J Antimicrob Chemother 2013; 68: 778 – 785
doi:10.1093/jac/dks481 Advance Access publication 7 December 2012
Mechanisms of azole resistance in 52 clinical isolates
of Candida tropicalis in China
Cen Jiang, Danfeng Dong, Beiqin Yu, Gang Cai, Xuefeng Wang, Yuhua Ji and Yibing Peng*
Department of Laboratory Medicine, Ruijin Hospital, Shanghai Jiaotong University School of Medicine,
197 Ruijin No.2 Road, Shanghai 200025, China
*Corresponding author. Tel: +86-21-64370045. Fax: +86-21-64311744; E-mail: [email protected]
Received 10 August 2012; returned 21 September 2012; revised 23 October 2012; accepted 2 November 2012
Objectives: To explore the mechanisms underlying azole resistance in clinical isolates of Candida tropicalis
collected in China by focusing on their efflux pumps, respiratory status and azole antifungal target enzyme.
Methods: Fifty-two clinical isolates of C. tropicalis were collected from five hospitals in four provinces of China
and antifungal susceptibility tests were performed. Rhodamine 6G and rhodamine 123 were used to investigate
the efflux pumps and respiratory status, respectively. Transporter-related genes CDR1 and MDR1, mitochondrial
gene CYTb, as well as ERG11, were quantified by real-time RT–PCR. Meanwhile, ergosterol content was analysed
using liquid chromatography-mass spectrometry/mass spectrometry. An ERG11-deficient (erg11D) Saccharomyces cerevisiae strain was generated to study the function of mutations in ERG11.
Results: MICs showed that 31 isolates were resistant to at least one type of azole antifungal. Flow cytometry
using rhodamine 123 revealed increased respiration for the azole-resistant isolates, but CYTb was not overexpressed. No significant difference in the efflux of rhodamine 6G was found, which was consistent with the comparable expression levels of CDR1 and MDR1. In contrast, the azole-resistant isolates overexpressed ERG11 and
showed increased ergosterol content. Moreover, the isolates resistant to three azole antifungals expressed
higher levels of ERG11 mRNA than those resistant to only fluconazole or itraconazole. Two ERG11 mutations,
Y132F and S154F, were found in azole-resistant isolates and could be shown to mediate azole resistance by
expression in S. cerevisiae.
Conclusions: The up-regulation and mutations of ERG11 mediate azole resistance of C. tropicalis.
Keywords: antifungals, ERG11, ergosterol
Introduction
Candida species are important opportunistic pathogens that
cause several diseases in immunocompromised patients.
Although Candida albicans remains the most common Candida
species encountered, the morbidity and mortality caused by
non-albicans Candida species are increasing. According to a
survey of invasive candidiasis in the USA,1 the rate of isolation
of C. albicans declined between 1997 and 2003, whereas that
of Candida parapsilosis and Candida tropicalis increased from
4.2% to 7.3% and from 4.6% to 7.5%, respectively. C. tropicalis,
which ranked second among non-albicans Candida species,
tends to cause fungaemia among patients with cancer, neutropenia, malignancy or bone marrow transplantation.2 – 4 The proportion of C. tropicalis in India, Brazil and Taiwan seems to be
higher than in other regions.5,6 Furthermore, C. tropicalis causes
invasive disease in neonatal intensive care units (ICUs) through
cross-contamination and has a slight tendency to progress
from colonization to infection.7
Antifungal resistance is a serious issue for treating infections
caused by Candida spp. C. tropicalis is intrinsically resistant to
5-fluorocytosine and has a moderate level of fluconazole resistance,8 but the species will quickly develop resistance to azole
antifungals after exposure to these compounds. Azole resistance
among Candida spp. caused by mutations, the overexpression
of the drug target and the up-regulation of transporters is
increasingly common and alternative mechanisms, such as
biofilm formation and mitochondrial defects, have also been
recently documented. The cytochrome P450 lanosterol
14a-demethylase encoded by the ERG11 gene is the primary
target for azole antifungals.9 ERG11 overexpression and mutations have been reported to result in azole antifungal resistance;
the amino acid substitutions changing the affinity of the enzyme.
Moreover, at least two families of multidrug transporters, the
# The Author 2012. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: [email protected]
778
JAC
Mechanisms of azole resistance in C. tropicalis
ABC (ATP-binding cassette) transporter family and the major facilitator superfamily (MFS), are involved in azole resistance.10 The
up-regulation of CDR1 and MDR1 genes, encoding the efflux proteins of these two transporter families, respectively, has been
reported to contribute to the active efflux of azole drugs in
several Candida spp.10,11 Azole resistance caused by respiration
deficiency, which primarily decreases the production of ATP and
reactive oxygen species (ROS) in mitochondria, has been reported
in both C. albicans and Candida glabrata.12,13 However, little is
known to date about the mechanisms of azole resistance in
C. tropicalis.
In this study, we set out to explore the mechanisms underlying azole resistance in 52 clinical isolates of C. tropicalis collected in China by focusing on their efflux pumps, respiratory
status and azole antifungal target enzyme.
