From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
MYELOID NEOPLASIA
Regulation of mir-196b by MLL and its overexpression by MLL fusions
contributes to immortalization
Relja Popovic,1 Laurie E. Riesbeck,1 Chinavenmeni S. Velu,2 Aditya Chaubey,2 Jiwang Zhang,3 Nicholas J. Achille,3
Frank E. Erfurth,3 Katherine Eaton,3 Jun Lu,4 H. Leighton Grimes,2 Jianjun Chen,5 Janet D. Rowley,5 and
Nancy J. Zeleznik-Le1,3,6
1Molecular
Biology Program, Loyola University Medical Center, Maywood, IL; 2Division of Immunobiology, Cincinnati Children’s Hospital Medical Center, OH;
Institute, Loyola University Medical Center, Maywood, IL; 4Broad Institute of Massachusetts Institute of Technology and Harvard University,
Cambridge, MA; 5Department of Medicine, University of Chicago, IL; and 6Department of Medicine, Loyola University Medical Center, Maywood, IL
3Oncology
Chromosomal translocations involving
the Mixed Lineage Leukemia (MLL) gene
produce chimeric proteins that cause abnormal expression of a subset of HOX
genes and leukemia development. Here,
we show that MLL normally regulates
expression of mir-196b, a hematopoietic
microRNA located within the HoxA cluster, in a pattern similar to that of the
surrounding 5ⴕ Hox genes, Hoxa9 and
Hoxa10, during embryonic stem (ES) cell
differentiation. Within the hematopoietic
lineage, mir-196b is most abundant in
short-term hematopoietic stem cells and
is down-regulated in more differentiated
hematopoietic cells. Leukemogenic MLL
fusion proteins cause overexpression of
mir-196b, while treatment of MLL-AF9
transformed bone marrow cells with mir196–specific antagomir abrogates their
replating potential in methylcellulose. This
demonstrates that mir-196b function is
necessary for MLL fusion-mediated immortalization. Furthermore, overexpres-
sion of mir-196b was found specifically in
patients with MLL associated leukemias
as determined from analysis of 55 primary leukemia samples. Overexpression
of mir-196b in bone marrow progenitor
cells leads to increased proliferative capacity and survival, as well as a partial
block in differentiation. Our results suggest a mechanism whereby increased expression of mir-196b by MLL fusion proteins significantly contributes to leukemia
development. (Blood. 2009;113:3314-3322)
Introduction
The Mixed Lineage Leukemia (MLL) gene is commonly involved in
chromosome translocations that cause leukemia.1,2 MLL-associated
leukemias can be myeloid, lymphoid or biphenotypic, depending on the
partner gene to which MLL is fused.3 There have been more than 60
different MLL fusion partners isolated to date and, in most cases,
overexpression of a subset of HOX genes is a hallmark of the disease.4
HOX genes are transcription factors that play an important role during
development and hematopoiesis.5,6 Humans have 13 paralogous groups
of HOX genes clustered on 4 different chromosomes. Expression of
HOX genes is spatially and temporally regulated with 3⬘ genes
expressed earlier and having a more anterior boundary of expression.5
Similarly, expression of HOX genes is tightly regulated during hematopoiesis. Genes located at the 3⬘ end of the cluster are down-regulated as
CD34⫹ cells become lineage-specific progenitors while 5⬘ genes, like
HOXA10, are turned off only after cells progress to the more differentiated CD34⫺ stage.7 MLL regulates expression of some of the HOX
genes at the chromatin level by binding to the promoters and recruiting
various transcriptional regulators.8-10 However, what happens at the
molecular level in the presence of the leukemogenic fusion proteins to
cause HOX overexpression is still poorly understood.
Among 6800 genes analyzed by expression microarrays, overexpression of HOXA9 was the most correlative marker of poor
prognosis in acute myeloid leukemia patients.11 Immortalization of
bone marrow progenitors by the MLL fusion protein MLL-ENL is
dependent on the presence of Hoxa9 and Hoxa7genes.12 Like other
HOX genes, the HOXA9 locus gives rise to several alternatively
spliced transcripts.13-15 The precise role of each one of these
transcripts is still unclear, but some of them do not code for proteins
and are more likely to have a strictly regulatory role.
MicroRNAs (miRNAs) are small RNA transcripts (⬃ 22 nt)
that function in posttranscriptional regulation of gene expression.
The mature miRNAs are processed from much longer primary
precursor molecules through a multistep process that involves
several proteins. MiRNA precursors are transcribed by RNA
polymerase II and initial processing is performed in the nucleus by
Drosha. Subsequent transport into the cytoplasm and additional
processing by Dicer and helicase give rise to the mature miRNA
that is incorporated into the RNA-induced silencing complex
(RISC), guiding it to the target mRNAs.16 It is now clear that
miRNAs play an important role during development and disease
and many of the genes encoding microRNAs are found at sites
frequently deleted or mutated in cancers.17 While the role of
miRNAs in various systems is starting to be elucidated, the
mechanism by which their expression is regulated is still poorly
understood.
We report here the regulation of a miRNA, mir-196b, by
wild-type MLL as well as its dramatic overexpression by leukemic
MLL fusion proteins. Mir-196b is located in a highly evolutionarily
conserved region between HOXA9 and HOXA10 genes, at chromosome band 7p15.2 in human and 6qB3 in mouse. Our studies
indicate that MLL regulates mir-196b expression in a pattern
similar to that of the surrounding genes. Mir-196b is overexpressed
Submitted April 28, 2008; accepted January 8, 2009. Prepublished online as Blood
First Edition paper, February 2, 2009; DOI 10.1182/blood-2008-04-154310.
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
The publication costs of this article were defrayed in part by page charge
© 2009 by The American Society of Hematology
3314
BLOOD, 2 APRIL 2009 䡠 VOLUME 113, NUMBER 14
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 2 APRIL 2009 䡠 VOLUME 113, NUMBER 14
specifically in primary leukemia samples from MLL patients, but
not from other types of leukemia. Furthermore, expression of MLL
fusion proteins in primary bone marrow cells causes overexpression of mir-196b. Treating these cells with specific antagomir
targeting mir-196b significantly compromises the increased replating potential of MLL-AF9–expressing cells. Mir-196b expression
increases proliferation and survival, and also partially blocks
differentiation of normal bone marrow hematopoietic progenitor
cells. Overexpression of mir-196b is an important component in
leukemia development caused by MLL fusion proteins.
