Castroviejo Needle Holder with Catch (Straight) 145mm Each Catheter Tray SS with cover /Lid 16" x 4" Each Cats Paw Each Centrifuge machine 4 tubes model R 854 Each Centrifuge Tube Each Centrifuge tubes, polypropylene seal with capacity 3.5 - 10 ml Each Cervical Collar (Philadelphia Type) Each Clavicular Braces Each Cheatle forceps, 10″ Each Cheatle Jar 20cm Each Cheatle Jar 25cm Each Cider wood oil Each Cidex Tray 8Ltrs Each Citrosteril for Nephrology Service Each Cl - - conducting systems (ABG) Each Cl - membrane shell (ABG) Each Clean 1 100ml (EA) Each Clinical Thermometer Each CO2 Adapter (Adult) - for Mindray Beneview T8 Monitor Each CO2 Adapter (Pedaitric) - for Mindray Beneview T8 Monitor Each CO2 module (Mindray) Each Cold light source for transillumination Each Collecting Jar Compatible for Suction Machine (Simex) Each cone sander fine medium Each Connector of the patient cable for IFT (Endomed 182) Each Contact liquid (943-760) Each 129 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 29.58 Contact Liquid (943-760) for Transcutaneous PO2/PCO2 (Make: Radiometer, Model: TCM 40) Each 29.6 CR cassettes 10""x 12"" (Kodak or equivalent) Each 29.59 29.61 29.62 29.63 29.64 29.65 29.66 29.67 29.68 29.69 29.7 29.71 29.72 29.73 29.74 29.75 29.76 29.77 29.78 29.79 29.8 29.81 29.82 29.83 29.84 29.85 29.86 29.87 29.88 29.89 29.9 29.91 29.92 29.93 Container Jar (Simex) CR cassettes 14" x 14" (Kodak or equivalent) Each Each CR cassettes 14" x 17" (Kodak or equivalent) Each CR cassettes 6.5 ""x 8.5 "" (Kodak or equivalent) Each CR cassettes 8" x 10" (Kodak or equivalent) Each Dark Room safelight bulbs Each DeBakey’s Bull Dog Clamps, Curved 115mm (4 ½”) long Each DeBakey’s Bull Dog Clamps, Curved 70mm (2 ¾”) long Each DeBakey’s Bull Dog Clamps, Curved 80mm (3 ⅛”)long Each DeBakey’s Bull Dog Clamps, Straight 120mm (4 ¾”) Each DeBakey’s Bull Dog Clamps, Straight 75mm (3”) Each DeBakey’s Bull Dog Clamps, Straight 85mm (3 ⅜”) Each Dendrite Each Digital Baby Weighing machine Each Digital thermometre Range 30ºC- 50°C Each Digital thermometre Range 50ºC- 100°C Each DIGITAL VERNIER CALIPRE Each Disafe Plus Filter for Nephrology Disposable Pressure Monitoring dome/ kit compatible with Philips M4/M6 Monitor system (Double Dome) Disposable Pressure Monitoring dome/ kit compatible with Philips M4/M6 Monitor system (Single Dome) Dissecting Forcep 18cm Toothed Dissecting Forceps Size 12.5 cm Each Each Each Each Each Dissecting forceps (Non -toothed) 6' Each Dissecting forceps (toothed) 6' Each Dissecting Forceps ‘ADSONS’ 11cm with1:2 teeth Each Dissecting Forceps ‘GILLIES’ Size 15 cm with 1:2 teeth Each Dissecting Forceps ‘KOCHER’ Size (Tissue) with 1:2 teeth 12.5 cm Each Dissecting Forceps ‘KOCHER’ Size (Tissue) with 1:2 teeth 15 cm Each Dissecting Forceps ‘KOCHER’ Size (Tissue) with 1:2 teeth 17.5 cm Each Dissecting Forceps ‘KOCHER’ Size (Tissue) with 1:2 teeth 20 cm Each Dissecting Forceps ‘KOCHER’ Size (Tissue) with 1:2 teeth 25 cm Each Dissecting Forceps ‘KOCHER’ Size 15.0 cm Each Dissecting Forceps ‘KOCHER’ Size 17.5 cm Each Dissecting Forceps ‘KOCHER’ Size 20.0 cm Each 130 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 29.94 Dissecting Forceps ‘KOCHER’ Size 25.0 cm Each 29.96 Dissecting forceps Adson 10" Each 29.95 29.97 29.98 29.99 30 30.01 30.02 30.03 30.04 30.05 30.06 30.07 30.08 30.09 30.1 30.11 30.12 30.13 30.14 30.15 30.16 30.17 30.18 30.19 30.2 30.21 30.22 30.23 30.24 30.25 30.26 30.27 30.28 30.29 Dissecting forceps ‘WAUGH’ 20 cm with 1:2 teeth Each Dissecting forceps Adson 10" tooth Each Dissecting forceps Adson 11cm Each Dissecting forceps Adson 25cm Each Dissecting forceps Adson 6" Each Dissecting forceps Adson 6" tooth Each Dissecting Forceps Plain Size 15.0 cm Each Dissecting Forceps Plain Size 17.5 cm Each Dissecting Forceps Plain Size 20.0 cm Each Dissecting Forceps Plain Size 25.0 cm Each Dissecting Forceps Size 20.0 cm with 1:2 teeth Each Dissecting forceps size 25 cm with 1:2Tooth Each Dissecting scissors ‘MAYO’ 14.5 cm Curved Each Dissecting scissors ‘MAYO’ 14.5 cm Straight Each Dissecting scissors ‘MAYO’ 17 cm Curved Each Dissecting scissors ‘MAYO’ 17 cm Straight Each Dissecting scissors ‘MAYO’ 23.5 cm Curved Each Dissecting scissors ‘MAYO’ 23.5 cm Straight Each Dissecting scissors ‘METZENBAUM’ 11.5 cm Blunt Blunt Curved Each Dissecting scissors ‘METZENBAUM’ 11.5 cm Blunt Blunt Straight Each Dissecting scissors ‘METZENBAUM’ 14.5 cm Blunt Blunt Curved Each Dissecting scissors ‘METZENBAUM’ 14.5 cm Blunt Blunt Straight Each Dissecting scissors ‘METZENBAUM’ 18 cm Blunt Blunt Curved Each Dissecting scissors ‘METZENBAUM’ 18 cm Blunt Blunt Straight Each Dissecting scissors ‘METZENBAUM’ 23 cm Blunt Blunt Curved Each Dissecting scissors ‘METZENBAUM’ 23 cm Blunt Blunt Straight Each Dissecting scissors ‘METZENBAUM’ 26 cm Blunt Blunt Curved Each Dissecting scissors ‘METZENBAUM’ 26 cm Blunt Blunt Straight Each Divided Mattress Each Doche Can SS with Nozzle (Assorted Sizes) Each Doyen's Retractor Each Dressing Bowl SS 12' diameter Each Dressing Bowl SS 14' diameter Each Dressing Bowl SS 3' diameter Each 131 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 30.3 Dressing Drum 10"x6" Each 30.32 Dressing Drum 14'x10' Each 30.31 30.33 30.34 30.35 30.36 30.37 30.38 30.39 30.4 30.41 30.42 30.43 30.44 30.45 30.46 30.47 30.48 30.49 30.5 30.51 30.52 30.53 30.54 30.55 30.56 30.57 30.58 30.59 30.6 30.61 30.62 30.63 30.64 30.65 Dressing Drum 12'x10' Each Dressing Drum 16'x12' Each Dressing Drum 8'x6' Each Dressing drum SS 11 x 9½ Each Dressing drums., 9″ x 9″ Each Dressing Forcep Dressing Scissors Sharpe-Blunt sharp-sharp or Blunt-Blunt points size 12.5 cm Curved Dressing Scissors Sharpe-Blunt sharp-sharp or Blunt-Blunt points Size 12.5 cm Straight Dressing Scissors Sharpe-Blunt sharp-sharp or Blunt-Blunt points size 15 cm Curved Dressing Scissors Sharpe-Blunt sharp-sharp or Blunt-Blunt points Size 15 cm Straight Dressing Scissors Sharpe-Blunt sharp-sharp or Blunt-Blunt points Size 17.5 cm Curved Dressing Scissors Sharpe-Blunt sharp-sharp or Blunt-Blunt points Size 17.5 cm Straight Dressing Scissors Sharpe-Blunt sharp-sharp or Blunt-Blunt points size 20.0 cm Curved Dressing Scissors Sharpe-Blunt sharp-sharp or Blunt-Blunt points size 20.0 cm Straight Dropper bottle 250ml Dropper bottle 500ml Each Each Each Each Each Each Each Each Each Each Each Dropper p.p. 6 long Each ECG Chest Ball (Neonate) (BPL) Each ECG Chest Ball (Ped) (BPL) Each ECG Graph Paper (63 mm x 20 mtr) Each ECG Machine (BPL) M: AT-1C Cardiart 6208 Each ECG Paper Each ECG Patient Cable (Adult) - BPL Cardiart 6208 Each ECG Patient cable (Adult) - Schiller AT1 Machine Each ECG Patient Cable (Pediatric) - BPL Cardiart 6208 Each ECG Patient cable (Pediatric) - Schiller AT1 Machine Each Elbow Cruthes Each Tennis Elbow Support Each NPWT dressing kit Each Silicone Rubber heel cups Each Electric hot bag Electrodes for IFT (For Combination therapy-Ultra sound therapy + Electrical Stimulator) (Make: Enraf nonius Sonoplus 491) Electronic Baby Weighing Machine Episiotomy scissor size 15cm 132 Each Each Each Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 30.66 Ergo Belt (For TMT Machine - CS 200) Each 30.68 Expiratory Filter Disp (Adult) (PB 840) Each 30.67 30.69 30.7 30.71 30.72 30.73 30.74 30.75 30.76 30.77 30.78 30.79 30.8 30.81 30.82 30.83 30.84 30.85 30.86 30.87 30.88 30.89 30.9 30.91 30.92 30.93 30.94 30.95 30.96 30.97 30.98 30.99 31 31.01 Expiratory Diaphragm Each Expiratory Filter Disp (Neonatal) (PB 840) Each Expiratory Filter Disp (Ped) (PB 840) External fixator smaller components: SCHANZ PINS (CORTICAL AND CANCELLOUS) Feeding cups Feotoscope Each Each Each Each Fibre Optic Phototherapy Lamp (Microbillimeter) Each Filter for Suction Machine (Atmos) Each Fine adjustment valve with gauge & flowmeter & gauge saver Each Fine Scissor pointed sharp 10.5cm curved Each Fine Scissor pointed sharp 10.5cm straight Each Fixation Ring (904-898) Fixation Ring (904-898) for Transcutaneous PO2/PCO2 (Make: Radiometer, Model: TCM 40) Fluid warmer Fogging Machine Each Each Each Each Fogging Machine Each Forcep pointed 15 cm Each Forceps (blunt) a) 125 mm Each Forceps (blunt) b) 150 mm Each Forceps (blunt) c) 200 mm Each Forceps (Sharp) a) 125 mm Each Forceps (Sharp) b) 150 mm, Each Forceps (Sharp) c) 200 mm Each Forceps beak bend 20cm Each Forceps beak bend 125mm Each Forceps beak bend 150mm Each Forceps beak bend 200mm Each Forceps blunt 17.5cm Each Forceps pointed 12.5cm Each Forceps pointed 17.5cm Each Funnel SS 5" diameter Each Funnels (glass) Each Funnels (glass) Each Funnels (glass) Each 133 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 31.02 Fuse 0.5A 250VJ8 21588 for 911 & 912 Each 31.04 Fuse 3A 250V J8 21592 for 911 & 912 Each 31.03 31.05 31.06 31.07 31.08 31.09 31.1 31.11 31.12 31.13 31.14 31.15 31.16 31.17 31.18 31.19 31.2 31.21 31.22 31.23 31.24 31.25 31.26 31.27 31.28 31.29 31.3 31.31 31.32 31.33 31.34 31.35 31.36 31.37 Fuse 10A 250V J8 21596 for 911 & 912 Each Fuse 5A 250V J8 21594 for 911 & 912 Each Gall Stone Forceps Desjardin’s Each G-Bone Each Gigly Saw Each Ginevri Capillary tube (H) (Microbillimeter) Each Ginevri Capillary Wax (Microbillimeter) Each Glass cutter Each Glover with Atraumatic jaws, Angled jaws, 50mm (2 ¾”), 20mm jaws Each Glover with Atraumatic jaws, Curved jaws, 65mm (2 ½”), 20mm jaws Each Glover with Atraumatic jaws, Curved jaws, 85mm (3 ⅜”),45mmjaws Each Glucometer set Each Glucometer set Each Glucometer set Each Glucose Test Strips Each Glucose Test Strips Each Glucose Test Strips Each Grapling Hook Each Green armtage forceps size 21 cm Each Gum elastic bougie Each Haemocrit tube Each Haemodylasis Blood Tubing Set Biofeq (BIOTEQ) Each Haemostatic Mosquito forcep 12.5 cm curved ponted Blunt end Each Haemostatic Mosquito forcep 12.5 cm straight ponted Blunt end Each Haemostatic "HALSTED" Mosquito 12.5 cmStraight Each Haemostatic "HALSTED" Mosquito 12.5 cm curved Each Haemostatic "HALSTED" Mosquito 14.5 cm curved Each Haemostatic "HALSTED" Mosquito 14.5 cm Straight Each Haemostatic "KELLY" Forcep 14cm curved Each Haemostatic "KEllY" Forcep Medium Each Haemostatic "KELLY" forcep14 cm Straight Each Haemostatic "KOCHER" forcep 13cm Straight Each Haemostatic "KOCHER" Forcep 14cm curved Each Haemostatic "KOCHER" Forcep 16cm curved Each 134 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 31.38 Haemostatic "KOCHER" forcep16 cm Straight Each 31.4 Halogen bulb/20 watt Each 31.39 31.41 31.42 31.43 31.44 Halogen bulb 20V Each Halogen lamp 20W 12V Each Halogen Lamp for 911 & 912 Each Hand Drill 31.45 Hand wash basin stand (double). - Five legs base mounted on 5cms dia castors with one 35cm s.s basin.Pre treated and epoxy powder coated. Handle of Dissecting knife No.11 31.47 Hct Sensor 31.46 31.48 31.49 31.5 31.51 31.52 31.53 31.54 31.55 31.56 31.57 31.58 31.59 31.6 31.61 31.62 31.63 31.64 31.65 31.66 31.67 31.68 31.69 31.7 31.71 31.72 31.73 Handle of Dissecting knife No.22 Each Each Each Each Each Head Box (for Oxygen) Each Head halter traction kit with pulley and weight Each Heater Coil (RW Meditrin) Each Heater wire adapter (Galileo Gold) Each Heater wire adapter (PB 840) Each Heating Element 1 Type - 4 kwt for Autoclave YSI-402 (4 Kwt) Each Height Measuring Scale Each Hicks oral thermometer High pressure Hose Autocon compatible with Laparascopic Set (Karl Storz) HME Filter Adult Size (PB 840) HME Filter Neonatal Size (PB 840) Each Each Each Each HME Filter Pediatric Size (PB 840) Each Hole cutters Each Hose (Simex) Each Hose Connector Hape L - compatible For Suction Machine (Simex) Each Hot bag Electric Each Hot water bag (Duckback) Each Hot water bag (Duckback) Each Humidifiers & Accessories (Galileo Gold) Each Humidifiers & Accessories (Galileo Gold) Each Humidifiers & Accessories (Galileo Gold) Each Humidifiers & bacterial filter Each Hysterectomy clamp ‘FAURE’ Each I.V. drip stand Each IBP Cable - for Mindray Beneview T8 Monitor Each IBP Sensor Port (M6) Each 135 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 31.74 Ice Bag/Collar Each 31.76 Ice box / Mobile blood refrigerator(5LT) Each 31.75 31.77 31.78 31.79 31.8 31.81 31.82 31.83 31.84 31.85 31.86 31.87 31.88 31.89 31.9 31.91 31.92 31.93 31.94 31.95 31.96 31.97 31.98 31.99 32 32.01 32.02 32.03 32.04 32.05 32.06 32.07 32.08 32.09 Ice box / Mobile blood refrigerator Each Ice pack/ Gel Each ICG Electrodes - for Mindray Beneview T8 Monitor Each Incubator Each Infant bonnet (Fisher & Paykel) (17-22) cm Each Infant bonnet (Fisher & Paykel) (22-25) cm Each Infant bonnet (Fisher & Paykel) (25-30) cm Each Infant Flow Sensor (Galileo Gold) Each Infantometer Each Injection tray SS with Lid 3" x 8" Each Inspiratory Bacterial Filter (Galileo) Each Inspiratory Filter (PB 840) Each Inspiratory Filter Neonatal size (PB 840) Each Instrument /Surgical tray SS with Lid 12" x 10" Each Instrument /Surgical tray SS with Lid 12" x15"" Each Instrument /Surgical tray SS with Lid 12"x 18" Each Instrument /Surgical tray SS with Lid 8"x 6" Each Instrument washing brush Each Intestinal Clamp ‘DOYEN’ size 21cm Curved Each Intestinal Clamp ‘DOYEN’ size 21cm Straight Each Intestinal Clamp ‘DOYEN’ size 23cm Curved Each Intestinal Clamp ‘DOYEN’ size 23cm Straight Each Intestinal Clamp ‘DOYEN’ size 25cm Curved Each Intestinal Clamp ‘DOYEN’ size 25cm Straight Each Intestinal Clamp ‘KOCHER’ size 22cm Each Intestinal Clamp ‘KOCHER’ size 24.5cm Each Intestinal Clamp ‘KOCHER’ size 27.5cm Each Intra uterine cannula ‘COLLINS’ plain 3 size Each Intra uterine cannula ‘HAYES PROVIS’ with rubber cone Each Intubation Stylet Adult Each Intubation Stylet Child Each Intubation Stylet infant Each Intubation manikin Each Disposable Iris Hooks/Retractors Each 136 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 32.1 Iris scissor (curved) 4" Each 32.12 Jeweller's forceps Each 32.11 32.13 32.14 32.15 32.16 32.17 32.18 32.19 32.2 32.21 32.22 32.23 32.24 32.25 32.26 32.27 32.28 32.29 32.3 32.31 32.32 32.33 32.34 32.35 32.36 32.37 32.38 32.39 32.4 32.41 32.42 32.43 32.44 32.45 Iris scissor(straight) 4" Each Jug SS 2 pint with lid Each Jug SS 4 pint with lid Each Jug SS 8 pint with lid Each K+ - conducting systems (ABG) Each K+ - membrane shell (ABG) Each Kelly's Artery forceps 8" curved Each Kelly's Haemostatic Forceps (Medium) Each Kelly's Pad (Rubber) Each Kelly's Pad with Pump Each Kidney tray SS 10" Each Kidney tray SS 12" Each Kidney tray SS 6" Each Kidney tray SS 8″ Each Kidney Wash Machine (Renatron II) Each Knee Cap for Orthosis - Large (black) Each Knee Cap for Orthosis - Medium (black) Each Knee Cap for Orthosis - Small (black) Each Knee Hammer Each Knee Immobilizer OC 2035 Each Knee Immobilizer OC 2035 Each Knee Stabilizer-DC 2069 Each Knife (kitchen type) needed flat Each Knife (meat cutting type ) Each Knife Dish 8"x 6" Each Knife Dish 8"x3" Each Kocher's artery Forceps 10" curved Each Kocher's artery Forceps 10" straight Each Lactometer Each Large Forcep with tooth/ blunt Each Larygoscope with four blades (Adult) Each Larygoscope with four blades (Paedictric) Each Laryngoscope bulb Each Laser Spectacles Each 137 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 32.46 Lead Apron Each 32.48 Lead Free Radiation Protection Gloves - 6.5 Each 32.47 32.49 32.5 32.51 32.52 32.53 32.54 32.55 32.56 32.57 32.58 32.59 32.6 32.61 32.62 32.63 32.64 32.65 32.66 32.67 32.68 32.69 32.7 32.71 32.72 32.73 32.74 32.75 32.76 32.77 32.78 32.79 32.8 32.81 Lead Free Radiation Protection Gloves - 6 Each Lead Free Radiation Protection Gloves - 7 Each Lead Free Radiation Protection Gloves -7.5 Each Lead Free Radiation Protection Gloves - 8 Each Lead numbers Half inch Each LED Phototherapy system Each Legenback Retractor 22cm Each Leggings Each Leggings(NWR) Each Leishmans stain Each Lengenback retractor Each Lengenback retractor Each Lengenback retractor Each Lens cleaning paper Each Lifting forceb with container Each Long Curved Forceps Each Long tissue Forcep Each Lotion bowl with Lid 4" diameter Each Lotion bowl with Lid 6" diameter Each Lotion bowl with Lid 8" diameter Each Lumbosacral belt large Each Lumbosacral belt small Each Lumbosacral belt medium Each Lymph node Each Magill forceps child Each Magill forceps adult Each Magill forceps Infant Each Magnet for ECG Each Magnifying glass Small Each Magnifying glass, big size with handle Each Maintenance kit for Elecsys 1010 Each Maintenance pack Each Malleable stylets with adjustable stop, different size Each Manual blood pressure instrument with stand Each 138 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 32.82 Manual blood pressure instrument without stand Each 32.84 Mattress plastic cover: size 6.2 ft x 3.2 ft x 3.2 inch Each 32.83 32.85 32.86 32.87 32.88 32.89 32.9 32.91 32.92 32.93 32.94 32.95 32.96 32.97 32.98 32.99 33 33.01 33.02 33.03 33.04 33.05 33.06 33.07 33.08 33.09 33.1 33.11 33.12 33.13 33.14 Mattress for patient Trolley 70'' x 23'' Each Mayo Instruments clip Large Each Mayo Instruments clip Small Each Mayo scissor (curved) 14cm Each Mayo scissor (curved) 15cm Each Mayo scissor (straight) 14cm Each Mayo scissor (straight) 15cm Each Mayo Scissors 17.5cm Curved Each Mayo Scissors 17.5cm Straight Each Mayo Scissors 20cm Curved Each Mayo Scissors 20cm Straight Each MEASURING TAPE Each Measuring Tape (Clinical) Each Medicine measuring cups Each Medicine measuring cups Each Medicine measuring cups Each Medicine measuring cups Each Medicine measuring cups Each Medicine measuring cups Each Membrane (904-892) Membrane (904-892) for Transcutaneous PO2/PCO2 (Make: Radiometer, Model: TCM 40) Micro needle holder, very delicate, smooth jaws, curved Micro needle holder, very delicate, smooth jaws, length 15cm (6”), straight tipped Micro Scissor Straight 145mm Micro Scissors, German Stainless Steel, Soft Spring tension, Round handles, Sharp tips, Flat serrated handles. Length: 12cm; (4 ¾”) Curved Each Each Each Each Each Each Micro Scissors, German Stainless Steel, Soft Spring tension, Round handles, Sharp tips, Flat serrated handles. Length: 12cm; (4 ¾”) Straight Each Micro Scissors, Wide flat handles with deep serration for grip, German Stainless Steel, 12mm cutting blades, Total length: 18cm; (7 ⅛”)Curved Each Micro Scissors, Wide flat handles with deep serration for grip, German Stainless Steel, 12mm cutting blades, Total length: 18cm; (7 ⅛”)Straight Each Microscope ( for side lab) - Binocular electric light microscope Each Micro Suture Tying Forceps (Straight) 180 mm Each Microscope Bulb 6V 20W Each 139 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 33.15 Midwifery forceps ‘SIMPSON’ Each 33.17 Molina Sheet Each 33.16 33.18 33.19 33.2 33.21 33.22 33.23 33.24 33.25 33.26 Midwifery forceps ‘WRIGLLY’ Each Mosquito artery (curved) 4" Each Mosquito artery (straight) 4" Each Mosquito Artery forceps, , Straight 5″ Each Mosquito Artery forceps, Curved 5″ Each Mosquito Artery forceps,"HALSTED" , Straight 5″ Each Mosquito Artery forceps,"HALSTED" Curved 5″ Each Mosquito Net (Single use patient specific, plastic) Each Mosquito nets ( standard size) 33.27 Motorised X-ray film viewers of high luminous Intensity and adjustable brightness with vertical belt system with two panel ( 4 section in each panel) Motorized X-ray film viewer with vertical belt system with video camera (Planilux 33.29 Mouth Gag Fergussion 33.28 33.3 33.31 33.32 33.33 33.34 33.35 33.36 33.37 33.38 33.39 33.4 33.41 33.42 33.43 33.44 33.45 33.46 33.47 33.48 33.49 33.5 Mouth gag Each Each Each Each Each Mox with pipe Each Mug SS Each Multiside Oxygen sensor with ear clip (Dura -Y D-YS) Each Multiside Oxygen sensor without ear clip (Dura -Y D-YS) Each Myoma screw ‘DOYEN’ Each Na+ conducting systems (ABG) Each Na+ - sensor casing (ABG) Each Nasal prong (Fisher & Paykel) (3020) Each Nasal prong (Fisher & Paykel) (3520) Each Nasal prong (Fisher & Paykel) (4030) Each Nasal prong (Fisher & Paykel) (4540) Each Nasal tubing (Fisher & Paykel) 70mm Each Nebuliser for Ventrilatro (Galileo) Each Nebulizer Each Nebulizer Each Needle & Syringe destroyer Each Needle & Syringe destroyer Each Needle Holder ‘BOZENMANN’ Size 20 cm Each Needle Holder ‘KILNER’ Size 13 cm Each Needle Holder ‘MAYO HEGER’ Size 12.5 cm Each Needle Holder ‘MAYO HEGER’ Size 15 cm Each 140 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 33.51 Needle Holder ‘MAYO HEGER’ Size 17.5 cm Each 33.53 Needle Holder ‘MAYO HEGER’ Size 25 cm Each 33.52 33.54 33.55 33.56 33.57 33.58 33.59 33.6 33.61 33.62 33.63 33.64 33.65 33.66 33.67 33.68 33.69 33.7 33.71 33.72 33.73 33.74 33.75 33.76 33.77 33.78 33.79 33.8 33.81 33.82 33.83 33.84 33.85 33.86 Needle Holder ‘MAYO HEGER’ Size 20 cm Each Needle holder 6" Each Needle Holder forceps short & small Each Nelson Inhaler Each Neubaur slide Each Neubeaur Chamber Each NIBP Cuff (Adult) (M6) Each NIBP Cuff (Neonate) (M6) Each NIBP Cuff (Pediatric) (M6) Each NIBP cuff connector (Adult) - for cardiac monitor M6 Aster MediAid Each NIBP Cuff Connector (Adult) (M6) NIBP Cuff Connector (Neonatal) - For cardiac monitor M6 Aster MediAid NIBP cuff connector (Ped) - for cardiac monitor M6 Aster MediAid NIBP Cuff Connector (Pediatric) (M6) Each Each Each Each NIBP Hose (M6) Each No zero dental driller Each Non Collapsible Suction tube Each Non Invasive Glucose monitoring system (Glucometer) Each O.Ring NBRP 9 L 456006 for 911 & 912 Each O2 Sensor Cable (Galileo) Each Open Care System with Radiant Warmer (Phoenix) M : NWS 100 Each Opthalmoscope Each Orthopaedics Pliers (Taperai) Each OT bulb 70watt/24 volts Each OT Light Bulb (Make: Martin) Each Otoscope Each Ounce glass steel Each Outlet forceps Each Ovum forceps ‘HEYWOOD SMITH’ size 25cm box joint Each Oxygen cylinder stand /trolley - B Type Each Oxygen cylinder stand /trolley - D Type Each Oxygen flow meter with Humidifier bottle Each Oxygen key /wrench Each Oxygen key cum spanner Each 141 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 33.87 Oxygen Mox connection for Anaesthesia machine Each 33.89 Oxygen Sensor (Galileo Gold) Each 33.88 33.9 33.91 33.92 33.93 33.94 33.95 33.96 33.97 33.98 33.99 34 34.01 34.02 34.03 34.04 34.05 34.06 34.07 34.08 34.09 34.1 34.11 34.12 34.13 34.14 34.15 34.16 34.17 34.18 34.19 34.2 34.21 34.22 Oxygen Sensor (PB 840) Each Pad Electrodes for SWD (DX 500 roland) Each Pail (steel bucket) 12 quarter with lid Each Pail (steel bucket) with lid 30Ltrs Each Pail (steel bucket) with lid 20Litrs Each Paper Roll (ABG) Each Patient Breathing Set Infant Reusable (Galileo Gold) Each Patient cable for IFT/MST (Make/Model: Multidyne 965) Each Patient cable for Pocket TENS (Make: Biomedical Life systems, Inc.) Each Patient cable with electrodes and sponge pads for IFT (Endomed 182) Each Patient shifting trolleys with the facility of Oxygen Cylinder carrier Each PC Board (RW Meditrin) Each PCO2 - sensor unit with membrane shell (ABG) Each PCO2 membrane shell (ABG) Each Pelvic traction kit with pulley and weight Each Percussion Hammer Each Percussion Hammer Paediatric Each Percussion or Knee Hammer Each pH - sensor unit (ABG) Each Phototherapy bulb (Blue) Each Phototherapy bulb (White) Each Phototherapy bulb holder (Meditrin) Each Phototherapy choke (Meditrin) Each Phototherapy Machine (Meditrin) Each Phototherapy specs for neonates(eye cover) Each Phototherapy tube (Blue) (Meditrin) Each Phototherapy tube (White) (Meditrin) Each Pile Binder Each Pile Forceps Leur’s Each Piles Ligation O Rubber ring/band Each Pituitary forcep large Each Pituitary forcep medium Each Pituitary forcep Small Each Plaster cutting power saw with saw blade Each 142 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 34.23 Plaster cutting power saw with saw blade(Electric) Each 34.25 Plastic dropping bottle (120ml) Each 34.24 34.26 34.27 34.28 34.29 34.3 34.31 34.32 34.33 34.34 34.35 34.36 34.37 34.38 34.39 34.4 34.41 34.42 34.43 34.44 34.45 34.46 34.47 34.48 34.49 34.5 34.51 34.52 34.53 34.54 34.55 34.56 34.57 34.58 Plastic dropper bottle. Each Plastic measuring cylinder 1000ml Each Plastic measuring cylinder 500ml Each Plastic measuring cylinder 250ml Each Plastic measuring cylinder 100ml Each Plastic name tag Born Babies Each Plastic small tube Each Platinum loop. Each Platinum lope Each Plug in mount all size 22M, 22F, 23M, 23F Each PO2 - sensor unit with membrane shell (ABG) Each PO2 membrane shell (ABG) Each Porcelain Dishes 50ml Each Pressure Meter 0-30 psi for Autoclave YSI-402 (4 Kwt) Pressure Monitoring Kit (Transducer Kit) (Double Dome) compatible for Lifeline Pressure Monitor Pressure Monitoring Kit with tru-wave disposable pressure Transducer. Ref:PX 284 Pressure Monitoring Kit (Transducer Kit) (Double Dome) compatible for Lifeline Pressure Monitor Pressure Rebense Knots for Autoclave YSI-402 (4 kwt) Printing Paper (Mindray) Each Each Each Each Each Each Proctoscope Rubber Each Proctoscope (Adult) Each Proctoscope (Pediatrics) Each Protective eye wear Each Pulse Oxymeter(finger tip) Each Pulse Oxymeter(finger tip) Each Pulse Oxymeter(table top) Each RAOS foot operated suction Each RAOS hand suction unit 100 ml Each Rechargeable battery operated drill Each Rectactor Baby Ribs spatula Each Rectal Biopsy Punch Forceps Each Rectal Speculum Kally Ext. Large Each Rectal Speculum Kally Large Each Rectal Speculum Kally Medium Each 143 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 34.59 Rectal Speculum Kally Small Each 34.61 Rectal thermometer Paediatric Each 34.6 34.62 34.63 34.64 34.65 34.66 34.67 34.68 34.69 34.7 34.71 34.72 34.73 34.74 34.75 34.76 34.77 34.78 34.79 34.8 34.81 34.82 34.83 34.84 34.85 34.86 34.87 34.88 34.89 34.9 34.91 34.92 34.93 34.94 Rectal thermometer Adult Each Ref. - conducting system (ABG) Each Ref. - membrane shell (ABG) Each Resucitation kits Automatics Each Resuscitation kit Emergency Each Resuscitation kit for neonates Each Retractor "KILNER" Each Retractor "KOCHER" 23cm(43 x 18mm) Each Retractor "KOCHER" 23cm(63 x 25mm) Each Retractor "KOCHER" 23cm(78 x 40mm) Each Retractor "MORRIS" 6cm width Each Retractor "MORRIS" 7.5cm width Each Retractor "MORRIS" 8.7cm width Each Retractor ‘BALFOUR’ Self Retaining Each Retractor ‘Czerny’ Size 15 cm Each Retractor ‘Czerny’ Size 20 cm Each Retractor ‘DEAVERS’ 18cm Each Retractor ‘DEAVERS’ 21.5cm Each Retractor ‘DEAVERS’ 25cm Each Retractor ‘DEAVERS’ 25cm x 2.5cm Each Retractor ‘DEAVERS’ 30cm x 4cm Each Retractor ‘DEAVERS’ 30cm x 6cm Each Retractor ‘DEAVERS’ 31cm Each Retractor ‘DEAVERS’ 33cm Each Retractor ‘DOYEN’ 10 cm width Each Retractor ‘DOYEN’ 5 cm width Each Retractor ‘DOYEN’ 6 cm width Each Retractor ‘Farabeuf’ Set of 2 Each Retractor ‘JANSEN’ 10cm Self Retaining Each Retractor ‘MOLLISON’ Self Retaining Each Retractor ‘MORRIS’ 10 cm width Each Retractor ‘MORRIS’ 5 cm width Each Retractor double hook Each Retractor for Ribs spreader self retaining fixed blade Each 144 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 34.95 Retractor for Ribs spreader self" BURFORD" Adult self retaining Each 34.97 Retractor Hook Single Sharp Each 34.96 34.98 34.99 35 35.01 35.02 35.03 35.04 35.05 35.06 35.07 35.08 35.09 35.1 35.11 35.12 35.13 35.14 35.15 35.16 35.17 35.18 35.19 35.2 35.21 35.22 35.23 35.24 35.25 35.26 35.27 35.28 35.29 35.3 Retractor Hook Double Sharp Each Retractor Lengenback 12mm width Each Retractor Lengenback 16mm width Each Retractor Lengenback 18mm width Each Retractor Lengenback 22.5cm (30 x 11mm) Each Retractor Lengenback 22.5cm (30 x 14mm) Each Retractor Lengenback 22.5cm (30 x 16mm) Each Retractor Lengenback 22.5cm (40 x 11mm) Each Retractor Lengenback 22.5cm (50 x 11mm) Each Retractor Lengenback 22.5cm (85 x 15mm) Each Retractor Lengenback 22mm width Each Retractor Lengenback 30cm x 2.5cm Each Retractor Lengenback 30cm x 4.0cm Each Retractor Lengenback 30cm x 5.0cm Each Retractor Lengenback 7mm width Each Retractor Lengenback 8mm width Each Retractor single hook Each Retrator (Right angle) Each Rib Cutter Each Right angle Skin retarctor Each RM Cable - for Mindray Beneview T8 Monitor Each Room thermometer Each Room thermometer Each Rubber Sole - 4mm Each S.S Funnel 4" Each S.S. Adaptor Each Safety goggles Each Sample detector Each Sample probe Each Sand Cone fine Each Sand Cone smooth Each Scalple Handle B.P. No. 3 Each Scalple Handle B.P. No. 4 Each Scalple Handle B.P. No. 7 Each 145 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 35.31 Scissor Badge “LISTER” 19.0 cm Each 35.33 Scissor size 15 cm Curved Each 35.32 35.34 35.35 35.36 35.37 35.38 35.39 35.4 35.41 35.42 35.43 35.44 35.45 35.46 35.47 35.48 35.49 35.5 35.51 35.52 35.53 