Materials and methods
was then evaluated by FACScan flow cytometry. The fluorescence of
the cells incubated without rhodamine 6G served as an unstained
control. The fluorescence was expressed as geometric mean values
and the data presented correspond to fluorescence frequency distribution histograms (relative number of cells versus relative fluorescence intensity, as expressed in arbitrary units on a logarithmic scale). Each
experiment
was
performed
in
triplicate
and
a
clinical
fluconazole-resistant C. glabrata, which has been demonstrated to have
an obvious efflux effect in a previous study,17 was used as a positive
control.
Measurement of respiratory capacity
Rhodamine 123 (Sigma– Aldrich) is a fluorochrome that is sensitive to the
mitochondrial membrane potential and concentrates specifically in the
mitochondria. Therefore we used the method developed by Skowronek
et al.18 to analyse the respiratory status of C. tropicalis, with or without
sodium azide (NaN3). Flow cytometry was performed as described
above and each experiment was performed in triplicate.
Strains and medium
A total of 52 C. tropicalis isolates were collected from five hospitals in
Shanghai, Jiangsu, Guangdong and Anhui Provinces in China. The isolates
were identified using standard biochemical and microbiological procedures, including assessment of the carbohydrate assimilation pattern
(API 21C, Paris, France) and colony colour in chromogenic medium (Chromagar, Paris, France). All of the isolates were maintained by biweekly
passages on YPD agar containing 10 g/L yeast extract, 21 g/L peptone
and 21 g/L dextrose. Escherichia coli strain DH5a and Luria– Bertani (LB)
medium were used for the transformation and plasmid DNA preparation.
Saccharomyces cerevisiae W303-1A (MATa SUC2 ade2 can1 his3 leu2 trp1
ura3) was generously provided by Professor Alistair Brown. The transformants were selected on synthetic defined medium with dextrose and the
appropriate supplements.
Antifungal susceptibility tests
The MICs of fluconazole, itraconazole and voriconazole (Pfizer Pharmaceuticals, Shanghai, China) for the 52 C. tropicalis strains were determined using the broth microdilution method according to CLSI M27-A3
standard guidelines. Candida parapsilosis ATCC 22019 and Candida
krusei ATCC 6258 were used as the quality control isolates. The range
of fluconazole, itraconazole and voriconazole was from 0.125 to
64 mg/L, 0.031 to 16 mg/L and 0.007 to 4 mg/L, respectively. MIC breakpoints of fluconazole and voriconazole were determined at 24 h according to reports by Pfaller et al.14,15 and those of itraconazole were
determined at 48 h according to M27-A3. The MICs of these three
azole antifungals for resistant isolates were ≥8, ≥1 and ≥1 mg/L,
respectively.
Flow cytometric analysis of the efflux of rhodamine 6G
The activity of efflux pumps was evaluated using flow cytometry by
measuring the efflux of rhodamine 6G (Sigma– Aldrich, St Louis, MO,
USA), a fluorescent dye that uses the same membrane transporter as
azoles in some Candida spp.16 Yeast cells (108) in YPD were suspended
in 2 mL of PBS and incubated at 308C with constant shaking for 4 h to
induce starvation. Rhodamine 6G at 10 mM was then added and incubated for 2 h at 308C. The uptake of rhodamine 6G was stopped, the
cells were washed twice in cold sterile PBS and the fluorescence of the
cells was immediately quantified at 535 nm using a Beckman Coulter
Epics XL FACScan flow cytometer. Glucose (4 mM) was added and incubated at 308C for an additional hour. The fluorescence of 20000 cells
Quantitative real-time RT– PCR
Total RNA was extracted from isolates grown to the exponential phase in
YPD medium using the Yeast RNAiso Reagent Kit (TaKaRa, Tokyo, Japan)
according to the instructions of the manufacturer. The total RNA was
quantified using a Synergy H1 Microplate Reader (Biotek, Winooski, VT,
USA) and reverse transcribed to cDNA using the PrimeScript RT Reagent
Kit (TaKaRa, Tokyo, Japan). The quantitative real-time RT–PCR of CYTb,
CDR1, MDR1 and ERG11 was performed using the SYBR Premix Ex Taq
Kit (TaKaRa, Tokyo, Japan) and a LightCycler 480 Real-Time PCR System
(Roche, Shanghai, China). ACT was used as the internal control. All of
the reactions were performed as follows: denaturation at 958C for 30 s,
followed by 40 cycles consisting of 5 s at 958C and 21 s at 608C. Each
sample was processed in triplicate and a change of 2.5 times was considered to be overexpressed. The primers used in the real-time RT–PCR are
described in Table 1.