Methods
MLL REGULATES MIR-196B EXPRESSION
3315
RT-PCR and qRT-PCR
RT-PCRs were performed in a Hybaid PCR Express machine. Each 50 ␮L
reaction contained 1.5 mM MgCl2, 100 ng of each primer, 0.125 mM dNTP
mix, 5 ␮L 10⫻ PCR buffer (Fermentas, Glen Burnie, MD), and 2.5 units
Taq DNA polymerase (GenScript, Piscataway, NJ). PCR products were
analyzed with ethidium bromide by electrophoresis on a 2% agarose gel.
For quantitative RT-PCR, cDNA was analyzed using ABI Prism 7300.
For SYBR Green, each 20 ␮L reaction contained 2 ␮L 10⫻ iTaq SYBR
Green Supermix with Rox (Bio-Rad) and 0.25 ␮M forward and reverse
primers. All reactions were performed in triplicate and gene expression
levels were normalized to hprt expression and fold difference calculated
using the 2⫺⌬⌬Ct method. Primer sequences are available on request.
Cloning mir-196b expression vector
Mll wild-type and ⫺/⫺ MEFs and ES cells have been described.18,19 Menin
wild-type and ⫺/⫺ MEFs were previously described.20 MLL and MLL-AF4
add back clones were previously described.21
A 200-bp DNA fragment surrounding mir-196b was amplified using the
primers: forward 5⬘ GAAGATCTTTCCTTGGCGGCGACA 3⬘ and reverse
5⬘CCCAAGCTTGATGGCCCGCCTA 3⬘. Gel-purified PCR product and
vector were both digested with HindIII and BglII and ligated into
pSuper.retro vector (OligoEngine, Seattle, WA).
miRNA detection
Retrovirus production and colony assay
Cell lines
RNA was isolated using TRI Reagent (Sigma-Aldrich, St Louis, MO)
according to the manufacturer’s protocol. Reverse transcription was
performed using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Real-time PCR was performed in
triplicate on an ABI 7300 machine using TaqMan analysis according to the
manufacturer’s instructions (miR196b probe set 000496, normalized to
RNU6B probe set 001093; Applied Biosystems).
Chromatin immunoprecipitation assay
The chromatin immunoprecipitation assay (ChIP) was performed using the
EZ-ChIP Kit (Upstate/Millipore, Billerica, MA) according to the manufacturer’s protocol. Chromatin was immunoprecipitated using anti–dimethyl
H3 K79, anti–dimethyl H3 K4, anti–trimethyl H3 K4, and anti–dimethyl
H3 K9 (Upstate/Millipore) and analyzed by qPCR in triplicate on an
ABI 7300 machine using iTaq SYBR Green Supermix with Rox (Bio-Rad,
Hercules, CA). Percentage enrichment was normalized to input DNA and
calculated as previously reported.22 Amplification of the AB region was
performed with primers previously described.21
Embryonic stem cell differentiation and isolation of CD41ⴙ
cells
Embryonic stem (ES) cells were maintained, differentiated, and day 10
embryoid bodies collected as described previously.23 Isolation of hematopoietic progenitors was performed using anti-CD41 antibody (BD Pharmingen, San Jose, CA). Cells not bound by the nanoparticles were collected as
CD41⫺ population.
Bone marrow cell sorting
Bone marrow (BM) was harvested from wild-type C57BL6/J mice using a
Loyola University Institutional Animal Care and Use Committee–approved
protocol. After red blood cell lysis, BM nucleated cells were dispersed into
a single-cell suspension. The long-term hematopoietic stem cells (HSCs;
Lin⫺Sca1⫹C-kit⫹Flk2⫺, LSKF⫺), short-term HSCs (Lin⫺Sca1⫹Ckit⫹Flk2⫹, LSKF⫹), and the committed progenitors (Lin⫺Sca1⫺C-kit⫹,
LK) were enriched by lin⫹ cell depletion (EasySep Mouse Hematopoietic
Progenitor Cell Enrichment Kit; StemCell Technologies, Vancouver, BC),
and purified by FACSAria flow cytometer (BD Biosciences, San Jose, CA)
sorting after fluorescein isothiocyanate–conjugated lineage (FITC-Lin)
cocktail, phycoerythrin (PE)–Sca1, APC-c-kit and PE-Cy5.5-Flk2 staining.
Gr1⫹ myeloid cells and B220⫹ B cells were sorted from BM cells after
FITC-Gr1 and APC-B220 staining. All fluorescent antibodies used were
purchased from eBioscience (San Diego, CA).
Retroviruses were produced as described previously.24 Bone marrow
colony assays were performed as we have previously described with minor
changes.24 Briefly, bone marrow cells were collected from 4- to 12-weekold C57Bl6 mice and c-kit–positive progenitors were selected using an
Easy Sep Selection kit (StemCell Technologies). Lineage-depleted cells
were separated using the Negative Selection Kit (StemCell Technologies).
After the second infection, cells were plated in methylcellulose with
cytokines interleukin-6 (IL-6), IL-3, stem cell factor (SCF), and (⫾)
granulocyte macrophage-colony stimulating factor (GM-CSF), in the
presence of puromycin (8.75 ␮g/mL). Cytospin slides of colony assay cells
were stained with the Hema 3 Stain Set (Fisher Scientific, Kalamazoo, MI).
Pictures were taken on an Olympus BH-2 microscope (Tokyo, Japan),
under a 100⫻/1.25 NA oil-immersion lens, with a Sony 3CCD camera,
model DXC-76OMD. Images were acquired with Adobe Premier software,
version 4.2.1. Pictures of colonies in methylcellulose were taken through air
on a Leica model DMIL microscope (Wetzlar, Germany), through a
4⫻/0.10 NA lens, with a Canon PowerShot S40 digital camera. Images
were acquired with Canon ZoomBrowser EX, version 8. All images were
processed using Adobe Illustrator CS3, version 13.0.0.