35.54 35.55 35.56 35.57 35.58 35.59 35.6 35.61 35.62 35.63 35.64 35.65 35.66 Scissor Guage Cutting (Tailor) size 20 cm Each Scissor size 17.5 cm Curved Each Scissor size 20 cm Straight Each Scissor size 22.5 cm Straight Each Scissors 5" Each Scissors 7" Each Scissors 8" Each Scissors Mayo Size 14.0 cm Curved Each Scissors Mayo Size 16.5 cm Straight Each Scissors Mayo Size 16.5cm Curved Each Scissors Mayo Size 19.0 cm Curved Each Scissors Mayo Size19.0 cm Straight Each Scissors metzen baum 20cm Each Scissors Metzenbaum Size 15 cm Curved Each Scissors Metzenbaum Size 15 cm Straight Each Scissors Metzenbaum Size 17.5 cm Curved Each Scissors Metzenbaum Size 17.5 cm Straight Each Scissors Metzenbaum Size 20.0 cm Curved Each Scissors Metzenbaum Size 20.0cm Straight Each Scissors Metzenbaum Size 22.5 cm Straight Each Scissors Metzenbaum Size 22.5cm Curved Each Scissors straight 20cm Each Scissors straight 22.5cm Each Scissors Suture cutting ‘HEATH’ Size 15 cm Each Screw driver Each Sealing rings Each Set tubing for roller pump (reagents) (ABG) Each Sharp container (yellow colour) Each Shin tube cutting jig 30mm Each Shin tube cutting jig 35mm Each Short needle Holder Each Side Support (Meditrin) Each Side Support (Meditrin) Each Silicon Tubal Ring Each 146 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 35.67 Sims Speculum Each 35.69 Sinus forceps (medium) Each 35.68 35.7 35.71 35.72 35.73 35.74 35.75 35.76 35.77 35.78 35.79 35.8 35.81 35.82 35.83 35.84 35.85 35.86 35.87 35.88 35.89 35.9 35.91 35.92 35.93 35.94 35.95 35.96 35.97 35.98 35.99 36 36.01 36.02 Singlehook retractor Each Sinus Forceps ‘LISTER’ 15 cm Each Skin Grafting Knife Each Skin hook Each Skin hook retractor Each Skin Probe (Rw Meditrin) Each Solid waste containers liners Each Solution Valve Spanners multipurpose,combination key & spanner key for pin index cylinder Spare canvas bag Spare lamp for Opthalmoscope Each Each Each Each Spare parts for: Easylyte,911 , 912 & others Each Spirit lamp Each Spirometer Respiratory Exerciser Each Spirometry Mouthpiece Each SPO2 Probe (Adult) (M6) Each SPO2 Probe (Neonatal) (Mindray) Each SPO2 Probe (Neonate) (M6) Each SPO2 Probe (Pediatric) (M6) SPO2 Probe compatible for Biphasis Defibrillator/ Monitor Recorder/ External Pacemaker (Model: Lifepack 20) SPO2 probe Extension (for L & T Stellar Pulse Oxymeter) SPO2 Probe for - for Mindray Beneview T8 Monitor Each Each Each Each SPO2 Probe for cardiac Monitor M6 Aster Medi Aid Each SPO2 Probe for Pulse Oxymeter L & T Stellar Each SPO2 Probe Neonatal (PB 840) Each SPO2 Probe Pediatric (Mindray) Each SPO2 Probe Pediatric (PB 840) Each SPO2 probe with ear clip neonatal size SPO2 Probe with earclip (Neonatal) compatible for Baby Warmer (Make: Atom Medical Corp, Model: Infa Warmer) SPO2 Sensor Port (M6) Sponge holding forceps Each Each Each Each Sponge Holding Forceps Size 25cm Each Spring balance Each Sputum mug with lid Each 147 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 36.03 SS Sterilizer 8 x 5x3 Each 36.05 SS Sterilizer 16 x 6 x 3 Each 36.04 36.06 36.07 36.08 36.09 36.1 36.11 36.12 36.13 36.14 36.15 36.16 36.17 36.18 36.19 36.2 36.21 36.22 36.23 36.24 36.25 36.26 36.27 36.28 36.29 36.3 36.31 36.32 36.33 36.34 36.35 36.36 36.37 36.38 SS Sterilizer 12 x 6 x 4 Each SS Sterilizer 20 x 8 x 6 Each SS Sterilizer 24x12x8.5 Each STANDARD WALKER Each Static Knee Brace Each Static Knee Brace (Long) Each Static Knee Brace (Short) Each Steel grip Each Steel Spatula Each Sterile eye draper with drainage bag Each Sterilizer electric Water Boiling Seamless 12x6x4 Each Sterilizer forceps ‘CHEATLE Heavy Pattern’ (LHP) size 25 cm Each Sterilizer forceps ‘CHEATLE Heavy Pattern’ (LHP) size 28 cm Each Sterilizer forceps ‘CHEATLE’ size 20 cm Each Sterilizer Forceps ‘CHEATLE’ Size 25 cm Each Sterilizer Large Each Sterilizer SS 20" x 8" x 6" Each Sterilizing drum 32cm x40 cm (225x225) Each Stethoscope 3M LITTMANN (adult) Each Stethoscope 3M LITTMANN (paediatric) Each Stethoscope Adult Each Stethoscope for Neonatal Each Stethoscope Paediatric Each Stich scissor Each Stop Clock Digital Each Stop watch Each Sucking pipe (Simex) Each Suction Cup Electrode (Ped) (BPL) Each Suction Needle (Simex) Each Surgical tray with cover SS 8 inches x10 inches Each Surgical tray with cover SS 9 inches x 6 inches Each Suture anchor (orthopaedics) Each Suture cutting scissor 6″ curved Each Suture cutting scissor 6″ straight Each 148 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 36.39 Syringe & Needle Destroyer Electrical Each 36.41 T- handle for Orthopaedics Each 36.4 36.42 36.43 36.44 36.45 36.46 36.47 36.48 36.49 36.5 36.51 36.52 36.53 36.54 36.55 36.56 36.57 36.58 36.59 36.6 36.61 36.62 36.63 36.64 36.65 36.66 36.67 36.68 36.69 36.7 36.71 36.72 36.73 Syringe Infusion pump Each Table Top Centrifuge 16 Tube Capacity Each Tailor Thread Each Taylor Brace Medium Each Taylor Brace Small Each Taylor Brace large Each TCO2 membrane kit,6/bx: CRT Each TCO2 mixer CRT4 Each TCO2 sensor TDH Headset Cable compatible with Diagnostic Pure Tone Audiometer Model: 270 Make: Amplivox Each Each TDH Headset complete compatible with Diagnostic Pure Tone Audiometer Model: 270 Make: Amplivox Each Teley's Forcep Each Thermometer 37 Degree C Each TDH Speaker compatible with Diagnostic Pure Tone Audiometer Model: 270 Make: Amplivox Each Temperature Detector Port (M6) Each Thyroid Guard (Lead Guard) Each Tissure Forceps ‘ALLIS’ 20.0 cm Each Tissure Forceps ‘ALLIS’ 25.0 cm Each Tissure Forceps ‘ALLIS’ 30.0 cm Each Tissure Forceps ‘ALLIS’ Size 12.5 cm Each Tissure Forceps ‘ALLIS’ Size 17.5 cm Each Tissure Forceps ‘ALLIS’ with 5:6 Size 15.0 cm Each Tissure Forceps ‘ALLIS’ with 1:2 Size 15.0 cm Each Tissure Forceps ‘ALLIS’ with 3:4: Size 15.0 cm Each Tissure Forceps ‘ALLIS’ with 4:5 Size 15.0 cm Each Tissure Forceps ‘BABCOCK’ 16.5 cm Each Tissure Forceps ‘BABCOCK’ 20.5 cm Each Touniquet Each Touniquet Each Towel clip cross action Each Towel clip large Each Towel clip Mayo 12.5cm Each Towel clip Mayo 15cm Each 149 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 36.74 Towel clip Mayo 9cm Each 36.76 Tracheal dilator (curved) Each 36.75 36.77 36.78 36.79 36.8 36.81 36.82 36.83 36.84 36.85 36.86 36.87 36.88 36.89 36.9 36.91 36.92 36.93 36.94 36.95 36.96 36.97 36.98 36.99 37 37.01 37.02 37.03 37.04 37.05 37.06 37.07 37.08 37.09 Towel clip medium Each Tracheal dilator (straight) Each TRACTION HOOKS Each TRACTION WEIGHTS Each Transparent Non Collapsible Pipe Each Tub for SitZ Bath Each Tube-to tube calmps Each Tuning fork 128 hertz Each Tuning fork 256 hertz Each Tuning fork 512 hertz Each Tuning fork for Neurological Examination Two Separated Reporting work station of Kodak Computed Radiography (CR 850) system (software & Hardware) Umbilical scissor American Pattern Umbilical Scissors Each Each Each Each Undine Each urinal male ss Each Urinometer With Cylinder Each Uterine curette double ended blunt & sharp Each Uterine curette double ended blunt & sharp Each Uterine depressor ‘SIMS’ Each Uterine dilators ‘MATHEW DUNCAN’ set of 12 Each Uterine dressing forceps ‘BOZEMANN’ size 25 cm Each Uterine flushing curette ‘BONNEY BERKELY’ angle on flat Each Uterine flushing curette ‘BONNEY BERKELY’ Curved Each Uterine flushing curette ‘MAINGOT’ Each Uterine flushing curette ‘WERTHEIM’ Each Uterine scissor ‘NOVAK’ S.S. Each Uterine scissor 23cmCurved Each Uterine scissor straight size 21cm Each Uterine sound ‘SIMS’ graduated maliable Each Uterus holding forceps ‘DARTIGUES’ Each Vaginal Speculum ‘AUVARD’ brass Each Vaginal Speculum ‘AUVARD’ double ended size set of 10 Each Vaginal Speculum ‘CUSCO’ ‘Sims’ S.S. large Each 150 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 37.1 Vaginal Speculum ‘CUSCO’ ‘Sims’ S.S. Medium Each 37.12 Vaginal Speculum ‘CUSCO’ ‘Sims’ S.S. super large Each 37.11 37.13 37.14 37.15 37.16 37.17 37.18 37.19 37.2 37.21 37.22 37.23 37.24 37.25 37.26 37.27 37.28 37.29 37.3 37.31 37.32 37.33 37.34 37.35 37.36 37.37 37.38 37.39 37.4 37.41 37.42 37.43 37.44 Vaginal Speculum ‘CUSCO’ ‘Sims’ S.S. small Each Vein 'Sper Veticose Each Ventilator Breathing Circuit (Adult) (PB 840) Each Ventilator Breathing Circuit (Neonatal) (PB 840) Each Ventilator breathing circuit disp neonatal size (Galileo Gold) Each Ventilator Breathing Circuit Pediatric (PB 840) Each Ventilator Breathing Circuit Reusable (Adult) (PB 840) Each Ventilator Breathing Circuit Reusable (Neonate) (PB 840) Each Ventilator Breathing Circuit Reusable (Ped) (PB 840) Each Ventilator breathing circuit Reusable neonatal size (Galileo Gold) Each Ventouse set with Sialastic cups og different sizes Each Versa Tips Viries active Yoke for 24 hrs Holter study compatible with Holter system (Make: Spacelabs Healthcare; Model: eVO Vomiting bowl Vortex mixer Each Each Each Each Vulsellum forceps 1 x 1 teeth 25cm Each Walker Adult Each Walker Paediatric Each WALKING STICKS Each WASH 2 330ml (ABG) Each WASH 2+M 250ml (ABG) Each Water Inlet Filter for Nephrology Each Water mattress Each Water seal bottles (Adult) Each Water seal bottles (Kid) Each Water seal bottles(Midi) Each Weighing Scale Adult Each Weighing Scale (Paediatric) Each Wire Cutter Each X-ray Chest Stand (Portable Floor Mounted) X-ray film viewers with collimation of high luminous density and adjustable brightness (2 film viewer, single panel)Automatic Each Each X-ray film viewers with collimation of high luminous density and adjustable brightness (2 film viewer, single panel)manual Each X-ray film viewers with collimation of high luminous density and adjustable brightness (3 film viewer, single panel)Automatic Each 151 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 37.45 X-ray film viewers with collimation of high luminous density and adjustable brightness (3 film viewer, single panel)manual Each 37.46 X-ray film viewers with collimation of high luminous density and adjustable brightness (4 film viewer, single panel)(Automatic) Each X-ray film viewers with collimation of high luminous density and adjustable brightness (8 film viewer, double panel) Automatic X-ray film viewers with collimation of high luminous density and adjustable brightness (8 film viewer, double panel) Manual Each 37.47 37.48 37.49 37.5 37.51 37.52 37.53 37.54 37.55 37.56 37.57 X-ray film viewers with collimation of high luminous density and adjustable brightness (4 film viewer, single panel)(manual) Each Neurosurgical Product Each Absorbable Gelatin based Tropical Absorbable Hemostat: -Absorbable Gelatin based Tropical Hemostat with syringe prefilled ith hemostatic matrix with various length applicators and flexible application tips. -Special storage if required should be provided.-Should have a shelf life minimum 1 year from date of supply. Each Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (High Pressure) Each Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Low Pressure) Each All Human Sealant :- Package should contain (different SKU's - 1ml, 2ml, 5ml) containing :1 vial each of 55-85mg/l fibrinogen and 800-1200 IU/ml human thrombin as frozen solution.-All human formulation free of Bovine Aprotinin.-Tripple-lumen tip to prevent clogging inside the applicator.- Maintains predictable fibrinogen viscosity in a range of temperatures.-Maintains fibronectin ratio within physiological ranges.-Adequate devices (in refrigeration etc) should be privided for storage at least 1 year from the date of supply. Each Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure) Each Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene. Each Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure with bacterial resistance) Each Closed Suction Catheter (Turbo Cleaning Close Suction Catheter) - Has isolated turbo cleaning chamber for cleaning catheter tip. Catheter is made up of medical grade Silicon Material. Catheter has Zig-Zag Ports for better suctioning. Twin PEEP seals Available in Both Endotracheal and Tracheostomy Version.12 fr. and 14 fr. Each Closed Suction Catheter for Paediatrics - Number and color coded graduations for controlled depth suctioning Elbow connector and ‘Y’ configurations for standard and high frequency ventilation Separate Y connectors available for different tubes in the pack Catheter is made up of medical grade Silicon Material 5fr, 6fr, 7fr, 8fr, 10fr and 12fr. Each 37.59 Paediatric Endotracheal Tube -Paediatric Microcuff designed according to the paediatric anatomy Cuff is made up of Polyurethane. Thickness of Cuff is 10 microns. Microcuff seals at an average cuff pressure of 11 cmH2o. Burst pressure of Cuff is 800cmH2o. Anatomically based intubation depth marking with precision bands. Cuff with play mode function.3mm, 3.5mm, 4mm, 4.5mm, 5mm, 5.5mm, 6mm, 6.5mm & 7mm. Each 37.6 Oral care Kit -Single Piece Silicone Brush with two Suction Ports Bristles are the part of the Brush not attached. Innovative self- cleaning covered Yankauer Suction handle has an ON and OFF button for suction flow through. Single wrapped Polyplus Dentaswab is available. Each 37.58 37.61 PEG (Percutaneous Endoscopic Gastrostomy) feeding Tubes -Medical Grade Silicone construction. Secur-Lok* external retention ring. Universal & Bolus feeding port connectors. Medication port Collapsible internal retention bumper. Radiopaque stipe and bumper Tubing Clamp. 14fr, 20fr and 24fr. Each Medical Grade Silicone construction. Silicone internal retention balloon. Secur-Lok* external retention ring. Universal feeding port connectors.Medication port.Tapered distal tip.Dual exit ports.Radiopaque stipe. 14fr, 18fr, 20fr, 22fr and 24fr. Each 37.63 Low-Profile Gastrostomy Feeding Tubes/Kits -Medical grade silicone construction. Low-Profile design. Tapered distal tip. Silicone internal retention balloon. Distal tip recessed at 5ml. Proximal Anti-Reflux valve. Secur-Lok* extension set connector Mechanism. Radiopaque stripe. Different extention sets available 12 fr, 14fr, 16fr, 18fr, 20fr & 24fr. Each 37.64 Re-Use Prevention Syringe with Needle with plunger rod breaking mechanism and auto lock on completion. Size 2ml 22/23/24gx1” Each 37.62 37.65 Re-Use Prevention Syringe with Needle with plunger rod breaking mechanism and auto lock on completion. Size 5ml 22/23/24gx1” 152 Each Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 37.66 37.67 37.68 37.69 37.7 37.71 37.72 37.73 37.74 37.75 37.76 37.77 37.78 37.79 37.8 37.81 37.82 37.83 37.84 37.85 37.86 37.87 37.88 37.89 37.9 37.91 37.92 37.93 Re-Use Prevention Syringe with Needle with plunger rod breaking mechanism and auto lock on completion. Size 5ml 22/23/24gx1” Each Closed Catheter Access Device with Split Septum Transparent Extension Line for Paediatric Patient Use- Size Single Extension Each Closed Catheter Access Device with Split Septum Transparent Extension Line for Adult Patient Use- Size Tri Extension Micro Bore Each Prefilled Syringe Device – for IV Line Flushing containing 0.9% Normal Saline (Preservative Free) – Size 5ml Each Safety IV Cannula with Blunt Plastic non metallic safety mechanism with catheter made of vialon bio material. Size 16g,18g,20g,22g Each Closed Catheter Access Device with Split Septum Transparent Extension Line for Paediatric/Adult Patient Use- Size Bi Extension Each IV Cannula with Catheter made of Vialon Bio Material for General Use .Size 16g,18g,20g,22g Each Prefilled Syringe Terminally sterile Device – for IV Line Flushing containing 0.9% Normal Saline (Preservative Free) – Size 10ml Each Manual Hub Cutter – with biohazard symbol and which can cut the plastic hub and NOT the metal needle with temporary and permanent locking mechanism on complete filling of the disposal hub cutter with clear demarcation of fill line and which can accomadate upto 400-600 needles. Re-Use Prevention Syringe with Needle with plunger rod breaking mechanism and auto lock on completion. Size 2ml 22/23/24gx1” Each Re-Use Prevention Syringe with Needle with plunger rod breaking mechanism and auto lock on completion. Size 5ml 22/23/24gx1” Each Closed Catheter Access Device with Split Septum Transparent Extension Line for Paediatric Patient Use- Size Single Extension Each Closed Catheter Access Device with Split Septum Transparent Extension Line for Adult Patient Use- Size Tri Extension Micro Bore Each Manual Hub Cutter – with biohazard symbol and which can cut the plastic hub and NOT the metal needle with temporary and permanent locking mechanism on complete filling of the disposal hub cutter with clear demarcation of fill line and which can accomadate upto 400-600 needles. Each Each Re-Use Prevention Syringe with Needle with plunger rod breaking mechanism and auto lock on completion. Size 5ml 22/23/24gx1” Each Safety IV Cannula with Blunt Plastic non metallic safety mechanism with catheter made of vialon bio material. Size 16g,18g,20g,22g Each Closed Catheter Access Device with Split Septum Transparent Extension Line for Paediatric/Adult Patient Use- Size Bi Extension Micro Bore Each IV Cannula with Catheter made of Vialon Bio Material for General Use .Size 16g,18g,20g,22g Each Prefilled Syringe Device – for IV Line Flushing containing 0.9% Normal Saline (Preservative Free) – Size 5ml Each Cerebral Reservior (Omaya Type) Each Lumbar Extranal Drainage System Each Prefilled Syringe Terminally sterile Device – for IV Line Flushing containing 0.9% Normal Saline (Preservative Free) – Size 10ml Extranal Ventricular Drainage Syatem Each Each Poly Propylene mesh (small) for Duroplasty Each Poly Propylene Mesh (Medium) for Duroplasty Each Poly Propylene Mesh (Large) for Duroplasty Each G Bone Cement (for Cranioplasty) Each Kraniotomy Drape Each 153 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 37.94 Iodine Drape Large Each 37.96 Microscope Drape Medium (for Neuro Operating Microscope Equipment) Each 37.95 37.97 37.98 37.99 38 38.01 38.02 38.03 38.04 38.05 38.06 38.07 38.08 38.09 38.1 38.11 38.12 38.13 38.14 38.15 38.16 38.17 38.18 38.19 38.2 38.21 C Arm Cover Viral Protection Operating Kit Balanced Salt Solution with Na/K/Mg & chloride levels similar to plasma with acetate & gluconate/malate as buffer, must not contain calcium ( eg.Plasmalyte A /Volulyte etc) Each Each Each Bactiseal Impregnated Shunt - FDA Approved, fixed pressure VP Shunts (low,medium, high) that are antibiotic impregnated and can reduce the potential for bacterial colonization in the lumen as well as its outer surface. Each Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Each Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Each Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Each Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. Each Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. Each Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . Each Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . Each Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. Each Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. Each Raneys scalp disposable clips - Disposable Raney's Clips Each Disposable Drapes For Universal Precautions and Disaster Scenario (Radioprotective Items Included) Each Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Each Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Each Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Each Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Each Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. Each Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . Each Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . Each Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. Each Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. Each Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. Each Cranioplasty kit - Cranioplasty kit, sterile, pack of two packets of Methyl methacrylate and two vials of liquid. Each 154 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 38.22 Spinal Drape Pack- 1no Bottom Drape, 1no Top Drape, 2nos Side Drape, US FDA certified Each 38.24 Integuseal- Microbial sealant Each Standard Surgical Gowns-Low Linting Fabric,Adjustable Neckline - Hook & loop closure, US FDA certifioed Each 38.23 38.25 38.26 38.27 38.28 38.29 38.3 38.31 38.32 38.33 38.34 38.35 38.36 38.37 38.38 38.39 38.4 38.41 38.42 38.43 Breathable Impervious Surgical Gowns -Breathable Impervious Fabric -Passes ASTM F1671 & F1670, Generous cut & Added length, US FDA certified Universal Extremity Drape- Control plus fabric,US FDA certified Impervious Split Sheet- 60" x 70", 4" x 21" split, Polyethylene Sheet, US FDA certified U-Bar-Pack- 1 back table cover-Reinforced 44" x 88",1 mayo stand cover reinforced 23" x 54",1 suture bag, 1U drape 71" x 124", 1 Bar Drape 71" x 124", 1 Bar Drape 41.5" x 82",US FDA certified Each Each Each Each Back Table Cover Zone Reinforced- 44" x 99", US FDA certified Each Fluid shield Mask with Visor -Four Layer Mask, water resistant with water resistant,-NAOSH, OSHA approved Each Impervious Stockinette-12" x 58", UDS FDA HIP Drape with LEG Pockets -control plus fabric, US FDA approved HIP Drape without LEG Pockets -Control plus fabric, US FDA approved Radioprotective Goggles:US FDA/CE approved Radioprotective Thyroid Shield:US FDA/CE approved Each Each Each Each Each Radioprotectiuve Gowns :US FDA/CE approved Each Hospital Full Face Mask Non - Vented Each Hospital Full Face Mask Vented Each Hospital Nasal Mask Each Quattro FX -Full Face Mask Vented Each Mirage FX- Nasal Mask Vented Each Swift FX- Nasal Pillow Stainless Steel Meshed Gloves :- Gloves should be made of non-corrosive stainless steel, should protect hands from injury by sharp edged instruments, should allow adequate movement of fingers and ability to hold instruments while conducting postmortem examinations, should have wrist grip so that the gloves does not accidentally slip, can be easily washed ,sterilised and reused,should be available in medium & large size, should be light in weight. Each Each 38.44 Protective Goggles: - Should be able to oprotect the eyes froim splashes of blood during postmortem and examination , glass should not distort vision or colour, should have adjustable strap/hold for use by different people, should be light in weight, glasses should be sturdy, can be easily washed, sterilized and reused. Each 38.45 Protective Gowns: - Should waterproof and be able to protect the body from splashes of blood during postmortem examination, should be full sleeved and full necked, should be available in small, medium and large size with loose fitting, can be easily washed, sterilized and reused. Each 38.46 Monocomponent Insulin (Recombinant DNA Origin penfill 100 IU penfill with permanent pen Each 38.48 Monocomponent Insulin Recombinant DNA Origin,25% Insulin Lispro and 75% Insulin Lispro protamine Suspension Each 38.47 Monocomponent Insulin Recombinant DNA Origin,50% Insulin Lispro and 50% Insulin Lispro protamine Suspension Reagents & Glasswares Each 38.49 Abciximab (reopro) GP II b,IIIa,black per gm 38.51 Ab Synaptophysin per ml 38.5 Ab Neurofilament protein per gm 155 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 38.52 Abrassive per gm 38.54 Abru Seed (white & Red) per gm 38.53 38.55 38.56 38.57 38.58 38.59 38.6 38.61 38.62 38.63 38.64 38.65 38.66 38.67 38.68 38.69 38.7 38.71 38.72 38.73 38.74 38.75 38.76 38.77 38.78 38.79 38.8 38.81 38.82 38.83 38.84 38.85 38.86 38.87 Abru precatorius per gm Absolute alcohol (AR) per ml Absolute Alcohol 90%(Lab. Testing Reagent) per ml Absolute Ethanol with 5% solution of L-Napthol per ml Accelerator ( electron microscopy) per gm Acetonitrile HPLC Grade per ml Acetaldehyde 500ml per ml Acetic acid per ml 1% Acetic Acid for dressing use per ml Acetic acid(MB052) per ml Acetic anhydride per ml Acetone 500ml per ml Acetone (methanol free) per ml Acetyle salicylic acid per ml Acid Acetic Glacial Aldehyde free AR per ml Acid Acetic Glacial AR 500ml per ml Acid Ascorbic LR per gm Acid Citric Anhydrous LR per gm Acid Barbituric AR per gm Acid Fuchsin per ml Acid fuchsin per gm Acid Hydrochloric AR per ml Acid fuchsin.MS(CI-42780). per ml Acid Hydrochloric LR per ml Acid L-Tartaric AR per ml Acid Molybdic LR per ml Acid Nitric AR per ml Acid Nitric LR per ml Acid Phosphatase Test Cards per ml Acid Salicylic LR per ml Acid Sulphonilic AR per ml Acid Sulphosalicylic LR per ml Acid Sulphuric Commerial per ml Acid Sulphuric Con.AR per ml 156 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 38.88 Acid Sulphuric Con.LR per ml 38.9 Acidic Solution per ml 38.89 38.91 38.92 38.93 38.94 38.95 38.96 38.97 38.98 38.99 39 39.01 39.02 39.03 39.04 39.05 39.06 39.07 39.08 39.09 39.1 39.11 39.12 39.13 39.14 39.15 39.16 39.17 39.18 39.19 39.2 39.21 39.22 39.23 Acid Tri-chlor acetic LR per ml Aconite per gm Acridine orange per gm Acrelamide mol grade per gm Activated Charcoal AR per gm Activated charcoal – AR grade per gm Adipocere per gm Adonitol per ml Adonitol (DD- 025) per ml Adonitol per gm Aesculin per ml ADP for platelet aggregometry per gm Aesculin per gm Agar Powder extra pure (RM - 301) per gm Aesculin agar per gm Alkaline peptone water per gm Arabinose LR per gm Agarose powder per gm Afim per gm Agar Powder extra Pure (RM - 301) per gm Agar TCBS per gm Agar-Agar (Becteriological) LR per gm Agarose per gm Agarose low EEO for electrophoresis mol bio grade per gm Albert Stain A Kit per ml Albert Stain B Kit per ml Albumin per gm Alcohol Methyl (Methanol) AR per ml Alcian Blue per gm Alizarin Red per ml Alizarin red.(PH indicator.).AR. per ml Alkaline Peptone Water per ml Alkaline Phosphatase per ml Alpha feto protein (AFP) per gm 157 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 39.24 Alpha Naphthol per gm 39.26 Alpha napthyl butyrate per gm alpha-Naphthylamine Solution (R-009) per gm Alpha Naphthylamine per ml 39.25 39.27 39.28 39.29 39.3 39.31 39.32 39.33 39.34 39.35 39.36 39.37 39.38 39.39 39.4 39.41 39.42 39.43 39.44 39.45 39.46 39.47 39.48 39.49 39.5 39.51 39.52 39.53 39.54 39.55 39.56 39.57 39.58 39.59 Alpha Naphthol per ml Alpha Napthylbutyrate.AR. per ml Alpha Napthyl Phosphate per gm Alseviers solution per gm Aluminium Ammonium Sulphate AR per gm ALT per gm Aluminium Potassium Sulphate LR per gm Aluminum Chloride per gm Aluminium foil 0.3 mm thickness per roll Aluminum Sulfate per gm Aluminum Hydroxide per gm Amido black per gm 2 amino-2 methyl 1-3 pranediol per gm 2-amino-2methyl 1-3 propanediol.AR. per ml 3-amino-9-ethylcarbazole pc 3-amino propyl triethoxysilane pc 5q deletion probes for FISH pc 1xTE Solution probes for FISH per ml Amikasin (0.016-256ug/ml 28% Ammonia per strip per disc per ml Ammoniun Acetate per gm Ammonium Sulphide (Yellow) AR per gm AML1 Break apart pc Amikacin 30 ug (50discs/cartridge) Ammonia Solution per ml Ammonium persulphate per gm Ammonium Acetate AR per gm Ammonium alum AR per gm Ammonium hydroxide per ml Ammonium Hydroxide LR per ml Ammonium molybdate per ml Ammonium Nitrate AR per ml 158 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 39.6 Ammonium oxalate per gm 39.62 Ammonium sulphate per gm 39.61 39.63 39.64 39.65 39.66 39.67 39.68 39.69 39.7 39.71 39.72 39.73 39.74 39.75 39.76 39.77 39.78 39.79 39.8 39.81 39.82 39.83 39.84 39.85 39.86 39.87 39.88 39.89 39.9 39.91 39.92 39.93 39.94 39.95 Ammonium Oxalate LR per gm Ammonium Chloride AR per gm Ammonium Vanadate per gm Amoebiasis IgM ELISA per test Amoebiasis IgM ELISA per test Amoebiasis IgG ELISA per test Amox / Clav 20 / 10 ug (50discs/cartridge) per disc per strip per strip per disc per gm Amoxicillin (0.016- 256 ug / ml.) Amoxicillin (0.016- 256 ug / ml.) Amoxycillin 30 ug (50discs/cartridge) Amoxycillin powder (Pure) Amphetamine tablet pc Amphotericin B (0.002 – 32 ug/ml) per strip per disc per gm Amphotericin B 10 ug (50discs/cartridge) Amphotericin B powder (pure) Ampicillin 10 ug (50discs/cartridge) per disc per disc pc Ampicillin/Salbactum 10/10 ug (50discs/cartridge) Amylase Anaerobic Agar per gm Andrade's indicator per gm Anaerobic Fermentation media base per gm Androgen receptor pc ANF - (Latex agglutination) per test Anhydrous Sodium Sulphate per ml Anhydrous Sodium acetate per gm Anidulafungin (1µg) (50discs/cartridge) Aniline Blue per disc per ml Animine 4% (RM901) per ml Aniline blue.