Ergosterol analysis
Ergosterol was extracted from lyophilized C. tropicalis cells grown to the
stationary phase in YPD medium. Methanol (5 mL) was added to
10 mg of dried cells and the cells were sonicated at 608C for 2 h to dissolve the ergosterol. The sonicated solution was then centrifuged at
3000 g to obtain the supernatant, which was processed using a liquid
chromatography-mass spectrometry/mass spectrometry (LC-MS/MS)
system that consisted of an API4000 triple quadrupole mass spectrometer (AB Sciex Inc., Framingham, MA, USA) and a Shimadzu LC-20ADXR
HPLC System (Shimadzu Inc., Tokyo, Japan). A Venusil XBP Phenyl
column (2.1×100 mm, 3.5 mm; Agela Technologies, Tianjin, China)
was used to separate the ergosterol at 358C and an elution rate of
0.5 mL/min. A standard curve was constructed for the range 1–20 mg/mL
by plotting the signal intensity against the corresponding ergosterol
concentration. The concentration of ergosterol in the samples was
determined by comparing the peak areas of ergosterol with those of
the standard curve. This was accomplished using the Analyst software
package (version 1.5.2).
ERG11 amplification and sequencing
C. tropicalis genomic DNA was extracted as previously described19 and
was used as the template for the amplification of the full-length
ERG11 gene. The primers used for the amplification and sequencing
were designed as previously described.20
779
Jiang et al.
Table 1. Primers used in this study
Sequence (5′ -3′ )
Gene
ACT
F: TTTACGCTGGTTTCTCCTTGCC
R: GCAGCTTCCAAACCTAAATCGG
F: TGAAGCCAGACCCGTAGTTG
R: CCACTTTGCCCATCCTAACA
F: TAAAGCAGGCTGGAGATGGA
R: ACAACCTCCAACTATAGCTA
F: TGTCAGCCATCCCATTCATT
R: TGCGTAGAATGGTAAGAGGT
F: CTACTCCCAAAAAAAACCATA
R: TAAACCTAATCCCAAGACATC
F: CGGGGTACCCAACCTATTCTTTTGTCAAC (restriction site of KpnI underlined)
R: GCCGCTCGAGATGGGATTTTTCTAGCTACT (restriction site of XhoI underlined)
F: TCCTTCACAATTGCAGCAGGCTTGAATAGAAACAGAACAAACGAGTAATACAAGGATGTCTGTTATTAATTTCACAGGTA
R: TGAATGTACAACTTCTCTCTTTTTCTGTTTTTTTTTTTTTTCTCAGTTACAAACCCTATTTCTTAGCATTTTTGACGAAA
AATTGCAGCAGGCTTGAATAGA
AGAGCACCCTTAACAAACTTCT
ACAAGGGAATAAACGAATGAG
CDR1
MDR1
CYTb
ERG11 for RT–PCR
ERG11 for clone
ERG-TRP
ERGuF
ERGiR
TRPiR
Table 2. S. cerevisiae strains used in this study
Strain
S. cerevisiae W303-1A
SC1
SC2
SC3
SC4
SC5
Relevant properties
Genotype
—
S. cerevisiae W303-1A transformed with pYES2/CT
S. cerevisiae W303-1A transformed with pYES2/CT-ERG11WT
S. cerevisiae W303-1A transformed with pYES2/CT-ERG11Y132F&S154F
SC2 transformed with TRP
SC3 transformed with TRP
SUC2 ade2 can1 his3 leu2 trp1 ura3 ERG11
SUC2 ade2 can1 his3 leu2 trp1 ura3 ERG11
SUC2 ade2 can1 his3 leu2 trp1 ura3 ERG11
SUC2 ade2 can1 his3 leu2 trp1 ura3 ERG11
SUC2 ade2 can1 his3 leu2 trp1 ura3 erg11D::TRP
SUC2 ade2 can1 his3 leu2 trp1 ura3 erg11D::TRP
Disruption, replacement and functional verification of
ERG11 in S. cerevisiae
Cloning and expression of ERG11
The ERG11 ORFs of a pair of fluconazole-susceptible and fluconazoleresistant matched C. tropicalis strains, 1a and 1b, were amplified from
isolates using primers containing the restriction enzyme sites KpnI and
XhoI (Table 1). The amplified KpnI-XhoI fragment was then ligated into
the KpnI-XhoI sites of pYES2/CT, which contains the GAL1 promoter
and CYC1 terminator. Because S. cerevisiae cannot survive without a
functional lanosterol 14a-demethylase,21,22 S. cerevisiae W303-1A was
first transformed with the cloned plasmid using the Frozen-EZ Yeast
Transformation II Kit (Zymo Research, Irvine, CA, USA) and grown on
selective synthetic dropout-uracil plates (SD-URA) containing galactose
and raffinose to induce the expression of ERG11.