Antagomir treatment of MLL-AF9–transduced bone marrow
cells
Antagomir oligoribonucleotides were synthesized (Dharmacon, Lafayette,
CO; 2⬘-O-Me on each ribonucleotide, phosphorthioate on the first 2 and
last 4 ribonucleotides, and a 3⬘ cholesterol modification linked through a
hydroxyprolinol linkage; miR-196, 5⬘-CCCAACAACAGGAAACUACCUA-3⬘; control (mutant) miR-196, 5⬘-CCCAAGAACAGGUA
AGUACGUA-3⬘). Underlined letters in the sequences represent mutated
nucleotides. Wild-type Lin⫺ bone marrow cells were treated with 100 nM
antagomir. To confirm efficacy, RNA was extracted after 72 hours using
TriZol (Sigma-Aldrich), then analyzed for steady-state mature miR-196b
expression. The level of mature miR196b was not detectable by TaqMan
assay after antagomir treatment. For colony assay, wild-type Lin⫺ bone
marrow cells were transduced with an MLL-AF9 expressing retroviral
vector and treated with 100 nM control antagomiR-196 or antagomiR-196
before 15 000 cells were plated in duplicate in methylcellulose medium
containing IL-3, IL-6, and SCF (M3534; StemCell Technologies). Colonies
were enumerated after 8 days of culture and the average number plotted
(⫾ SD). For serial replating, colonies were pooled and 15 000 cells were
treated with control antagomiR or antagomiR-196b and replated.
Bead-based miRNA expression profiling assay
A large-scale, genome-wide miRNA expression profiling analysis was
performed using a bead-based flow cytometric method.25 A total of 55 acute
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
3316
BLOOD, 2 APRIL 2009 䡠 VOLUME 113, NUMBER 14
POPOVIC et al
Figure 1. Expression of mir-196b is dependent on Mll and Menin. (A) Schematic illustration of the murine Hoxa9 locus on chromosomal band 6qB3. Open boxes represent
3 exons and gray boxes indicate CpG islands. Exon II is the homeodomain (HD) containing exon. The canonical Hoxa9 is encoded by exons CD and II. Regions of high
homology between species are noted as dark boxes and the region amplified by ChIP primers is indicated by arrows. The location of mir-196b is labeled above exon AB with an
arrowhead. (B) Sequence alignment of the conserved mir-196b sequence among different species. The mature mir-196b sequence is highlighted in black. (C) Quantitative
RT-PCR of mir-196b levels in WT, Mll⫺/⫺, and Men⫺/⫺ MEFs. The experiment was run in triplicate and the results represent average expression plus or minus SD.
(D) Quantitative RT-PCR of mir-196b expression in individual clones expressing an empty vector, MLL, or MLLAF4 in Mll⫺/⫺ MEF background. Transfection of Mll⫺/⫺ MEFs and
clone selection was performed as previously described. Mir-196b expression was determined from total RNA. (E) ChIP assay performed in WT and Mll⫺/⫺ MEFs. Chromatin
was precipitated using indicated antibodies and qPCR performed with primers spanning mir-196b region. All samples were run in triplicate and were normalized to the input
chromatin.
myeloid leukemia (AML) primary patient samples, including 29 MLLassociated acute leukemias (10 acute lymphocytic leukemias [ALLs] and
19 AMLs) and 26 AMLs with other abnormalities, along with 3 normal
bone marrow controls were included in the expression assay. To control for
data quality, only samples with total miRNA signals greater than or equal to
15 000 were analyzed further. All patient samples were collected with
approval of the Institutional Review Board at the University of Chicago and
after informed consent was obtained in accordance with the Declaration of
Helsinki. After normalization, only probes for human miRNAs with
maximum expression in any sample being greater than or equal to 7.25
were retained for further analyses. TIGR Multiple Array Viewer software
package (TMeV version 4.0; The Institute for Genetic Research [TIGR],
Rockville, MD) was used to perform data analysis and to visualize the
results.26 The details of this assay were reported elsewhere.27
Myeloid and B-cell differentiation assay
Bone marrow cells harvested after 1-week culture in the methylcellulose
colony assay were used for the differentiation assays. Totals of 35 000
mir-196b or vector-infected cells were plated on 20 000 OP9 cells per well
to a 24-well dish in RPMI, 20% fetal bovine serum (FBS), 1% Pen/Strep.
Wells were supplemented either with 10 ng/mL GM-CSF (myeloid) or
10 ng/mL IL-7 and 10 ng/mL FLT3L (B cell). After 5 days, cells were
stained with allophycocyanin (APC)–conjugated CD117 and PE-conjugated CD11b or PE-conjugated B220 antibodies. Percentage of cells
expressing these surface markers was determined using flow cytometry.
Results
MLL-dependent expression of mir-196b
MLL is a known regulator of HOX gene expression. We have
recently described expression of an Mll-dependent transcript from
a region highly conserved across species located approximately
4.5 kb upstream of the canonical Hoxa9 promoter.21 Mll protects
this DNA region from becoming methylated, thus allowing expression of the transcript. Mir-196b is located in the center of the
conserved region and we hypothesized that the transcript encodes
the precursor of mir-196b (Figure 1A,B). Our initial approach used
ligation-mediated PCR to isolate the mature form of mir-196b (data
not shown). While our method was successful, we were not able to
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 2 APRIL 2009 䡠 VOLUME 113, NUMBER 14
MLL REGULATES MIR-196B EXPRESSION
3317
determine the expression levels quantitatively. To overcome this
problem, we used a microRNA assay specific for mir-196b that
uses TaqMan probe chemistry, thus allowing for quantitative
measurement. Analysis of mouse embryonic fibroblasts (MEFs),
wild-type and null for Mll, showed a 3.5-fold higher level of
expression of mir-196b in the presence of Mll (Figure 1C). As
previously reported and confirmed in our laboratory (data not
shown), canonical Hoxa9 transcript expression shows a similar Mll
dependency.18 Dependence of mir-196b expression on MLL was
further confirmed by exogenous expression of wild-type MLL in
Mll⫺/⫺ MEFs. MLL restored expression of mir-196b in these cells
(Figure 1D).
The tumor suppressor protein menin was previously biochemically purified as part of an MLL protein complex and subsequently
shown to be an essential cofactor in MLL-dependent gene expression.10,28 Binding of Mll to some of its target genes that have been
studied requires menin; absence of menin leads to decreased
expression of Mll-target genes, including Hoxa9.10,29 Thus, we
hypothesized that if mir-196b is regulated by Mll, then the absence
of menin should also diminish mir-196b levels. To test this
hypothesis, Men⫺/⫺ MEFs were assessed for mir-196b expression.
As predicted, mir-196b expression in Men⫺/⫺ MEFs was 4-fold
lower than in the wild-type counterparts (Figure 1C).