(water soluble) MS(CI-42780). per ml ANSA pc Anti 3D per ml Anti c (Small) per ml Anti C (Big) per ml Anti C3c per ml 159 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 39.96 Anti C3d per ml 39.98 Anti e (Small) per ml 39.97 39.99 40 40.01 40.02 40.03 40.04 40.05 40.06 40.07 40.08 40.09 40.1 40.11 40.12 40.13 40.14 40.15 40.16 40.17 40.18 40.19 40.2 40.21 40.22 40.23 40.24 40.25 40.26 40.27 40.28 40.29 40.3 40.31 Anti E (Big) per ml Anti ER per ml Anti Fya per ml Anti Fyb per ml Anti HBc (96 tests) per test Anti Hepatitis D (a & b) IgM per ml Anti HDV ELISA per test Anti Human Globulin (IgG+C3d) per ml Anti Human Globulin (IgG) per ml Anti Human Globulin (C3d) per ml Anti I (Big) per ml Anti i(small) per ml Anti IgG per ml Anti IgM per ml Anti Jka per ml Anti JKb per ml Anti K per ml Anti M per ml Anti - Melanoma ( HMB45) per ml Anti Mycloperoxidase per ml Anti N per ml Anti P1 (Goat) per ml Anti P1 (Human) per ml Anti p16INK4) per ml Anti P53 protein per ml Anti S (Big) per ml Anti s (Small) per ml Anti U per ml Anti A1 (Lectin) per ml Anti A Serum Monoclonal per ml Anti AB Serum Monoclonal per ml Anti B Serum Monoclonal per ml Anti C3 FITC per ml Anti C1q FITC per ml 160 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 40.32 Anti Cardiolipin Ab (IgA) per ml 40.34 Anti Cardiolipin Ab (IgM) per ml 40.33 40.35 40.36 40.37 40.38 40.39 40.4 40.41 40.42 40.43 40.44 40.45 40.46 40.47 40.48 40.49 40.5 40.51 40.52 40.53 40.54 40.55 40.56 40.57 40.58 40.59 40.6 40.61 40.62 40.63 40.64 40.65 40.66 40.67 Anti Cardiolipin Ab (IgG) per ml Anti CD117 per ml Anti CD15 per ml Anti Ch/Rg per ml Anti CK per ml Anti Ck (PancytoKeratin) per ml Anti Cr(1) per ml Anti Co(a) per ml Anti Co(b) per ml Anti Compliment C3 Polyclonal per ml Anti Compliment CIg Polyclonal per ml Anti Dantu per ml Anti Di(a) per ml Anti Di(b) per ml Anti Do(a) per ml Anti D IgG Monoclonol per ml Anti D IgM + IgG Monoclonal per ml Anti D IgM Monoclonal per ml Anti ds DNA Antibody per ml Anti Estrogen receptors per ml Anti Ge per ml Anti H (Lectin) per ml Anti HAV IgM ELISA per test Anti HB core antibody (IgG) ELISA per test Anti HAV IgM Strip ELISA per test Anti HB core antibody IgG (Strip ELISA) per test Anti HB core antibody IgM for Elisa per test Anti HBe Strip ELISA per test Anti HBs antibody (Strip ELISA) per test Anti HBs antibody ELISA per test Anti HCV ELISA (antibody) per test Anti HCV ELISA (Ultra) per test Anti HCV Strip ELISA (antibody) 3rd generation per test Anti IgA FITC per ml 161 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 40.68 Anti IgA Polyclonal per ml 40.7 Anti IgG Polyclonal per ml 40.69 40.71 40.72 40.73 40.74 40.75 40.76 40.77 40.78 40.79 40.8 40.81 40.82 40.83 40.84 40.85 40.86 40.87 40.88 40.89 40.9 40.91 40.92 40.93 40.94 40.95 40.96 40.97 40.98 40.99 41 41.01 41.02 41.03 Anti IgG FITC per ml Anti IgM FITC per ml Anti IgM Polyclonal per ml Anti In(a) per ml Anti In(b) per ml Anti JMH per ml Anti Jsa per ml Anti Jsb per ml Anti K (Big) per ml Anti k (Small) per ml Anti Kappa for IHC per ml Anti Kappa FITC per ml Anti Kpa per ml Anti Kpb per ml Anti Lambda for IHC per ml Anti Lambda FITC per ml Anti Lea per ml Anti Leb per ml Anti Lu(a) per ml Anti Lu(b) per ml Anti Lua per ml Anti Lub per ml Anti LW per ml Anti Mi(a) per ml Anti Microscomal antibodies per ml Anti MPO per ml Anti nuclear antibody ELISA per ml Anti Progesterone receptors (Anti PR) per ml Anti -S-100 protein per ml Antisera for Beta – hemolytic Streptococcus per ml Anti Thyroglobulin antibody per ml Anti thrombin111 assay chromogen kit per ml Anti TP IgG ELISA antibody detection per test Anti TP IgM ELISA antibody detection per test 162 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 41.04 Anti TPO antibody per ml 41.06 Anti Vimentin per ml 41.05 41.07 41.08 41.09 41.1 41.11 41.12 41.13 41.14 41.15 41.16 41.17 41.18 41.19 41.2 41.21 41.22 41.23 41.24 41.25 41.26 41.27 41.28 41.29 41.3 41.31 41.32 41.33 41.34 41.35 41.36 41.37 41.38 41.39 Anti U per ml Anti Yt(b) per ml Anti Xg(a) per ml Anti aspergillus sera -Aspergillus sera(61681) per ml Anti candida sera -Candidose Sera(61691) per ml Antigen detection kit for Meningitis (H influenza b, N meningitis A & C, S. pneumonia,GBS,E.coli) per test Antithrombin III assay chromogenic kit per ml Antilupus antibody (LCA) Apolipoprotein A-1 per ml per ml Apolipoprotein A-2 per ml APTT (Liquicillin) with Cacl2 per ml APTT reagent kit per ml Arabinose pc Aromatic Spirit Ammonia per ml Arsenomolybdate per ml Arsenic trioxide per ml Arsenous acid (As2o3) per ml ASLO (Latex agglutination) per test Asparagine (RM041) per ml ASO test per test AST pc ATCC Strains of MBL producing isolate pc Acinetobacter baumannii pc Acinetobacter luroffii pc Pseudomonas aeryinose pc ATP Sodium Salt AR per gm Auramine O powder per gm Augmentin powder per gm Auramine 'O' Powder/Rhodamine per gm Auramine 'O' Powder/Rhodamine(KO21) per gm Autoclavabale storage vials 5 ml pc Autoclavabale storage vials 10 ml pc Auto Processor Developer Pkts. (To make 19 lit. Solution) per ml Auto Processor Fixer Pkts. (To make 19 lit. Solution per ml 163 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 41.4 Autovlavable Disposable Plastic Jar 1litre 41.42 41.43 Autoclavable screw cap tube self standing (dia 15 mm, length 104 mm) Round bottom (Poly Propylene) Autoclavable micro centrifuge tube Autoclavable Biohazard plastic bag: size 10 ltr 41.45 Autoclavable Biohazard plastic bag: size 30 ltr 41.41 41.44 41.46 41.47 41.48 41.49 41.5 41.51 41.52 41.53 41.54 41.55 41.56 41.57 41.58 41.59 41.6 41.61 41.62 41.63 41.64 41.65 41.66 41.67 41.68 41.69 41.7 41.71 41.72 41.73 41.74 41.75 per ml Autoclavable screw capped plastic test tube Autoclavable Biohazard plastic bag: size 20 ltr Autoclavable Plastic colour coded containers for storing plasma in freezer Autoclavable Plastic Vial Flat Bottom, screw capped Autoclavable Plastic Vial Flat Bottom, screw capped 11.5 mm. X 53 mm. Autoclavable Plastic Vial Flat Bottom, screw capped 11.5 mm. X 53 mm. Autoclavable Tips 1000-5000ml capacity Azithromycin pc pc pc pc pc pc pc pc pc pc per ml Azithromycin per gm Azithromycin (.016-256 ug / ml.) per strip per disc per gm Azithromycin-15mcg (50discs/cartridge) Azlocillin powder Aztreonam 30 ug (50discs/cartridge) per disc per gm Azur B Bac T/ALERT FAN Aerobic (FA) pc Bac T/ALERT FAN Anaerobic (FN) pc Bac T/ALERT Mycobacteria Antibiotic Supplement (MAS) pc Bac T/ALERT Mycobacteria Process (MP) pc Bac T/ALERT Pedi Bac T (PF) pc Bac T/ALERT Restoring Fluid pc Bacitracin pc Bacitracin (8 IU & 10 IU) pc Bacitracin 0.04 units pc Bacitracin 10 units pc Bacteriological loop holder with loop (ready to use) pc Bacteriosides bile esculin agar with with kanamycin pc Bacto Agar per gm BamHI pc BamHI probes for FISH pc Barbuturic acid per gm Barium Chloride per gm Barium carbonate per gm 164 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 41.76 Barium Chloride 41.78 Barium Hydroxide AR per gm Barium Sulphate Powder I.P. per gm Barium Sulphate Enima kit single use complete pack per ml 41.77 41.79 41.8 41.81 41.82 41.83 41.84 41.85 41.86 41.87 41.88 41.89 41.9 41.91 41.92 41.93 41.94 41.95 41.96 41.97 41.98 41.99 42 42.01 42.02 42.03 42.04 42.05 42.06 42.07 42.08 42.09 42.1 42.11 per m Barium Hydroxide per ml Barium Sulphate per ml Barium Sulphate 9.5 w/v (flavoured) per ml Barium Sulphate HD 100% w/v (high density) single use pack with effervescent powder 1 litre per ml Basal Media for Decarboxylase Test ( without amino acid) per gm Basic Fuchsin 25gm per gm Bcl-2(EPOS) per ml Basic carbol faischin per ml Basal Media for Decarboxylase test (without Amino Acid) per ml Bcl-2. (Monoclonal mouse antibody to human.- Pre-Diluted per ml Bcr-abl fusion kit probes for FISH per ml BD Facs count control per ml BD Facs count reagent per ml BD Facs flow solution per ml Beaker glass (Low form) Heat resistant 2000ml pc Beaker glas (Low form) Heat resistant 1000ml pc Beaker glass (Low form) Heat resistant 500ml pc Beaker glass (Low form) Heat resistant 250ml pc Beaker glass (Low form) Heat resistant 100ml pc Beaker glass (Low form) Heat resistant 50ml pc Beaker glass (Low form) Heat resistant 25ml pc Beaker glass (Low form) Heat resistant 10ml pc Beakers Glass 1000ml pc Beakers Glass 500ml pc Beakers Glass 250ml pc Beakers Glass 100ml pc Beakers Glass50ml pc Beakers Glass25ml pc Beakers Glass 10ml pc Beakers (Autoclavable) 1000ml pc Beakers (Autoclavable) 500ml pc Beakers (Autoclavable) 250ml pc 165 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 42.12 Beakers (Autoclavable) 200ml pc 42.14 Beakers (Autoclavable) pc 42.13 42.15 42.16 42.17 42.18 42.19 42.2 42.21 42.22 42.23 42.24 42.25 42.26 42.27 42.28 42.29 42.3 42.31 42.32 42.33 42.34 42.35 42.36 42.37 42.38 42.39 42.4 42.41 42.42 42.43 42.44 42.45 42.46 42.47 Beakers (Autoclavable) 100ml pc Beakers plastic 1000ml pc Beakers plastic 500ml pc Beakers plastic 250ml pc Beakers plastic 100ml pc Bee wax per gm Beef Extract per gm Beef Extract (M806) per gm Bell jars, Size-300x350mm pc Bell jars, Size-300x400mm pc Bell jars, Size-300x450mm pc Benedic's solution Quantatitive per ml Benedicts Reagent per ml Benedicts Reagent per ml Benedict's Solution (Qualitative) LR per ml Bentonite per ml Benzakonium Chloride per ml Benzene AR per gm Benzidine powder LR per gm Benzyl Penicillin (0.002-32 ug / ml.) per strip per gm Benzene AR grade, per ml Benzidine reagent per ml Benzyl penicillin powder (pure) Beta 2 Microblobulin ELISA per test Beta HCG ELISA per test Bhilawa pc Bicart (single use) pc Bile esculin agar per gm Bile salt (Powder) per gm Bilirubin (Powder) per gm Bile salt per ml Bile salt Agar per gm Bilirubin (Pure) AR Biochemical indntification kit for Gram negative Entro bactenacae Nil fermenter 166 per ml pc Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 42.48 Biotynlated Goat anti-mouse/rabbit immunoglobulins pc 42.5 Bismarck brown.MS .CI21010 pc 42.49 42.51 42.52 42.53 42.54 42.55 42.56 42.57 42.58 42.59 42.6 42.61 42.62 42.63 42.64 42.65 42.66 42.67 42.68 42.69 42.7 42.71 42.72 42.73 42.74 42.75 42.76 42.77 42.78 42.79 42.8 42.81 42.82 42.83 Bis acrelamide mol bio grade pc Bismuth Carbonate per gm Blood agar base per gm Bismuth subnitrate per gm Blood Lancet pc Blood Culture Bottle for Automated system pc Blood Gas Quality Control 30 x 1.7ml (Level 1) per ml Blood Gas Quality Control 30 x 1.7ml (Level 3) per ml Blood Gas Quality Control 30 x 1.7ml (Level 2) per ml Blood strips for Glucose per strip pc Micro cover glass 50 x 22mm Blue star glass slide PIC - I (pkt of 50 slide) pc Blue star cover glass 75x25 mm pc Blue star cover glass 18x18 mm pc Blue star cover glass 40x22 mm pc Blue star cover glass 22x22 pc Blue star glass slide 6 mm pc Boeck and Drbohlav Locke Egg serum(LES) Media per gm Boric acid powder per gm Borex Powder AR per gm Bottle glass, wide mouth for semen analysis pc Bottle Media aluminum cap with washer 15ml Bottle reagent, Plain Narrow Mouth with flat bottom (Boro - silicate glass) Bottle reagent, Plain Narrow Mouth with flat bottom (Boro - silicate glass) Bottle reagent, Plain Narrow Mouth with flat bottom (Boro - silicate glass) Bottle top dispenser (Imp.) 0-1,,0-2, 0-5 (ml) Bottle with screw caps 30ml Bovine Albumin 22% pc pc pc pc pc Bottle with screw caps 250ml Bottle with screw caps 500ml pc pc pc -----do---- per ml Bovine Albumin Fraction - V Purified per ml Bovine haemoglobin powder soluble per gm Bovine serum albumin (powder) (RM3135-100 G) per gm Bovine serum albumin per ml 167 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 42.84 Bovine Thrombin 1000NIH units/mg of protein 42.86 Brain heart infusion broth 42.85 42.87 42.88 42.89 42.9 42.91 42.92 42.93 42.94 42.95 42.96 42.97 42.98 42.99 43 43.01 43.02 43.03 43.04 43.05 43.06 43.07 43.08 43.09 43.1 43.11 43.12 43.13 43.14 43.15 43.16 43.17 43.18 43.19 pc Brain heart infusion Agar per gm per gm BRCAI1 pc Brentamine Fast Blue B Salt per gm Brilliant Green per ml Brilliant Cresyl Blue (imported) per ml Brilliant green bile broth per gm Brillient crecyl blue per ml Brillient crecyl blue per gm Brom Phenol blue yellow per ml Brom Phenol violet per ml Bromine ampoule pc Bromocresol Green powder per gm Bromocresol purple powder per gm Bromo phenol Blue Dye powder per gm Bromo phenol Blue Dye Liquid per ml Bromocresol Green Liquid Bromocresol purple per ml Liquid per ml Bromo phenol Blue pc Bromothymol Blue powder per gm Bromo cresol purple broth base per gm Bird seed agar per gm Bromothymol Blue Liquid per ml Boeck and Drbohlav Locke Egg serum (LES) Media per gm 5 Bromo 2’ deoxyuridine B-9285 pc Brucella antigen for tune agglutination test per test Brucella selective medium per gm Buffer Tablets P H 2 LR pc Buffer Tablets P H 4 LR pc Buffer Tablets P H 7 LR pc Buffer Tablets P H 9LR pc Buffer, Preservatives < .04% pc Bunsen burner pc Burettes and Pipettes pc Burettes with stand 25 ml pc 168 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 43.2 Butanol per ml 43.22 1,3 - butylenes glycol (RM-6747) per ml 43.21 43.23 43.24 43.25 43.26 43.27 43.28 43.29 43.3 43.31 43.32 43.33 43.34 43.35 43.36 43.37 43.38 43.39 43.4 43.41 43.42 43.43 43.44 43.45 43.46 43.47 43.48 43.49 43.5 43.51 43.52 43.53 43.54 43.55 Butyl Alcohol per ml 2,3 - butylenes glycol (RM-6748) per ml C –Check (XS) L2 per ml C –Check (XS) L2 per ml C check L1 & L3 per ml C -Reactive Protein per test C1q- FITC per ml C reactive protein (quantitative) ELISA per test C3c- FITC per ml CA 125 per ml CA 15-3 per ml CA 19-9 per ml CA 242 per ml CA 72-4 per ml Caffeic acid ferric citrate test sugar(M-563) per test Calamina powder per gm Caffeine citrate per gm Calcium per gm Calcium alpha napthal phosphate AR per gm Calcium & Magnesium for Hanks solution per ml Calcium Carbonate AR per gm Calcium carbonate – AR grade per gm 0.025 Molar calcium chloride pc Calcium Chloride (Cacl2) per ml Calcium Chloride (Fused) AR per gm Calcium Nitrate AR per gm Calcium chloride( anhydrous ) per gm Camphor per gm Creatine crystals per gm Christensen urea agar base per gm Cary blair Columbia Blood Agar Base-500gm with Vaginalis Selective Supplement -5ml/25vials Columbia Blood Agar Base w/1 % Agar Chrome Agar per gm per gm per gm per gm 169 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 43.56 CHROMagar KPC 43.58 Campylobacter agar base per gm Calcoflor white per gm 43.57 43.59 43.6 pc CHROM ID ESBL (code : 43481) 20plates/pack pc Caffeic acid ferric citrate agar per gm Calibrant A: for Fully Automated Biochemistry Analyzer- 43.61 Sodium chloride - 70mm /lit per ml 43.63 Tri –tone – X – 100 < .01% per ml 43.62 43.64 Potassium chloride - 4mm/lit per ml Buffer, Preservatives < .04% per ml Calibrant A: for Fully Automated Biochemistry Analyzer-Reagent content: Sodium chloride - 70mm /litPotassium chloride - 4mm/lit Tri –tone – X – 100 < .01% Buffer, Preservatives < .04% / Calibrant B: for Fully Automated Biochemistry Analyzer- Reagent content: 43.65 Sodium chloride - 140mm /lit per ml 43.66 Potassium chloride - 4mm/lit per ml 43.68 Buffer, Preservatives < .04% per ml 43.67 Tri –tone – X – 100 < .01% per ml Calibrant B: for Fully Automated Biochemistry Analyzer-Reagent content: Sodium chloride - 140mm /litPotassium chloride - 4mm/litTri –tone – X – 100 < .01%Buffer, Preservatives < .04% 43.69 PM Kit Cuvette for ERBA XL 300 & XL 600 per ml 43.7 Calibrator ( Sysmex) per ml 43.72 Camphor. per ml 43.71 43.73 43.74 43.75 43.76 43.77 43.78 43.79 43.8 43.81 43.82 43.83 43.84 43.85 43.86 43.87 43.88 Calibrator MS9 3/S per ml Camphorata opii Tincture 400ml Campy pak plus disposable Hydrogent + Co2 generator envelop with integral palladium catalyst (Imported) per ml per ml Campylobacter & S Kirrows supplement (Imported) per gm Campylobacter supplement(Skirrovi)FD 008 per gm Campylobacter Agar Base(M994) per gm Campylobacter Supplement - I (Blaser-Wang) 5 vials packing vial Campylobacter Supplement - II(Butzler) 5 vials packing vial Campylobacter Supplement- III (Skirrow) 5 vials packing vial Campylobacter growth Supplement 5 vials packing vial Canada balsam pc Candida albicans for ATCC Strain pc Candida Tropicalis for ATCC Strain pc Candida Parapsilosis for ATCC Strain pc Candida Krusci for ATCC Strain pc Candida albicans IgA ELISA per test Candida guilliermondii ATCC 6260 pc 170 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 43.89 Candida Hi chrome agar 43.91 Candida psedotropicalis TCC 4135 43.9 43.92 43.93 43.94 43.95 43.96 43.97 43.98 43.99 44 44.01 44.02 44.03 44.04 44.05 44.06 44.07 44.08 44.09 44.1 44.11 44.12 44.13 44.14 44.15 44.16 44.17 44.18 44.19 44.2 44.21 44.22 44.23 44.24 per gm Candida medium pc gm pc Candle jar pc Capriomycin powder (Pure) per gm Carbamide pc Carbenecillin 100 ug pc Carbogen per test Carbohydrate Fermentation Disc per disc per gm Maltose Sucrose pc Trehalose pc Millibiose pc Inositol pc Xylose pc Cellibiose pc Raffinose pc Dulcitol pc Dextrose pc Carbol Fuchsin per ml Carbon Tetrachloride AR per gm Cardiac Troponin kit per kit Castor oil per ml Carbon Tetrachloride 99.8% HPLC grade per ml Carmine pc Caspofungin (5µg) (50discs/cartridge) per disc per ml Castor oil seeds Caustic soda per gm CD3 primary antibody - Pre-Diluted per ml CD5 per ml CCHFV RT-PCR kit (Mix, Enzyme/Master mix) pc CD3(EPOS) per ml CD10 primary antibody. - Pre-Diluted per ml CD10(EPOS) per ml CD10 antigen. per ml CD15 per ml 171 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 44.25 C-18 column per ml 44.27 CD20 (EPOS) per ml 44.26 44.28 44.29 44.3 44.31 44.32 44.33 44.34 44.35 44.36 44.37 44.38 44.39 44.4 44.41 44.42 44.43 44.44 44.45 44.46 44.47 44.48 44.49 44.5 44.51 44.52 44.53 44.54 44.55 44.56 44.57 44.58 44.59 44.6 CD 20 primary antibody. - Pre-Diluted per ml CD30 per ml CD34 per ml CD45 (EPOS) per ml CD45 (LCA). - Pre-Diluted per ml CD56 per ml CD 61 per ml CD68 per ml CD99 per ml CD117 per ml CD-X (Coagulation analyzer) Control per ml CD-X (Coagulation analyzer) Calibrator per ml CD-X (Coagulation analyzer) cleaning solution per ml CEA per ml Cefatoxime (0.016-256 ug / ml.) per strip per strip per disc per disc per strip per strip per disc per strip per strip per disc per disc per disc per disc per disc per strip per disc pc Cefatoxim (0.002-32 ug / ml.) Cefazoline 30 ug Cefipime 30 microgram Cefepime (0.016-256 ug / ml.) Cefepime(0.002-32 ug / ml.) Cefepime 30 ug (Imported) (50discs/cartridge) Cefeprime + cetepine + clavulanic acid (PM/PML) (0.2516/0.064 ug/ml) Cefixime 5 mcg (Imp) (50discs/cartridge) Cefoperazone 75 microgram Cefoperazone+Sulbactum disc Cefotaxime 30 microgram (50discs/cartridge) Cefotaxime + Clavulanic Acid Disc Cefotaxime/Clavulanate (0.25-16 µg/ml /4 µg/ml )(30 strips/pkd Cefotaxime/Clavulanate (30/10 µg) Cefoxitin Cefoxitin 30 ug per disc per disc per disc Cefoxitin 30 ug Cefoxitin(ugm)SD-041) 172 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 44.61 Cefperazone 75 mcg (Imp) 44.63 Cefpirome 30 ug (Imported) 44.62 44.64 44.65 44.66 44.67 44.68 44.69 44.7 44.71 44.72 44.73 44.74 44.75 44.76 44.77 44.78 44.79 44.8 44.81 44.82 44.83 44.84 44.85 44.86 44.87 44.88 44.89 44.9 44.91 44.92 44.93 44.94 44.95 44.96 per disc per strip per disc per strip per disc per disc per strip pc Cefpirome (0.016- 256 ug /ml.) Ceftazidime (0.016-256 ug / ml.) Ceftazidime 30 ug Ceftazidime clavulanic acid 30/10 mcg Ceftazidime+ Clavulanate(.004-128ug / ml.) Ceftazidinac + Ceftazidine + Clavulanic acid (Tz ITZL) 0.532/0.064/ug/ml pc Ceftazidine/Calvualnic acid (30/10ugm)discs SD-207 per disc per disc per strip per disc per disc per strip per strip per disc per gm Ceftazidime/clavulanic acid 30/10 mcg (50discs/cartridge) Ceftibuten (0.016-256 ug /ml.) Ceftibuten 30 ug (Imported) Ceftizoxime 30 mcg (Imp) Ceftriaxone (.016-256 ug /ml.) Ceftriaxone (0.002-32 ug / ml.) Ceftriaxone 30 ug (50discs/cartridge) Ceftriaxone powder (pure) Cefuroxime 30 ug Cell Clean per disc per ml Cellobiose per ml Cell pack per ml Cellobiose AR 500gm per gm D(+) Cellobiose per ml Centipede pc Centrifuge Tube plastic 1.5ml pc Centrifuge Tube plastic 2ml pc Centrifuge Tube plastic 10ml pc Centrifuge Tube plastic 15ml pc Centrifuge Tube plastic 50ml pc Centrifuge tube graduated (Autoclavable) pc Centrifuge tube (Conical bottom) 15ml pc Cephadroxil 30 ug per disc per gm Cephalexin powder (Pure) Cephalexin 30µg (50discs/cartridge) per disc per disc Cephalothin 30 ug 173 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 44.97 Cephatoxime powder (Pure) 44.99 Ceric ammonium sulphate 44.98 45 45.01 45.02 45.03 45.04 45.05 45.06 45.07 45.08 45.09 45.1 45.11 45.12 45.13 45.14 45.15 45.16 45.17 45.18 45.19 45.2 45.21 45.22 45.23 45.24 45.25 45.26 45.27 45.28 45.29 45.3 45.31 45.32 per gm Cephatoxine + ceftox + clavulanic acid 0.25-16/0.016 – per strip per gm 1ug/ml - (CT/CTL) pc Cetriaxone 30 microgram per disc per gm Cetrimide LR Cetrimide agar Changeable nichrome loop in stainless steel rod with heat resistant handle with nichrome wire loop of dia 4mm (Cap 0.01ml) per gm pc pc Chart Paper for Temparature Recording of Blood Bank Refrigetators sheet Chart Paper for Temparature Recording of Platelet agitator and Incubator sheet Chart Paper for Temparature Recording of Deep Frizers(-40,-80) sheet Chlamydia antibody IgG ab ELISA per test Chloral hydrate AR per gm Chlamydia antibody IgM ab ELISA per test Chloramphenicol powder per gm Chloramphenicol 30 microgram (50discs/cartridge) per disc per gm Chloride Chloride electrode pc Chloride sensor,4/box:CRT pc Chloroauric acid per ml Chloroform IP per ml Chloroform per ml Chloromycltin powder (pure) per gm Choloroquine di-Phosphate(Sigma Chemicals) per gm Cholesterol powder per gm Christensen urea agar base with supplement urea 40% per gm Chromic Acid 500ml per ml Chromic Acid,500gm per gm Chromium tetroxide per ml Chrom Agar for Candida per gm Chromogenic medium for culture of micro-organisms pc Chromogranin A pc Chromotrope 2R per gm Chromotropic acid per ml Chromotrope 2R (RM337) per ml 174 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 45.33 Ciprofloxacin (0.002-32 ug / ml. 45.35 Ciprofloxacin 1 mcg (Imp) 45.34 45.36 45.37 45.38 45.39 45.4 45.41 45.42 45.43 45.44 45.45 45.46 45.47 45.48 45.49 45.5 45.51 45.52 45.53 per strip per strip per disc per disc per gm Ciprofloxacin (.001-8ug / ml.) Ciprofloxacin 5 ug (50discs/cartridge) Ciprofloxacin powder (pure) Cirrhosis of liver pc CISH kit 1 for HPV high risk and EBV pc Citric acid per gm Citric acid monohydrate (C6H8O7.H2O) per gm CK pc Ck (EPOS) pc CK – MB pc Cl pc Clarithromycin (0.016-256 ug / ml.) per strip per gm Clarithromycin (Pure) Clarithromycin 15 ug (50discs/cartridge) per disc per ml Clavunate Clavula nate powder per gm Clavulanic Acid powder (Imported) Cleaning solution for Fully Automated Biochemistry Analyzer Clean Cart A Clean Cart C per ml Cleaning solution for Fully Automated Biochemistry Analyzer 45.54 Cleaning Solution Kit: Cleaning solution kit (for Na/K, Na/K/Cl, Na/K/Li Analyzers) - Code No: 2118 45.56 Clindamycin 2 microgram (50discs/cartridge) 45.55 45.57 45.58 45.59 45.6 45.61 45.62 45.63 45.64 45.65 45.66 per gm Cleaning solution for CD-X coagulation analyzer ( Diamed) per ml per ml per ml per disc pc Clot Activator 4ml glass Clot Activator 4ml plastic pc Clot Filter pc Clot Filter for MR 9 pc Clotrimazole (0.016 – 256 ug/ml) CMV antigen and monoclonal antibody conjugated CRP-CMV IgG Elisa per strip per disc per disc per test CMV IgM Strip ELISA 96 test per test Clotrimazole 10 ug (Imp) Co- Trimoxazole 25 ug ( 1.25 / 23.75 ) (50discs/cartridge) CMV IgM Elisa per test 175 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 45.67 Coagglutination Reagent 45.69 CoTrimoxazole 25 ug ( 1.25 / 23.75 ) 45.68 45.7 45.71 45.72 45.73 45.74 45.75 45.76 45.77 45.78 45.79 45.8 45.81 45.82 45.83 45.84 45.85 45.86 45.87 45.88 45.89 45.9 45.91 45.92 45.93 45.94 45.95 45.96 45.97 45.98 45.99 46 46.01 46.02 Coagulation kit along with calibrator,control,standard and other auxiliary reagents pc pc Cobaltous Sulphate AR per strip per gm Colchicin (Imp.) per ml Colcemid (Demicolcine)lyophilized dry powder per gm Colchicine 500mg per gm Colistin 10 ug (50discs/cartridge) per disc per disc per gm Colistin 50 ug Colistin powder (pure) Collection vials (autoclavable) 8ml pc Collection vials (autoclavable) 5ml pc Collection vials (autoclavable) 2ml pc Columbia blood agar base per gm Columbia blood sugar base per gm Complement C-3 (Radial Immuno diffusion quantitative with control) pc Complement C-3 with calibrators pc Complement C-4 (Radial Immuno diffusion quantitative with control) pc Complement C-4 with calibrators pc Compositum Cardamon Tincture pc Concavity slides pc Conc. Hydrochloric acid (HCl) per ml Conc. Sulphuric acid (H2SO4) per gm 2/3 N H2 SO4 per ml Conc. Nitric acid (HNO3) per ml Neutral Sulphuric Acid LR per ml Congo Red per ml Conical Flask 10ml pc Conical Flask 25ml pc Conical flask 50ml pc Conical flask 100ml pc Conical flask 250ml pc Conical flask 500ml pc Conical flask 1000ml pc Conical flask Plastic Autoclavable 500ml pc Conical flask Plastic Autoclavable 250ml pc 176 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 46.03 Conical flask glass pc 46.05 Progard TS 2 pc 46.04 46.06 46.07 46.08 46.09 46.1 46.11 46.12 46.13 46.14 46.15 46.16 46.17 46.18 46.19 46.2 46.21 46.22 46.23 46.24 46.25 46.26 46.27 46.28 46.29 46.3 46.31 46.32 46.33 46.34 46.35 46.36 46.37 46.38 Consumables for the millipore Elix 70 pc 1 micron filter pc 3 micron filter pc MX cartridge 5 μm pc 20 '' carbon cartridge pc Sanitization tablets pc Consolidated of lungs pc Consumables for the XL-600/300 pc PM kit per kit XL wash solution per ml 200-1000 μl microtips pc 100-200 μl microtips pc 5-50 μl microtips pc 1-5 ml microtips pc 200-1000 μl micropipette pc 100-200 μl micropipette pc 5-50 μl micropipette pc 2-20 μl micropipette pc Microcentrifuge tube 0.5ml pc Container for autoclaving eppendorf tubes pc Control pc Control MS9 3/S per ml Control slides for immunocytochemistry pc Convex Slides pc Cooked meat medium per gm Cooked meat medium (RCM) per gm Coplin Jars Coplin Jars Vertical & Horizontal with slide carrier (10 & 20 slides capacity Coplin jar(Vertical plastic) Coplin jar (rectangular) pc pc pc pc Coplin jar( Vertical) pc Copper Sulphate per gm Cornmeal agar per gm Corn starch per gm 177 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 46.39 Coronary atherosclerosis pc 46.41 Corynebacterium diptheriae ATCC 13812 pc 46.4 46.42 46.43 46.44 46.45 46.46 46.47 46.48 46.49 46.5 46.51 46.52 46.53 46.54 46.55 46.56 46.57 46.58 46.59 46.6 46.61 46.62 46.63 46.64 46.65 46.66 46.67 46.68 46.69 46.7 46.71 46.72 46.73 46.74 Cortisol pc Cotton Blue per gm Cotton Blue (RM901) per ml Cotton gauge Piece pc Counting Chamber (Sliver line) pc Couplin jar horizontal type Glass 4" x 2" pc Couplin jar Rectangular type Glass, 3" x 2" pc Couplin jar vertical type Glass 5" x 4" x 2" pc Cover slip round pc Cover slips for Hoemocytometer 20 X 25 mm.Thickness 0.4 mm pc Cover slips for Hoemocytometer 20 X 25 mm.Thickness 200 mm. pc Cover slips for Hoemocytometer 20 X 25 mm.Thickness 150mm pc Cover slips for Hoemocytometer 20 X 25 mm.Thickness 300mm pc Cover slips for Hoemocytometer 20 X 25 mm.Thickness 250mm pc C-myc deletion probes for FISH pc C-Peptide ELISA per test Creatinine per test C-Reactive Protein (Quantitative Test) per test Cresol Red per ml Cresyl fast violet Liquid per ml Cresyl fast violet Pwd. per gm Crimean Congo Haemorrhagic Fever Virus IgM Capture Elisa per test Cryo cube box (100) pc Crucibles with tongue pc Cryo glue per ml Cryptococcus antigen (latex Agglutination detection) per ml Crystal violet powder 25gm per gm Cupper Sulphate Powder per gm Cryogel for SLEE cryostat pc Crystal Violet liquid per ml Culture Bottle - 136N Bottles Mac Cartney Flat with aluminium screw Cap & Rubber Liner Capacity 210ml Cupric Citrate pc per gm Cuvette pc Cuvettes for Coagulometer pc 178 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 46.75 Cuvettes for CD-X coagulation analyzer ( Diamed) pc 46.77 CX 100NG/MLTHC Urine CAL pc 46.76 46.78 46.79 46.8 46.81 46.82 46.83 46.84 46.85 46.86 46.87 46.88 46.89 46.9 46.91 46.92 46.93 46.94 46.95 46.96 46.97 46.98 46.99 47 47.01 47.02 47.03 47.04 47.05 47.06 47.07 47.08 47.09 47.1 CVA en- richment pc CX Micro albumin cal pc CX/LXHBA1C Control pc CX5 Micro albumin pc Cyclo Hexamide powder (pure) pc Cycloserine powder (pure) pc Cyclin D1 pc Cyclin D1 probes for FISH pc Cylinder Graduated glass with base 100ml pc Cylinder Graduated glass with base 250ml pc Cylinder Graduated glass with base 500ml pc Cylinder Graduated glass with base 1000ml pc Cynogen Bromide pc Cysteine- activated Papain. pc Cysteine lactose electroyte deficient agar (CLED) per gm Cysticercosis ELISA per test Cyto spray for pap smear fixation pc Cytospin – cell funnel ( SLEE) pc Cytospin –filter paper – double hole/rectangular pc Cytospin –filter paper – single hole/rectangular pc Cytokeratin 7 per ml Cytokeratin (EPOS) per ml Cytokeratin 20 per ml Cytokeratin. - Pre-Diluted per ml Cytomegalovirus IgG ELISA per test Cytomegalovirus IgM ELISA per test DAPI probes for FISH pc Dark glasses for museum eye protection pc D- dimer pc D.P.X .mountant(for histology.) R.I—1.520. per ml DCA Agar per gm D-Dimer latex agglutination kit per gm DCA(M065) pc D-dimer.Readymade. per ml 179 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 47.11 DEAE Saphedex 47.13 Dehydrated Alcohol 47.12 47.14 47.15 47.16 47.17 47.18 47.19 47.2 47.21 47.22 47.23 47.24 47.25 47.26 47.27 47.28 47.29 47.3 47.31 47.32 47.33 47.34 47.35 47.36 47.37 47.38 47.39 47.4 47.41 47.42 47.43 47.44 47.45 47.46 pc Decarboxylase Broth Base per gm Deionised water (HPLC grade) per ml per ml Dengue antibody IgG Elisa per test Dengue Card Test (Rapid) per test Dengue antibody IgM ELISA per test Dengue MAC ELISA kit per test Dengue RT-PCR Kit per test Dengue IgM capture Elisa per test Dengue differentiation (Mix, Enzyme/Master mix) per test Deoxy ribonuclease test agar with toludine blue per gm DEPC biotechnology grade per ml DEPC mol bio grade pc DEPC mol bio grade probes for FISH pc Dermatophyte Test medium 500gm per gm Desicator with cover 200mm pc Desicator with cover 300mm pc Desicator with cover 150mm pc Desmin (EPOS) pc Desmin.