(SD-TRP) at 308C for 3 –5 days, the isolated clones were selected and cultured overnight in liquid SD-TRP for further screening. The genomic DNA
was extracted and amplified using ERGuF-ERGiR and ERGuF-TRPiR primers
(Table 1). Information about all of the S. cerevisiae strains used in this
study is listed in Table 2.
Functional verification of the ERG11 mutations
The MICs of fluconazole, itraconazole and voriconazole for S. cerevisiae
W303-1A, SC1, SC4 and SC5 were determined using the broth microdilution method according to CLSI M27-A3.
Statistical analysis
Data were analysed using SPSS 17.0. Statistical significance was determined using Student’s t-test. Statistical significance was determined as
P, 0.05.
Disruption and replacement of ERG11
Results
The promoter-dependent disruption of genomic ERG11 was performed as
previously described,23 with a few modifications. Briefly, a linear TRP1
DNA fragment was amplified from the pY24GAL plasmid using ERG-TRP
primers (Table 1) and transformed into the transformants mentioned
above. After culturing on selective synthetic dropout-tryptophan plates
Azole susceptibility of C. tropicalis
780
Of the 52 isolates of C. tropicalis, 18 (34.6%) were resistant to fluconazole, 21 (40.4%) were resistant to itraconazole and 4 (7.7%)
were resistant to voriconazole. Among these resistant strains,
JAC
Mechanisms of azole resistance in C. tropicalis
four isolates were resistant to both fluconazole and itraconazole
and another four isolates were resistant to all three azole
antifungals (Table S1, available as Supplementary data at JAC
Online). Thus 31 isolates were resistant to at least one type of
azole antifungal and 21 isolates were susceptible to all three
of the azole antifungals.
Uptake and efflux of rhodamine 6G
The accumulation and efflux of rhodamine 6G were quantified
using flow cytometry to evaluate the function of the yeast transporters. A pair of fluconazole-susceptible and fluconazole-resistant matched C. tropicalis (1a and 1b) were isolated from the
same patient and their homology was demonstrated by multilocus sequence typing (MLST) and repetitive sequence-based PCR
(Rep-PCR) (data not shown). The visual variation of rhodamine
6G for the pair is presented in Figure 1. After a 4 h starvation
and 2 h incubation in PBS with fluorochrome, the mean fluorescence intensity of the cells did not change significantly (black
line). Moreover, the efflux of rhodamine 6G in the resistant
isolate, after the removal of the free dye and an additional incubation of 1 h in PBS with 4 mM glucose, was comparable to that
of the susceptible isolate (grey line). The activity of efflux pumps
was similar in 31 azole-resistant and 21 azole-susceptible
C. tropicalis strains.
Respiratory status of C. tropicalis
The fluorescent dye rhodamine 123 was used to evaluate the
mitochondrial respiratory status of C. tropicalis using flow
90
90
80
80
70
70
Cell number
(b) 100
Cell number
(a) 100
60
50
40
60
50
40
30
30
20
20
10
10
0
100
101
102
103
Mean fluorescence intensity
104
0
100
101
102
103
Mean fluorescence intensity
104
(c) 100
90
80
Cell number
70
60
50
40
30
20
10
0
100
101
102
103
Mean fluorescence intensity
104
Figure 1. Flow cytometric analysis of rhodamine 6G uptake and efflux. The uptake of the fluorochrome was quantified by incubating the cells of
fluconazole-susceptible (a) and fluconazole-resistant (b) matched C. tropicalis with 10 mM rhodamine 6G at 308C for 2 h after starvation (black
lines). The efflux was evaluated by quantifying the residual fluorescence of the cells after the removal of the free dye and an additional
incubation of 1 h in PBS with 4 mM glucose (grey lines). A clinical fluconazole-resistant C. glabrata that has been demonstrated to have an efflux
effect in a previous study was used as a positive control (c).
781
Jiang et al.