Several studies have documented that Mll regulates expression
of its target genes at least in part by altering chromatin structure.8-10,30
Previous studies have shown that the SET domain of MLL possesses
histone methyltransferase activity specific for lysine 4 on histone H3.8,9
Using ChIP, we investigated histone modifications in the mir-196b
region in wild-type and Mll null cells. We and others have
previously reported binding of endogenous Mll to this region.21,31
Surprisingly, we did not observe any differences in H3K4 methylation between the 2 cell types (Figure 1E). However, we did notice
dramatically higher levels of H3K79 dimethylation in the Mll
wild-type cells compared with Mll⫺/⫺ cells (Figure 1E). H3K79
methylation by the protein Dot1 has been linked to active
transcriptional elongation suggesting that this mark may also
represent transcriptional elongation in the conserved region only in
the wild-type but not Mll⫺/⫺ cells.32,33
Mll-dependent mir-196b expression during ES cell
differentiation
Mll regulates expression of a subset of genes in the Hox cluster during
embryonic development.19,34 Mice lacking Mll are embryonic lethal and
display gross defects in the early stages of hematopoiesis.19,23 Absence
of Mll leads to deficiencies in proliferation and survival of hematopoietic progenitors in the yolk sac.35 To investigate the dependency of
mir-196b expression on Mll during development, we used wild-type and
Mll⫺/⫺ murine embryonic stem (ES) cells. On removal of leukemia
inhibitory factor (LIF), ES cells form embryoid bodies (EBs) and the
pattern of gene expression in the embryoid bodies generally follows that
of early hematopoiesis in a developing embryo.36 Previous studies have
shown that the expression of several Hox genes depends on the presence
of Mll during ES cell differentiation.37 We wanted to determine whether
Mll regulates the timing of mir-196b expression in a manner similar to
that of the neighboring Hoxa9 and Hoxa10 genes. As previously
reported, and confirmed in our laboratory, Mll⫺/⫺ cells form embryoid
bodies indistinguishable from those derived from the wild-type cells.37
Levels of Hoxa9 and Hoxa10 genes are similar in both cell types in
undifferentiated ES cells and during the first few days of differentiation
(Figure 2A,B). At the later stages of differentiation, transcription of both
of these genes is up-regulated in the wild-type cells. Cells carrying
homozygous Mll mutations show lower levels of Hoxa9 and Hoxa10
Figure 2. Mir-196b is regulated by Mll during ES cell differentiation, similar to
Hoxa9 and Hoxa10. (A,B) Quantitative RT-PCR of Hoxa9 (A) and Hoxa10 (B)
mRNA using SYBR green. All values are compared with WT day 0 and this value is
set to 1. Experiments were performed in triplicate and the results represent average
fold change plus or minus SD. (C) Quantitative RT-PCR of mir-196b expression using
mir-196b TaqMan primers and probe.
expression. Similarly, levels of mir-196b are decreased up to 14-fold in
the absence of Mll. Mir-196b is expressed during ES cell differentiation
in a pattern of expression similar to that of Hoxa9 and Hoxa10 (Figure
2C). Sharing of cis-regulatory elements has been previously described
for genes in the HoxB and C clusters, however, it remains unclear
whether mir-196b shares regulatory elements with the neighboring Hox
genes or if its expression is controlled by Mll independently of Hoxa9
and Hoxa10.38,39
Embryoid bodies contain a highly heterogenous population of
cells. To more specifically investigate hematopoietic cells we
isolated CD41⫹ cells from day 10 embryoid bodies. This marker
was shown to be present on definitive hematopoietic progenitor
cells giving rise to all blood lineages.40 As reported by Ernst et al,
wild-type and Mll⫺/⫺ ES cells form a comparable number of
CD41⫹ cells however Mll⫺/⫺ CD41⫹ cells are less efficient at
producing hematopoietic colonies.37 We found that both the
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
3318
POPOVIC et al
BLOOD, 2 APRIL 2009 䡠 VOLUME 113, NUMBER 14
Figure 4. MLL fusion proteins induce expression of mir-196b in primary bone
marrow progenitors, which is required for their MLL fusion-dependent increased proliferative capacity in vitro. Wild-type Lin⫺ bone marrow cells were
transduced with MLL-AF9 retroviral vectors and treated with either control antagomiR196 or antagomiR-196, then plated in duplicate. Colonies were enumerated after
8 days and the average number was plotted. Cells were then replated after additional
antagomir treatment. The cycle was repeated twice. Data shown are representative
of 2 independent experiments with similar results.
population and that it may be playing a role at early stages of
hematopoiesis.
To determine which population(s) of hematopoietic progenitors
expresses mir-196b, mouse bone marrow cells were sorted into
long-term hematopoietic stem cells (LT-HSC), short-term hematopoietic stem cells (ST-HSC), multipotent progenitors (MPP) and
more mature myeloid (GR1⫹) and lymphoid (B220⫹) cells. Expression levels of mir-196b are the highest in ST-HSC and decrease as
cells become more differentiated (Figure 3C). The tightly regulated
pattern of mir-196b expression suggests that misregulation of
mir-196b expression may lead to drastic defects in normal
hematopoiesis.
MLL fusion proteins induce expression of mir-196b, which is
required for increased proliferative capacity
Figure 3. Mll regulates mir-196b expression in hematopoietic progenitors.
(A) RT-PCR for canonical Hoxa9 in CD41⫹ ES cells. Day 10 EBs were disrupted and
CD41⫹ cells isolated using a magnetic column. Total RNA was isolated from the
CD41⫹ cells and used for cDNA synthesis. Hoxa9 primers used span the junction
between exon CD and exon II of the gene. Gapdh is used as a loading control. Space
between panels indicates repositioned gel lanes. (B) Quantitative RT-PCR of mir196b expression in WT and Mll⫺/⫺CD41⫹ and CD41⫺ murine embryonic stem cells
from day 10 embryoid bodies. WT levels were set to 1 for comparison. Experiment
was performed in triplicate and the results represent average expression plus or
minus SD. (C) Quantitative RT-PCR of mir-196b expression in sorted mouse bone
marrow cells. Mouse bone marrow cells were sorted in various populations based on
the expression of cell surface markers. Expression of LT-HSCs is set to
1 for comparison. The results represent average fold change plus or minus SD.
canonical Hoxa9 as well as mir-196b are expressed at a lower level
in Mll⫺/⫺ CD41⫹ cells in comparison to the wild-type cells (Figure
3A,B). In addition, expression of mir-196b was also Mll dependent
in the CD41 negative population, suggesting that Mll is also
required for expression of mir-196b in other cell types and tissues
(Figure 3B).