( Polyclonal antibody.) - Pre-Diluted per ml Desoxycholate citrate agar 500gm per gm Dextrin powder per gm Dextrose 25% per ml Detection Reagent probes for FISH pc Dextrose 5% per ml Dextrose (C6H1206) per ml Dextrose powder (RM077) per gm DHEAS ELISA per test Di- sodium hydrogen phosphate12H2O.IP per gm Dextrose annalar grade pc DIDS- 4,4’disothiocyanatostilbene-2,2’disulfonic acid pc Di Thio Threitol(DTT) or 2 Mercaptoethanol. pc Dia Reptin pc Diacetyl monoxime pc Dialyser Kawasumi 1.3mm pc 180 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 47.47 Dialyser Kawasumi 1.5mm pc 47.49 Dialyser Kawasumi F4mm pc 47.48 47.5 47.51 47.52 47.53 47.54 47.55 47.56 47.57 47.58 47.59 47.6 47.61 47.62 47.63 47.64 47.65 47.66 47.67 47.68 47.69 47.7 47.71 47.72 47.73 47.74 47.75 47.76 47.77 47.78 47.79 47.8 47.81 47.82 Dialyser Kawasumi F6mm pc Dialysate System Multi Filtrate (For CRRT Machine) Code no-5016751 Dialysis Filtrate Bag 10LAD (For CRRT Machine( Code no-5029011 Diacetatehollow Fibre Dialyzer pc pc pc 3,3 diamino benzidine tetrahydrochloride powder pc 3,3 diaminobenzidine tetrahydrochloride. Liquid pc Diamond pencil for slide marking pc Diastix pc Dibasic sodium phosphate per ml Diethyl ether – AR grade per ml Diethyl Ether per ml Difco Bacto Agar Powder per gm Diluent A per ml Dihydro streptomycin powder (pure) per gm Diluent B ( Buffered ) Reag Pack per ml Diluents for primary antibody per ml 3-3 Dimethoxy Benzidine per ml Dimethyl foramide -Excela R. per ml Dimethyl Sulphoxide Lr per ml Dinitro phenyl hydrazine AR per ml 2-2 Dipyridyl per ml Diphtheria Antitoxin per ml Di-Phenyl alanine AR per ml Di-Potassium hydrogen orthe phosphate LR per ml Direct Bilirubin per ml Disodium arsenate per ml Disodium EDTA salt per gm DiSodium Hydrogen ortho phosphate per gm Disodium EDTA powder per gm Disodium hydrogen phosphate ( anhydrous) per gm DiSodium Hydrogen phosphate ( Na2 HPO4) per gm Disodium Phenyl Phosphate per gm Disposable Plastic pipette with bulb pc Disposable plastic embedding rings 1” x 1” pc 181 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 47.83 Dipotassium Phosphate per gm 47.85 Distilled water still plant 5 Litre per ml 47.84 47.86 47.87 47.88 47.89 47.9 47.91 47.92 47.93 47.94 47.95 47.96 47.97 47.98 47.99 48 48.01 48.02 48.03 48.04 48.05 48.06 48.07 48.08 48.09 48.1 48.11 48.12 48.13 48.14 48.15 48.16 48.17 48.18 Distilled water. 5Litre per ml Deionzer Water 5 Litre per ml DLC Counter / Blood Cell Counter(6/9/12 units pc DLC Counter pc DL- Alanine pc DL-Tyrosine (RM-457) pc DMEM (AT063A-1L) (for Virology Lab) pc DMSO (Dimithye Sulfoxide) per ml DMSO (Dimithye Sulfoxide) AR Grade per ml 20 bp DNS ladder pc 100 bp DNA ladder pc 100 bp DNA ladder probes for FISH pc DNA extraction kit(column based) pc DNA extraction kit(column based) probes for FISH pc DNA extraction kit for Tissue and blood pc DNA ligase pc DNA ligase probes for FISH pc DNA loading buffer pc DNA loading dye pc DNA loading dye probes for FISH pc DNA & RNA purification kits probes for FISH pc DNA loading dye 6X 1ml pc Loading Dye for PCR pc DNPH pc dNTP dNTPs dNTPs probes for FISH pc pc 100 millimolar each (0.5ml) per ml Dodeca - Tungstophosphoric acid per ml Dot EIA for IgM & IgG antibody to salmonella typhi per ml Doxyline pc Doripenem (10 µg) (50discs/cartridge) per disc per disc pc Doxycycline 30 ug (50discs/cartridge) DPBS (1X) w/ Ca & Mg (TL1006) DPBS (1X) w/o Ca & Mg (TL10023) pc 182 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 48.19 DPX Mountant per gm 48.21 Drabkin’solution. per ml 48.2 48.22 48.23 48.24 48.25 48.26 48.27 48.28 48.29 48.3 48.31 48.32 48.33 48.34 48.35 48.36 48.37 48.38 48.39 48.4 48.41 48.42 48.43 48.44 48.45 48.46 48.47 48.48 48.49 48.5 48.51 48.52 48.53 48.54 DPX Mountant per gm Dramme Measuring glass pc Dry Citrasate Advance formulation pc Dry Citrasate Advance formulation Potassium free pc Dry Heavy Chemical Indicator pc DT Calibrator Kit pc DT Control I/II pc DT Pipette pc DT Printer Paper pc DT Tips pc DTE Pipette pc DTE Ref fluid pc Dual Cups (DT) pc Dubos broth base per gm Dubosoleic agar base per gm Dulcitol pc Dulcitol (DD - 003) per ml Dulcitol 500 gm per gm Dulcitol with phenol red indicator per ml Durham's tube pc EBSS (1X) (TL1002) pc EBSS (10X) (TL1020) pc E Strips for MBL per strip pc E Test Storage tubes EA 36 Readymade per ml Eagles minimum essential medium per gm Ecchinococcus granuloses ELISA per test EBV PCR kit probes for FISH pc eCheck- control ( Sysmex) 1, 2 & 3levels per ml EcoRI restriction enzyme pc EcoRI restriction enzyme probes for FISH pc EDTA IM Solution per ml EDTA AR per gm EDTA -- AR grade per gm 183 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 48.55 EDTA Di Potassium Salt LR per gm 48.57 EDTA Powder (K+) (RM678) per gm 48.56 48.58 48.59 48.6 48.61 48.62 48.63 48.64 48.65 48.66 48.67 48.68 48.69 48.7 48.71 48.72 48.73 48.74 48.75 48.76 48.77 48.78 48.79 48.8 48.81 48.82 48.83 48.84 48.85 48.86 48.87 48.88 48.89 48.9 EDTA Powder (Tri Potassium) per gm EDTA Vacutainer sodium citrate vial pc EDTA Vacutainer 2ml k2 pc EDTA Vacutainer 4ml pc EDTA disodium dehydrate per gm EGFR pc EGFR amplification probes for FISH pc Egg albumin powder per gm Egg albumin.(Flakes.). per gm Electrophoresis apparatus SAS 1 pc Elio pc ELISA Kit for AFP per test ELISA Kit for anti-Joe per test ELISA Kit for ANA per test ELISA Kit for anti-Smith per test ELISA Kit for CA-125 per test ELISA Kit for C-ANCA per test ELISA Kit for CEA per test ELISA Kit for DsDNA per test ELISA Kit for G6PD per test ELISA kit for Malaria Detection per test ELISA Kit for P-ANCA per test ELISA Kit for PSA per test ELISA kit for syphilis Detection per test ELISA Kit for βHCG per test Elisa plate pc Elisa plate with detachable wells pc Elisa plate with round bottom wells pc Eliza kit for Anti phospholipid acid body per test EMA (EMEM) with earl salt L-Glutamine & 35 mm. Hepes buffer with sod. Bicarbonate Embedding Tray 15x15mm Embedding Tray 24x24mm per ml pc pc pc Embedding Tray 7x7mm pc 184 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 48.91 Empty racks for blue tips pc 48.93 Empty racks for white tips pc 48.92 48.94 48.95 48.96 48.97 48.98 48.99 49 49.01 49.02 49.03 49.04 49.05 49.06 49.07 49.08 49.09 49.1 49.11 49.12 49.13 49.14 49.15 49.16 49.17 49.18 49.19 49.2 49.21 49.22 49.23 49.24 49.25 49.26 Empty racks for clear tips pc Empty racks for yellow tips pc Enamel print measure pc Enterococcus faecalis ATCC 29212 pc Eosin (Powder or crystals) 25gms per gm Eosin yellow per gm Eosin spirit solution per ml Eosin yellow per ml Ependorf tubes (poly propylene) 0.5 ml pc Ependorf tubes (poly propylene) 1.5ml pc Ependorf vial pc Ephedrine for platelet aggregometry pc Ertapenem (10 µg) (50discs/cartridge) Erythromycin (0.125- 64 ug/ml) Erythromycin 15 ug 50discs/cartridge Erythromycin 5 ug Esbach’s Albuminometer Esbach's Albuminometer Tubes for 24 hrs. Urinary Protein 150 x 15 mm Escherichia coli ATCC 25922 Escherichia coli ATCC 35218 per disc per strip per disc per disc pc pc pc pc ESR Cartridge for roller 20 machine pc ESR Cartridge for roller 20 machine pc ESR pipette pc ESR stand (3 & 6 tube) pc Estradiol pc Estrogen receptor clone 1D5 pc Estrogen receptors. - Pre-Diluted pc Ethambutol (EMB) pc Ethambutol 7.5 kit pc Ethambutol (0.016-256 ug/ml) Ethambutol powder (pure) per strip per gm Ethanol – AR grade per ml Ethanol AR 500ml per ml Ethanol absolute per ml 185 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 49.27 Ether 49.29 Ether Petroleum 60o-80o C AR 49.28 49.3 49.31 49.32 49.33 49.34 49.35 49.36 49.37 49.38 49.39 49.4 49.41 49.42 49.43 49.44 49.45 49.46 49.47 49.48 49.49 49.5 49.51 49.52 49.53 49.54 49.55 49.56 49.57 49.58 49.59 49.6 49.61 49.62 per ml Ether Petroleum 40o-60o C AR per gm Ether Petroleum per ml per gm Ether Solvent (Diethyl Ether) per ml Ethidium bromide per gm Erhidium beomide solution Biotechnology grade per ml Ethidium Bromide Solution per ml Ethionamide (0.016-256 ug / ml.) Ethionamide powder (pure) per strip per gm Ethyl Alcohol AR 99.9% per ml Ethyl Alcohol 95% per ml Ethyl alcohol 70% per ml Ethylene dichloride per ml Ethylene glycol monomethyl ether per ml Evan's Blue per ml Evan’s blue per gm Extract glycerrhiza powder per gm Factor deficient plasmas b) Factor V per ml External Quality control reagents FOR hematology per ml Factor deficient plasmas a) Factor II per ml Factor deficient plasmas c) Factor VII per ml Factor deficient plasmas d) Factor VIII per ml Factor deficient plasmas e) Factor IX per ml Factor deficient plasmas f) Factor XII per ml Factor deficient plasmas f) Factor 11 per ml Factor VIII related antigen per ml Fast blue BB (IMP) per ml Fast blue BBN per ml Fast blue RR per ml Fast garnet GBC (IMP) per ml Fast green (BBL) RM4266 per ml Fast green (FCF) per ml Fast Plague TB – RIF per ml Fast Plague TB Rapid detection system 5 per ml Fast violet B salt per gm 186 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 49.63 Fast-garnet GBC salt per gm 49.65 Fe per gm Fehlings Solution B per ml 49.64 49.66 49.67 49.68 49.69 49.7 49.71 49.72 49.73 49.74 49.75 49.76 49.77 49.78 49.79 49.8 49.81 49.82 49.83 49.84 49.85 49.86 49.87 49.88 49.89 49.9 49.91 49.92 49.93 49.94 49.95 49.96 49.97 49.98 Fauchets reagents per ml Fehlings Solution A per ml Female Spike Adapter (For CRRT Machine) Code no-5016351 pc Ferric Ammonium Sulphate per gm Ferric Chloride acqueous per gm Ferric Citrate per gm Ferric Chloride per ml Ferric Chloride anhydrous per gm Ferritin ELISA TEST per test Ferrous Sulphate per gm Ferrous ammonium sulphate AR per gm Fetal Calf serum per ml Fetal Bovine Serum (RM1112) per ml Fetal Bovine Serum (FBS) per ml Fevicol (glass adhesive) pc Fibrinogen assay per test Fibrinogen latex agglutination per test Fibrinogen FITC per test Ficoll Type 400 (RM885) pc Filter for eliza read Filter paper Filter paper pc (Round) pc (ordinary) pc Filter paper qualitative 11cm pc Filter paper (Chart) sheets pc Filter pore size 0.33um pc Filter paper chromatography grade (1) 46 x 57 cm. pc Filter paper chromatography grade (3) 46 x 57 cm pc Filter paper large (fine quality) Size: 46 cm x 57 cm. pc Filter Paper (11 cm. Dia.) pc Filter Paper (12.5 cm. Dia.) pc Filter Paper (15 cm. Dia.) pc Filter Paper (18.5 cm. Dia.) pc Filter paper Whatman No 1 (9 cm dia) pc 187 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 49.99 Filter paper Whatman 903 pc 50.01 Fite staining for acid fast bacilli ( ready made) pc 50 50.02 50.03 50.04 50.05 50.06 50.07 50.08 50.09 50.1 50.11 50.12 50.13 50.14 50.15 50.16 50.17 50.18 50.19 50.2 50.21 50.22 50.23 50.24 50.25 50.26 50.27 50.28 50.29 50.3 50.31 50.32 50.33 50.34 Finit pc Fitkari white Fl 70 solution Flask Boiling flat bottomed glass 100ml Flask Boiling flat bottomed glass 500ml Flask Boiling flat bottomed glass Flask Boiling flat bottomed glass Flask Boiling flat bottomed glass pc pc pc 250ml pc pc 1000ml pc 2000ml pc Flask conical glass (Narrow mouth) 25ml Flask conical glass (Narrow mouth) Flask conical glass (Narrow mouth) Flask conical glass (Narrow mouth) Flask conical glass (Narrow mouth) pc 100ml pc 250ml pc 500ml pc 1000ml pc Flask Volumetric glass (with stopper) 500ml pc Flask Volumetric glass (with stopper) 250ml pc Flat Bottom Flask 1000ml pc Flat Bottom Flask 500ml pc Flat Bottom Flask 250ml pc Flat Bottom Flask 100ml pc Flat Bottom Flask 50ml pc 0.2ml flat cap PCR tubes pc 0.65ml Flat cap PCR tube pc Flagellar stain RYU pc Flourescein Sodium Corneal Staining Strips per strip pc Flow clean for semi tubes Fluconazole (0.016 – 256 ug/ml) per strip per disc per disc per gm Fluconazole 10 ug Fluconazole 25 microgram (50discs/cartridge) Fluconazole power (Pure) Flucytosine pc Fluid Warming Cassette - WF250 pc Fluid Warming Cassette - WF100 pc Fluid thioglycolate medium per gm Fluorscein conjugated sera C3 per ml 188 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 50.35 Fluorscein conjugated sera Fibrinogen per ml 50.37 Fluorscein conjugated seraIgA per ml 50.36 50.38 50.39 50.4 50.41 50.42 50.43 50.44 50.45 50.46 50.47 50.48 50.49 50.5 50.51 50.52 50.53 50.54 50.55 50.56 50.57 50.58 50.59 50.6 50.61 50.62 50.63 50.64 50.65 50.66 50.67 50.68 50.69 50.7 Fluorscein conjugated sera IgG per ml Fluorscein conjugated seraIgM per ml Foetus at 12 weeks gestation per ml Foetus at 20 weeks gestation per ml Foetus at 36 weeks gestation per ml Foetus at 4 weeks gestation for X-Ray (high density) Liquid Suspensions of barium Sulphate I.P. (high density) Fok I & NlaIII restriction enzyme Foreign body in trachea per ml pc pc pc Formaidehyde (37-41%) per ml 37% Formaldehyde. AR. per ml Formaldehyde Tablet pc Formamide AR perg Formic acid per ml Formic acid per gm Formaldehyde Solution per ml Fouchet’s reagent(for bile pigment.). pc Fouchets reagents pc Free Beta HCG ELISA per test Fructose with phenol red indicator per ml Fungal Broth per gm Fructose pc FSH pc Funnel glass, plain long stem 50mm dia pc Funnel 75mm dia pc Funnel 100mm dia pc Funnel 25 mm pc Funnel 50 mm pc Funnel 500 ml pc Funnel 250 ml pc Furaxone 100 x 50 ug 50discs/cartridge per disc per disc pc Fusidic acid 30 mcg & 10 mcg 50discs/cartridge G6-PD kit Galactose pc 189 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 50.71 D(+) Galactose 50.73 Galactose with phenol red indicator 50.72 50.74 50.75 50.76 50.77 50.78 50.79 50.8 50.81 50.82 50.83 50.84 50.85 50.86 50.87 50.88 50.89 50.9 50.91 50.92 50.93 50.94 50.95 50.96 50.97 50.98 50.99 51 51.01 51.02 51.03 51.04 51.05 51.06 pc Galactose -AR per gm Gas pack envelopes (H2 + CO2 with integral catalyst attached with 100 dryanaerobic indicators included (Imported) Gas pack plus bulk kit (Imported) Gaspak System per gm pc pc pc Gatiflexacin powder (Pure) per gm Gatifloxacin 5 ug 50discs/cartridge per disc pc Gauge saver GC medium base/difco per gm Gelatin per gm GC supplements with antibiotics pc Gelatin Agar per gm Gelatin sheets high grade pc Gelatin stab agar per gm Gentamicin (.008-128ug / ml.) per strip per disc per disc per strip per disc per gm Gelatin Tube pc Gentamicin 10 ug 50discs/cartridge Gentamicin 120 mcg 50discs/cartridge Gentamycin (0.064-1024 ug / ml.) Gentamycin 10ug Gentamycin powder Gention Violet per ml GFAP pc GGT pc Giemsa powder per gm Giemsa's Stain powder per gm Glacial Acetic acid(aldehyde free) per ml Giemsa's Stain per ml Glacial acetic acid AR per ml Glass airway for water seal pc Glass beads 4 mm to 8 mm dia. pc Glass beads 5mm diameter pc Glass marking pen pc Glass petridish size 150 mm dia pc Glass pipette 1 ml pc 190 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 51.07 Glass Pipette(2ml) pc 51.09 Glass pipette 10 ml pc 51.08 51.1 51.11 51.12 51.13 51.14 51.15 51.16 51.17 51.18 51.19 51.2 51.21 51.22 51.23 51.24 51.25 51.26 51.27 51.28 51.29 51.3 51.31 51.32 51.33 51.34 51.35 51.36 51.37 51.38 51.39 51.4 51.41 51.42 Glass pipette 5 ml pc Glass Pipette 20ml pc Glass pipette 25 ml pc Glass rods 8 mm x 1 mtr pc Glass slides (Microscope) 75mm x 25mmx1.45mm. pc Glass stirrer pc Glass tank pc Glass test tubes 10 x 75 mm pc Glass test tubes 12 x 100 mm pc Glass test tubes 12 x 75 mm pc Glass test tubes 15 x 125 mm pc Glass test tubes 18 x 150 mm pc Glass vial with rubber stopper pc D(+) Glucose Monohydrate LR pc Glucose pc Glucose AR per gm Glucose Phosphate Broth per gm Glucose powder pkt ISO per gm Glucose phosphate broth (MR VP broth) per gm Glucose phosphate Peptone water per gm Glucose reagent IP pc Glucose -AR per gm Glutaradehyde 25% LR per ml Glutamine pc Glutaraldehyde 2.5% per gm Glycerin ( For patient use only) per ml Glutathione oxidised AR per gm Glycerol per gm Glycerol, AR Grade per ml 85% Glycerol A.R. per ml Glycerol 99.9% pure per ml Glycerol (Saturated) (RM1027) per ml Glycine MB grade per gm Glycogen pc 191 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 51.43 Glycolytic inhibition 51.45 Gold Chloride yellow 51.44 51.46 51.47 51.48 51.49 51.5 51.51 51.52 51.53 51.54 51.55 51.56 51.57 51.58 51.59 51.6 51.61 51.62 51.63 51.64 51.65 51.66 51.67 51.68 51.69 51.7 51.71 51.72 51.73 51.74 51.75 51.76 51.77 51.78 pc Gold Chloride per gm per gm Gomori Methenamine Silver Stain (GMS) kit pc Gram stain per gm Griseofulvin (10 µg) (50discs/cartridge) Growth Hormone ELISA per disc per test GMS stain (Gomori Methanamine Silver) per gm Gruft Mycobacterial supplement (FD-053) per test Guanidinum thiocynate sodium citrate pc Guanidium iso thiocynate biotechnology grade pc Gum Acacia pc Gupti pc H. Pylori Card test per test H.C.V. (Flavicheck) per test H- pyloric per test H.C.V. Rapid test ( 30 test) per test H.D. supplement for Haemophilus duereyi per test Haematocrit tube pc Haematoxylin per gm Haematoxylin.MS. per ml Haematoxylin & Eosic (powder) per gm Haematoxylin monohydrate (MS) per ml Haemin pc Haemocytometer(Neubure chamber) pc Haemocytometer coverslip pc Haemo Cue Cassette pc Haemodylasis Blood Tubing set Biofeg (Kawasumi) pc Haemodialysis Acetate Fluid per ml Haemoglobin powder per gm Haemopericardium pc Haemophilus influenzae ATCC-49766 pc Haemospot test per gm Haemospot.Ready made. per ml Hardener 964 pc Hardener Bottle pc 192 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 51.79 Harr julapha 51.81 Hb reference fliud MS 9 3/S 51.8 51.82 51.83 51.84 51.85 51.86 51.87 51.88 51.89 51.9 51.91 51.92 51.93 51.94 51.95 51.96 51.97 51.98 51.99 52 52.01 52.02 52.03 52.04 52.05 52.06 52.07 52.08 52.09 52.1 52.11 52.12 52.13 52.14 pc Hartal pc per ml Hb Pipette (with rubber tube & mouth piece) (Imp) pc Hb Tube 1. (Square) pc Hb Tube 11. (Round) pc HBe Ag (Hepatitis e antibody) ELISA per test HBs Ag (Latex agglutination) per test HBeAg Strip ELISA per test HBs Ag ELISA per test HBs Ag Strip ELISA 96 test per test HbsAg (Card Test) per test HBsAg ELISA(Ultra) per test HbsAg Rapid Detection Test Kit per test HBSS (10X) (TS1021) pc HBSS (TS1003) pc HBSS (TS10033) pc HBV pc Hb variant calibrator(HPLC) pc Hb variant primer(HPLC) pc Hb Variant control(HPLC) pc Hb variant calibrator (HPLC) pc HCG card test per test HCG ELISA (Total) per test HCl pc HCV Dot Test (strip test) per test Heamatoxilin powder (Crystal or Power) 5gm per gm HDL-Cholesterol pc Hemoglobinometer pc Hemolytic Streptococcus Group A T – Typing Antisera pc Hemometer pc Hep - Alert B pc Heparin dry powder per gm Heparin sodium 3ml glass pc Heparin sodium 3ml plastic pc Heparin sodium 3ml quantum 100"s pc 193 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 52.15 Heparin solution 5000Iu/ml( phenol and benzyl alcohol free) 52.17 Hepatitis E Virus IgM Strip ELISA 52.16 52.18 52.19 52.2 52.21 52.22 52.23 52.24 52.25 52.26 52.27 52.28 52.29 52.3 52.31 52.32 52.33 52.34 52.35 52.36 52.37 52.38 52.39 52.4 52.41 52.42 52.43 52.44 52.45 52.46 52.47 52.48 52.49 52.5 per ml Hepatitis E Virus IgM per test per test Heperinised Capillary tube pc Heparinised vial (Vacutainer) pc Hepes HEPES buffer ( N-2- hydroxy ethylpiperazine n'2- ethane sulfonic acid) Heppurate disc Her/neu pc pc per disc per ml Herpes II antigen detection kit by Strip ELISA per test Herpes type II IgM Strip ELISA per test Herpes II antigen detection kit ELISA per test Herpes type II IgM with RF Control ELISA per test Herpes simplex I IgM Strip ELISA 96 test per test Herpes simplex II IgM Strip ELISA 96 test per test iv. Herpes simplex 1&2 per test iv. Herpes simplex 1&2 IgM per test Hexa methelene teramine pc HHV8 PCR kit probes for FISH pc HinDIII pc HinDIII probes for FISH pc Hippurate Broth per gm Hippurate disc 50discs/cartridge Hiss’s serum sugar media (Glucose) per disc per gm Hiss’s serum sugar media (Sucrose) per gm Hippurate Hydrolysis Broth per gm Hiss’s serum sugar media (Lactose) per gm Hiss’s serum sugar media (mannitol) per gm Hugh-Leifson’s Oxidation Fermentation media per gm Hiss' Serum Sugar media base per gm Histopaque-1077 per ml HIV Card test per test HIV I & II antigen & antibody detection kit ELISA(4th Generation) per test HIV I & II antibody detection kit ELISA per test HMB - 45 - Pre-Diluted per ml Hoechst stain sol B-2883 pc 194 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 52.51 Honeycomb appearance in liver pc 52.53 Horseshoe kidney pc 52.52 52.54 52.55 52.56 52.57 52.58 52.59 52.6 52.61 52.62 52.63 52.64 52.65 52.66 52.67 52.68 52.69 52.7 52.71 52.72 52.73 52.74 52.75 52.76 52.77 52.78 52.79 52.8 52.81 52.82 52.83 52.84 52.85 52.86 Horse serum (Irradiated) pc HPV HPTLC plates (silica gel 60 F 254 coated on alluminium foil 20x20 cm) HPTLC plates (silica gel 60 F 257 coated on alluminium foil 20x20 cm) HPLC-(Hb variant) reagent full set pc pc pc pc HSV I IgM Strip ELISA per test Human AB serum per ml Hugh Leifson's media per gm Hyaluronidase pc Hyaluronidase Lyophilised pc Hybridization chamber probes for FISH pc Hybridization solution probes for FISH pc Hydrochloric Acid Solution 1N (TCL003) (for Buffer maintenance) per ml 0.1 N KMnO4 per ml 0.1 N H2SO4 (95%) per ml 0.1 N HNO3 (65%) per ml Hydrochloric Acid per ml Hydrochloric acid AR grade per ml Hydrochloride solution per ml Hydrocyanic acid per ml Hydrogen peroxide per ml Hydrogen peroxide 3% per ml Hydrogen peroxide 30% AR per ml Hydroquinone per ml Hydroquinone crystal photography quality. per ml Hydroxy propylmethyl cellulose 2% (Viscoelastic) per ml Hypochlorite solution per ml Hypochlorite solution 1% per ml Icotonica Dia-diluent for Hematology Analyzer (Logotech) per ml ID Diluent 2 per ml ID Grouping + Reverse Card pc ID IgG card pc ID Liss Coombs Card pc ID NaCl Card pc 195 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 52.87 IfG- FITC pc 52.89 Iga ( ISO) pc 52.88 52.9 52.91 52.92 52.93 52.94 52.95 52.96 52.97 52.98 52.99 53 53.01 53.02 53.03 53.04 53.05 IgA-FITC pc IgE pc IgE-FITC pc IgM capture ELISA for Scrub typhus pc IgM- FITC pc Imidazole (IMP) pc Imipenem 10 microgram 50discs/cartridge per disc per strip per gm Imipenem (0.002-32 ug /ml.) Imipenem powder (pure) Imipenem(.004-128ug / ml.) per strip per strip per disc per strip per disc per ml Imipenem/Cilastin (0.004-128ug / ml ) ( 30 strips/pkd Imipenem/Cilastin (10/10 µg) Imipenem/EDTA (4-256/1-64µg/ml) Imipenem/EDTA discs (10/750 µg) Immersion oil (Cedar wood oil) 30ml Power block immunohistochemistry pc 53.06 Immunostaining ER/PR kits for formalin fixed paraffin embedded tissue sections with reagent capacity for 50 test for each antibody. Imipenem+ EDTA (4-256/1-64 ug/ml) per test 53.08 Indian Ink per ml 53.07 53.09 53.1 53.11 53.12 53.13 53.14 53.15 53.16 53.17 53.18 53.19 53.2 53.21 53.22 India Ink Stain Indole acetate disc per strip per ml per disc per ml Inositol Inositol Ar per gm Insulin per ml Inositol with phenol red indicator per ml Insulin with phenol red indicator per ml Intensifying Screen Cleaning Solution Internal Filling Solution: Internal filling solution for Easylyte -Code No: FECIN0009 Intracranial haemorrhages Itraconazole (0.002-32 µg/ml) 30 strips/pkd per ml per ml pc per strip per disc pc Itraconazole (10µg) (50discs/cartridge) Inosine Inulin pc Inulin AR pc 196 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 53.23 Inulin 53.25 Iodine Pellets 53.24 53.26 53.27 53.28 53.29 53.3 53.31 53.32 53.33 53.34 53.35 53.36 53.37 53.38 53.39 53.4 53.41 53.42 53.43 53.44 53.45 53.46 53.47 53.48 53.49 53.5 53.51 53.52 53.53 53.54 53.55 53.56 53.57 53.58 per ml Iodine Crystal per gm Iodine per gm per gm Iodine powder per gm Iodine Resublime Powder per gm Iodine Solution per ml Iron Alum pc IPTG AR pc ISE cal-3 solution per ml ISE wash 2 solution per ml ISE cal -4 solution per ml Isoamyl alcohol AR per ml Isoamyl alcohol – AR grade per ml Iso Enzyme Calibrator Kit pc Isoflux MS 9 3/S pc Isoniazide (0.016-256 ug / ml.) per strip per gm Isoniazide powder (pure) Isopropyl alcohol(R R) per ml Isopropyl 70% alcohol sterile,single disposal swabs pc Itra Colazole (0.016 – 256 ug/ml) per strip per disc pc Itra Conazole 10 ug (Imp) I.U.I kit sperm wash Jamalghota seeds pc Jenner Powder per gm K+ pc K-3 EDTA vacutainer pc K-3 EDTA vacutainer pc K-3 EDTA vacutainer pc K-3 EDTA vacutainer pc Kachur pc Kala Nag pc Kaladana pc Kanamycin (0.016-256 ug/ml) per strip pc Kanamycin 1 mcg (IMP) Kanamycin 30 mcg (IMP) 50discs/cartridge per disc 197 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 53.59 Kanamycin powder (pure) 53.61 Kappa light chain 53.6 53.62 53.63 53.64 53.65 53.66 53.67 53.68 53.69 53.7 53.71 53.72 53.73 53.74 53.75 53.76 53.77 53.78 53.79 53.8 53.81 53.82 53.83 53.84 53.85 53.86 53.87 53.88 53.89 53.9 53.91 53.92 53.93 53.94 per gm Kaolin powder per gm pc Kappa light chain - FITC pc Karihari pc Ketoconazole (0.002 – 32 ug/ml) per strip per gm Ketoconazole powder (Pure) Ketoconazole 10 ug per disc pc Ki67 (mib) Kit for Identification of mac A gene for MRSA pc Kligler Iron Agar per gm Kovac's indole reagent per ml Koser’s Citrate Broth per gm Krait pc Kukri pc Kupferberg T.V. Broth base per gm L - Glutamine AR per gm L –Cysteine Hydrochloride AR per gm 5% Solution of L-Napthol in Absolute Ethanol - 500ml per ml L- Arabinose per gm L –Cysteine Hydrochloride (0.5M:C3H7NO2S.HCL) per gm L(+)-tartaric acid per gm L.J. Medium Slant(SL001) pc L.D.H. pc L.J. Medium Slant pc Lab Site Leucocyte Filter pc Labels for cryogenic storage white 1.28”x0.5” pc Labolene (Lab detergent) LR per ml Lactate Ringer per ml Lactic acid per ml Laceration of Liver pc Lactate per ml Lactic Acid (RM243) per ml lactometer pc Lactophenol Cotton Blue per ml Lactose pc 198 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 53.95 D(+) Lactose Monohydrate pc 53.97 L-amino acid pc 53.96 53.98 53.99 54 54.01 54.02 54.03 54.04 54.05 54.06 54.07 54.08 54.09 54.1 54.11 54.12 54.13 54.14 54.15 54.16 54.17 54.18 54.19 54.2 54.21 54.22 54.23 54.24 54.25 54.26 54.27 54.28 54.29 54.3 Lambda light chain pc Lancets pc Lancets steel disposable sterile pkt of 100-Tissue culture flask - pc 25 sq.cm length area flask centered neck pc 75 sq.cm flask centered neck pc L-Arbinose LR per gm L-Arginine HCL per gm L-Arginine Monohydrochloride pc L-Aspargine LR per gm L-Lysine 100 gm per gm Lead acetate pc Lead Acetate paper pc Lead acetate – AR grade per gm Lead citrate pc Lead Nitrate pc Leishman Stain per ml Leishman Stain powder per gm Leoginella agar base per gm Leishman Stain per ml Leisman powder per gm Leoginella broth supplement per gm Levofloxacin (0.002-32 ug /ml.) Levofloxacin (Pure) Levofloxacin 5 ug ( Imported) LH per strip pc 50discs/cartridge per disc pc LIA Media pc Libolene. per ml Light Green per gm Light green SF.CI-42095. per ml Light Green SF per ml Light Magnesium Carbonate Linco T Suppiement (Linocmycin, colistin, Amphotericin, Trimethoprin) Lincomycin 2 ug Linezolid 30 mcg (Imp) 50discs/cartridge 199 pc pc per disc per disc Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 54.31 Linezolid (0.016-256ug/ml) 54.33 Liquicillin with calcium chloride. per ml Liquid paraffin ( light ) per ml 54.32 54.34 54.35 54.36 54.37 54.38 54.39 54.4 54.41 54.42 54.43 54.44 54.45 54.46 54.47 54.48 54.49 54.5 54.51 54.52 54.53 54.54 54.55 54.56 54.57 54.58 54.59 54.6 54.61 54.62 54.63 54.64 54.65 per strip pc Lipoprotein (A) Liquid paraffin ( heavy ) per ml Liquid Nitrogen per ml Liquid Phenol per ml Liquiplastin per ml Liquor Ammonia per ml Listeria broth per gm Listeria identification agar per gm Lithium sensor, 3/bx:CRT pc Lithium carbonate.AR per gm Lithium carbonate AR grade per gm Litmus paper blue pc Litmus paper red pc L-Napthalamine pc L-Pyrrolidonyl. ß-napthylamide pc L-Lysine pc L-Lysine dihydrochloride pc L-Mold pc L-Mold (brass) pc L-Moulds 37x25x15 mm (pair) pc L-Moulds 50x25x15 mm (pair) pc L-Moulds 75x25x15 mm (pair) pc L-Napthol per ml L-Napthol per gm L-Ornithine dihydrochloride pc Loeffler’s Alkaline Methylene Blue pc Loeffler’s Serum slope per ml Lomifloxacin 10 ug per disc per gm Lowenstein Jensen base (L.J Media) M-162 Lowenstein Jensen base (L.J Media) M-162 Lowenstein jensens’s medium with antibiotics bottle with media i. ii. Streptomycin 5 ug/ml per ml pc Streptomycin 50ug/ml pc 200 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 54.66 iii. 54.68 54.67 54.69 54.7 54.71 54.72 54.73 54.74 54.75 54.76 54.77 54.78 54.79 54.8 54.81 54.82 54.83 54.84 54.85 54.86 54.87 54.88 54.89 54.9 54.91 54.92 54.93 54.94 54.95 54.96 54.97 54.98 54.99 55 55.01 INH 1ug/ml pc v. Rifampcin 20 ug/ml pc vii. Rifabutin 0.5 ug/ml iv. vi. viii. ix. INH 5 ug/ml Rifampcin 40 ug/ml xii. Kanamycin 30 ug/ml xiv. pc pc pc Amikacin 674 ug/ml pc pc Ciprofloxacin 12.5 ug/ml pc Para-Amino-Salicylic acid 2.5 ug/ml xv. Pyrazinamide (AT PH-5.5) 50 ug/ml xvii. Clarithromycine 8 ug/ml xvi. pc Ethambutol 10 ug/ml Ethionamide 20 ug/ml xiii. pc Ethambutol 2 ug/ml x. xi. pc pc pc D-cyclocerine 30 ug/ml pc pc Lowenstien Jensen medium pc Lowenstein jensens’s medium with pyrovate media Lowenstein jensens’s medium with thiophene media -2- carboxylic acid 5 ug/ml L-Rhamnose monohydrate(RM-062) Lupus anti coagulant (LCA) pc pc pc pc Luria Bertani (Imp) pc Lysine pc Lysine Decarboxylase (M376) pc Lysine(M-330) pc Lysol (Disinfectant) Cresol and Soup Solution per ml Mac Cartney bottles For Microbacteria culture Mac Cartney bottles Flat bottom with aluminium screw Cap & Rubber Liner. 