*
30
8
S
R
*
S
R
Fold expression level (log2)
Mean f luorescence intensity
35
25
20
15
10
6
4
2
5
0
0
CDR1
Figure 2. Mean fluorescence intensity of rhodamine 123 in
azole-susceptible (S) and -resistant (R) C. tropicalis. Isolates were
incubated with or without 1 mM NaN3 before rhodamine 123 staining
and each experiment was performed in triplicate. Error bars show the
standard deviations. *P,0.05.
cytometry. The results showed that the azole-resistant
isolates incorporated more rhodamine 123 than the susceptible
ones (Figure 2; P, 0.05). Additionally, the fluorescence of the
azole-resistant isolates decreased sharply when they were
pre-treated with NaN3, but the fluorescence of the susceptible
isolates did not change to a great extent (Figure 2). Furthermore,
quantitative real-time RT–PCR of CYTb, a gene functioning in the
respiratory chain in mitochondria, was also performed, but no
significant difference was observed with regard to the expression
level between the two groups (data not shown).
Expression of the CDR1, MDR1 and ERG11 genes
Quantitative
RT–PCR
experiments
revealed
that
31
azole-resistant isolates had higher expression levels of the
ERG11 gene than the 21 azole-susceptible isolates (Figure 3).
In contrast, the CDR1 and MDR1 expression levels in the 31
azole-resistant isolates were not significantly different from the
21 azole-susceptible isolates (Figure 3). Moreover, 4 isolates
resistant to all three of the azole antifungals had a higher level
of ERG11 gene expression than 10 isolates that were only resistant to fluconazole or 13 isolates that were only resistant to
itraconazole (Figure 4).
Ergosterol analysis
The ergosterol contents of the 31 azole-resistant and 21 azolesusceptible C. tropicalis isolates were analysed using LC-MS/MS.
The results did not reveal a significant change in their overall sterol
levels, but the mean ergosterol content of the resistant group was
higher than that of the susceptible group (4.88+0.13 mg/mg
versus 3.84+0.04 mg/mg). Additionally, the fluconazole-resistant
isolate 1b showed a 1.2-fold higher ergosterol content than its
matched fluconazole-susceptible isolate 1a (4.79 mg/mg versus
3.85 mg/mg). Furthermore, the ergosterol contents of the isolates
that were multiresistant to two or three types of azole antifungals
782
MDR1
With NaN3
ERG11
Gene
Figure 3. Fold expression levels of CDR1, MDR1 and ERG11 in
azole-susceptible (S) and -resistant (R) groups of C. tropicalis.
Quantification of each target gene was determined by the 2DDCt
method using the housekeeping gene ACT as a control. Each sample
was processed in triplicate. Error bars show the standard deviations.
*
15
Expression level of ERG11 (log2)
Without NaN3
*
10
5
0
FLC
ITC
FLC + ITC FLC + ITC + VRC
Figure 4. Expression levels of ERG11 in 31 azole-resistant C. tropicalis
isolates. All of the resistant isolates were divided into four groups
according to their resistance to three types of azole antifungals; the
quantities of each mRNA were normalized using the expression level of
ACT mRNA. The results, which are the mean values from triplicate
experiments, represent the fold increase in expression compared with
that in a susceptible isolate. FLC, ITC and VRC represent resistance to
fluconazole, itraconazole and voriconazole, respectively. *P,0.05.
(5.01+0.07 mg/mg and 5.11+0.09 mg/mg) were slightly higher
than the isolates that were only resistant to fluconazole or itraconazole (4.80+0.05 mg/mg and 4.83+0.06 mg/mg).
Mutations in ERG11
The DNA sequence analysis of the ERG11 ORFs revealed that
there were no mutations in the 21 azole-susceptible isolates
compared with the corresponding sequence in the GenBank
database (GenBank accession number M23673). Two missense
mutations Y132F and S154F were discovered in 12 isolates
among the 31 azole-resistant isolates; interestingly, these two
JAC
Mechanisms of azole resistance in C. tropicalis
mutations consistently appeared together. Furthermore, these
two mutations were found in all four of the isolates that were
resistant to the three azole antifungals (Table S1).