Mir-196b expression in hematopoietic progenitors
MiRNA expression patterns vary between cell types. We wanted
to examine if mir-196b is generally expressed in hematopoietic
progenitor cells or if it is limited to expression in specific stages
of hematopoiesis. Mouse bone marrow cells were separated into
more differentiated versus less differentiated populations. Expression of mir-196b was on average 2.5-fold higher in lineage
negative cells (data not shown). Similarly, the c-Kit⫹ population
of bone marrow cells expressed 6-fold higher levels of mir-196b
than the c-Kit⫺ cells (data not shown). These results suggest that
mir-196b is indeed expressed in the hematopoietic progenitor
Overexpression of certain HOX genes is a hallmark of MLLassociated leukemias, however, the exact mechanism by which
MLL fusion proteins exert their effect in the leukemic cells is still
poorly understood. Because MLL regulates expression of various
HOX transcripts, we wanted to investigate whether an MLL fusion
protein causes a change in mir-196b expression. Transfection of
constructs expressing the MLL-AF4 fusion protein into Mll⫺/⫺
MEFs reactivated expression of mir-196b to levels higher than
transfection of constructs expressing wild-type MLL (Figure 1D).
We also used a bone marrow progenitor colony assay to investigate
the effect of MLL-AF9 on mir-196b expression. C-Kit⫹ bone
marrow cells infected with MLL-AF9 retroviruses show on average more than a 100-fold increase in mir-196b expression in
comparison to vector infected cells (data not shown). Expression
of canonical Hoxa9 is also greatly increased (⬎ 300-fold;
data not shown).
Although MLL fusion proteins caused increased mir-196b
expression, we next determined whether mir-196b expression was
necessary to manifest the increased in vitro proliferative capacity
observed for MLL fusion–transduced bone marrow progenitor
cells. For this experiment, MLL-AF9–transduced progenitors were
treated with antagomir specific to mir-196b or with control
(mutant) antagomir and assessed for replating activity. We found
that mir-196b function is required to maintain the increased
proliferative capacity of MLL fusion-expressing bone marrow
progenitors in vitro (Figure 4). The role of mir-196b in immortalization and enhanced proliferation of cells transduced by MLL fusion
proteins was intriguing and suggested that further investigation of
mir-196b in MLL leukemia was warranted.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 2 APRIL 2009 䡠 VOLUME 113, NUMBER 14
MLL REGULATES MIR-196B EXPRESSION
3319
Figure 5. Mir-196b is overexpressed in the majority of
MLL-associated leukemias, but not in non-MLL leukemias,
irrespective of their phenotype. Heat map of relative mir-196b
expression of 55 leukemia samples and 3 normal controls using
bead-based technology.
Mir-196b is overexpressed in the majority of MLL-associated
leukemias
To investigate mir-196b expression in primary leukemia patient
samples, we used bead-based expression profiling technology.27 To
this end, 55 different patient samples (10 ALL and 45 AML) and
3 normal bone marrow samples were analyzed for expression of
mir-196b. The 29 MLL leukemia samples (10 ALL and 19 AML)
expressed consistently higher levels of mir-196b than non-MLL
leukemia samples (Figure 5). It is of interest that multiple cell lines
derived from MLL leukemia patients also express high levels of
mir-196b (data not shown). As a molecule that has the potential of
regulating expression levels of many different proteins, high levels
of mir-196b in MLL leukemias may play a crucial role in the
disease process.
cells and expressed intermediate levels of CD117 and Sca1, with
about 50% also expressing Gr-1, whereas vector-transduced cells
after the second and third plating (very few cells remaining after
the third plating) became CD117 and Sca1 high, but negative for
lineage markers and resembled mast cells (Figure 6B and data not
shown). To rule out the possibility that simply activating the
microRNA processing pathway was responsible for the observed
increased proliferative capacity, we also transduced cells with
Mir-196b causes increased proliferative capacity and
decreased differentiation
To examine possible roles of mir-196b overexpression in hematopoietic progenitor cells we cloned a 200 bp region surrounding the
mature miRNA into a retroviral expression vector. Increased
mir-196b expression was confirmed after transfection in MEFs
(data not shown). In vitro serial replating colony assays have been
used extensively to determine the leukemogenic potential of MLL
fusion proteins. Because we found mir-196b overexpressed in
primary MLL leukemia samples, we wished to determine whether
overexpression of mir-196b could contribute to the immortalization
process by providing increased proliferative capacity to progenitor
cells. Bone marrow c-kit⫹ cells were transduced using retroviruses
that express mir-196b precursor or with the empty vector alone and
serially replated in methylcellulose containing either SCF, IL-6,
IL-3 and GM-CSF (referred to as ⫹GM-CSF) or SCF, IL-6 and
IL-3 (referred to as ⫺GM-CSF). Transduced cells formed colonies
of various sizes after the first week in culture for both vector and
mir-196b under both conditions, as expected (Figure 6B). Mir-196b
was expressed approximately 2-fold higher in the mir-196b–
transduced cells compared with controls (data not shown). In the
presence of GM-CSF, mir-196b–expressing cells survived into the
third week (after the second replating) and increased in cell number
on average 5-fold, in contrast to control-infected cells that did not
survive after the first replating (Figure 6A). Overexpression of
mir-196b was not sufficient to completely immortalize cells under
these conditions. However, using cytokine mix ⫺GM-CSF, a more
dramatic effect of mir-196b expression on increased colonyforming ability and proliferative capacity was observed. Under
these conditions, mir-196b expressing cells formed tight colonies
even after the fourth plating of cells, in contrast to the vectortransduced cells, which formed primarily loose colonies after the
second plating and almost no colonies after the third plating (Figure
6A,B). Mir-196b–expressing cells after 4 platings in methylcellulose became a relatively homogenous population resembling blast
Figure 6. Mir-196b expression enhances colony formation and partially blocks
hematopoietic progenitor cell differentiation. (A,B) Serial replating myeloid colony
assay using c-Kit⫹ bone marrow cells. Cells were transduced with retroviruses
producing mir-196b construct or with an empty vector and plated in methylcellulose
with 2 different cytokine mixes. The number of colonies (A) and colony and cell
morphology (B) at 1 and 4 weeks are shown. Only mir-196b–expressing cells are
able to form colonies at the fourth week. Scale bars on cytospin pictures represent
10 ␮m in top panel and 25 ␮m in bottom panel. (C) Representative FACS profiles of
in vitro–differentiated bone marrow cells. After 1 week of growth and selection in
methylcellulose, mir-196b or vector-expressing bone marrow cells were plated on the
OP9 cell line in the presence of GM-CSF or IL-7/Flt3L. After 5 days, expression of
CD117 and CD11b (top panels, cells on GM-CSF) or B220 (bottom panels, cells on
IL-7/Flt3L) was determined. Under both conditions, overexpression of mir-196b
causes a partial block in differentiation.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
3320
POPOVIC et al
retroviruses that express short hairpin RNAs that target 2 different
molecules, CtBP and Bmi-1. Cells transduced with either of these
retroviruses formed colonies in the first week, confirming effective
infection of the cells; however, the colony-forming ability of both
of these were similar to vector-transduced cells (data not shown).