20ml capacity pc pc Mac Conkey Agar per gm Mac Conkey broth purple with bromocresol purple per ml Mac Conkey broth per gm Mac-conkey agar with salt (082) per gm Mac-conkey broth purple (US formulation) Mac Cartney bottles Flat bottom with aluminium screw Cap & Rubber Liner. 20ml capacity Madar Madar Hydrocyanic acid per gm pc pc pc Magnetic stirrer pc 201 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 55.02 Magnessium 55.04 Magnesium carbonate light 55.03 55.05 55.06 55.07 55.08 55.09 55.1 55.11 55.12 55.13 55.14 55.15 55.16 55.17 55.18 55.19 55.2 55.21 55.22 55.23 55.24 55.25 55.26 55.27 55.28 55.29 55.3 55.31 55.32 55.33 55.34 55.35 55.36 55.37 pc Magnesium Carbonate per gm Magnesium chloride AR per gm per gm Magnesium citrate (RM1866) per gm Magnesium sulphate per gm Magnesium sulphate with 7 H2O(RN684) per ml Malachite Green per gm Malachite green (RM245) per gm Malaria kit (parascreen) per tesr per tesr pc Rapid test for Malaria (Parascreen)PF/PB Antigen Card (30tests) Maleic acid Malonate AR per gm Malonate with phenol red indicator per ml Malonate broth per gm Malt diatase pc Malt Extract LR per gm Manitol Motility test medium per gm Mannitol salt agar powder per gm Maltose (RM - 018) pc Mannitol per gm Mannitol salt broth per gm Mannose pc Masson's trichrome staining ( ready made) pc May & Graunwalds per gm MBL E-Test Strip for Imipenem per strip pc Mccoy's 5 A Measuring Cylinder Glass 1000 ml pc Measuring Cylinder Glass 500 ml pc Measuring Cylinder Glass 250 ml pc Measuring Cylinder Glass 150ml pc Measuring Cylinder Glass 100ml pc Measuring Cylinder Glass 50 ml pc Measuring Cylinder Glass 25 ml pc Measuring Cylinder ,Glass 10ml pc Measuring glasses 5ml pc 202 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 55.38 Measuring glasses 10ml pc 55.4 Measuring glasses 50ml pc 55.39 55.41 55.42 55.43 55.44 55.45 55.46 55.47 55.48 55.49 55.5 55.51 55.52 55.53 55.54 55.55 55.56 55.57 55.58 55.59 55.6 55.61 55.62 55.63 55.64 55.65 55.66 55.67 55.68 55.69 55.7 55.71 55.72 55.73 Measuring glasses 20ml pc Measuring Pipette, Capacity-1 ml pc Measuring Pipette, Capacity-2 ml pc Measuring Pipette, Capacity-5 ml pc Measuring Pipette, Capacity 10 ml pc Measuring Pipette, Capacity-25 ml pc Meat extract powder per gm Mecuric Oxide pc D(+) Mellibiose Monohydrate pc Mellibiose with phenol red indicator pc Melibiose -AR pc MEM Base (AT049-1L) (for Virology Lab) pc MEM Eagle (AT020-1L) (for Virology Lab) pc MEM Eagle (AT056-1L) (for Virology Lab) pc MEM Medium pc Meningitis set (H influenza b, N meningitis A & C, S. pheumonia) pc Meningococcus typing sera A and C per ml 2-Mercapto Ethanol AR per ml Meningococcus typing sera A,B,C,Y, W135 per ml Mercaptethanol per ml Mercuric Chloride extra pure per ml Mercuric chloride – AR grade per gm Mercuric oxide per gm Mercuric Nitrate per gm Mercuric Sulphate per gm Meropenem (0.002-32/ug/ml) Metaphosphoric acid per strip per disc per ml Methanol(acetone free) EP per ml Meropenem 10 ug (Imported) 50discs/cartridge Methanol AR grade per ml Methaqualone pc Methyacrylate pc Methyl Green per gm Methyl orange per gm 203 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 55.74 Methyl red 55.76 Methyl Red Indicator solution/powder 55.75 55.77 55.78 55.79 55.8 55.81 55.82 55.83 55.84 55.85 55.86 55.87 55.88 55.89 55.9 55.91 55.92 55.93 55.94 55.95 55.96 55.97 55.98 55.99 56 56.01 56.02 56.03 56.04 56.05 56.06 56.07 56.08 56.09 per ml Methyl Red per gm per gm Methyl Umbelliferyl β-D Glucoromide pc Methylene Blue per ml Methylene Blue Powder per gm Methyl Violet (powder) per gm Methyl-Umbelliferyl β-D Glucoromide pc Metranidazole powder per gm Metronidazole 5 mcg per disc pc Mesothelin Mg++ pc MHD8 Flotrac Sensor (For Vigiles Monitor) pc Mib pc Micafungin (0.015-128µg/ml) 30 strips/pkd per strip per disc pc Micafungin 10 µg 50discs/cartridge Microbar Barium emulsion (95% weight/volume) Microbar HD Barium Glasses pc Micro albumineria pc Micro centrifuge tube 0.5ml pc Micro centrifuge Autoclavable Plastic Tubes with cap 15ml pc Micro centrifuge Autoclavable Plastic Tubes with cap 10ml pc Micro centrifuge Autoclavable Plastic Tubes with cap 5ml Micro centrifuge Autoclavable Plastic Tubes with cap Micro cover glass 18mmx18mm pc 2ml pc pc Micro cover glass 22mmx22mm Micro cover glass pc 50mmx22mm pc Micro cover glass 40mmx22mm pc Micro cover glass 24mmx60mm pc Micro cover glass 16 mm dia pc Micro cover glass 18 mm dia pc Micro ESR tubes (GINEVRI) pc Micro ESR tubes - Sealing / Wax / Clay pc Micro Protein (EP, Pyrogallol Red) Kit pc Micro protein sestem pack pc Micro slide pc 204 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 56.1 Micro slide, Blue star pc 56.12 Micro titer plate round bottom pc 56.11 56.13 56.14 56.15 56.16 56.17 56.18 56.19 56.2 56.21 56.22 56.23 56.24 56.25 56.26 56.27 56.28 56.29 56.3 56.31 56.32 56.33 56.34 56.35 56.36 56.37 56.38 56.39 56.4 56.41 56.42 56.43 56.44 56.45 Micro titer plate flat bottom pc Microcyline Micropipette stand for 4 & 6 with attached box to keep the tips PVC made, 6 positions Micropipette tips(100-1000 micro litre) Micropipette tips(200-1000 micro litre) pc Micropipette tips(40-200 micro litre) pc Micropipette tips(5-40 micro litre) pc Micropipette tips(1-10 micro litre) pc Micropipette tips(10-100 micro litre) pc Micropipette tips (2-200µl) pc Minus 20 mini cooler with gel cover pc Microtip box (.2-10 µl) pc Micro centrifuge tube (1.5ml) pc Microtip box (2-200 µl) pc Micropipette(Tarsons) -T 5000-Range 1000-5000 ul (030060) pc Micropipette(Tarsons) T100 Range 10-100ul (030030) Microscope cover slips optical grade 24x60 mm. Thickness 0.08 to .012 mm. Microscope cover slips optical grade 19 x 19 mm. Thickness 0.08 to 0.12 mm. Microscope cover slips optical grade 22 x 22 mm. Thickness 0.13 to 0.16 mm. Microscope cover slips optical grade 22 x 50 mm. Thickness 0.13 to 0.16 mm. Microslides with sinlge cavity/cavity slides Microtip box (autoclavable) code:524050) Microtips (Autoclavable) 5ul-200ul Microtips (Autoclavable) Microtips (Autoclavable) Microtips (200-100 mm) pc pc pc pc pc pc pc Microtip Stand/Microtip Box 20ul-200ul tips Microtips (Autoclavable) pc pc Micropipette tips(20-200 micro litre) 2ul-20ul pc pc Micropipette tips(1000-5000 micro litre) Microtips (Autoclavable) pc pc pc 5ul-50ul pc pc 20ul-200ul pc 200ul-1000ul pc pc Microtips big pc Microtips small pc Microtips 0.1ml pc 205 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 56.46 Microtips 1ml pc 56.48 Microtips 5µl(micron) pc 56.47 56.49 56.5 56.51 56.52 56.53 56.54 56.55 56.56 56.57 56.58 56.59 56.6 56.61 56.62 56.63 56.64 56.65 56.66 56.67 56.68 56.69 56.7 56.71 56.72 56.73 56.74 56.75 56.76 56.77 56.78 56.79 56.8 56.81 Microtips 5ml pc Microtips 1-20 micro litre, autoclavable pc Microtips 1-200 micro litre, autoclavable pc Microtips box 100-1000µl pc Microtips box 10-100µl pc Microtips box5000µl pc Microtips (Autoclavable)(Tarsons) -1000x5000ul(100/packet) (521030) pc Microtips (Autoclavable)(Tarsons) -2x200ul(1000/packet)(521010) Microtips Box (Tarsons) - For 2-200ul tip(Autoclavable) (524050) Microtitre pipette stand/racks Aerosol displacement barrier tips size 5-200 ul & 100-1000 ul Micropipette variable 100-1000µl Micropipette variable 1000-5000µl pc Micropipette 2 microlitre to 20 microlitre variable autoclavable pc Micropipette 10 microlitre to 100 micro litre variable autoclavable pc Micropipette 40 microlitre to 200 microlitre variable autoclavable pc Micropipette 100 microlitre to 1000 microlitre variable autoclavable Micropipette fixed 5µl Micropipette 1ml pc pc Micropipette 0.5 microlitre to 10 microlitre variable autoclavable Micropipette fixed pc pc Micropipette variable 10-100µl 500µl pc pc Micropipette variable 20-200µl Micropipette fixed pc pc pc 1000µl pc pc pc Micropipette 0.1-2.5 micro litre fully pc Micropipette 0.5-10 micro litre fully pc Micropipette 20-200 micro litre fully pc Micropipette 2-20 micro litre fully autoclavable pc Micropipette 500-5000 micro litre fully pc Micropipette digital (varying capacity) 1000-5000ul pc Micropipette digital (varying capacity) 100-1000ul pc Micropipette digital (varying capacity) 1-10ul pc Micropipette digital (varying capacity) 20-200ul pc Micropipette digital (varying capacity) 2-20ul pc Micropipette fixed and variable (varying sizes 10microlts-1ml) pc 206 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 56.82 Micropipette digital (varying capacity) 1000-5000ul pc 56.84 Micropipette stand pc 56.83 56.85 56.86 56.87 56.88 56.89 56.9 56.91 56.92 56.93 56.94 56.95 56.96 56.97 56.98 56.99 57 57.01 57.02 57.03 57.04 57.05 57.06 57.07 57.08 57.09 57.1 57.11 57.12 57.13 57.14 57.15 57.16 57.17 Micropipette stand pc Microtome knife Microtome disposable blades for SLEE micrtomes –High profile/low profile pc pc Middle Brooke 7 H 11 agar without malachite green & (with malachite green) (Imported) per gm Middle brooke 7H10 agar base (Imported) per gm Middle Brooke 7 H9 broth base (Imported) Middle Brooke OADC growth supplement (Imported) per gm per gm Milk Dilution Bottle 160ml pc Millipore filter membrane cellulose nitrate 0.22 ul pc Millipore filter membrane cellulose nitrate 0.22 ul pc Millipore filter membrane cellulose nitrate 0.22 ul pc Millipore filter membrane cellulose nitrate 0.45 ul pc Millipore filter membrane cellulose nitrate 0.45 ul pc Millipore filter membrane cellulose nitrate 0.45 ul pc Millipore millicare Elix cat no JMBM01747 pc Millipore prefiltrate cartridge kit pc Millipore proguard 2 pack Cat. No PROG0002 pc Millipore Q Guard 1 Cat. No QGARD00R1 pc Millipore Quantum Ex cat. No- QTUM000Ex pc Milipore Sanitization Tablet Cat. No. ZWCL01F50 pc Millipore Tank Vent Filter Cat No TANKMPK01 pc Millon’s Reagent per ml Modified casitone agar per gm Moellers Decarboxylase broth base per gm Mineral oil per ml Muller Hinton agar per gm Moellers Decarboxylase Broth with Arginine Hydrochloride per gm Moellers Decarboxylase Broth with Arginine Hydrochloride per gm Moellers Decarboxylase Broth with lysine Hydrochloride per gm Moellers Decarboxylase Broth with lysine Hydrochloride per gm Moellers Decarboxylase Broth with Ornithine Hydrochloride per gm Moellers Decarboxylase Broth with Ornithine Hydrochloride per gm Monobasic sodium phosphate Monoclonol Primary antibody CD3, CD10, CD20, CD33, CD45, CD56, LCA 1 ml each along with the Lab kit Universal i. LSAB® 2 Single reagent peroxidase ii. LSAB® 2 biotenylated live Ab rabbit/ mouse iii. LSAB® 2 streptamide/HRP 207 per gm pc Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 57.18 Monopotassium phosphate (Anhydrous)(MB050) per gm 57.2 Montoux Reagent per ml 57.19 57.21 57.22 57.23 57.24 57.25 57.26 57.27 57.28 57.29 57.3 57.31 57.32 57.33 57.34 57.35 57.36 57.37 57.38 57.39 57.4 57.41 57.42 57.43 57.44 57.45 57.46 57.47 57.48 57.49 57.5 57.51 57.52 57.53 Monopotassium phosphate (RM 3943) per gm MOPS AR grade per ml Motar and pestle (small) pc Motar and pestle (big) pc Mounting medium pc Moxifloxacin 5 mcg 50discs/cartridge per disc pc MR Reagent MRVP Medium pc MS9 3/s card( Actidiff) pc Mucasol reagent for dissolving sputum/pus thick samples for pc Mucicarmine stain pc Mueller Hinton broth per gm Mueller Hinton agar per gm Multi channel pipette 50-300 ul (Imp) pc Multienzyme pc Multifiltrate Cassette AVF (For CRRT Machine) Code no-5016801 pc Multistix Museum Jar 3000 ml per strip per strip pc Museum jar 1000 ml pc Multistix 10 SG Museum jar 2000 ml pc Museum jar 500 ml pc Museum jar with lid (both rectangular & cylindrical) 500ml pc Museum jar with lid (both rectangular & cylindrical) 1000ml pc Museum jar with lid (both rectangular & cylindrical) 2000ml pc Museum jar with lid (both rectangular & cylindrical) 3000ml pc Museum jar (both rectangular& cylindrical) 5000ml pc Museum Jar, With Cover 160x110x60mm pc Museum Jar, Without Cover 250x250x120mm pc Museum Jar, Without Cover 360x150x100mm pc Museum Jar, Without Cover250x1656x140mm pc MX Cart 5 Micron pc MX Cart 1 Micron pc Myco - IgA (38 KDA antigen) pc 208 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 57.54 Myco - IgG (38 KDA antigen) 57.56 Myconazole (0.016 – 256 ug/ml) 57.55 57.57 57.58 57.59 57.6 57.61 57.62 57.63 57.64 57.65 57.66 57.67 57.68 57.69 57.7 57.71 57.72 57.73 57.74 57.75 57.76 57.77 57.78 57.79 57.8 57.81 57.82 57.83 57.84 57.85 57.86 57.87 57.88 57.89 pc Myco - IgM (38 KDA antigen) pc Mycoplasma agar base (Imported) per strip per gm Mycoplasma enrichment supplement G (Imported) per gm Mycoplasma broth base (Imported) per gm Mycoplasma enrichment supplement G (Imported) per gm Mycoplasma pneumonia IgG ELISA per test Mycoplasma pneumonia IgM ELISA Mycoprep reagent for dissolving sputum/pus thick samples for Myocardial infraction NaCL Powder NALC-NaOH (for digestion/decontamination) per test pc per gm pc N acetate L cystune,(RM3142) pc N- Acetyl L-Cysteine AR pc N-hexane per ml N-myc deletion probes for FISH pc N. BIL pc Na+ pc NAD+ pc NADH pc NADP Di Sodium AR per gm Nalidixic Acid 30 ug (Imp) 50discs/cartridge Nalidixic acid powder (pure) per disc per gm Naphthol AS Acetate Powder (IMP) per gm NaOH Powder per gm Napthalene balls pc Naphthol AS Phosphate (IMP) per ml Naphthol AS-BI Phosphate Powder (IMP) per gm Naphthol ASD Chlor acetate per ml Naphthol ASD Acetate (IMP) per ml Napthol AS-B1 phosphoric acid per ml Napthol AS-D chloroacetate per ml α- Nathalamine per ml N-dimethyl alpha napthlamine 0.6% per ml Neisser’s Stain per ml Neomycin 30 mcg 50discs/cartridge per disc 209 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 57.9 Neomycin sulphate per gm 57.92 Neonatal Bilirubin per ml 57.91 57.93 57.94 57.95 57.96 57.97 57.98 57.99 58 58.01 58.02 58.03 58.04 58.05 58.06 58.07 58.08 58.09 58.1 58.11 58.12 58.13 58.14 58.15 58.16 58.17 58.18 58.19 58.2 58.21 58.22 58.23 58.24 58.25 Neomycin powder (Pure) per gm Netilimicin 30 ug 50discs/cartridge per disc per disc pc Netilmicin Sulphate 30 microgram Neubauer cover slip Neutral Red per ml Neutral red(RM122) per gm Neutral Red indicator per ml Neutral Red per gm Neutral red.(PH indicator). AR ,CI50040 per ml New Fuchsin per ml New methylene blue per ml NGAL kit per kit Niacin test strips (Imported) per strip pc Nichrone wire 2 mm Niger seed agar per gm Nigrosin stain per ml Nigrosin stain 10% per ml Nigrosin Powder per gm Nimodipine oral pc Nile Blue Sulphate AR pc Ninhydrin AR per gm Nitrate disc Nitrate broth per disc per gm Nitric acid per ml Ninhydrin Solution per ml Nitrate Reductiuon (R-015) per ml Nitro-blue Tetrazolium chloride (IMP) per ml Nitrocefin (Imported) per ml Nitrofuratoin 30 ug 50discs/cartridge per disc per disc pc Nitrofuratoin 300 ug 50discs/cartridge NN dimethyl formamide N.N-methyl aminocinnamaldehyde pc N-dimethyl alpha napthlamine 0.6% per ml N-naphthylethylenediamine dihydrochloride (pkt) pc 210 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 58.26 N-naphthylethylenediamine dihydrochloride(RM1073) pc 58.28 Non Sterile Millipak 40 pc 58.27 58.29 58.3 58.31 58.32 58.33 58.34 58.35 58.36 58.37 58.38 58.39 58.4 58.41 58.42 58.43 58.44 58.45 58.46 58.47 58.48 58.49 58.5 58.51 58.52 58.53 58.54 58.55 58.56 58.57 58.58 58.59 58.6 58.61 Non Heperinised Capillary tube pc Nonidet P-40 per ml Norfloxacin 10 ug 50discs/cartridge Novobiocin powder per disc per disc per disc per gm NSE (Monoclonal mouse antibody to human.) - Pre-Diluted per ml Nuclease Decontamination solution probes for FISH per ml Novobiocin 5 ug 50discs/cartridge Novobiocin 30 microgram NSE (EPOS) pc Nuclear fast red per ml Nuclease duplex buffer probes for FISH pc Nuclease Free water per ml Nuclease Free water probes for FISH per ml Nuclease K pc Nutrient agar per gm Nux Vomica (strychine) pc Nylon Wool for T&B Seperation pc Nystatin (0.016 – 256 ug/ml) per disc pc Oring NBRP 9 L 456006 for 911 & 912 OADC Supplement (Imp) pc Ofloxacin (0.002-32 ug / ml.) Ofloxacin 5 ug per strip per disc per gm (50discs/cartridge) Ofloxacin powder (pure) OG-6 pc Oil Red O pc Oligo nucleotide primers (HPLC purification) pc Oligo nucleotide primers (HPLC purification) probes for FISH pc Olive oil per ml ONPG Broth per gm ONPG (o-nitrophenyl β-d-galactopyranoside) disc 50discs/cartridge per disc pc Optional pre treatment reagent for IHC/ICC Optochin (0.04 units) pc Optochin disc 50discs/cartridge per disc per gm Orange G 6 211 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 58.62 Orange G 58.64 0.2% Orcinol 58.63 58.65 58.66 58.67 58.68 58.69 58.7 58.71 58.72 58.73 58.74 58.75 58.76 58.77 58.78 58.79 58.8 58.81 58.82 58.83 58.84 58.85 58.86 58.87 58.88 58.89 58.9 58.91 58.92 58.93 58.94 58.95 58.96 58.97 per ml Orange green -6 per gm pc Ornithine decarboxylase pc Ortho Phosphoric acid per ml Ortho toludine stain per ml Osmium tetroxide pc Oxacillin pc Oxacillin (0.016-256 ug / ml.) Oxacillin powder (Imported) per strip per disc per gm Oxacillin Resistance Selective Supplement per gm Oxacillin 1 ug Oxacillin Resistance Screening Agar Base (M-1454) per gm Oxacillin Resistance Selective Supplement (FD-191) per gm Oxalic Acid per ml Oxcid Lab Lence Meat Extract per gm Oxidase disc (50 disc) per disc per ml Oxidase reagent Oxoferin ointment pc P-Dimethyl Amino Cinnamaldehyde pc P.C.R. tube racks with 96 holes pc P.C.R. tubes (Poly propylene) 0.2 ml pc P.C.R. tubes (Poly propylene) 15 ml pc P16 pc P16 deletion probes for FISH pc P53 pc P53 deletion probes for FISH pc Pack cell volume tube pc Palladium chloride pc Papain enzyne sol. For Serological application per ml Papin 1% wt/vol per ml Papain solution per ml PAP Pen immuno historchemistry pc Para - Resanilin Hydrochloride pc Para Amino Salicylic acid powder (pure) per gm Para film roll (size 10cmx125cm) 3 “ dia pc 212 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 58.98 58.99 59 59.01 59.02 59.03 59.04 59.05 59.06 59.07 59.08 59.09 59.1 59.11 59.12 59.13 59.14 59.15 59.16 59.17 59.18 59.19 59.2 59.21 59.22 59.23 59.24 59.25 59.26 59.27 59.28 59.29 59.3 59.31 59.32 59.33 Paraflim pc Paradimethyl Amino Benzyldehyde pc Paraffin liquid per ml Paraffin wax per gm Para formaldehyde per ml Paraffin tablet wax pc Paraffin wax. 58-600C per gm Pararosaline pc Paris Green pc Parraffin Wax 60-62-LR per gm Pasteur pipette 1ml pc Pasteur pipette 2ml pc Pasteur pipette 3ml pc Pasteur pipette with long tip pc Pasteur pipette (glass) with long stem pc Pasteur pipette : L-15cm,D-8mm,Tip-3cm,L-1mm ID pc Pasteur pipette disposable 3ml pc Pasteur pipette (sterile) (autoclavable) pc Pasteur pipette 140 mm pc Pasteur pipette 230 mm pc Pastorex Aspergillus(61706) pc Pastorex Candida(61705) pc Pasture Pipette (Glass) Long Stem pc Pasture Pipette (Plastic) Long Stem pc PBS Powder (M-1452) per gm PBS (10X) (TL1032) pc PCNA pc PCR core kit with DNA polymerase probes for FISH pc PCR reaction mix with Mgcl2 probes for FISH pc PCR Tip pc PCR Tube pc PCR Rack with cover pc PDGFRA Del/Fusion probes for FISH pc P-Di-methyl Amino Benzaldehyde AR per gm Pefloxacin 5mcg per disc pc Pencilin 213 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 59.34 Pencillin- 2 units (IMP) 59.36 Penicillin G 10 (0.002-32 ug / ml.) 59.35 59.37 59.38 59.39 59.4 59.41 59.42 59.43 59.44 59.45 59.46 59.47 59.48 59.49 59.5 59.51 59.52 59.53 59.54 59.55 59.56 59.57 59.58 59.59 59.6 59.61 59.62 59.63 59.64 59.65 59.66 59.67 59.68 59.69 pc Penicillin G 10 microgram 50discs/cartridge per disc per strip per ml Pentafluoroproprionic Acid (HPLC grade) Pepain enzyne sol. For Serological application per ml Pepsin pc Peptone & Phenol Red per gm Peptone Water per ml Peptone Powder per gm Peptone Bacteriological per ml Peptone Water with Phenol Red (M-0281) per ml Perchloric Acid per ml Perchloric Acid per gm Periodic acid Schiff stain per gm Periodic acid per gm Periodic Acid per ml Peroxide block ( IHC) pc Perspex cement per gm Perspex complete sheet museum pc Perspex for museum Pethidine Inj Petri dishes 5 inch diameter Petri dishes 5 inch diameter Petri dishes 100x17mm pc vial 100x75mm pc 150x20mm pc pc Petri dishes plastic Autoclavable with lid (Transparent) 100 x 17 mm. pc Petri dishes plastic Autoclavable with lid (Transparent) 100 x 17 mm. pc Petri dishes sterile (Plastic) 90 x 15 mm pc Petri dishes, glass 200 x 20 mm. pc Petridish 150mm Dia pc Petri dishes -100 x 20 mm pc Petri dishes - 100 x 17 mm. pc Petridish -150 x 20 mm dia pc Petri dishes sterile (Plastic) 90 x 15 mm (disposable) Petri dishes plastic Autoclavable with lid (Transparent) 100 x 17 mm. 90mm diameter Petri Plate Carrier (10 petri plates) PF 2000N Fibre Plasmo Filter pc pc pc pc 214 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 59.7 PF 20000N Fibre Plasmo Filter 59.72 pH Calibrator (4.0,7.0,9.0) 59.71 59.73 59.74 59.75 59.76 59.77 59.78 59.79 59.8 59.81 59.82 59.83 59.84 59.85 59.86 59.87 59.88 59.89 59.9 59.91 59.92 59.93 59.94 59.95 59.96 59.97 59.98 59.99 60 60.01 60.02 60.03 60.04 60.05 pc PGUA-ß-glugoronidase pc per ml PH Paper acidic and alkalik pc PH paper (Quality grade) 10.2 to 12.3 pc PH paper (Quality grade) 2.9 to 5.2 pc PH paper (Quality grade) 4.9 to 6.9 pc PH paper (Quality grade) 6.0 to 9.5 pc PH paper (Quality grade) 9.2 to 10.6 pc PH paper (Quality grade)-1.4 to 2.8 pc pH Tablet (4.0,7.0,9.2,10.0) pc Phenalpthalein Phosphate per ml Phenol (Crystal) per gm Phenol red Solution 0.5% (TCL004) per ml Phenol AR per ml Phenol red per gm Phenol red (ISO) per ml Phenol Red Dextrose broth per gm Phenol Red Sucrose broth per gm Phenol Red Lactose broth per gm Phenol Red Mannitol broth per gm Phenol Red Dulcitol broth per gm Phenol Red Maltose broth per gm Phenol Red Salicin broth per gm Phenol Red Adonitol broth per gm Phenol Red Lactose Broth per gm Phenol (RM1153) per ml Phenol, molecular biology grade pc Phenoptheline pc Phenolphthalein Phosphate Agar per gm Phenylalanine Agar per gm Phenoptheline Phosphate Agar per gm Phenylalanine broth per gm Phenylalanine agar per gm ß-phenylethylalcohol per ml Phenylethyl Alcohol Agar Base per gm 215 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 60.06 Phenylethyl Blood Agar Base (Anaerobic) 60.08 Phenylpyruvic acid Reagent 60.07 60.09 60.1 60.11 60.12 60.13 60.14 60.15 60.16 60.17 60.18 60.19 60.2 60.21 60.22 60.23 60.24 60.25 60.26 60.27 60.28 60.29 60.3 60.31 60.32 60.33 60.34 60.35 60.36 60.37 60.38 60.39 60.4 60.41 per gm Phenylhydrazine Hydrochloride per ml pc Phloxine pc Phosphate buffer saline (PBS) per ml Phosphorous per ml Phosphoric acid per ml Phosphotungstic Acid per ml Phosphotungstic acid per gm Phytohaemagglutimin (M form) 2646 per ml Phosphotungstic acid(RM398) per ml Phytohaemoagglutinin(Lyophilized dry powder ) per gm Picric Acid per gm Phytohaemogglutonin 'P' pc Piperacillin + Tazobactum 100 ug /10 ug Pipette Can stainless steel 2ml per disc per disc per disc pc Pipette Can stainless steel 10ml pc Piperacillin 100 ug 50discs/cartridge Piper/Tazo 100 ug /10 ug 50discs/cartridge Pipette Can stainless steel 5ml pc Pipette Can stainless steel 25ml pc Pipette graduated glass 50ml pc Pipette graduated glass 25ml pc Pipette graduated glass 20ml pc Pipette graduated glass 10ml pc Pipette graduated glass 5ml pc Pipette graduated glass 3ml pc Pipette graduated glass 2ml pc Pipette graduated glass 1ml pc Pipette stand (vertical) 161010 pc Pipette stand for 1 pipette pc Pipette stand for 12microlit pc Pipette stand for 6 microlit pc Pipette stand for 8 microlit pc Pipette stand horizontal pc Pipette stand vertical pc 216 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 60.42 Pipette tips for Micropipettes Yellow (5ul-200ul) pc 60.44 Pipette tips for Micropipettes White (1000ul-5000ul) pc 60.43 60.45 60.46 60.47 60.48 60.49 60.5 60.51 60.52 60.53 60.54 60.55 60.56 60.57 60.58 60.59 60.6 60.61 60.62 60.63 60.64 60.65 60.66 60.67 60.68 60.69 60.7 60.71 60.72 60.73 60.74 60.75 60.76 60.77 Pipette tips for Micropipettes Blue (200ul-100ul) pc Pipette tips for Micropipettes Pink (1000 ul) pc Pipette dispenser range 5ml-100ml pc Pipettor Assy. 736-0143 for 911 & 912 pc Pituitary pc PLAP(EPOS) pc PLAP. (Monoclonal mouse antibody to human.- Pre-Diluted per ml Plasma Flux PSU 2S (For CRRT Machine) Code no-5004811 pc Plasmid extraction kit(column based) pc Plasmid extraction kit(column based) probes for FISH pc Plasmodium Falciparum strip/card per strip pc Plasminogen Activator inhibitor assay Plasmodium vivax strips/cards Plastic carbuoys (assorted sizes) 10 L per strip pc Plastic carbuoys (assorted sizes) 5 L pc Plastic carbuoys (assorted sizes) 20 L pc Plastic carbuoys (assorted sizes) 50 L pc Plastic test tube pc Plastic straw pc Plastic vacumtainer tube witj gel for biochemistry 10ml capacity pc Plasticizer pc Platelet Diluting fluid pc PML-RARA tranlocation pc P-Nitrobenzoic Acid pc Posaconazole 5ug per disc per gm Pokweed nitrogen (lyophilized dry powder ) Polychrome Methylene Blue pc Polyethylene glycol 3350mmol (PEG) pc Poly L lysine per test Polymilxin B powder per gm Polymer HRP detection system per test Polymyxin- B 300 units 50discs/cartridge Polymyxin-B 50 units Polystyrene ELISA Plate per disc per disc pc 50discs/cartridge 217 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 60.78 Poly-vinyl Alcohol 60.8 Poppy capsule 60.79 60.81 60.82 60.83 60.84 60.85 60.86 60.87 60.88 60.89 60.9 60.91 60.92 60.93 60.94 60.95 60.96 60.97 60.98 60.99 61 61.01 61.02 61.03 61.04 61.05 61.06 61.07 61.08 61.09 61.1 61.11 61.12 61.13 per ml Ponder’s Stain per gm pc Poppy seeds pc Portable Slide Box 100slides capacity pc Portable Slide Box 50slides capacity pc Portable Slide Box 25slides capacity pc Positive Control for T.B.