Table 3. MICs of azole antifungals for four S. cerevisiae isolates
MIC (mg/L)
Isolate
Mutations Y132F and S154F are involved in azole
resistance
Lanosterol 14a-demethylase is a prominent intermediate in ergosterol biosynthesis and S. cerevisiae cannot survive without
this enzyme.21,22 Therefore the expression plasmid pYES2/CT
with the full-length ERG11 ORF amplified from C. tropicalis 1a
and 1b, with or without the Y132F and S154F mutations, was
transformed into S. cerevisiae W303-1A. An empty plasmid
was transformed as the control (Table 2). The genomic ERG11
of SC2 and SC3 was replaced by homologous recombination
with a linear TRP1 DNA fragment, amplified from pY24GAL
using primers designed with the promoter-dependent disruption
of gene (PRODIGE) method, as previously documented.23 The
principle of the final screen and the electrophoresis results of
the wild-type and erg11D isolates are shown in Figure 5. The
erg11D isolates SC4 and SC5 present bands with ERGuF-TRPiR
primers rather than ERGuF-ERGiR primers. Quantitative real-time
RT–PCR of ERG11 did not show a significant difference between
S. cerevisiae W303-1A, SC4 and SC5 (data not shown). The
(a)
ERGiR
STOP
ATG
ERG11
ERGuF
TRP1
ATG
TRPiR
STOP
(b)
1
ERG11
2
3
marker
4
5
erg11D
1000 bp
700 bp
500 bp
400 bp
300 bp
200 bp
100 bp
Figure 5. Principle of the screen and electrophoresis results of ERG11 and
erg11D isolates. (a) Primers for the screening were designed according to
the diagram, in which ERGuF indicates the upstream forward primer of
ERG11, and ERGiR and TRPiR indicate the internal reverse primers of
ERG11 and TRP, respectively. (b) Lanes 1 and 5 are the PCR products
using ERGuF-TRPiR primers and lanes 2 and 4 are the PCR products
using ERGuF-ERGiR primers. A DL1000 DNA ladder was used as the marker.
S. cerevisiae W303-1A
SC1
SC4
SC5
fluconazole
itraconazole
voriconazole
0.5
1
1
32
0.031
0.031
0.062
1
0.015
0.015
0.031
0.25
MICs of fluconazole, itraconazole and voriconazole for S. cerevisiae W303-1A, SC1, SC4 and SC5 were determined using the
broth microdilution method. As illustrated in Table 3, compared
with SC4, the MICs of fluconazole and itraconazole in SC5
increased from 1 mg/L to 32 mg/L and from 0.062 mg/L to
1 mg/L, respectively. Although voriconazole resistance was not
induced, the MIC of this compound also increased from
0.031 mg/L to 0.25 mg/L.
Discussion
The current increasing clinical isolation rate of C. tropicalis, especially among patients with cancer or haematological malignancies,1 has drawn the attention of epidemiologists. Although
azole resistance has been widely investigated in several
Candida spp., such as C. albicans and C. glabrata, related
studies in C. tropicalis are insufficient to date. In the present
study we investigated the azole resistance of 52 clinical isolates
of C. tropicalis, primarily with regard to their efflux pumps, respiratory activity and azole antifungal target cytochrome P450
lanosterol 14a-demethylase.
The number of isolates in this study is still not high enough,
therefore the rate of azole resistance is higher than clinical
reports. Of the 52 isolates of C. tropicalis, most were resistant
to fluconazole and itraconazole, and no isolate was only resistant to voriconazole, which indicates that voriconazole has a
greater potency against C. tropicalis.
We demonstrated an active role of efflux pumps in
azole-resistant C. glabrata (data not shown), however, no
similar phenomenon was observed in C. tropicalis (Figure 1).
During pre-experiments, the efflux effect was also tested
without glucose, but the mean fluorescence intensity of the
cells was also comparable (data not shown). Similarly, the realtime RT–PCR quantification of two transporter-related genes,
CDR1 and MDR1, showed no overexpression, which was consistent with the results of Vandeputte et al.20 Barchiesi et al.24
reported that CDR1 and MDR1 were overexpressed in a
fluconazole-resistant C. tropicalis isolate. However, this was the
result of an experimentally induced isolate in vitro and may
have represented a different mechanism than our in vivo isolates;
alternatively, the difference may be caused by heterogeneity
between the isolates. Therefore, according to our study, efflux
pumps do not play a vital role in inducing azole resistance in
C. tropicalis.
The petite mutant phenotypes of C. albicans and C. glabrata
caused by mitochondrial deficiency have been correlated to
783
Jiang et al.
their azole resistance.12,13 However, in our study, an increased respiratory status rather than respiratory deficiency was observed
in azole-resistant C. tropicalis using rhodamine 123 (Figure 2).
On the other hand, between these two groups, no significant difference was observed regarding the expression of CYTb, a gene
that functions in the mitochondrial respiratory chain (data not
shown). Further research should examine the other genes
involved in the respiratory chain, including CYTc and CYTaa3.
We then focused on ERG11, which encodes the primary azole
target enzyme cytochrome P450 lanosterol 14a-demethylase;9
lanosterol is an intermediate produced in the ergosterol
biosynthesis pathway.25 Although there was only a slight increase in the ergosterol content in the azole-resistant isolates,
other products in this pathway are suspected to be involved.