Our data demonstrate that mir-196b expression causes an increased
survival and proliferative capacity of bone marrow progenitor cells.
The normal process of terminal differentiation is often abrogated during development of leukemia. We investigated whether
mir-196b helps hematopoietic progenitor cells retain a more
undifferentiated state. To this end, equal numbers of bone marrow
progenitor cells cultured in methylcellulose with puromycin selection for 1 week after transduction with vector or mir-196b–
expressing constructs were replated on OP9 feeder cells in the
presence of GM-CSF or IL-7/FLT3L. The 2 conditions support
myeloid and lymphoid differentiation, respectively. After 5 days,
the cells were analyzed for the expression of CD117/CD11b or
CD117/B220 markers. Under both conditions, the mir-196b–infected
cells retained a significant percentage (⬃ 20%) of CD117 positive
cell population, whereas vector expressing cells did not (Figure
6C). This suggests that overexpression of mir-196b can partially
block differentiation in hematopoietic progenitor cells.
Discussion
MLL, a large multidomain protein, is a master regulator of gene
expression during development and hematopoiesis. MLL positively
regulates expression of genes by binding to their promoters and
recruiting various chromatin-associated proteins and through the H3K4
histone methyltransferase activity of its SET domain.8,9,28 Translocations
in MLL give rise to in-frame fusions with various partner genes and the
formation of chimeric proteins leading to misregulation of MLL target
genes. While transcriptional activation and histone methyltransferase
domains of MLL are both lost in the chimeras, the fusion proteins still
cause overexpression of downstream MLL targets, including members
of the HOX clusters.41,42 Dysregulation of certain HOX genes plays a
central role in MLL-associated leukemogenesis, however, the mechanism is still very poorly understood.12,28 In our study, we demonstrate
that MLL and MLL fusion proteins regulate expression of a microRNA
located in the HOX cluster, mir-196b. Mir-196b is an attractive target of
MLL regulation for various reasons: (1) mir-196b is situated between
HOXA9 and HOXA10, 2 MLL targets that are frequently overexpressed
in MLL leukemias; (2) some of the mir-196b targets are HOX genes
themselves and by regulating mir-196b expression, MLL can simultaneously regulate boundaries of HOX expression43; and (3) as with any
other miRNA, strict regulation of mir-196b expression is essential for its
proper function and possible misregulation by MLL fusion proteins may
lead to misregulated expression of mir-196b target mRNAs, and thus
contribute to large-scale changes in gene expression often seen in
leukemic cells.
In this study, we provide several lines of evidence to support
mir-196b as a target of MLL regulation. Our previous findings
demonstrated that the presence of Mll selectively prevents DNA
methylation of a region adjacent to mir-196b that allows for
expression of transcripts that are mir-196b precursors.21 Using a
method that detects the mature form of miRNA, we demonstrate
that Mll⫺/⫺ MEFs express lower levels of mir-196b than wild-type
cells. We and others have previously shown that the expression of
other Mll targets, such as Hoxa7, a9, a10, are also decreased in
these cells.18 One of the components of an MLL protein complex is
menin, a tumor suppressor protein often deleted in multiple
BLOOD, 2 APRIL 2009 䡠 VOLUME 113, NUMBER 14
endocrine neoplasms.44 Genome-wide mapping of menin and MLL
binding to chromatin shows that the 2 proteins are often bound to
the same loci.31 Our data show that mir-196b expression is also
dependent on menin and that in the absence of menin, mir-196b
levels fall to similar low levels as measured in Mll⫺/⫺ cells.
Transfection of MLL or MLL-AF4 into the Ml⫺/⫺ cells boosts
expression of mir-196b to and above wild-type levels, respectively,
which is accompanied by the reversal of DNA methylation.21
The SET domain of MLL contains histone methyltransferase
activity specific for lysine 4 on histone H3 and this function
contributes to activation of MLL target genes.8,9 Surprisingly, ChIP
data do not show any changes in H3K4 methylation between
wild-type and Mll⫺/⫺ cells in the region surrounding the microRNA. It has been previously noted that trimethylation of H3K4
is a mark usually found close to the transcription start site and it is
possible that the mir-196b precursor transcript starts further
upstream. Interestingly, our ChIP data show that the mir-196b
region is greatly enriched in H3K79 dimethylation only in the
presence of Mll. H3K79 methylation is a mark associated with
transcriptional elongation suggesting that Mll is necessary for
proper transcriptional elongation in this region.32,33 Dot1 is the only
H3K79 histone methyltransferase isolated to date. It is still unclear
if any of these histone marks are altered in the presence of MLL
fusion proteins, however, several MLL partners, including AF10,
AF9, ENL, and AF4 interact with Dot1 in a multiprotein transcription elongation complex with pTEFb.45,46 It is possible that this
interaction may also play a role in overexpression of MLL target
genes in the MLL-associated leukemias.
Using in vitro differentiation of wild-type and Mll⫺/⫺ murine
embryonic stem cells we show that Mll regulates expression of
mir-196b similarly to other 5⬘ Hox genes. These data suggest that
Mll regulates mir-196b temporally and studies by Mansfield et al
showed that the paralogous mir-196a is also regulated spatially in a
Hox-like pattern during embryogenesis.47 Considering that a subset
of mir-196 targets are also members of the HOX cluster, it is likely
that the pattern of mir-196b expression plays a role in fine-tuning
the levels of HOX gene expression. In a developing organism, this
mechanism would help generate the boundaries of HOX expression
without the need for turning off the genes completely.