(My.TB H37rv strain) pc Postmortem artefacts pc Potassium Tartrate per gm Potassium ( anhydrous ) per gm Potassium Permanganate per gm Potassium acetate LR per gm Potassium acetate.AR. per gm Potassium alum.AR. per gm Potassium Aluminium Sulphate per gm Potassium Chloride AR per gm Potassium chromate per gm Potassium citrate monohydrate (K3C6H5O7H2O) per gm Potassium citrate per gm Potassium cyanide AR per gm Potassium cyanide Broth Base per gm Potassium dichromate AR per gm Potassium di-hydrogen ortho phosphate AR per gm Potassium Di-hydrogen phosphate per gm Potassium electrode per gm Potassium ferricynide LR per gm Potassium hydrogen phosphate per gm Potassium hydroxide per gm Potassium hydroxide 20% solution per ml Potassium Hydroxide (pellets) AR per gm Potassium Iodide AR per gm Potassium Iodate AR per gm Potassium Iodide LR per gm Potassium Iodine per gm Potassium Iodine per ml 218 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 61.14 Potassium Metabisulphate per gm 61.16 Potassium Nitrate Broth (1%) per gm 61.15 61.17 61.18 61.19 61.2 61.21 61.22 61.23 61.24 61.25 61.26 61.27 61.28 61.29 61.3 61.31 61.32 61.33 61.34 61.35 61.36 61.37 61.38 61.39 61.4 61.41 61.42 61.43 61.44 61.45 61.46 61.47 61.48 61.49 Potassium nitrate.AR. per gm Potassium Nitrate Peptone Broth per gm Potassium oxalate LR per gm Potassium permanganate LR per gm Potassium phosphate KH2PO4 per gm Potassium tellurite per gm Potassium Tellurite 1% per gm Potassium Tellurite 1% 2ml/vial per ml Potassium thiocynate pc Potato Dextrose Agar per gm Potato Starch per gm Potato Dextrose Agar(M-4096) per gm P Rb deletion pc Pre dropped anti HLA-ABC72 pc Pre dropped anti HLA-DR pc Pre dropped anti HLA-DQ72 pc Pre dropped anti HLA-B27 pc Pre treatment reagent pc Pregnancy test -Elisa (0.2 - 0.5 l.u. ml.) per test Pregnancy test -Card test per test Pregnancy test -Latex (0.5 - 3.5 l.u. ml.) per test Pregnancy test direct test single step Primary antibody (Monoclonol) (IMP) (CD 3,10,20,33, CD 56 &45,LCA 1ml each Primer (Both forward & reverse) Printing paper rolls for RA - 50 Autoanalyser (width 111 mm.) per test per ml pc pc Pristinomycin 15 ug (Quinupristin + Balfofrectin) 50discs/cartridge per disc pc Progard 2 Alone(Long) Pack Progesterone pc Progesterone receptors clone 1A6 pc Progesterone receptors cloneIA6. - Pre-Diluted per ml Progloback C kit per kit Prolactinonin Elisa kit per test Prolactin pc Propanol per ml 219 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 61.5 Propan-2-ol HPLC grade 61.52 Propylene oxide 61.51 61.53 61.54 61.55 61.56 61.57 61.58 61.59 61.6 61.61 61.62 61.63 61.64 61.65 61.66 61.67 61.68 61.69 61.7 61.71 61.72 61.73 61.74 61.75 61.76 61.77 61.78 61.79 61.8 61.81 61.82 61.83 61.84 61.85 per ml Proparacaine HCL 0.5% per ml pc Protease. pc Protein C test analyzer per test Protein C Elisa per test Protein S test per test Proteinase K pc Protein S Elisa per test PSA (antibiotic solution) (A002) per ml PSA (Free) ELISA per test Proteose peptone No. 3 pc PSA pc PSA (Total) ELISA per test PSAP pc Pseudomonas aeruginosa ATCC 27853 pc PTH (Parathyroid Hormone ) Pyrex glass test tube Autoclavable 19 x 150 mm. Thermal printing, paper roll 110 mm x 30 mts. Pyrex glass test tube Autoclavable 19 x 150 mm. Thermal printing, paper roll 57 mm x 30 mts. Pyrex glass test tube Autoclavable 19 x 150 mm. Thermal printing, paper roll 35 mm x 10 mtrs Pyrex glass test tube Autoclavable 19 x 150 mm. Thermal printing, paper roll 80 mm x 30 mtr PYR disc Pyradine Pyrazinamide (PZA) Kit pc pc pc pc pc per disc per ml per kit Pyrazinamide (PZA) medium per gm PyronineY per gm Pyridin per gm Pyruvate per gm Pyruvate Broth per gm Pyruvate – LR grade, per gm Q gard 1 pc QBC capillary blood test pack pc QBC venus blood test pack pc Qualitative Benedicts Reagent per ml Quality Control Reagent for Coagulation assay Quality Control Reagent for ELISA tests for transfusion Transmissible infections 220 per test per test Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 61.86 Quality Control Reagent for Hematology Analyzer per test 61.88 Quality Control reagent for HIV I & II, HCV,HBV( Virotrol HIV 2) per ml 61.87 61.89 61.9 61.91 61.92 61.93 61.94 61.95 61.96 61.97 61.98 61.99 62 62.01 62.02 62.03 62.04 62.05 62.06 62.07 62.08 62.09 62.1 62.11 62.12 62.13 62.14 62.15 62.16 62.17 62.18 62.19 62.2 62.21 Quality Control reagent for HIV I & II, HCV,HBV( Virotrol I) per ml Quality Control reagent for HIV I & II, HCV,HBV( Virotrol Syphilis Total ) Quality Control reagent for HIV I & II, HCV,HBV( Viroclear.) Quantative Benedict reagent per ml per ml per ml Quantum EX pc Quinacrine dihyrochloride per gm racks for blue tips pc racks for white tips pc racks for clear tips pc racks for yellow tips pc D(+) Raffinose Pentahydrate per gm Raffinose with phenol red indicator per gm Rampuri chaku pc Rapid plasma Reagin test (cart test) per test Rapid test for HIV I & II antibody detection per test Ratan jot (Zatropha) pc Ratti -red pc Ratti -white pc Rb gene protein pc RBC Diluting fluid per ml RBC pipette pc Reaction viewing glass (convex mirror) Ready to use Universal Cyto-chemistry Detection System -HRP Detection System / DAB -HRP Detection System / DAB Reagent pack Reagent bottle 500 mm pc per test pc pc Reagent Bottle with stopper ( clear) 25ml pc Reagent Bottle with stopper (amber ) 25ml pc Reagent Bottle with stopper (clear) 50ml pc Reagent Bottle with stopper ( amber) 50ml pc Reagent Bottle with stopper (clear) 100ml pc Reagent Bottle with stopper (amber) 100ml pc Reagent Bottle with stopper ( clear) 125ml pc Reagent Bottle with stopper (amber) 125ml pc Reagent Bottle with stopper (clear) 250ml pc 221 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 62.22 Reagent Bottle with stopper (amber) 250ml pc 62.24 Reagent Bottle with stopper ( amber ) 500ml pc 62.23 62.25 62.26 62.27 62.28 62.29 62.3 62.31 62.32 62.33 62.34 62.35 62.36 62.37 62.38 62.39 62.4 62.41 62.42 62.43 62.44 62.45 62.46 62.47 62.48 62.49 62.5 62.51 62.52 62.53 62.54 62.55 62.56 62.57 Reagent Bottle with stopper ( clear) 500ml pc Reagent Bottle with stopper ( clear) 1000ml pc Reagent Bottle with stopper (amber ) 1000ml pc Reagent bottles with IC stopper ( clear) 125 ml pc Reagent bottles with IC stopper (amber) 125 ml pc Reagent bottles with IC stopper (clear) 250 ml pc Reagent bottles with IC stopper (amber ) 250 ml pc Reagent bottles with IC stopper (clear) 500 ml pc Reagent bottles with IC stopper ( amber ) 500 ml pc Reagent bottles with IC stopper (clear) 1000 ml pc Reagent bottles with IC stopper (amber ) 1000 ml pc Reagent dropper bottles 125ml pc Reagent dropper bottles 500ml pc Reagent for Factor VIII per ml Reagent for P time per ml Reagent for Fibrinogen per ml Reagent Pack CRT-4 pc Real time HPV assay kits for high risk HPV probes for FISH pc Rectangular Glass jars with lids & Glass rods pc Rectangular Glass jars with lids & Glass rods pc Rectified Spirit 95.01% per ml M/Spirit per ml Rectified Spirit 100% per ml Red cell preservative solution per ml Red Mirch pisi pc Red Oleander pc Reinforced Clotredial Agar per gm Repeater pipette 10-200 ul pc Rep prep solution per ml Replenisher Packet (To make 4.5 lt. Sol.) pc Resorcinol per ml Reticulocyte Stain per ml Restriction enzyme reaction buffer pc Retinoblastoma pc 222 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 62.58 Reverse transcriptase 62.6 RF (Rheumatoid factor) Latex - test per test Rhamminose per ml 62.59 62.61 62.62 62.63 62.64 62.65 62.66 62.67 62.68 62.69 62.7 62.71 62.72 62.73 62.74 62.75 62.76 62.77 62.78 62.79 62.8 62.81 62.82 62.83 62.84 62.85 62.86 62.87 62.88 62.89 62.9 62.91 62.92 62.93 pc Reverse transcriptase probes for FISH pc Rhaminose per gm Rhodamine stain per gm RIA Kits for free T-3 pc RIA Kits for free T-4 pc RIBA HIV I & II pc Ribose with phenol red indicator per ml Rice Starch agar per gm Rifampicin (.002-32 ug / ml) Rifampicin powder (pure) per strip per disc per disc per strip per gm Rinsing solution for CD-X coagulation analyzer (Diamed) per ml Rifampicin 15 ug Rifampicin 5 mcg 50discs/cartridge Rifampicin High (0.002-32 ug / ml.) Rifampin (RIF) -Syrup (1799) per ml Rinsing solution 3x1.25lit for CD-X (Coagulation analyzer) per ml RNA later pc RNA extraction kit (column based) probes for FISH pc RNA Extraction kit for human sera per ml Robert son cooked meat medium (RC medium) per gm RO Cartridge 2" pc Rokinson’s Cooked meat media per gm Room thermometer pc Rose Bengal Corneal Staining Strips per strip pc Round Bottom Flask 100mlm Round Bottom Flask 250ml pc Round Bottom Flask 500ml pc Round Bottom Flask 1000ml pc RPMI-1640 medium per gm RPMT Medium (without NA2 HCO3) per gm Rubber solution glue probes for FISH pc Rubber teats/bulbs big pc Rubber teats/bulbs small pc 223 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 62.94 Rubber teat (Long sizes) 62.96 Rubella IgG Kit Strip ELISA 62.95 62.97 62.98 62.99 63 63.01 63.02 63.03 63.04 63.05 63.06 63.07 63.08 63.09 63.1 63.11 63.12 63.13 63.14 63.15 63.16 63.17 63.18 63.19 63.2 63.21 63.22 63.23 63.24 63.25 63.26 63.27 63.28 63.29 pc Rubella IgG Kit Elisa per test Rubella IgM Kit Elisa per test per test Rubella IgM Kit Strip ELISA per test Rubhonium Red pc Ruptured spleen pc Russel Viper Venom -Lads pc S-Line tubing kit (6 / kg) per gm Sabouraud Chloramphenicol Agar - per gm Sabouraud's Dextrose Agar per gm S-100 - Pre-Diluted per ml Saborrand’s dextrose maltose agar per gm Sabouraud's Dextrose Agar with chloramphenicol per gm Sabouraud's Dextrose Agar with chloramphenicol & cycloheximide per gm Saffranine powder per gm Safranine Solution per ml Safranine Stain Powder per gm Sahli"s Haemoglobinometre pc Sahli tube round pc Sahli pipette pc Salicin pc Salicin (DD - 001) pc Salmonella Antigens (WIDAL kit) tube test i) H A Salmonella enterica subspecies enterica serovar cholerasuis ATCC-10708 Salmonella enterica subspecies enterica serovar paratyphi A ATCC-9150 Salmonella enterica subspecies enterica serovar typhimurium ATCC-25241 Salmonella Polyvalent H Salmonella Polyvalent H Phase I a per test pc pc pc pc pc Salmonella Polyvalent H Phase Ib pc Salmonella Polyvalent H Phase Ic pc Salmonella Polyvalent H Phase Ii pc Salmonella Polyvalent O pc Salmonella Polyvalent O2 pc Salmonella Polyvalent O4 pc Salmonella Polyvalent O7 pc 224 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 63.3 Salmonella Polyvalent O9 63.32 Sample applicator 63.31 63.33 63.34 63.35 63.36 63.37 63.38 63.39 63.4 63.41 63.42 63.43 63.44 63.45 63.46 63.47 63.48 63.49 63.5 63.51 63.52 63.53 63.54 63.55 63.56 63.57 63.58 63.59 63.6 63.61 63.62 63.63 63.64 63.65 pc Salmonella shingella agar per gm sample probe for easylyte pc pc sample cup for auto H-911 Sample Vial with screw cap round bottom, self standing 17 mm x 75 mm. Sample collection, screw capped, presterilized plastic vials Sample Container -Wide mouth bottle,125ml Autoclavable (Polypropylene) Sample Container (Tarsons) -Wide mouth bottle,125ml Autoclavable (Polypropylene) 582220 Sampling site couplers 4C2405 Sanitization Tablets 45/packet pc pc pc pc pc pc pc Sarboraud’s Dextrose agar per gm Saturated Solution of Glucose per ml Scheel's Green pc Schiff's Reagent LR per ml Schirmer's Strips per strip pc Scorpion Screw capped tissue culture tube 15ml pc Screw capped tubes 16x125mm pc Screw capped tubes 20x150mm pc SDS AR grade per gm Sealing rings pc Sealing tapes for labware (clear/white/yellow) pc Selenious Acid Powder per gm Selenite broth per gm Selenium Acid (Powder) EP per ml Selenite F Broth (M - 052) per gm Serological Pipette -capacity 25ml pc Serological Pipettes 10ml pc Serological Pipettes 5ml pc Serological Pipettes 2ml pc Serological Pipettes 1ml pc Serological Pipettes 0.1ml pc Serum Dip stick test for Malarial parasite pc Shalitube (Hb %) pc Shigella flexneri ATCC-9199 pc 225 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 63.66 Shigella Polyvalent boydii pc 63.68 Shigella Polyvalent flexnerii pc 63.67 63.69 63.7 63.71 63.72 63.73 63.74 63.75 63.76 63.77 63.78 63.79 63.8 63.81 63.82 63.83 63.84 63.85 63.86 63.87 63.88 63.89 63.9 63.91 63.92 63.93 63.94 63.95 63.96 63.97 63.98 63.99 64 64.01 Shigella Polyvalent dysenteriae pc Shigella Polyvalent sonnei pc Signal Reagents pc Silast tube 1 ID 30d G153170 for 911 & 912 pc Silica gel G 254 per gm Silica gel GF 254 per gm Silicon tube 2*4Mts for 911 & 912 pc Silver nitrate per gm SIM medium per gm Silver nitrate Solution per ml Simmon's Citrate Agar per gm Sindoor pc Skim Milk as dried powder (pure) per gm Skin showing ligature mark pc Skin showing tatoo pc Skin with abraision /contusion pc Slide Box (for 25 slides) pc Slide Box ( for 50 slides) pc Slide Box (for 100 slides) pc Slide Cabinet 20000 capacity pc Slide Cabinet 10000 capacity pc Slide Cabinet 5000 capasity pc Slide carrier 20 slide capacity steel pc Slide carrier 50 slide capacity steel pc Slide tray 20 slide capacity pc SMA pc Soda Lime per gm Sodium Bi-Carbonate per gm Sodium acetate per gm Sodium Beta-Glycero Phosphate pc Sodium Diethyl Barbitutrate Powder per gm Sodium acetate (HPLC grade) per ml Sodium Acetate Dehydrate AR per gm Sodium Acetate Trihydrate AR per gm 226 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 64.02 Sodium Azide (NaN3) per gm 64.04 Sodium Barbitone per ml 64.03 64.05 64.06 64.07 64.08 64.09 64.1 64.11 64.12 64.13 64.14 64.15 64.16 64.17 64.18 64.19 64.2 64.21 64.22 64.23 64.24 64.25 64.26 64.27 64.28 64.29 64.3 64.31 64.32 64.33 64.34 64.35 64.36 64.37 Sodium Azide AR per ml Sodium Benzoate LR per ml Sodium Bicarbonate (NaHCO3) (RM447) per ml Sodium Bicarbonate LR per ml Sodium Bicarbonate AR Extra pure per gm Sodium bisulphite per ml Sodium Bisulphate AR per gm Sodium cacodylate pc Sodium carbonate (anhydrous) AR. per gm Sodium citrate per gm Sodium Carbonate LR per gm Sodium citrate per ml Sodium Citrate Powder per gm Sodium Citrate(RM-3953) per ml Sodium citrate 3.2% 2ml glass pc Sodium citrate 3.2% 2ml plastic pc Sodium citrate 3.8% 2ml glass (quantum)-100"s pc Sodium citrate 3.8% 2ml glass pc Sodium citrate 3.8% 2ml plastic pc Sodium conditioning solution per ml Sodium deoxycholate per gm 10% Sodium Deoxycholate serum digest per ml Sodium deoxycholate per ml Sodium Hydrogen Di-phosphate ( NaH2PO4) per gm Sodium Dithionate per gm Sodium di-hydrogen phosphate per gm Sodium electrode pc Sodium Fluoride LR per gm Sodium Flurescein strip per strip per gm Sodium hippurate Sodium Hippurate Broth per gm Sodium Hyaluronate 1.5% (Viscoelastic) pc Sodium hydrogen Orthophosphate monobasic per gm Sodium hydrosulphite purified. per ml 227 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 64.38 Sodium hydrosulphite AR per gm 64.4 Sodium Hydroxide AR per ml 64.39 64.41 64.42 64.43 64.44 64.45 64.46 64.47 64.48 64.49 64.5 64.51 64.52 64.53 64.54 64.55 64.56 64.57 64.58 64.59 64.6 64.61 64.62 64.63 64.64 64.65 64.66 64.67 64.68 64.69 64.7 64.71 64.72 64.73 Sodium Hydrosulphide per gm Sodium Hydroxide Crystals per gm Sodium Hypobromite per ml Sodium Hydroxide pellets or Powder AR per gm Sodium Hypochlorite 4% LR 5Litre per ml Sodium iodate per gm Sodium metabisulphite AR per gm Sodium Iodide per gm Sodium Nitrate per ml Sodium nitrate LR per gm Sodium nitrite AR per gm Sodium Nitroprusside per ml Sodium Nitrate(RM416) per ml Sodium nitrite LR per gm Sodium nitroprusside AR per gm Sodium phosphate,12H2O per gm Sodium phosphate ( Na2 HPO4 per gm Sodium phosphate.IP. per ml Sodium Potassium tartarate per gm Sodium salicylate per gm Sodium Puruvate AR per gm Sodium sulphate AR per gm Sodium Sulphite per gm Sodium Thio glycolate per gm Sodium thioglycollate bile salt per gm Sodium Thiosulphate per ml Sodium Thiosulphate(Anhydrous)(RM1420) per gm Sodium tungstate LR per gm Sodium Tungstate per ml Sofratulle pc Sofrols pc Soft paraffin (white) per gm Solution Pack (Na/K/Cl): Solution pack for Easylyte Plus Analyzer - Code No: FECIN0002 per ml Soft paraffin (yellow) 228 per gm Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 64.74 Soluzione cleaning solution for Hematology Analyzer(Logotech) 64.76 Soot particles in trachea 64.75 64.77 64.78 64.79 64.8 64.81 64.82 64.83 64.84 64.85 64.86 64.87 64.88 64.89 64.9 64.91 64.92 64.93 64.94 64.95 64.96 64.97 64.98 64.99 65 65.01 65.02 65.03 65.04 65.05 65.06 65.07 65.08 65.09 per ml Soluzione Lisante solution for Hematology Analyzer (Logotech) per ml pc Sorbitol per gm Sorbitol mac-konkey Agar per gm Sorbitol AR per gm SP Kit pc Sparfloxacin (Pure) per gm Sparfloxacin 5 mcg per disc pc Speciment Tube 15ml capacity Specimen Jar 100ml pc Specimen Jar 200ml pc Specimen Jar 500ml pc Spectinomycin per ml Spectinomycin 100 mcg (Imp) per disc per gm Spectinomycin powder (pure) Sperm antibody IgG ELISA per test Spirit Chloroform per ml Sperm wash media pc Spirit lamps with extra nicks (100 bundle) pc Spore strips per strip pc Spirit Lamp glass/ metal Sprit swab pc 8 Square template slides probes for FISH pc SR Bicarb-Cl per ml Staining Rack pc SSC buffer S-4641 pc Staining trough 1000ml capacity pc Staining trough 500ml capacity pc Standard inoculating loop pc Standardised pack for prepration Of coomb’s control cell pc Staphy cococus pc Staphylococcus aureus ATCC 25923 pc Staphylococcus aureus ATCC 33591 pc Starch per gm Starch (MV-107) per ml 229 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 65.1 Starch Hydrolysee for Electrophorisis AR 65.12 Sterile antibiotic 65.11 65.13 65.14 65.15 65.16 65.17 65.18 65.19 65.2 65.21 65.22 65.23 65.24 65.25 65.26 65.27 65.28 65.29 65.3 65.31 65.32 65.33 65.34 65.35 65.36 65.37 65.38 65.39 65.4 65.41 65.42 65.43 65.44 65.45 per gm Starch LR per gm pc Sterile cotton pc Stop watch pc Stomach mucosa in copper sulphate poisoning pc Stomach mucosa in corrosive acid poisoning pc Storage vials (autoclavable) pc Storage vials (autoclavable) pc Storage vials (autoclavable) pc Storage vial (2ml) pc Storage vial (5ml) pc Strep Latex Agglutination Kit Streptococci per kit Strepto coccus pc Streptococcus pneumoniae ATCC 49619 pc Streptomyces avidin biotin complex horse radish peroxidase pc Streptomycin (STR) pc Streptomycin 4.0 kit pc Streptomycin pc Streptomycin High (0.064-1024 ug / ml.) per strip pc Strile swab on wooden stick length 150 mm Stripper & Cutter pc Strips for Tropoxin-T visual in assay pc Stromatolyser 4 DL per ml Stuart's transport media per gm Stromatolyzer 4DS per ml Sublimed Sulphur powder Substitute System Multi Filtrate (For CRRT Machine) Code no-5016761 per gm pc D(+) Sucrose (certified bact grade) per gm Sucrose – AR grade, per gm Sucrose per ml Sudan black B per gm Sudan Black B kit staining.Readymade. Sugar Assimilation Discs(glucose, maltose, lactose, sucrose, rhaffinose, cellubiose, galactose,mellibiose, inositol, xylose, trehalose, dulcitol Sulfolyser Sulphanilamide (R M1558) 230 pc per disc per ml per ml Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 65.46 Sulphanilic acid 65.48 Sulphosalicyclic acid 20% 65.47 65.49 65.5 65.51 65.52 65.53 65.54 65.55 65.56 65.57 65.58 65.59 65.6 65.61 65.62 65.63 65.64 65.65 65.66 65.67 65.68 65.69 65.7 65.71 65.72 65.73 65.74 65.75 65.76 65.77 65.78 65.79 65.8 65.81 per ml Sulpher powder per gm Sulphosalicyclic acid 3% per ml per ml Sulphosalicylic acid per ml Sulphur ki goli pc Sulphur powder per gm Sulphuric acid 98%. AR. per ml Sulphuric acid per ml Surgical spirit. per ml Surma white pc Swab culture tube with screw cap Sterilized Size: 13 mm. X 110 mm pc Synaptophysin per ml Syrup simplex per ml Syphilis stix (solid phase immuno chromatographic graphy for T.P. Antibody) pc T.B. Complex II (38 KDA antigen) per test T-4 ELISA per test T-3 ELISA per test Taq Polymerase per test Taq polymerase reaction buffer per test Taq Polymerase with PCR buffer per test Taq Polymerase with PCR buffer probes for FISH pc Tartaric acid per gm TCBS per gm Taxo Hipporate 1 vials 5 vial Teichoplanin powder Teicoplanin 30 ug (Imported) 50discs/cartridge Tellurite blood agar base with supplements supplement-17vials & © potassium tellurite 1%-30vials per gm (a) Haemoglobin powder-300g, (b) Vitamino groth Tellurite blood agar base with supplements per disc vial per gm Tertiary Butyl alcohol per ml Testis pc Teepol pc Test tube polystrine with screw capped (Clear Transparent) Test tube nylon cleaning brush (polypropylene filament bunched typed brush for cleaning 6”, 5” & 4” tubes) Test tube basket, (autoclavable) code 181020 Test tube basket, large pc pc pc pc 231 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 65.82 Test tube basket, small pc 65.84 Test tube glass without rim 12x75mm pc 65.83 65.85 65.86 65.87 65.88 65.89 65.9 65.91 65.92 65.93 65.94 65.95 65.96 65.97 65.98 65.99 66 66.01 66.02 66.03 66.04 66.05 66.06 66.07 66.08 66.09 66.1 66.11 66.12 66.13 66.14 66.15 66.16 66.17 Test tube glass without rim 10x75mm pc Test tube glass without rim 12x100mm pc Test tube 6" pc Test tube 12" pc Test tube glass without rim 18x150mm pc Test tube holder brass pc Test tube holder wooden pc Test tube rack to accommodate 3 ml. test tubes 5X15 pc Test tube rack to accommodate 5 ml. test tubes 5X15 pc Test tube racks:42x 12 pc Test tube racks:4 x 12 pc Test tube racks:4 x 13 pc Test tube rack 10mm pc Test tube rack 16mm pc Test tube rack (5x10 capacity for 5ml test tube) pc Test tube still rack pc Test Tube Stand - test -tube size - 16mm diametre pc Test Tube Stand - Test-tube size - 10mm diametre pc Test Tube Stand (Tarsons) - Test -tube size - 25mm diametre Test Tube Stand (Tarsons) - Test -tube size - 25mm diametre (202040) Test Tube Stand (Tarsons) - test -tube size - 16mm diametre (202040) Test Tube Stand (Tarsons) - Test-tube size - 10mm diametre (202010) Test tube stand 10x75mm Test tube with rim 10x75mm pc pc pc pc pc pc Test tube with rim 12x75mm pc Test tube with rim 12x100mm pc Test Tubes : -Big Rimless test tubes 50ml (25x150mm)(9820) pc Test Tubes : -Medium Rimless test tubes 10ml(15x25mm)9820 pc Test Tubes : -Small Rimless tests tube 5ml(10x75mm)(9820) pc Testosterone pc Tetcoplannin (0.016-256 ug / ml.) per strip per strip per disc per disc Tetracycline (0.016-256 ug / ml. Tetracycline 10 mcg (Imp) Tetracycline 30 mcg 50discs/cartridge 232 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 66.18 Tetracycline powder (pure) per gm 66.2 Tetramethyl para phenylenediamine dihydrochloride powder per gm 66.19 66.21 66.22 66.23 66.24 66.25 66.26 66.27 66.28 66.29 66.3 66.31 66.32 66.33 66.34 66.35 66.36 66.37 66.38 66.39 66.4 66.41 66.42 66.43 66.44 66.45 66.46 66.47 66.48 66.49 66.5 66.51 66.52 66.53 Tetrathionate broth per gm Tetrazolium reduction medium per gm Thayer Martin media per gm Thayer Martin medium base with supplements per gm Thermal paper -80 mm for CD-X coagulation analyzer ( Diamed) pc Thermometer 1000C pc Thermometer 370C pc Thiazine Carbazide pc Thioglycolate Agar per gm Thioglycollate broth per gm Thioglycollate Medium W/ Haemin & Vit K pc Thioglycollate Medium W/o Dextrose pc Thionyl Chloride pc Thrombin NIH units pc Thromboplastin (Rabbit) with calcium pc Thymol (Orange Yellow) per ml Thymol blue (Alkaline range) per ml Thymol Blue (acid) Red per ml Thymol Crystal per gm Thymol crystal(preservative) Pure per gm Thymus pc Thyroid Thyroid binding globulin Ticarcillin + clav. 75/10 ug pc pc 50discs/cartridge per Tigecycline (0.016-256 µg/ml) 30 strips/pkd per strip per disc pc Tigecycline (15µg) 50discs/cartridge Tik -20 Timer electronic pc Tincture Hyoscyamus per ml Tincture Iodine per ml Tissue culture bottle 1000ml pc Tissue culture flat bottle 3000ml pc Tissue culture micro plates presterile, with cover pc Todd Hewwitt broth per gm 233 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 66.54 Toluene AR per ml 66.56 Topfers reagent per ml 66.55 66.57 66.58 66.59 66.6 66.61 66.62 66.63 66.64 66.65 66.66 66.67 66.68 66.69 66.7 66.71 66.72 66.73 66.74 66.75 66.76 66.77 66.78 66.79 66.8 66.81 66.82 66.83 66.84 66.85 66.86 66.87 66.88 66.89 Toluidine blue O per ml TORCH PANEL IgG (Capture Quantitative with multiple calibrators) Toxo Plasma IgM Elisa TORCH PANEL IgM (Capture Quantitative with Multiple calibrators) ELISA -Toxo Plasma IgM Elisa Total Bilirubin Total Cholesterol per test per test pc pc Total Protein pc Touledine Blue per ml Toluidine Blue per gm Toxoplasma IgM Strip ELISA per test Treponema pallidum haemagglutination test(TPHA) 50 tests per test Transducer Protector pc Transflux MS 9 3/S per ml Transgrow medium (Imported) per gm Tree Snake pc D(+) Trehalose Dihydrate pc Trehalose with phenol red indicator per ml Tri Potassium (EDTA) per gm Trichloroacetic Acid per ml Trichloroacetic Acid per gm Trichomonas selective supplement per gm Trichophyton Agar – 3 per gm Trichophyton Agar – 1 per gm Trichophyton Agar – 4 per gm Trichophyton Agar – 6 per gm Triethanolamine LR per gm Triglyceride per ml Trihydrosodium acetate AR 1 Bottle pc Tri-methroprim powder per gm Triple Sugar Iron per gm Tripple distilled water per ml 2,3,5 Triphenyl Tetrazolium Chloride pc Triple sugar iron(TSI )Media per gm Tripticase Soy Agar per gm Tris (Hydroxymethyl) Aminomethane per gm 234 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 66.9 Tris Based AR grade per gm 66.92 Tri-Sodium Citrate per ml 66.91 66.93 66.94 66.95 66.96 66.97 66.98 66.99 67 67.01 67.02 67.03 67.04 67.05 67.06 67.07 67.08 67.09 67.1 67.11 67.12 67.13 67.14 67.15 67.16 67.17 67.18 67.19 67.2 67.21 67.22 67.23 67.24 67.25 Tris Buffer per gm Trisodium citrate (C6H5Na3O7.H2O) per ml 3.2% Trisodium citrate pc Tri-Sodium Citrate powder per gm Troponin – T per test Trypan Blue Solution 0.5% (TCL005) per ml Triton X 100 AR per gm Trypan Blue per gm Tryphase Soya broth (Imp) per gm Trypsin 1:250 Powder (RM713) per gm Trypsin per gm Trypsin 2.5% solution(10X) (TCL008) per ml Trypsin EDTA Solution(1X) (TCL007) per ml Trypsin Phosphate Versene Glucose(TPVG)Solution(1X) (TCL022) per ml Trypticase soya agar (Imported) per gm Tryptone broth per gm Tryptone agar base per gm Tryptone ceritified pc Trytone pc TSH ELISA per test Tubercular culture and smear pc Tuberculosis first Line Kit(total 7 slant)SL 023)-KT pc Tuberculosis of lungs pc Tungstic acid per gm Tween 20 per ml Tween 60 per ml TV Set for donors pc Tween 40 per ml Tween 80 per ml Tween 80 (Polysorbate LR) pc Tween 80(10%) per gm Tween 80(10%)(RM-159) pc Ultra Flux AV 600S ( For CRRT Machine) Code no-5007361 pc Universal ISH Kit ( streptavidin HRP) per kit 235 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 67.26 Universal Wash Reagents per ml 67.28 Urea per ml 67.27 67.29 67.3 67.31 67.32 67.33 67.34 67.35 67.36 67.37 67.38 67.39 67.4 67.41 67.42 67.43 67.44 67.45 67.46 67.47 67.48 67.49 67.5 67.51 67.52 67.53 67.54 67.55 67.56 67.57 67.58 67.59 67.6 67.61 Uranyl acetate pc Urea AR per gm Urea supplement per gm Urea 40% supplement vial Rapid Urease test kits for Helicobacter pylori pc Uric acid per ml Urine Diluent: Urine diluent for Easylyte - Code No: FECIN0008 pc Urine strips for Albumin & Sugar Urine Strips for Albumin, sugar, Sp. Gr & PH Urine Strips for Glucose / Bilirubin / Ketone /Sp. Gr. / Blood /Ph / Protein / Urobilinogen / Leucocytes Urine strips for Leucocytes / Ketone / Nitrite / Urobilinogen Urine Strips for Micro Albumin Urinometer Urinometer with cylinder pc Urinometer (for specific gravity) pc Uristix per strip per strip per strip per strip pc Urocolor TM 2 Urocolor TM 10 Urocolor TM 4S Uterus showing products of conception Vanillin Reagent per gm Vanilin Reagent Extra pure AR per gm V factor 50discs/cartridge V.D.R.L. Slides per strip per strip per strip per strip per strip pc per disc pc 75mmx50mmx1.45mm VDRL (Complete kit) per test VDRL Antigen per test Vaccutrend Citrate vial 3.2% pc Vacuette tube plastic, with serum clot activator 5ml capacity pc Vaccutrend Citrate vial 2ml 3.2% pc Vaccutrend Citrate vial 3ml 3.2% pc Vaccutrend Citrate vial 4ml 3.2% pc Vaccutrend Citrate vial disposable 3.2% pc Vaccutrend Citrate vial 3.8% pc Vaccutrend Citrate vial 2ml 3.8% pc 236 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 67.62 Vaccutrend Citrate vial 3ml 3.8% pc 67.64 Vaccutrend Citrate vial disposable 3.8% pc 67.63 67.65 67.66 67.67 67.68 67.69 67.7 67.71 67.72 67.73 67.74 67.75 67.76 67.77 67.78 67.79 67.8 67.81 67.82 67.83 67.84 67.85 67.86 67.87 67.88 67.89 67.9 67.91 67.92 67.93 67.94 67.95 67.96 67.97 Vaccutrend Citrate vial 4ml 3.8% pc Vaccutrend EDTA on Vial 2 ml pc Vaccutrend EDTA Vial 3ml pc Vaccutrend plain Vial disposable pc Vaccutrend plain 2ml Vial pc Vaccutrend plain 3ml Vial pc Vaccutrend plain 4ml Vial pc Vaccutrend plain 5ml Vial pc Vaccutrend EDTA Vial disposable pc Vaccutrend plain Vial disposable pc Vancolin powder (pure) per gm Vancomycin (0.016-256 ug / ml.) per strip per disc per disc per gm Vancomycin pc Vancomycin 30 ug 50discs/cartridge Vancomycin 5 mcg Vancomycin powder (pure) Vancomycin(.03-16ug / ml.) per strip pc Variable volume micropipette (IMP) 5-10 ul Variable volume micropipette (IMP) 5- 50 ul pc Variable volume micropipette (IMP) 20-200 ul pc Variable volume micropipette (IMP) 200-1000 ul. pc VCN Supplement per gm VCNT supplement per gm Vectashield probes for FISH pc Versene (EDTA)0.1% Solution(1X) ((TCL020) per ml Vibrio cholerae-01 pc Vibrio cholerae-0139 pc Vibrio cholerae-Inaba pc Vibrio cholerae-Ogawa pc Vibriostatic (O/129) Agent pc Vinegar per ml Vitamin growth factor supplement per gm Viper Snake pc Vitamin K1 supplement per gm 237 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 67.98 67.99 68 68.01 68.02 68.03 68.04 68.05 68.06 68.07 68.08 68.09 68.1 68.11 68.12 68.13 68.14 68.15 68.16 68.17 68.18 Vitamino Growth supplement Vitamino Growth Supplement(Twin