Our results indicated that ERG11 was overexpressed in
azole-resistant C. tropicalis (Figure 3) and, as shown in Figure 4,
there is a tendency for C. tropicalis to increase its ERG11 mRNA
expression when the isolate is multidrug resistant to azole antifungals. However, as only one pair of susceptible and resistant
matched isolates (1a and 1b) was collected in this study, we
cannot disregard the possibility that this difference resulted
from strain variations. Dunkel et al.26 reported that a mutation
in the transcription factor Upc2 can induce the overexpression
of ERG11 in C. albicans, but this has not been investigated in
C. tropicalis. In future studies we intend to collect additional
matched C. tropicalis isolates and investigate their expression
levels of ERG11 and mutations and the function of its promoter
and transcription factors.
Sanglard et al.27 demonstrated in 1998 that mutations of
ERG11 in C. albicans primarily lead to azole resistance by affecting the affinity of the target enzyme to azole derivatives. In our
study, we discovered two missense mutations, Y132F and S154F,
in azole-resistant C. tropicalis. Interestingly, another mutation,
Y132H, was reported in C. albicans by Favre et al.28 and Feng
et al.,29 indicating that amino acid substitution at the 132 site
may be a ‘hot spot’ for ERG11 in Candida spp. The MICs
showed that the mutations Y132F and S154F decreased the
azole susceptibility of S. cerevisiae W303-1A, particularly to fluconazole and itraconazole. Thus we hypothesize that C. tropicalis,
which has virulence similar to C. albicans, possesses a similar
mechanism as C. albicans, an assertion that requires further
investigation.
In conclusion, with its increasing incidence of clinical isolation
and azole resistance, investigation of the mechanisms of azole
resistance in C. tropicalis is meaningful. All of the azole-resistant
C. tropicalis isolates in this study showed an increased respiratory
status. In comparison with the efflux pumps, the azole antifungal target cytochrome P450 lanosterol 14a-demethylase played
a more vital role. The ERG11 gene encoding this enzyme was
overexpressed in the azole-resistant isolates and two mutations,
Y132F and S154F, were demonstrated to be responsible for azole
resistance, particularly to fluconazole and itraconazole.
Acknowledgements
We thank Professor Alistair Brown (School of Medical Science, University
of Aberdeen, Aberdeen, UK) for his gift of the strain S. cerevisiae
W303-1A, and our colleagues in the five hospitals for collecting the
clinical isolates.
784
Funding
This work was supported by the Shanghai Jiaotong University School of
Medicine Foundation.
Transparency declarations
None to declare.
Supplementary data
Table S1 is available as Supplementary data at JAC Online (http://jac.
oxfordjournals.org/).
References
1 Pfaller MA, Diekema DJ. Epidemiology of invasive candidiasis: a
persistent public health problem. Clin Microbiol Rev 2007; 21: 133–63.
2 Kontoyiannis DP, Vaziri I, Hanna HA et al. Risk factors for Candida
tropicalis fungemia in patients with cancer. Clin Infect Dis 2001; 33:
1676– 81.
3 Kothavade RJ, Kura MM, Valand AG et al. Candida tropicalis: its
prevalence, pathogenicity and increasing resistance to fluconazole.
J Med Microbiol 2010; 59: 873–80.
4 Marr KA, Seidel K, White TC et al. Candidemia in allogeneic blood and
marrow transplant recipients: evolution of risk factors after the
adoption of prophylactic fluconazole. J Infect Dis 2000; 181: 309– 16.
5 Colombo AL, Guimarães T, Silva LR et al. Prospective observational study
of candidemia in São Paulo, Brazil: incidence rate, epidemiology, and
predictors of mortality. Infect Control Hosp Epidemiol 2007; 28: 570–6.
6 Ruan SY, Hsueh PR. Invasive candidiasis: an overview from Taiwan.
J Formos Med Assoc 2009; 108: 443– 51.
7 Roilides E, Farmaki E, Evdoridou J et al. Candida tropicalis in a neonatal
intensive care unit: epidemiologic and molecular analysis of an outbreak
of infection with an uncommon neonatal pathogen. J Clin Microbiol 2003;
41: 735–41.
8 Silva S, Negri M, Henriques M et al. Candida glabrata, Candida
parapsilosis and Candida tropicalis: biology, epidemiology, pathogenicity
and antifungal resistance. FEMS Microbiol Rev 2012; 36: 288–305.