Microarray profiles of miRNA expression patterns have shown that
mir-196b is expressed at the highest levels in bone marrow and spleen,
suggesting it has a role in hematopoiesis.48 Our analysis of c-Kit⫹
hematopoietic progenitors demonstrates that mir-196b is expressed at
higher levels in this population than in the more differentiated c-Kit⫺
population. In addition, separation of mouse bone marrow into lineagenegative and lineage-positive cells confirms that mir-196b is expressed
at higher levels in less differentiated cells. Of the early hematopoietic
progenitors, expression of mir-196b is the highest in ST-HSCs. Isolation
of CD41⫹ definitive hematopoietic progenitors from differentiated
embryoid bodies confirms mir-196b expression in hematopoietic progenitor cells only in the presence of Mll. Aberrant hematopoietic colony
formation of Mll⫺/⫺CD41⫹ cells was rescued by the addition of certain
Hox genes or the homeodomain containing transcription factor Cdx4.37
Cdx4 positively regulates expression of Hox genes and, similar to MLL,
binding of Cdx4 to the Hoxa9 locus is dependent on menin.49 In a mouse
model, Cdx4 overexpression generates acute myeloid leukemia while
dysregulating Hox expression.50 It would be of interest to determine if
Cdx4 also regulates mir-196b expression and if this regulation plays a
role in Cdx4-induced leukemogenesis.
A hallmark of MLL-associated leukemia is overexpression of
specific HOX genes.41,42 Likewise, our study shows that MLL
fusion proteins also drastically increase levels of mir-196b. C-Kit⫹
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 2 APRIL 2009 䡠 VOLUME 113, NUMBER 14
MLL REGULATES MIR-196B EXPRESSION
3321
Figure 7. Model for the role of mir-196b in hematopoietic cells and
MLL fusion-mediated leukemia. MLL regulates expression of mir-196b
and MLL fusion proteins cause a block in differentiation of progenitor cells.
This effect may be due partially to high levels of mir-196b expression
caused by the MLL fusion protein. High levels of mir-196b may also
provide a survival advantage to cells expressing the MLL fusion protein.
bone marrow cells transduced with MLL-AF9 retroviruses express
on average more than 100-fold increased levels of mir-196b than
cells infected with control retrovirus. The increased proliferative
capacity of the MLL fusion-expressing progenitors was dependent
on mir-196b expression because antagomir specifically targeting
mir-196b abrogated this effect. Importantly, expression analysis of
primary patient leukemia samples confirms high levels of mir-196b
expression specifically in MLL leukemias. This increase in expression is observed in both acute myeloid, as well as acute lymphoid,
MLL leukemia samples. Significantly, non-MLL leukemias do not
express high levels of mir-196b. Abnormal expression of mir-196b
influences expression of many downstream targets that likely
contribute to the development of leukemia. Targets of mir-196b
include Hoxb8 and Hoxa7, along with an extensive list of
additional putative mir-196b targets. To either rule in or rule out a
direct contribution of mir-196b regulation of Hox target expression
in the transformation process, we quantitatively assessed levels of
multiple Hox genes after expression of mir-196b in bone marrow
progenitor cells. These include Hoxa5, Hoxa7, Hoxa9, Hoxa10,
Hoxb3, Hoxb4, Hoxb6, Hoxb8, Hoxc8, and Meis1. Hoxc8 and
Hoxb8 were below the level of detection in both control- and
mir-196b–expressing cells, suggesting that they do not play a role
in the observed phenotypes. Of the other genes measured, Meis1
and Hoxc6 do show decreased expression when mir-196b is
overexpressed, however, these are not predicted to be direct targets
of mir-196b. Further studies are needed to determine which
mir-196b targets are relevant in MLL leukemogenesis.
Using a serial replating hematopoietic colony assay, we show
that increased levels of mir-196b stimulate the proliferative capacity of hematopoietic progenitor cells, but are not sufficient to
completely immortalize cells. Furthermore, overexpression of
mir-196b in hematopoietic cells also results in a partial differentiation block such that a significant percentage of progenitors retain
expression of c-Kit under conditions that cause differentiation of
cells not expressing this miRNA. Increased proliferation and block
in differentiation are essential to leukemia development. Our
results suggest that misregulation of mir-196b expression by MLL
fusion proteins plays an important role in the disease. This evidence
establishes a connection between misregulation of miRNA expression and increased proliferation, survival, and differentiation block
in leukemia (Figure 7). In this model, expression of mir-196b is
tightly controlled by MLL in hematopoietic precursor cells. The
presence of MLL fusion proteins leads to aberrant mir-196b
expression causing increased proliferation, abnormal hematopoietic differentiation and contributes to leukemogenesis. MiRNAs
may be used as new molecular targets for the development of novel
therapeutic strategies.
Note added in proof. During revision of this manuscript,
Schotte and colleagues51 showed that mir-196b is specifically
overexpressed in MLL-rearranged ALL but not in other B-ALL
pediatric patient samples.
Acknowledgments
Wild-type and Mll null MEFs were kindly provided by Dr Patricia
Ernst and Dr Stanley Korsmeyer. We thank Dr Xianxin Hua for
providing wild-type and Men null MEFs and Dr Todd Golub for
help with the bead-based miRNA profiling.
This work was funded by the G. Harold and Leila Y. Mathers
Charitable Foundation (White Plains, NY; J.C.), National Institutes
of Health (NIH)/National Cancer Institute (NCI, Bethesda, MD;
CA105152, H.L.G.), Leukemia & Lymphoma Society (White
Plains, NY) Translational Research Grant (J.D.R.), the Dr Ralph
and Marian Faulk Medical Research Trust (Barrington, IL), and
NIH/NCI grants CA105049 and HL087188 (N.J.Z.-L.).
Authorship
Contribution: R.P. designed and performed research and wrote the
manuscript; L.E.R., C.S.V., A.C., J.Z., F.E.E., and J.L. designed
and performed research; N.J.A. and K.E. performed research;
H.L.G. and J.C. designed research, analyzed data, and edited the
manuscript; J.D.R. analyzed data and edited the manuscript; and
N.J.Z.-L. designed research and wrote and edited the manuscript.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Nancy J. Zeleznik-Le, 2160 South 1st Ave,
Building 112, Room 337, Maywood, IL 60153; e-mail:
[email protected].