pack) pc Volumetric Flask 1000ml pc Volumetric Flask 500 ml pc Volumetric flask 250ml pc Volumetric flask 100ml pc Volumetric flask 50ml pc Volumetric flask 25ml. pc Volumetric pipette 25ml pc Volumetric pipette 10ml. pc Volumetric pipette 5 ml pc Volumetric pipette 2 ml pc Von- willebrand factor assay kit pc VP Reagent 68.25 68.26 68.27 68.28 68.29 68.3 68.31 68.32 per disc pc Wafers for Sterile connecting device Wash bottle 500ml pc Wash bottle plastic with delivery Nozzle 60ml pc Wash bottle plastic with delivery Nozzle 250ml Wash kit for Fully Automated Biochemistry Analyzer Watch glass medium 68.24 pc Voriconazole 1 microgram 50discs/cartridge 68.21 68.23 pc Vitek 2 GNB Cards Wash Solution: Wash solution for Easylyte - Code No: FECIN0007 68.22 per gm Vitek 2 ESBL Cards 68.19 68.2 per gm pc per ml Wasp pc pc Watch glass small pc WBC Diluting fluid pc WBC pipette pc Weil Felix Test OX 19 per ml Weil Felix Test OXK per ml Weil Felix Test OX 2 per ml Weil Felix Test with Positive Control per test Welkins Chalgren Anaerobic Agar per gm Westogen tube with stand for ESR pc Whole blood DNA extraction kit Whole blood gamma interferon test Using TB-specific ESAT-6 & CFP-10 238 per kit pc Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 68.33 Widal rack and test tube 68.35 Widal test (tube method) per test Wilson aid Blair brilliant green bismuth sulphite agar base per gm 68.34 68.36 68.37 68.38 68.39 68.4 68.41 68.42 68.43 68.44 68.45 68.46 68.47 68.48 68.49 68.5 68.51 68.52 68.53 68.54 68.55 68.56 68.57 68.58 68.59 68.6 68.61 68.62 68.63 68.64 68.65 68.66 68.67 68.68 pc Widal test (slide method) 4x5ml per ml Wilms tumour 1 protein (WT1) pc Wilson Blair Brilliant Green Bismuth Sulphite Agar Base per gm Wine pc Wire gauge pc Wintrobe tube pc Woulfer bottle n.g 500ml pc Wright Stain per gm 10X TBE pc X-Gal AR grade pc X & V factor 50discs/cartridge per disc per disc pc X factor 50discs/cartridge Xanthine (RM-457) Xylose Lysine Deoxycholate Agar (XLD) per gm Xylene LR per ml Xylene AR per ml Xylene. EP. per ml Xylene Cyanol ultra pure per gm D(+) Xylose pc Xylose with phenol red pc X T245 KNL Pediaset Oximetry Catheter pc X3816 HS - Presep Oximetry Catheter 16cm pc X3820 - Presep Oximetry Catheter 20cm pc Yeast autolysate supplement per gm Yeast carbon base agar per gm Yeast Cards (card for yeast indentification) pc Yeast Extract Powder LR per gm Yeast fermentation broth (M-676) per gm Yeast extract powder type I per gm Yeast nitrogen base agar per gm Yeast nitrogen base(M139) per gm Yeast peptone Agar per gm Yellow tips 2-200ul pc 239 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 68.69 YEP Agar (Yeast extract peptone agar) per gm 68.71 Yessinia selective Supplement (FD-034) per gm 68.7 68.72 68.73 68.74 68.75 68.76 68.77 68.78 68.79 68.8 68.81 68.82 68.83 68.84 68.85 68.86 68.87 68.88 68.89 68.9 68.91 68.92 68.93 68.94 68.95 68.96 68.97 68.98 68.99 69 69.01 69.02 69.03 69.04 Yessinia selective Agar Base (M843) per gm Zinc Acetate LR pc Zinc Granules per gm Zinc oxide powder per gm Zinc Nano Powder per gm Zinc oxide – AR, per gm Zinc Sulphate per gm Zinc Dust per gm Zinc Dust(RMK 888) per gm ZN Acid Fast Stain kit per gm ZN stain (kit) per ml α- ketoglutarate pc Fields pc Thioglycollic Acid pc Merthiolate pc Thiomersol pc Chromatrope 2R pc Phenol pc CRP (Latex) per test Phosphate Powder per gm Tri Basic Potassium Phosphate pc Tryplicase pc Thiolic Acid pc Vitamin B12 pc Test Tube Rack for 25ml test tube pc Wooden Slide Rack Bacteriological Inoculating Loop Holder with Loop (ready to use) Nichrome Amikasin 30ug Gram Iodine pc pc per disc per ml Strip Elisa IGG Anti HDV per test Andrade's Indicator per ml Storage Box for 1.5ml microfuge tubes pc Hexamine per gm Borax per gm 240 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 69.05 Borax AR, 69.07 Clavualnate 10ug 69.06 69.08 69.09 69.1 69.11 69.12 69.13 69.14 69.15 69.16 69.17 69.18 69.19 69.2 69.21 69.22 69.23 69.24 69.25 69.26 69.27 69.28 69.29 69.3 69.31 69.32 69.33 69.34 69.35 69.36 69.37 69.38 69.39 69.4 per gm Silver Aluminium Foil/Wrap paper pc per disc pc Calcium Chloride DiSodium Hydrogen Phosphate per gm EDTA Powder (K+) per gm Dextrose Powder per gm Gelatin pc L-Giutamine pc Potassium chloride pc Potassuirn Di-hydrogen Phosphate per gm Sodium Hydrogen Phosphate Monobasic per gm Saturated Glycerol pc Sucrose pc Sodium Citrate di-hydrate pc Thioglycollate broth per gm Tri-sodium Citrate per ml 1N NAOH pc 0.1 N H2SO4 (95%) pc 10X TBE pc 10X TBE pc 6X gel loading buffer pc Hydrochloric acid Solution 1 N per ml T_rypsin 1:250 Powder per gm Trypsin EDTA Solution(1X) per ml Trypsin 2.5% Solution (10X) per ml Trypsin Phosphate Versene Glucose (TPVG) solution(1 X) per ml Versene (EDTA) 0.l% Solution{1X) per ml Ethidium Bromide pc Phenol Red Solution 0.5% per ml Phenol Red Solution 0.5% per gm Trypan blue solution 0.5% per ml Microtips 0.2 -10 µl(1000’s) pc Microtips 2 -200 µl (1000’s) pc Microtips 200 -1000 µl (500’s) pc Microtips 1000 -5000 µl (100’s) pc 241 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 69.41 Microtips 1000 -2000 µl (100’s) pc 69.43 Microtips Box 2 -200 µl 96 places pc 69.42 69.44 69.45 69.46 69.47 69.48 69.49 69.5 69.51 69.52 69.53 69.54 69.55 69.56 69.57 69.58 69.59 69.6 69.61 69.62 69.63 69.64 69.65 69.66 69.67 69.68 69.69 69.7 69.71 69.72 69.73 69.74 69.75 69.76 Microtips Box 0.2 -10 µl 96 places pc Microtips Box 200 -1000 µl 100places pc Micro Centrifuge Tube 1.5 ml (coloured) pc Micro Centrifuge Tube 2 ml pc Rack for Microtube 0.5 ml (24 places) pc Rack for Micro Tube 1.5 ml (24 places) pc Eppendorf Safe Lock Tube 0.5 ml pc Eppendorf Safe Lock 1.5 ml pc Eppendorf Safe Lock 2 ml pc U –bottom microlitre plate pc V –bottom microlitre plate with sealer pc Screw cap Tissue Culture tube pc Milk Dilution Bottle pc Pipette Rubber Teats/Bulb pc Pipette Rubber Teats/Bulb pc Pipette Rubber Teats/Bulb pc Boiling Flask 500ml pc Boiling Flask 250ml pc Pipette Can pc Pipette Can pc Pipette Can pc Pipette Can pc Screw capped Bottle 1000ml pc Screw capped Bottle 500ml pc Screw capped Bottle 250ml pc Gradient screw capped glass centrifuge tubes pc MEM Base pc MEM Eagle AT020 1L pc MEM Eagle AT0561L pc DMEM High Glucose pc (Transport Media) HiViral transport swab pc HiViral transport medium pc DPBS (1X)_ W/o Ca & Mg_ pc DPBS (1X) WI Ca & Mg_ pc 242 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 69.77 EBSS(1X) pc 69.79 HBSS(10X) pc 69.78 69.8 69.81 69.82 69.83 69.84 69.85 69.86 69.87 69.88 69.89 69.9 69.91 69.92 69.93 69.94 69.95 69.96 69.97 69.98 69.99 70 70.01 70.02 70.03 70.04 70.05 70.06 70.07 70.08 70.09 70.1 70.11 70.12 EBSS(10X) pc HBSS pc PBS, Powder per gm PBS (10X) pc HBSS pc Bovine Serum Albumin (Powder) per gm Fetal Bovine Serum pc Ficoll Type 400 pc Fetal Calf Serum per gm Micro Pipette Variable Volume0.5 -2 µl pc Micro Pipette Variable Volume 2 -200 µl pc Micro Pipette Variable Volume 2-20µl pc Micro Pipette Variable Volume 20 -200 µl pc Micro Pipette Variable Volume 100 -1000 µl pc Micro Pipette variable Volume 1000 -5000 µl pc Multi Channel Pipette 0.5 -10 µl pc Multi Channel Pipette 10 -200 µl pc Multi Channel Pipette 5-50 µl pc Multi Channel Pipette 50-300 µl pc Axiva Vacuum Driven Filter (0.22jun)250 ml pc Levifloxacin 10ug per disc pc Pasteur Pipett (long stem) UV Lamp (for Sapphire ,120 Semi Automated Analyser) pc Sodium Chloride AR per gm Sodium Flouride LR per gm Micro Tips 100-1000ul pc Erlenmeyer Flask 2000ml pc XL Multicalibrator pc Benzoic Acid per ml Biorad Liquicheck Blood Gas Plus E Control Level 1 per ml Biorad Liquicheck Blood Gas Plus E Control Level 3 per ml Randox Multical Calibrator pc Biorad Liquicheck Blood Gas Plus E Control Level 2 per ml Preventive Maintenance Kit for DI Water Plant per ml 243 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 70.13 Solution Valve (For Easylyte Electrolyte Analyser - Transasia) 70.15 Block Cabinet 70.14 70.16 70.17 70.18 70.19 70.2 70.21 70.22 70.23 70.24 70.25 70.26 70.27 70.28 70.29 70.3 70.31 70.32 per ml Tuning Kit (For Easylyte Electrolyte Analyser - Transasia) pc pc Staining Trough 1000ml capacity with Lid pc Staining Trough 5000ml capacity with Lid pc Staining Trough 500ml capacity with Lid pc Quality Control for MS93s (5 parts diff Haematology Analyser) pc Calibrator for MS93s (5 parts diff Haematology Analyser) pc 10% Dextrose Solution per ml Sodium Phosphate Monohydrate (NAH2 PO4 H2O) pc Ammonium Alum pc Potassium Alum pc Stock Ohloyione pc Plain Agar per gm Hinkle Man's Fluid per ml Cytokeratin Cocktail per ml C3 FITC pc Ciq FITC Uristix 100's (Consumables for Bayer Urine Chemistry Analyser in Pathology Dept) Multistix 10SH (Consumables for Bayer Urine Chemistry Analyser in Pathology Dept) Reagent for department of Biochemistry pc per strip per strip Lipid Profile: 70.33 1. Total Cholesterol per ml 70.35 3. HDL per ml 70.34 70.36 70.37 2. 4. per ml LDL per ml Liver Function Tests: per ml 70.38 1. Bilirubin(Total and Conjugated) per ml 70.4 3. ALT per ml 70.39 70.41 70.42 70.43 70.44 5. Triglycerides 2. 4. 5. VLDL AST per ml ALP per ml 5’ NT per ml 6. G GT Renal Function Test: per ml 1. Urea per ml 244 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 70.45 70.46 2. per ml Cardiac Markers: per ml 70.47 1. CK per ml 70.49 3. LDH Pancreatic Markers: per ml 1. per ml 70.48 70.5 70.51 3. Creatinine 2. CK-MB per ml Amylase Proteins: per ml 70.52 1. Total Protein per ml 70.54 3. Microalbumin per ml 70.53 70.55 70.56 70.57 2. Uric Acid 2. I. II. III. Lipase Albumin per ml System Packs compatible with Erba XL-600 & Erba XL-300 per gm Liquid Stable Lyophilized per gm Department of Biochemistry -(Internal Quality Control) per gm 70.58 1. Quality Control for Clinical Chemistry: Each 70.59 2. Quality Control for the Immunoassay System: Each 70.6 3. Quality Control for Urine Samples: Each 70.61 4. Quality Control for Cardiac Markers: Each · Must be human sera based · Minimum 2 level is required · Lyophillised · Compatible with XL-300 & XL-600 autoanalyzer · Preferably from good companies BIORAD/RANDOX Lyphochek Assayed chemistry control level-1 Lyphochek Assayed chemistry control level-2 · Must be human sera based · Minimum 3 level is required · Lyophillised · Compatible with BECKMAN COULTER Access 2 Immunoassay system · Preferably from good companies BIORAD/RANDOX Lyphochek Immuno Assayed Plus Control control level-1 Lyphochek Immuno Assayed Plus Control control level-2 Lyphochek Immuno Assayed Plus Control control level-3 · Tumor markers like CA-125,AFP,Hormones like FT3,FT4 etc, Vitamins like B12 has preferably to be included. · Human matrix based · Lyophillised · At least 2 level · Common parameters like total protein, Sodium,Potassium,Creatinine, VMA should be included Liquichek Urine Chemistry Control level-1 Liquichek Urine Chemistry Control level-2 · Human matrix based · Lyophilized/liquid · CK,CK-MB, Homocysteine, Troponin,Myoglobin should be included · Minimum 3 level is required Liquichek Cardiac Marker Plus Control Level-1 Liquichek Cardiac Marker Plus Control Level-2 Liquichek Cardiac Marker Plus Control Level-3 245 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 70.62 5. Electrolyte Control: Each · Minimum 3 level · Liquid based · Na,K,Cl,Li,Ca Liquichek Blood Gas Plus E Control Level-1 Liquichek Blood Gas Plus E Control Level-2 Liquichek Blood Gas Plus E Control Level-3 Reagents for Clinical Chemistry 70.63 Parameter per ml 70.65 Urea per ml 70.64 70.66 70.67 70.68 70.69 70.7 70.71 70.72 70.73 70.74 70.75 70.76 70.77 70.78 70.79 70.8 70.81 70.82 70.83 70.84 70.85 70.86 70.87 70.88 70.89 70.9 70.91 70.92 Glucose per ml Creatinine per ml Bilirubin per ml SGOT (AST) per ml SGPT (ALT) per ml Alkaline Phosphatase per ml Acid Phosphatase per ml Total Protein per ml Albumin per ml Microalbumin per ml Gamma Glutamyl Tranferase per ml (g - GGT) per ml Amylase per ml Lipase per ml CK per ml CK-MB per ml LDH per ml Total Cholesterol per ml Triglyceride per ml HDL per ml LDL per ml Uric acid per ml Calcium per ml Copper per ml Phosphorus Zinc per ml per ml Special Test Parameter per ml Iron per ml 246 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 70.93 TIBC per ml 70.95 ADA Calibrator per ml 70.94 70.96 70.97 70.98 70.99 71 71.01 71.02 71.03 71.04 71.05 71.06 71.07 71.08 71.09 71.1 71.11 71.12 71.13 71.14 71.15 71.16 71.17 71.18 71.19 71.2 71.21 71.22 71.23 71.24 71.25 71.26 71.27 71.28 ADA per ml G-6-PD per ml Glycosylated Hb per ml Glycosylated Hb Calibrator per ml CRP per ml CRP Calibrator per ml α-1 Acid Glycoprotein per ml Ammonia per ml Lactate per ml Glutathione Peroxidase per ml Superoxide dismutase per ml Total Antioxidant Status per ml Homocysteine per ml ASO per ml RF per ml Lipoprotein (a) per ml Lipoprotein (a) Calibrator per ml Transferrin per ml Cystatin C per ml Gentamycin per ml Barbiturates per ml Valproic Acid per ml Phenitoin per ml VMA per ml Galactosemia per ml Calcitonin per ml Calcitriol per ml Galactokinase per ml Galactose-1-phosphate uridyl transferase per ml Renin per ml ACTH per ml Interleukin 1 per ml Interleukin 4 per ml Interleukin10 per ml 247 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 71.29 Leukotrine A4 per ml 71.31 Leukotrine C4 per ml 71.3 71.32 71.33 71.34 71.35 71.36 71.37 71.38 71.39 71.4 Leukotrine B4 per ml Leukotrine D4 per ml Leukotrine E4 per ml TNFα per ml Cephalosporin per ml Serum tryptase per ml Urine fluoride per ml Anti-dsDNA Antibody per ml Anti nuclear antibody per ml Anti-sm Antibody Reagents for the MBBS Course - Department of Biochemistry per ml 71.41 Sodium carbonate per gm 71.43 Potassium Dihydrogen Phosphate KH2PO4 (HPLC grade) per gm 71.42 71.44 Potassium Dihydrogen Phosphate Creatinine powder 71.45 Isopropyl alcohol, AR Grade 71.47 Aluminium foil -- 0.3mm 71.46 71.48 71.49 71.5 71.51 71.52 71.53 71.54 71.55 71.56 71.57 71.58 71.59 71.6 71.61 71.62 per gm Research Reagents per gm per ml Acetone – AR grade AR grade per ml thickness pc Ammonium chloride –AR grade, per gm Ammonium persulphate – AR grade, per gm Ammonium nitrate – AR grade, per gm Buffer powder/Tablets -- pH -4 , pH – 7 ,pH – 9 pc Calcium chloride dihydrade – AR grade, per gm Magnesium chloride – AR grade, per gm Dinitro phenyl hydrazine AR grade, per gm Magnesium sulfate –AR grade, per gm Methanol – Acetone free – HPLC grade, per ml Methanol (HPLC grade) per ml Potassium dichromate – AR grade, per gm Sodium bicarbonate – AR grade, per gm Silver nitrate – AR grade, per gm Sodium acetate dehydrate –AR grade, per gm Ammonium acetate – AR grade, per gm 248 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 71.63 Thio semi carbazide – AR grade, per gm 71.65 Guanidium iso thiocyanate – Biotechnology grade, per gm 100 bp DNA ladder 1 ml X 5 per gm 71.64 71.66 71.67 71.68 71.69 71.7 71.71 71.72 71.73 71.74 71.75 71.76 71.77 71.78 71.79 71.8 71.81 71.82 71.83 71.84 71.85 71.86 71.87 71.88 71.89 71.9 71.91 Ethidium bromide soln 10ml– Biotechnology grade, per ml IPTG AR grade, per gm Taq Polymerase with PCR buffer 3-5 U/µl, 1000 U per vial per gm dNTPs 100 millimolar each per ml EcoRI restriction enzyme 0.5 ml X 1 per ml BamHI 0.5 ml X 1 per ml HinDIII 0.5 ml X 1 per ml DNA ligase 0.5 ml X 1 per ml DNA extraction kit(column based) for 50 extraction per ml RNA extraction kit(column based) for 20 extraction per ml Plasmid extraction kit(column based) for 50 extraction per ml Oligo nucleotide primers (HPLC purification) per ml RNAlater per ml DEPC mol bio grade per ml Nuclese K per ml Milipore Prefiltrate Kit Cartridge pc Milipore Proguard 2 Pack Cat. No. PROG0002 pc Milipore Q Guard 1 Cat. No. QGARD00R1 pc Milipore Tank Vent Filter Cat. No. TANKMPK01 pc Milipore Sanitization Tablet Cat. No. ZWCL01F50 pc Millipore millicare Elix cat no JMBM01747 pc Millipore Quantum Ex cat. No- QTUM000Ex pc MX cart 5 micron pc MX cart 1 micron pc RO cartridge Non sterile millipak 40 pc Consumables for the Millipore ELIX 70 pc 71.92 Progard TS 2 pc 71.94 3 micron filter pc 71.93 71.95 71.96 71.97 1 micron filter pc MX cartridge 5 μm pc 20 '' carbon cartridge pc Sanitization tablets pc 249 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 Consumables for the XL-600/300 71.98 71.99 72 72.01 72.02 72.03 72.04 72.05 72.06 72.07 72.08 72.09 72.1 72.11 72.12 72.13 72.14 72.15 72.16 72.17 72.18 72.19 72.2 72.21 72.22 72.23 72.24 72.25 72.26 72.27 72.28 72.29 72.3 72.31 72.32 PM kit pc XL wash solution per ml 200-1000 μl microtips pc 100-200 μl microtips pc 5-50 μl microtips pc 1-5 ml microtips pc 200-1000 μl micropipette pc 100-200 μl micropipette pc 5-50 μl micropipette pc 2-20 μl micropipette pc Microcentrifuge tube 1.5ml pc Ammonium persulphate AR per gm Toluene AR per ml Potassium iodate (KIO3) per gm Arsenous acid(As2O3) per ml Arsenic trioxide per ml Ceric ammonium sulphate per gm TRIS – base AR grade per gm 20bp DNA ladder pc Fok I & NlaIII restriction enzyme pc DNA loading buffer pc DNA sample loading dye pc Ethiduim bromide pc Primer (Both forward & reverse) pc 10 X TBE pc Heparinised vial pc Disposable syringe pc Microwave oven pc Glucose kit per kit G6-PD kit per kit Bilirubin Kit per kit Vacutainer pc Disposable syringe pc Cystatin C kit per kit Bilirubin Kit per kit 250 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 72.33 Creatinine kit per kit 72.35 ALT kit per kit 72.34 72.36 72.37 72.38 72.39 72.4 72.41 72.42 72.43 AST kit per kit ISE wash 2 solution per ml ISE cal-3 solution per ml ISE cal -4 solution per ml Microcentrifuge tube 2ml pc SP kit per kit Rep prep solution per ml Sample applicator pc Disposable sample cup Consumables for Beckman Coulter AU 2700 plus - Department of Biochemistry pc 72.44 AST per test 72.46 Creatinine per test 72.45 72.47 72.48 72.49 72.5 72.51 72.52 72.53 72.54 72.55 72.56 72.57 72.58 72.59 72.6 72.61 72.62 72.63 72.64 72.65 72.66 72.67 ALT per test Albumin per test Glucose per test GGT per test BUN per test HDL cholesterol per test LDL cholesterol per test Cholesterol per test UIBC per test RF RTG latex per test CRP per test Uric acid per test Triglyceride per test ALP per test Total bilirubin per test IgG per test Direct bilirubiun per test IgM per test Protein per test IgA per test Phosphorus per test C3 per test 251 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 72.68 Calcium per test 72.7 Lipase per test 72.69 72.71 72.72 72.73 72.74 72.75 72.76 72.77 72.78 72.79 72.8 72.81 72.82 72.83 72.84 72.85 72.86 72.87 72.88 72.89 72.9 72.91 72.92 72.93 72.94 72.95 72.96 72.97 72.98 72.99 73 73.01 73.02 73.03 CK-MB per test ASO per test Iron per test C4 per test Amylase per test CK per test Acid phosphatase per test Transferrin per test LDH per test Magnessium per test HB-DH per test Haptoglobin per test Lactate per test Microalbumin per test Microalbumin calibrator per test Cholinesterase per test Urine CSF protein per test Wash solution per ml Cleaning solution per ml Cleaning solution weekly wash per ml CRP latex calibrator per test System calibrator per test Urine calibrator per test HDL calibrator per test LDL calibrator per test CRP calibrator per test RF calibrator per test CK-MB calibrator per test Xl-300/600 cuvette pc Beckman coulter AU 2700 cuvettes pc Xl-300/600 Lamp pc Beckman coulter AU 2700 lamp pc EQAS (Bio-Rad) per test ApoA1 & ApoB reagent & calibrator per test 252 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 73.04 Bio-Rad lipid conrol 73.05 Ethylene Glycol (Ethandiol pc 73.07 Tissue Capsule Big pc 73.06 73.08 73.09 73.1 73.11 73.12 73.13 73.14 Methylene Soluble (working Reagent pc Tissue Capsule Small pc Tissue Cassettes Big pc Tissue Cassettes Small pc Stock Phloxine B pc Progesterone Receptor pc ANA Kit for SLE (Indirect Immunoflurescence Method) Hb/Cayanaid Method standard 73.15 Nalidixid 10ug 73.17 Furozotidime 30ug 73.16 Department of Pathology per test per test Department of Microbiology Netilmycin 10ug Additional Reagent for Blood Bank department pc per disc per disc per disc 73.18 Antigen and antibody HCV ELISA test kits per test 73.2 (Machine available is ABX pentra which is a closed system) per gm 73.19 73.21 73.22 73.23 73.24 73.25 73.26 73.27 73.28 73.29 73.3 73.31 73.32 73.33 73.34 73.35 73.36 Cell counter reagents pc Reagent for APTT per test Control plasma N per test Calcium Chloride for APTT estimation per test Reaction tube per test CA CLEAN per test OWRENS Veronal buffer per test Standard Human Plasma per test Sodium Azide (NaN3) per test Bovine thrombin per test 1000 NIH units/ mg of protein per test Anti DCE per test Sc(1) per test Sc(2) per test Sc(3) per test Yt(a) per test Yt(b) per test 253 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 73.37 Do(a) per test 73.39 PYR Disc per test 73.38 73.4 73.41 73.42 73.43 73.44 73.45 73.46 73.47 73.48 73.49 73.5 73.51 73.52 73.53 73.54 73.55 73.56 73.57 73.58 73.59 73.6 73.61 73.62 73.63 73.64 73.65 73.66 73.67 73.68 73.69 73.7 73.71 73.72 Do(b) per test PYR -Pyrolidonyl-ß naphthylamine per test Paradimethylaminobenzaldehyde per ml P-dimethylaminocinamaldehyde pc p-nitrophenylglycerol pc Potassium Telurite pc Potassium Cyanide (KCN) per gm Potassium hydroxide per gm Phenol Crystal (powder) per gm Phenethyl alcohol per ml Para dimethyl aminobenzaldehyde per ml Phenol per ml Phosphate Buffer Saline per ml Phenol red indicator per ml Phenol red indicator per gm Phenol red per gm Phenylpyruvic acid Reagent pc Potassium Chloride AR per gm Potassium Iodate AR per gm Potassium dichromate LR per gm Potassium Iodide AR per gm Potassium permanganate LR per gm Potassium permanganate AR per gm Potassium Phosphate monobasic per gm Potassium Nitrate per gm Phenol (Crystal) per gm Peptone per gm Raffinose AR per gm Rhammnose per gm Sodium/ Potassium Dichromate pc Sodium citrate per ml Sodium Pyruvate AR per gm Sodium acetate per gm Sodium Biocarbonate LR per gm 254 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 73.73 Sodium Iodide 73.75 Sugar assimilation disc – Cellobiose 73.74 73.76 73.77 73.78 73.79 73.8 73.81 73.82 73.83 73.84 73.85 73.86 73.87 73.88 73.89 73.9 73.91 73.92 73.93 73.94 73.95 73.96 73.97 73.98 73.99 74 74.01 74.02 74.03 74.04 74.05 74.06 74.07 74.08 per gm Sulphanilamine-AR per gm pc Sugar assimilation disc – Dextrose pc Sugar assimilation disc – Dulcitol pc Sugar assimilation disc – Galactose pc Sugar assimilation disc – Inositol pc Sugar assimilation disc – Lactose pc Sugar assimilation disc – Maltose pc Sugar assimilation disc – Melibiose pc Sugar assimilation disc - Raffinose pc Sugar assimilation disc- Sucrose pc Sugar assimilation disc – Trehalose pc Sugar assimilation disc - Xylose pc Salicin AR per gm Trehalose Ar per gm Tarric Acid per gm Triypticase per gm Thiosulphate per ml Tri-Sodium Citrate per gm Vibriostatic (0/129) Agent per ml Voges proskaeur reagent pc Wright’s Stain per gm Vibrio cholerae-01 3ml per ml Xylose AR per gm Vibrio cholerae-0139 3ml per ml Vibrio cholerae-Ogawa 3ml per ml Vibrio cholerae-Inaba 3ml per ml Salmonella Polyvalent O 3ml per ml Salmonella Polyvalent H 3ml per ml Salmonella Polyvalent O2 3ml per ml Salmonella Polyvalent O4 3ml per ml Salmonella Polyvalent O9 3ml per ml Salmonella Polyvalent H Phase I a 3ml per ml Salmonella Polyvalent H Phase Ib 3ml per ml Salmonella Polyvalent H Phase Ic 3ml per ml 255 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 74.09 Salmonella Polyvalent H Phase Ii 3ml per ml 74.11 Shigella Polyvalent flexnerii per ml 74.1 74.12 74.13 74.14 74.15 Shigella Polyvalent dysenteriae Shigella Polyvalent boydii 74.22 74.23 74.24 74.25 3ml 74.32 74.33 74.34 74.35 74.36 74.37 74.38 74.39 74.4 74.41 vial Erythromycin Powder per gm Imipenem 5gm/vial vial Ciprofloxacin 5gm/vial vial Gentamicin 5gm/vial Oxacillin vial 5gm/vial Vancomycin vial 5gm/vial Ciprofloxacin (0.001-8ug / ml.) 74.31 per gm per gm 74.28 74.3 per test Clindamycin Powder Anidulafungin (0.015-128µg/ml) 74.29 per test per gm Benzal Pennicillin Powder 74.26 74.27 per ml Antibiotic Powder Cefoxitin 5gm/vial 74.21 per ml Antigen detection kit for Meningitis (H influenza b, N meningitis A & C, S. pneumonia, GBS, E.coli) 74.18 74.2 3ml Cryptococcus antigen detection kit (latex Agglutination detection) Amphotericin Powder 74.19 per ml Shigella Polyvalent sonnei 3ml 74.16 74.17 3ml vial E-Test Strips Ceftriaxone (0.016-256 ug /ml.) Ceftazidime+ Clavulanate(0.004-128ug / ml.) Clindamycin E-test (0.016-256 µg/ml) Colistin (0.06-0.25µg/ml) Caspofungin (0.015-128µg/ml Doripenem(0.002-32 µg/ml) Ertapenem (0.002-32 µg/ml) Fluconazole (0.016-256 µg/ml) Imipenem(0.004-128ug / ml.) Levofloxacin (0.001-8ug / ml.) Meropenem (4-256 µg/ml) Meropenem/EDTA (1-64 µg/ml) Moxifloxacin (0.001-8ug / ml.) Lyophyllized Cultures for Quality Control Candida albicans ATCC 14053 per strip per strip per strip per strip per strip per strip per strip per strip per strip per strip per strip per strip per strip per strip per strip vial 256 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 74.42 Candida guilliermondii ATCC 6260 vial 74.44 Corynebacterium diptheriae ATCC 13812 Vial vial 74.43 74.45 74.46 74.47 74.48 74.49 74.5 74.51 74.52 74.53 74.54 74.55 74.56 74.57 Candida Psedotropicalis TCC 4135 vial Escherichia coli ATCC 25922 Vial vial Escherichia coli ATCC 35218 Vial vial Enterococcus faecalis ATCC 29212 Vial vial Haemophilus influenzae ATCC-49766 Vial vial Pseudomonas aeruginosa ATCC 27853 Vial vial Positive Control for T.B. (My.TB H37rv strain) vial Staphylococcus aureus ATCC 25923 Vial vial Streptococcus pneumoniae ATCC 49619 Vial vial Staphylococcus aureus ATCC 33591 Vial Salmonella enterica subspecies enterica serovar cholerasuis ATCC-10708 Vial Salmonella enterica subspecies enterica serovar paratyphi A ATCC-9150 Vial Salmonella enterica subspecies enterica serovar typhimurium ATCC-25241 Vial Shigella flexneri ATCC- 9199 Vial Bact/Alert& Vitek Consumables vial vial vial vial vial 74.58 AST for GNB AST –N280 per test 74.6 Media for Aerobic Sample – 259791, BACT/ALERT FA per test 74.59 74.61 74.62 74.63 74.64 74.65 74.66 Media for Pediatric Sample -259794,BACT/ALERT PF per test Solution for Inoculum Preparation – V1204, 3x500 ml per test Tubes for Inoculum Preparation - 69285(unsensitised tube) Identification of Fermentes and Non-ferments – 21341(GN TEST KIT VTK) DNA ladder / molecular weight marker size range : 100 to 1200 bp (50µg) DNA Extraction kit Deoxynucleotide triphosphate (dNTP) mixture Glass & Plasticwares per test per test per test per test per test 74.67 Anaerogas pack pc 74.69 Anaerobic Blood Culture bottle – Adult pc 74.68 74.7 74.71 74.72 74.73 74.74 74.75 Autoclavable Biohazard plastic bag: size 10 ltr 10ltr pc Anaerobic Blood Culture bottle – Paediatric pc Anaerobic System Rubber Ring pc Anaero Indicator Tablet RT (1x10/pkt) pc Autoclavable Plastic Vial Flat Bottom,screw capped 11.5 mm x53 mm. pc Craigie’s tube pc Durham's tube 25 x 6 mm pc 257 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 74.76 Durham's tube 37x 6 mm pc 74.78 Kline Concavity Slides 75x56x3 mm thick & 12 concavity code GW097 pc 74.77 74.79 74.8 74.81 74.82 74.83 74.84 74.85 74.86 74.87 74.88 74.89 74.9 74.91 74.92 74.93 74.94 74.95 74.96 74.97 74.98 74.99 75 75.01 75.02 75.03 75.04 75.05 75.06 75.07 75.08 75.09 75.1 75.11 Embading Cassette 1x1000/box pc Microtips (Autoclavable) with box (96’s/pack) 0.1ul - 20µl pc Microtips (Autoclavable) with box (96’s/pack) 2ul - 200µl pc Microtips (Autoclavable) with box (96’s/pack) 50ul - 1000µl pc Microtips (Autoclavable) 0.1ul - 20µl pc Microtips (Autoclavable) 2ul - 20ul pc Microtips (Autoclavable) 5ul-50ul pc Microtips (Autoclavable) 20ul-200ul pc Microtips (Autoclavable) 200ul-1000ul pc Microtips-1000 ul pc Microtips-5000 ul pc Microtitre plate with round bottom wells 96wells Microtitre plate with detachable wells 96wells pc Micro centrifuge Autoclavable Plastic Tubes with cap 2ml Micro centrifuge Autoclavable Plastic Tubes with cap 10ml pc pc Micro centrifuge Autoclavable Plastic Tubes with cap 5ml pc Mac Cartney bottles Flat bottom with aluminium screw Cap & Rubber Liner. Capacity 30ml Museum Jar, With Cover 160x110x60mm Museum Jar, With Cover 170x130x210 mm pc pc pc pc Screw capped tubes 20x150mm pc Serum vials sample storage box & stand for 3ml capacity Sample Container -Wide mouth bottle,125ml Autoclavable (Polypropylene) 125ml Storage vials (autoclavable) 2ml Teasing Needles for moulds pc pc pc pc Test Tube Stand - Test -tube size - 25mm diametre pc Test Tube Stand - test -tube size - 16mm diametre pc Test Tube Stand - Test-tube size - 10mm diametre pc Test tube basket, large pc Test tube basket, small pc Test tube rack to accommodate 3 ml. test tubes 5X15 pc Test tube rack to accommodate 5 ml. test tubes 5X15 pc Test tube racks:4 x 13 Test tube cleaning brush (polypropylene filament bunched typed brush for cleaning 6”, 5” & 4” tubes) Test Tube Carrier (stainless steel) 258 pc pc pc Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 75.12 V.D.R.L. Slides (75mmx50mm 1.45mm) pc 75.14 Wash bottle plastic with delivery Nozzle 60ml pc 75.13 75.15 75.16 75.17 75.18 75.19 75.2 75.21 75.22 75.23 75.24 75.25 75.26 75.27 75.28 75.29 75.3 75.31 75.32 75.33 75.34 75.35 75.36 75.37 75.38 75.39 75.4 75.41 75.42 75.43 Wash bottle plastic with delivery Nozzle 200ml pc Bunsen burner pc Bacteriological loop holder with loop (ready to use) pc Biological indicator for steam (3M) pc Ice box 5 litres pc Labels for Micro centrifuge tubes white Size ½” Metaloops (Changeable Nichrome loop embedded in Brass rod with heat resistant handle witha. 