9 Sanguinetti M, Posteraro B, Fiori B et al. Mechanisms of azole resistance
in clinical isolates of Candida glabrata collected during a hospital survey
of antifungal resistance. Antimicrob Agents Chemother 2005; 49: 668–79.
10 Marie C, White TC. Genetic basis of antifungal drug resistance. Curr
Fungal Infect Rep 2009; 3: 163– 9.
11 Morschhäuser J. Regulation of multidrug resistance in pathogenic
fungi. Fungal Genet Biol 2010; 47: 94 –106.
12 Brun S, Aubry C, Lima O et al. Relationships between respiration and
susceptibility to azole antifungals in Candida glabrata. Antimicrob Agents
Chemother 2003; 47: 847– 53.
13 Helmerhorst EJ, Murphy MP, Troxler RF et al. Characterization of the
mitochondrial respiratory pathways in Candida albicans. Biochim
Biophys Acta 2002; 1556: 73– 80.
14 Pfaller MA, Andes D, Arendrup MC et al. Clinical breakpoints for
voriconazole and Candida spp. revisited: review of microbiologic,
molecular, pharmacodynamic, and clinical data as they pertain to the
development of species-specific interpretive criteria. Diagn Microbiol
Infect Dis 2011; 70: 330–43.
15 Pfaller MA, Andes D, Diekema DJ et al. Wild-type MIC distributions,
epidemiological cutoff values and species-specific clinical breakpoints
Mechanisms of azole resistance in C. tropicalis
JAC
for fluconazole and Candida: time for harmonization of CLSI and
EUCAST broth microdilution methods. Drug Resist Update 2010; 13:
180–95.
23 Edlind TD, Henry KW, Vermitsky JP et al. Promoter-dependent
disruption of genes: simple, rapid, and specific PCR-based method with
application to three different yeast. Curr Genet 2005; 48: 117–25.
16 Maesaki S, Marichal P, Vanden Bossche H et al. Rhodamine 6G efflux
for the detection of CDR1-overexpressing azole-resistant Candida albicans
strains. J Antimicrob Chemother 1999; 44: 27– 31.
24 Barchiesi F, Calabrese D, Sanglard D et al. Experimental induction of
fluconazole resistance in Candida tropicalis ATCC 750. Antimicrob Agents
Chemother 2000; 44: 1578 –84.
17 Peng Y, Dong D, Jiang C et al. Relationship between respiration
deficiency and azole resistance in clinical Candida glabrata. FEMS Yeast
Res 2012; 12: 719–27.
25 Henry KW, Nickels JT, Edlind TD. Upregulation of ERG genes in Candida
species by azoles and other sterol biosynthesis inhibitors. Antimicrob
Agents Chemother 2000; 44: 2693 –700.
18 Skowronek P, Krummeck G, Haferkamp O et al. Flow cytometry as a
tool to discriminate respiratory-competent and respiratory-deficient
yeast cells. Curr Genet 1990; 18: 265– 7.
26 Dunkel N, Liu TT, Barker KS et al. A gain-of-function mutation in the
transcription factor Upc2p causes upregulation of ergosterol
biosynthesis genes and increased fluconazole resistance in a clinical
Candida albicans isolate. Eukaryotic Cell 2008; 7: 1180– 90.
19 Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA
sequences in eubacteria and application to fingerprinting of bacterial
genomes. Nucleic Acids Res 1999; 19: 6823– 31.
20 Vandeputte P, Larcher G, Bergès T et al. Mechanisms of azole
resistance in a clinical isolate of Candida tropicalis. Antimicrob Agents
Chemother 2005; 49: 4608 –15.
27 Sanglard D, Ischer F, Koymans L et al. Amino acid substitutions in the
cytochrome P-450 lanosterol 14a-demethylase (CYP51A1) from
azole-resistant Candida albicans clinical isolates contribute to resistance to
azole antifungal agents. Antimicrob Agents Chemother 1998; 42: 241–53.
21 Kelly SL, Arnoldi A, Kelly DE. Molecular genetic analysis of azole
antifungal mode of action. Biochem Soc Trans 1993; 21: 1034– 8.
28 Favre B, Didmon M, Ryder NS. Multiple amino acid substitutions in
lanosterol 14a-demethylase contribute to azole resistance in Candida
albicans. Microbiology 1999; 145: 2715– 25.
22 Kalb VF, Woods CW, Turi TG et al. Primary structure of the P450
lanosterol demethylase gene from Saccharomyces cerevisiae. DNA
1987; 6: 519–37.
29 Feng LJ, Wan Z, Wang XH et al. Relationship between antifungal
resistance of fluconazole resistant Candida albicans and mutations in
ERG11 gene. Chin Med J (Engl) 2010; 123: 544–8.
785