2 mm diameter Nichrome wire b. 3 mm diameter Nichrome wire pc pc pc c. 4 mm diameter Nichrome wire Metaloops (Fixed straight Nichrome loop embedded in SS rod with heat resistant handle withMicrotome Knife Mops pc pc pc pc Magnifying glass, big size with handle pc Mortar - Pestle pc Nichrome loop-4 mm pc Nichrome loop-2 mm pc Nichrome loop-1.3 mm pc Pipette stand( vertical & horizontal) 4/5 pipettes pc Staining rack. 20 slide capacity. pc Sprit Lamp glass/ metal pc Screwdrivers -multipurpose pc Silver aluminium foil pc Surgical Knife (Big) pc Sterile swab sticks pc Syringe driven filters PTFE (hydrophilic) pore size 0.22µm pc Thermometer 37degree C pc Twine pc Universal collection vials (Urine pot) Universal Wash Reagents 500ml pc pc Special Reagent for Pathology department pc 75.44 Anti-CD 56 per ml 75.46 Anti-CD 68 per ml 75.45 Anti-61 per ml 259 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 75.47 Anti-CD 33 per ml 75.49 Anti Neurofilament Protein per ml 75.48 75.5 75.51 75.52 75.53 75.54 75.55 75.56 75.57 75.58 75.59 75.6 75.61 75.62 75.63 75.64 75.65 75.66 75.67 75.68 75.69 75.7 75.71 75.72 75.73 75.74 75.75 75.76 75.77 75.78 75.79 75.8 75.81 75.82 Anti-Ki 67 (Mib) per ml Anti-Synaptophysin per ml Anti-GFAP per ml Anti-CD 99 per ml Anti-HRP Polymer Kit per ml Anti-CD 31 per ml Anti-B HCG per ml Poly-L.Lysine per ml Anti-CD 20 (B cells) per ml Anti-CD 45 (LCA) per ml Anti-S 100 per ml Anti- Desmin per ml Anti-C-erb B-2 (Her-L/Neu) per ml Anti-ER per ml Anti-PR per ml Anti-CD 3 per ml Anti-CD 20 per ml Anti-CD 117 per ml Anti-CD 34 per ml Anti-CD 30 per ml Anti-Cyclin D1 per ml Anti-CD 15 per ml Anti-CD 5 per ml FITC-Conjugated Rabbit per ml Anti-Human IgA (alpha chain) per ml FITC-Conjugated Rabbit per ml Anti-Human IgG (Gamma chain) per ml FITC-Conjugated Rabbit per ml Anti-Human Kappa Light chain per ml FITC-Conjugated Rabbit per ml Anti-Human C3c Complement per ml FITC-Conjugated Rabbit per ml Anti-Human IgM (Mu chain) per ml FITC-Conjugated Rabbit per ml 260 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 75.83 Anti-Human Lambda (Light chain) 75.85 Electrodes for µpH System 361 75.84 75.86 75.87 75.88 75.89 75.9 75.91 75.92 75.93 75.94 75.95 75.96 75.97 75.98 75.99 76 76.01 76.02 76.03 76.04 76.05 76.06 76.07 76.08 76.09 76.1 76.11 76.12 76.13 76.14 76.15 76.16 76.17 76.18 per ml ANA by Hep-2-cell-line substrate(kit with reagents) pc pc Osmium Tetroxide pc Chromium trioxide pc Zinc Chloride pc Di-Sodium hydrogen phosphate anhydrous per gm Sodium dihydrogen orthophosphate monohydrate per gm Di-Sodium hydrogen Orthophosphate Dibasic per gm Sodium borate per gm Alpha napthyl butyrate per gm Anti-CISH kits-HPV16/18DNA per ml ER/P-R control per ml Anti-Melanomal(HMB45) per ml Anti Myeloperoxidase per ml Anti -NSE per ml Anti-PLAP per ml Anti-bc12 oncoprotein per ml Anti-Cytokeratin7 per ml Anti-Cytokeratin20 per ml Anti-BRCA 1Protein per ml Anti-IgA per ml Anti-IgM per ml Anti-IgG per ml Anti-compliment CD3 per ml Anti-Rb gene protein per ml Anti-P53 protein per ml Anti-WT1 turmor per ml Anti-Vimentin (V9) per ml Anti-EMA(E29) per ml Anti-p169INK4) per ml Kappa per ml Lamda per ml Eosine spirit soluble per ml PAP Pen Immuno histochemistry per ml Anti-CD 1a per ml 261 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 76.19 Anti-SMA per ml 76.21 Fluorescent bchiff reagent per ml 76.2 76.22 76.23 76.24 76.25 76.26 Anti-Myogenin per ml Carmine per ml Acriffarine per ml Cresyl fast blue per ml Luxol fast blue Cresyl violet per ml Consumables for Platelete Aggregometer Machine per ml 76.27 Epinephrine (3x0.5ml) pc 76.29 A D P(Adenosine-5l Diphosphate(3x0.5ml) pc 76.28 76.3 76.31 76.32 76.33 76.34 76.35 76.36 76.37 76.38 76.39 76.4 76.41 Aggrecetion ristocetion A Sulfate (3x0.5ml) pc Arachidonic acid lyohillzed sodium Arachidonate pc Collagen Soluble Calfskin(3x0.5ml) pc Vw Fator Assay ristocetin cofactor (3x0.5ml) pc Test tube( siliconized,flate bottom 7x25x55mm) pc Stri Bars plastic coaled MICRO pc Cryo Glue (Tissue Embedding Medium)for Cryostat Machine pc Diposables blades for Cryostat Machine pc Silicon Tubal Ring pc Laser Spectacles pc Fluid Warmer pc Filter for Suction Machine( Atmos) NIBP Monitor with integrated cuff arm - Should monitor NIBP and Pulse rate, - should use Oscillometric technique with linear deflation for NIBP measurenment, -should have LED digital display for SYSTOLIC BP and Pulse Rate, - The monitor should have an integrated cuff arm with arm support for correct positioning of the patient's arm for BP measurement, - the Cuff should automatically adjust to the size of the patient's arm, - the main body and cuff arm cover should have antibacterial coating for multiple usage and hygiene, -p the Cuff cover should be detachableand washable, - the monitor should give printout of oscillometric graph after every measurement indicating the accuracy of the measurement and presence of any noise during BP measurement, - the monitor should announce the measured values on completion of measurement, should have an inbuilt thermal printer, - should be portable and easy to use, - should meet international quality directives such as CE, ISO 9001 & ISO 14001. Additional Reagent for Biochemistry department pc pc 76.42 Serum Zinc per ml 76.44 Ceruloplasmin per ml 76.43 76.45 76.46 76.47 76.48 76.49 Copper per ml Ammonia per ml Ammonia per ml Alcohol per ml D- Dimer per ml Anti ds DNA per ml 262 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 76.5 Anti sn Antibody per ml 76.52 Vitamin E per ml 76.51 76.53 76.54 76.55 76.56 76.57 76.58 76.59 76.6 76.61 76.62 76.63 76.64 76.65 76.66 76.67 76.68 76.69 76.7 76.71 76.72 76.73 76.74 76.75 76.76 76.77 76.78 76.79 76.8 76.81 76.82 76.83 76.84 76.85 Vitamin D per ml NGAL per ml Cystatin C per ml G6 PD per ml Lactate per ml Apo A1 per ml Homocysteine per ml BNP per ml Urinary VMA per ml Blood ketones per ml Lip a per ml ANA per ml Anti phospholipid antibody per ml Vitamin C per ml ENA per ml Vitamin K per ml Iodine per ml APO B per ml Troponin T per ml CK MB1 per ml CK MB 2 per ml TIBC per ml Transferrin per ml IgG per ml IgM per ml IgA per ml Inhibin A per ml β trace protein per ml Βeta 2 microgobulin per ml Alpha 1 Antitrypsin per ml α -1 Microglobulin per ml α-2 Macroglobulin per ml Screening kit for inborn error of metabolism per ml EQAS for clinical chemistry,Immunoassay, electrolyte, HbA1C. per ml 263 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 76.86 TPO (Thyroperoxidase) antibody per ml 76.88 TNF-a per ml 76.87 76.89 76.9 76.91 76.92 76.93 76.94 76.95 76.96 76.97 76.98 Control for M-band electrophoresis IL-2 77.05 77.06 77.07 77.08 77.09 77.1 77.11 77.12 77.13 77.14 77.15 77.16 77.17 77.18 77.19 77.2 per ml 5'GTGGCTGTTCCGGGATGGCCTTCTG3’ per ml 5'CTTGAAGAAGGGCTCACTCTGTTTG3’ per ml 5'CAGTACGATGATGCAGC3’ per ml 5'CAGGTAGAAGAGGCGGT3’ per ml amikacin ,neomycin & tobramycin standard (HPLC grade) Acrylic - Heat cure-pink 77.04 per ml 5'AAAAGCTCTTCCCGCAGGATCCCGC3’ 77.01 77.03 per ml 5'ACAGCGTCATGGCAGAGCAGGTGGC3’ EDTA gel (15%) 77.02 per ml Procalcitonin 76.99 77 per ml per ml Dental Consumables per ml Per gm Acrylic - Heat cure-clear Pc Pc Acrylic - Self cure-clear Pc Acrylic - Self cure-pink Pc Agate Spatula Pc Alginate impression material ( Dustless) Pc Articulation paper Pc Bur - Airotor-Diamond Pc Bur - Airotor-TC- straight fissure Pc Calcium Hydroxide paste for root canal Pc Dappen dish Pc Dental Floss – waxed, 25 m Pc Dental Stone Pc Dentin bonding agent Pc Die stone Pc Disposable Suction Tips with copper wire Pc Emery Sheet - 100, 150 and 400 Grade Pc Endodontic Gutta Percha Points(15-80) Pc Etchant gel ( 37 % Phosphoric Acid) Pc Fiber Composite splint Pc Flexible Composite polishing discs Pc 264 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 77.21 Formocresol Pc 77.23 Glass Ionomer Cement Type I Pc 77.22 77.24 77.25 77.26 77.27 77.28 77.29 77.3 77.31 77.32 77.33 77.34 77.35 77.36 77.37 77.38 77.39 77.4 77.41 77.42 77.43 77.44 77.45 77.46 77.47 77.48 77.49 77.5 77.51 77.52 77.53 77.54 77.55 77.56 GIC- High strength pacakable for posteriors Pc Glass Ionomer Cement Type II Pc Gluma Dentin Desensitizer Pc Gutta Percha Sticks Pc Halogen bulbs- 12V, 55 W Pc Hydroxyapatite Bone graft Material Pc K File - all sizes Pc Light cure composite - Flowable - All shades Pc Light cure composite - nano-hybrid – all shades Pc Modelling wax sheet no.2 Pc Non Eugenol Impression Paste - standard pack Pc Pinnacle tracing sticks ( minimum three years shelf life) Pc Polishing brush for dental lathe Pc Polymer Reinforced Zinc oxide Eugenol cement Pc Pumice powder for polishing dentures Pc Silver reinforced Glass Ionomer Pc Supernal Base Plate Pc Tissue conditioner ( Soft reliner) Pc Ultrasonic scaler tip Pc Vacuum formed sheets - Soft and hard - 2 and 3mm Pc Vulcanite Trimmer ( TC) Pc Zinc oxide Eugenol impression paste Self Cure Acrylic Tooth Colour Temporary Crown Materials (Powder & Liquid) Cold - Cure Acrylic Powder With Liquid (White Colour) Pits and Fissure Sealant Pc Pc Pc Pc Zinc oxide Eugenol impression paste Pc IRM (Intermediate Restorative Materials) Pc GIC Fuji Tupe IX Pc GIC Type -II Restoative Materials Pc Light Cure Composite Nano- Filling Materials Pc Alginate impression material ( Dustless) Pc Dental Stone Pc Wedges Pc Sodium Hypochloride Solution Pc 265 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 77.57 Miracle Mix Materials Pc 77.59 Dycal Pc 77.58 77.6 77.61 77.62 77.63 77.64 77.65 77.66 77.67 77.68 77.69 77.7 77.71 77.72 77.73 77.74 77.75 77.76 77.77 77.78 77.79 77.8 77.81 77.82 77.83 77.84 77.85 77.86 77.87 77.88 77.89 77.9 77.91 77.92 Hand Piece Lubricant Pc Suction Tips Pc Acrylic Teeth Set Pc Polishing Paste Pc Polishing Rubber Cups and Bristle Pc Disposable Glass Pc Abrasive Strips for Polishing Proximal Areas of Teeth Pc Cellophene Matrix Strips for LC Restoration Pc Applicator Tips for LC Pc Desensitizing Varnish Pc Burs For Tooth Reduction Set Pc Dental stone cutting Burs (Small Size) Pc H-Files for Both Anterior and Posterior Pc K- File for Both Anterior and Posterior Pc Broaches Pc Reamers for Both Anterior and Posterior Pc Gutta Percha Pc Absorbant Paper Point Pc Titanium Post (All Sizes) Pc Protapper Gutta Parcha All Size Pc Alveogel Pc RC CAL (Intra Canal Dressing Paste) Pc Fiber Optics Air Rotor Hand Pieces with Coupling Unit Pc GP Cutter Pc Tungsten Carbide Burs For Air Rotor and Micro Motor HandPieces Pc Sectional Matrixs Pc Metal Crown Pc Zinc oxide powder and eugenol (Big Size) Pc Zinc oxide eugenol (Powder ) Pc Zinc oxide eugenol (Liquid) Pc Zinc oxide eugenol (ready mix) Pc ZnO Impression paste Pc Dycal Cement Pc Stone burs (all sizes and shape) Pc 266 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 77.93 Stone burs for polishing (fine) Pc 77.95 Composite Cement Pc 77.94 77.96 77.97 77.98 77.99 78 78.01 78.02 78.03 78.04 78.05 78.06 78.07 78.08 78.09 78.1 78.11 78.12 78.13 78.14 78.15 78.16 78.17 78.18 78.19 78.2 78.21 78.22 78.23 78.24 78.25 78.26 78.27 78.28 Composit polishing disc Pc Composite filling kit Pc Composite finishing and polishing Pc Composite polishing disc Pc Composite polishing kit Pc Composite polishing paste Pc Endo Wash 5% 450ml Pc Bristle Brush & Cup Pc Eugenol 15ml Pc Eugenol 110ml Pc DPI Selfcure Pc Ketac Molar Pc NT Premium Pc One Coat Bond Pc GIC LC (Mini) GC Pc PIVO Crown & Bridge Kit Pc Protaper Hand Kit 21/25mm Pc Mouth Mith Handle (GDC) Pc Explorer (GDC) Pc Surgical scissor (BRP) Pc DPI Alloy Pc Tri Hawk Pc Glyde 3mlx1 Pc GP F4-F5 (Dentsply) Pc GP (15/35/40 ) Dentsply Pc Dtech Etchn Pc H File 15/20/25 Pc Matrix Band No1 Pc Diamond Bur Pc Shofu Crown & Bridge Kit Pc Vitrebond Pc AH 26 Pc Ketac Silver Pc API Needle Holder Pc 267 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 78.29 NSK Push Button Airotor Handpiece Pc 78.31 Lightcure Michine Coltene Pc 78.3 78.32 78.33 78.34 78.35 78.36 78.37 78.38 78.39 78.4 78.41 78.42 78.43 78.44 78.45 78.46 78.47 78.48 78.49 78.5 78.51 78.52 78.53 78.54 78.55 78.56 78.57 78.58 78.59 78.6 78.61 78.62 78.63 78.64 Apex Locator Pixi Dentsply Pc Sealer Machine with Pouch Pc Scaller Tips Satellec Pc Ultrasonic Cleaner Pc Smart Burs Pc Anti Fog Mouth Mirror Pc Flouride Solution with Applicator Pc Luting Cement Pc Silicon Base Impression Materials Pc Base Putty Impression Materials Pc Light Body Impression Materials Pc Re Cap Pc DVI Self Pc Propopar Band Kit 21/25ml Pc GHOFU Crown & Bridge Kit Pc ALT 26 Pc APL Needle Holder Pc Giyote 3ml Pc IA File 15/20/25 Pc Otech Pc Flowable Composite Shade Pc Plastic Filling Instruments Pc Cement Spatula Pc Cement Condenser Pc Ball Burnisher (API) Pc Extraction Forcept for Pedo (set of 16) Pc Tweezer Pc Diamond Round Bur Pc Diamond Straight Fissure Bur Pc Diamond Cone Shape Bur Pc Contra Angle Hand Piece Pc Paper point (15-40 & 45-80) Pc Flamed Shaped Diamond Bur (All Sizes) Pc Spoon Excavator Pc 268 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 78.65 Cold Mold Seal Pc 78.67 Shade Guide Pc 78.66 78.68 78.69 78.7 78.71 78.72 78.73 78.74 78.75 78.76 78.77 78.78 78.79 78.8 78.81 78.82 78.83 78.84 78.85 78.86 78.87 78.88 78.89 78.9 78.91 78.92 78.93 78.94 78.95 78.96 78.97 78.98 78.99 79 Pain Off Pc Coe- Pack Pc Apexit Plus Pc Fibre Post (yellow, red , blue) Pc Gingival Retraction Cord Pc Spreader /Plugger (all sizes) Pc Disposable Napkin Pc Crown Cutting Kit Pc Elevators (straight and periostal) Pc Extraction Forcept for pedo adult (set of 14) Pc G-coat Plus Pc Protemp with tips and gun Pc GIC Type IX Pc Durable Flouride Releasing Coating Pc Light Curing nano ionomer restorative Pc Remin pro (protective dental cream) Pc Chair Bulbs (ocero Infinity) Pc Cold cure (pink) powder Pc Cold cure (White) powder Pc Cold Cure Liquid Pc Green Sticks Pc Mercury Pc Disposable Patient Apron Pc Bobe Cutter Pc Bobe ronger Pc Bone file Pc Mought Prod Chain Pc Macet/Hammer Pc Amalgam Condenser Pc Amalgam carrier Pc Amalgam Curver Pc Wax Knife Pc Wire Cutter Pc Plier Pc 269 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 79.01 Rubber dam Kit Pc 79.03 Micromotor drill bits Pc 79.02 79.04 79.05 79.06 79.07 79.08 79.09 Crown remover Pc Compo Roller Pc GP Holder Pc Surgical Micromotor Pc Periodontal Probe Pc Acrylic Mixing Jar Pc Air Polisher Pc Oral and Maxillofacial Surgery 79.1 S.S. Inter maxillary fixation Screws 2.0mm - 12-14mm Pc 79.12 Titanium cranial microplates (0.5mm plate thickness)10-18hole straight Pc 79.11 79.13 79.14 79.15 79.16 79.17 79.18 79.19 79.2 79.21 79.22 79.23 79.24 79.25 79.26 79.27 79.28 79.29 79.3 79.31 79.32 79.33 79.34 79.35 S.S. Inter maxillary fixation Screws 2.5mm - 12-14 mm Titanium mandible miniplates (1mm plate thickness) 4 hole with bar/gap Titanium mandible miniplates (1mm plate thickness) 10-12hole straight Titanium midfacial miniplates (0.5-0.6mm plate thickness) L plate 90 degree long 4 hole with bar/gap Right side Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 90 degree Long 4 hole with bar/gap left side. Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree short 4 hole with bar/gap Right side Titanum Mid Facial Miniplates (0.5-0.6mm plates thickness) L plate 100-110 degree short 4 hole with bar/ gap Left side Titannium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree long 4 hole with bar/gap Right side Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree Long 4 hole With bar/gap Left side Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 4 hole With bar/gap Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 6 hole with bar/gap . Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 10 hole Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) T Plates 5 holes Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Y plate 4 holes Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Double Y plate 4 holes Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) X plate 5 holes Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Straight plate 10-12 holes Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 12-16 holes Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 20-25 holes Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 12-16 holes Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 20-25 holes Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 12-16 holes Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 20-25 holes Titanium double angled Reconstruction plates (2-2.4mm plate thickness) 20-25 holes 270 Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 79.36 Titanium Cranial ( outer diameter 1.0-1.2 mm) non self drilling screw- 4-6 mm length Pc 79.38 Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -8 mm length Pc 79.37 79.39 79.4 79.41 79.42 79.43 79.44 79.45 79.46 79.47 79.48 79.49 79.5 79.51 79.52 79.53 79.54 79.55 79.56 79.57 79.58 79.59 79.6 79.61 79.62 79.63 Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -6mm length Titanium midfacial (outer diameter 1.8/1.9mm) non self- drilling emergency screw -6 mm length Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -6mm length Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -8mm length Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -6mm length Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -8 mm length Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling screw -10mm length Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling Maxi screw -12mm length Titanium Reconstruction (2.4mm) non self- drilling Maxi Emergency screw -8-20mm length Titanium Lag Screws non self drilling ( outer diameter 2.4/2.5 mm)- 15-20mm length Drill bit with 6mm stop for Titanium cranial (1.0/1.2mm,1.0 mm pilot hole diameter) non self- drilling screw Drill bit with 6mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screw Drill bit with 8mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screw Drill bit with 6mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screw Drill bit with 8mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screw Drill bit with 10-12mm stop for Titanium (2.4mm reconstruction, pilot hole diameter 2mm) non self-drilling screw Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 4x4 cms Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 6x6 cms Titanium Mesh for mandible (0.5-0.6mm thickness) approx. dimension 10x8 cms Titanium orbital reconstruction mesh plates- Small Titanium orbital reconstruction mesh plates- Medium Titanium orbital reconstruction mesh plates- Large ( with medial and lateral wall extensions) Porous Polyethylene Orbital sheets ( 0.8-1.5 mm thickness; 5x5 cms approx) 26 guage Stainless Steel wire spool 32 guage Stainless Steel wire spool Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Pc Raney Clips Stainless Steel Pc Orthodontics 79.64 022 slot MBT Brackets with weldable convertible UTLD first molar Buccal tubes and NC II molar tubes Pc 79.66 016 Multistranded SS wire Pc 79.65 79.67 79.68 79.69 79.7 Crimpable hooks Preformed Archwire - 014 NiTi U/ L Pc Pc Preformed Archwire - 016 NiTi U/ L Pc Preformed Archwire - 016 x 022 SS – U/L Pc Preformed Archwire - 017 x 025 SS– U /L Pc 271 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 79.71 Preformed Archwire - 019 x 025 SS – U / L Pc 79.73 Dunaform – soft and hard sheets- 2mm, 3mm Pc 79.72 Orthodontic stone Pc Non -Consumables 79.74 Dental Surgery Pc 79.76 Mouth mirror Pc 79.75 79.77 79.78 79.79 79.8 79.81 Mouth Mirror with Handle Pc Dental probe Pc Periodontal probe Pc Dental Explorer ( Curved and pigtail) Pc Glass Bead Sterilizer Pc Airotor handpiece - Mini-head (2 years warranty) Pc Oral and Maxillofacial Surgery 79.82 Medesy/Hu Friedy Maxillary Anterior Extraction forceps Pc 79.84 Medesy/Hu Friedy Maxillary Premolar Extraction forceps Pc 79.83 79.85 79.86 79.87 79.88 79.89 79.9 79.91 79.92 79.93 79.94 79.95 79.96 79.97 79.98 79.99 80 80.01 80.02 80.03 80.04 Medesy/Hu Friedy Maxillary Reed's Extraction forceps Pc Medesy/Hu Friedy Maxillary Molar Extraction forceps Right/Left Pc Medesy/Hu Friedy Maxillary Bayonet Extraction forceps Pc Medesy/Hu Friedy MaxillaryThird molar Extraction forceps Pc Medesy/Hu Friedy Mandibular Anterior Extraction forceps Pc Medesy/Hu Friedy Mandibular premolar Extraction forceps Pc Medesy/Hu Friedy Mandibular molar Extraction forceps Pc Medesy/Hu Friedy Warwick James Elevator-Straight Pc Medesy/Hu FriedyWarwick James Elevator-Right/Left Pc Medesy/Hu FriedyCryer's Elevator-Small size- Right/Left Pc Medesy/Hu FriedyCryer's Elevator-Medium size- Right/Left Pc Medesy/Hu FriedyCryer's Elevator- Large Size-Right/left Pc Double angled Currette- Medium size Pc Double angled Currette- Large size Pc Molt's Perisoteal Elevator Pc Freer Periosteal Elevator Pc Walsham's nasal Forceps- Pair Pc Asche Septal Forceps Pc Hayton's Williams maxillary forceps Pc Rowe's zygomatic elevator Pc Sigmoid Notch retractor (Left/Right) Pc 272 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 80.05 Ramal Retractor Pc 80.07 wire twister Pc 80.06 80.08 80.09 80.1 80.11 80.12 80.13 80.14 80.15 80.16 80.17 80.18 80.19 80.2 80.21 80.22 80.23 80.24 wire cutter Pc Coronoid retractor Pc Mastoid self retaining retractor Pc Mandibular Lower Border retractor Pc Condylar retractor Pc Dingmann retractor ( Adult) Pc Vestibular retractor Pc Swallow Tail retractor Pc Curved Pterygoid osteotome 8mm Pc Curved Pterygoid osteotome 10mm Pc Epker Osteotome 4mm/6mm/8mm Curved Pc Epker Osteotome 4mm/6mm/8mm Straight with marking Pc Orthodontics Orthodontic model boxes Pc Dontrix gauge Pc Tongue Guard - Medium Pc Extraoral Force gauge Pc Orthodontic Typodont set ( With wax ridges and teeth set ) Plaster Vibrator (Worktop area of at least 20 X 10 cm, adjustable setting, 2 years warranty) IVF Consumables for ART Clinic Pc Pc 80.25 Haematoxylin & Eosin Stain Pc 80.27 V.G. Tube Pc 80.26 80.28 80.29 80.3 80.31 80.32 80.33 80.34 80.35 80.36 80.37 80.38 Eosin & Negrosin stain Pc ICSI Holding Needle Pc ICSI injecting Pipette Pc Nunt & Well Dish Pc 140 Micro Deadering Pipette Pc 170 Micro Desdering Pipette (Flexipet Denuding) Pc 300 Micro Desdering Pipette (Flexipet Denuding) Pc Manipulation Pipette Pc Embryo Transfer cath Pc Single Lumen Ovum Pickup Pc 14ml Round Bottom Tube Pc 5ml Round Bottom Tube Pc 273 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 80.39 15ml Conical Tube (Poly Sterile) Pc 80.41 Central Well Dish 60ml Pc 80.4 80.42 80.43 80.44 80.45 80.46 80.47 80.48 80.49 80.5 80.51 80.52 80.53 80.54 80.55 80.56 80.57 80.58 80.59 80.6 80.61 80.62 80.63 80.64 80.65 80.66 80.67 80.68 80.69 80.7 80.71 80.72 80.73 80.74 Petri Dish 60 x 15ml Pc ICSI Dish (Petri Dish) 50 x 9mm Pc Metallic TVS Needle Guided Bracket Pc Denuding Pipette 170micron Pc Denuding Pipette 140micron Pc Double Lumen Drum Pick Up Needle Pc Syringe Non Rubber 1ml Pc Recombinant FSH (Pen) Pc Recombinant HCG 250 IU Pc Recombinant HCG 500 IU Pc Highly Purified HMG 75 Pc Highly Purified HMG 150 Pc GnRh Antagonist .25mg Pc GnRh agonist 1mg, 4m Pc Granulocyte colony stimulating factor Pc Pipelle Aspirator/Vabra Aspirator Pc Progesterone gel Pc Injectable Progesterone Pc IUI catheter Pc Latex Condom without spermicide Pc Highly Purified FSH 75 Pc Highly Purified FSH 150 Pc Recombinant LH -75 Pc Recombinant LH -150 Pc IUI Media/Sperm Wash Media Pc I.V.F Flushing Media Pc I.V.F Culture Media Pc I.V.F Cleavage Media Pc Blastocyst Culture Media Pc Embryo Transfer Media Pc Verification Media Pc Thawing Media Pc Cryolock Pc Halo Kit (Hyase Media) Pc 274 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 80.75 Fertilization Medium Pc 80.77 Hyaluronidase Solution Pc 80.76 80.78 80.79 80.8 80.81 80.82 80.83 80.84 80.85 80.86 80.87 80.88 80.89 80.9 80.91 80.92 80.93 80.94 80.95 80.96 80.97 80.98 80.99 81 81.01 81.02 81.03 Warming Media Pc PVP Solution Pc Culture Oil Pc Embryo Freezing Media Pc IUI Media/Sperm Wash Media - HEPES (with amino acids) Pc Sperm Gradient Medium 45% Pc Sperm Freezing Media Pc Sperm Wash Media Pc Warming Media Pc Embryo Freezing Media Pc Embryo Thawing Media Pc Sperm Gradient Medium Pc Sperm Freezing Medium Pc Inj Recagon 600IU Pc Inj Gonal F 450IU Pc Inj hmg 150Iu Pc Inj Cetro Relix 0.25 Pc Inj Menotropin 75 IU Pc Osafe Incubator and Laminar Floor Cleaning Lotion Pc Fersafe Antiseptic Lotion Pc Liquid Nitrogen for Cryocan Pc Immunobeads Reagents( Rabbit Anti Human IgG Pc Immunobeads Reagents( Rabbit Anti Human IgA Pc Immunobeads Reagents( Rabbit Anti Human IgM Pc Conical Dispo Beaker 3.0ml Pc Inj HMG 75 IU Inj HMG 150Iu Pc Additional Consumables & Disposables Pc 81.04 PRP Lens Each 81.06 Kymograph Paper (100 sheets) Each 81.05 81.07 81.08 81.09 FAC's Tube (12 x 75mm, 5ml Round Bottom Test Tube, snap, sterile Cat: 352054 Perimetric Chart Paper (100 sheets) Each Each Haemocytometer Box Each Haemoglobinometer sets Each 275 Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 81.1 Dewar Tank 11 litre Each 81.12 Bulb for Telepack Lamp Each 81.11 81.13 81.14 81.15 81.16 81.17 81.18 81.19 81.2 81.21 81.22 81.23 81.24 81.25 81.26 81.27 81.28 81.29 81.3 81.31 81.32 81.33 81.34 81.35 81.36 81.37 81.38 81.39 CRYO PRO - 500ml (Liquid Nitrogen Cryosurgical Equipment Each Radiofrequency Electrode Round Loop Big Each Radiofrequency Electrode Round Loop Small Each Bacterial Filter Machine sl No:101122008 Each Indirect Ophthalmoscope Each 20448-000Hgh Pressure Hose(Erbe Cryo Unit)) Each Bone hand Drill Moore - 8448.28 Each Hand Drill Jacobs Chuck Each Demartel Condf/Wire Sawsflex 350mm Each Twist Drill Set of 3mm, 3.5mm 4mm, 4.5mm Each Crocodile Forceps (Ear Microsurgery) Each Ear Microsuction Tips Each Adaptors for Ear Microsuction Tips Each Cup Ear Forceps Each Perforators for Stopedectomy 0.4mm Each Perforators for Stopedectomy 0.5mm Each Rigid Pharyngoscope (pediatric) 20cm Each Tonsil Holding Forceps Each Straight Pick (Tympanyplasty) Each Back Biting Forceps for Endoscope Nasal Surgery Each Fiberoptic Otoscope with Pneumatic Pump Each Bismith lodopyrrophosphate (BIPP) Paste/Powder Each Mercurochrome Lotion Each Haed Light fot ENT Each Endoscopic Biopsy Forceps with Needle Each CPR Manikin Each Intubation Manikin Easy Pump Each Each Contrast 81.4 MRI Contrast Media - Gadoterate Meglumine Injection 5mmmol /ml. 10 ml vial vial 81.42 MRI Contrast Media - Gadopentetate Dimeglumine Injection 0.5mmol/ml. 10 ml vial vial 81.41 81.43 81.44 MRI Contrast Media - Gadobenate Dimeglumine Injection 10ml vial MRI Contrast Media - Gadobutrol Pre -Filled Syringe Injection 5ml Non -Ionic Contrast Media - Iopromide Injection: USP 370mg - 50 ml vial 276 vial vial vial Tender enquiry no: neigr/s&p/ot/e-62/2016 -17 81.45 Non -Ionic Contrast Media - Iopromide Injection: USP 370mg -100ml vial vial 81.47 Non -Ionic Contrast Media -Iobitridol 350mg -100ml vial vial 81.46 81.48 81.49 81.5 81.51 81.52 81.53 81.54 81.55 81.56 81.57 81.58 Non -Ionic Contrast Media - Iopromide Injection: USP 300mg -100ml vial Non -Ionic Contrast Media -Iomeprol Injection 300mg -50ml vial vial vial Non -Ionic Contrast Media -Iomeprol Injection 300mg -100ml vial vial Non -Ionic Contrast Media -Iomeprol Injection 350mg -50ml vial vial Non -Ionic Contrast Media -Iomeprol Injection 350mg -100ml vial vial Non -Ionic Contrast Media -Iomeprol Injection 400mg -50ml vial vial Non -Ionic Contrast Media -Iomeprol Injection 400mg -100ml vial vial Non -Ionic Contrast Media -Iopamidol Injection 370mg -50ml vial vial Non -Ionic Contrast Media -Iopamidol Injection 370mg -100ml vial vial Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 20ml vial vial Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 50ml vial Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 100ml vial 277 vial vial
© Copyright 2025 Paperzz