References
1. Tkachuk DC, Kohler S, Cleary ML. Involvement
of a homolog of Drosophila trithorax by 11q23
chromosomal translocations in acute leukemias.
Cell. 1992;71:691-700.
2. Ziemin-van der Poel S, McCabe NR, Gill HJ, et al.
Identification of a gene, MLL, that spans the
breakpoint in 11q23 translocations associated
with human leukemias. Proc Natl Acad Sci U S A.
1991;88:10735-10739.
3. Rowley JD. The critical role of chromosome
translocations in human leukemias. Annu Rev
Genet. 1998;32:495-519.
4. Popovic R, Zeleznik L. MLL: how complex does it
get? J Cell Biochem. 2005;95:234-242.
5. Krumlauf R. Hox genes in vertebrate development. Cell. 1994;78:191-201.
6. Magli MC, Barba P, Celetti A, et al. Coordinate
regulation of HOX genes in human hematopoietic cells. Proc Natl Acad Sci U S A. 1991;88:
6348-6352.
7. Sauvageau G, Lansdorp PM, Eaves CJ, et al.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
3322
BLOOD, 2 APRIL 2009 䡠 VOLUME 113, NUMBER 14
POPOVIC et al
Differential expression of homeobox genes in
functionally distinct CD34⫹ subpopulations of
human bone marrow cells. Proc Natl Acad Sci
U S A. 1994;91:12223-12227.
8. Milne TA, Briggs SD, Brock HW, et al. MLL targets
SET domain methyltransferase activity to Hox gene
promoters. Mol Cell. 2002;10:1107-1117.
9. Nakamura T, Mori T, Tada S, et al. ALL-1 is a histone methyltransferase that assembles a supercomplex of proteins involved in transcriptional
regulation. Mol Cell. 2002;10:1119-1128.
10. Yokoyama A, Wang Z, Wysocka J, et al. Leukemia proto-oncoprotein MLL forms a SET1-like
histone methyltransferase complex with menin to
regulate Hox gene expression. Mol Cell Biol.
2004;24:5639-5649.
11. Golub TR, Slonim DK, Tamayo P, et al. Molecular
classification of cancer: class discovery and class
prediction by gene expression monitoring. Science. 1999;286:531-537.
12. Ayton PM, Cleary ML. Transformation of myeloid
progenitors by MLL oncoproteins is dependent on
Hoxa7 and Hoxa9. Genes Dev. 2003;17:22982307.
13. Popovic R, Erfurth F, Zeleznik-Le N. Transcriptional complexity of the HOXA9 locus. Blood
Cells Mol Dis. 2008;40:156-159.
14. Borrow J, Shearman AM, Stanton VP Jr, et al.
The t(7;11)(p15;p15) translocation in acute myeloid leukaemia fuses the genes for nucleoporin
NUP98 and class I homeoprotein HOXA9. Nat
Genet. 1996;12:159-167.
15. Kim MH, Chang HH, Shin C, et al. Genomic structure and sequence analysis of human HOXA-9.
DNA Cell Biol. 1998;17:407-414.
16. Bartel DP. MicroRNAs: genomics, biogenesis,
mechanism, and function. Cell. 2004;116:281297.
17. Calin GA, Sevignani C, Dumitru CD, et al. Human
microRNA genes are frequently located at fragile
sites and genomic regions involved in cancers.
Proc Natl Acad Sci U S A. 2004;101:2999-3004.
18. Hanson RD, Hess JL, Yu BD, et al. Mammalian
Trithorax and polycomb-group homologues are
antagonistic regulators of homeotic development.
Proc Natl Acad Sci U S A. 1999;96:14372-14377.
mitogen-induced acetylation of histone H4 and
gene activation. Genes Dev. 2001;15:2069-2082.
23. Ernst P, Fisher JK, Avery W, et al. Definitive hematopoiesis requires the mixed-lineage leukemia
gene. Dev Cell. 2004;6:437-443.
24. Lavau C, Du C, Thirman M, Zeleznik-Le N.
Chromatin-related properties of CBP fused to
MLL generate a myelodysplastic-like syndrome
that evolves into myeloid leukemia. EMBO J.
2000;19:4655-4664.
25. Lu J, Getz G, Miska EA, et al. MicroRNA expression profiles classify human cancers. Nature.
2005;435:834-838.
26. Saeed AI, Bhagabati NK, Braisted JC, et al. TM4
microarray software suite. Methods Enzymol.
2006;411:134-193.
27. Mi S, Lu J, Sun M, et al. MicroRNA expression
signatures accurately discriminate acute lymphoblastic leukemia from acute myeloid leukemia.
Proc Natl Acad Sci U S A. 2007;104:1997119976.
28. Yokoyama A, Somervaille TC, Smith KS, et al.
The menin tumor suppressor protein is an essential oncogenic cofactor for MLL-associated leukemogenesis. Cell. 2005;123:207-218.
29. Milne TA, Hughes CM, Lloyd R, et al. Menin and
MLL cooperatively regulate expression of cyclindependent kinase inhibitors. Proc Natl Acad Sci
U S A. 2005;102:749-754.
30. Milne TA, Martin ME, Brock HW, Slany RK, Hess
JL. Leukemogenic MLL fusion proteins bind
across a broad region of the Hox a9 locus, promoting transcription and multiple histone modifications. Cancer Res. 2005;65:11367-11374.
31. Scacheri PC, Davis S, Odom DT, et al. Genomewide analysis of menin binding provides insights
into MEN1 tumorigenesis. PLoS Genet. 2006;2:
e51.
32. Pokholok DK, Harbison CT, Levine S, et al.
Genome-wide map of nucleosome acetylation and
methylation in yeast. Cell. 2005;122:517-527.
33. Schubeler D, MacAlpine DM, Scalzo D, et al. The
histone modification pattern of active genes revealed through genome-wide chromatin analysis
of a higher eukaryote. Genes Dev. 2004;18:12631271.
19. Yu BD, Hess JL, Horning SE, Brown GA,
Korsmeyer SJ. Altered Hox expression and segmental identity in Mll-mutant mice. Nature. 1995;
378:505-508.
34. Yu BD, Hanson RD, Hess JL, Horning SE,
Korsmeyer SJ. MLL, a mammalian trithoraxgroup gene, functions as a transcriptional maintenance factor in morphogenesis. Proc Natl Acad
Sci U S A. 1998;95:10632-10636.
20. Jin S, Mao H, Schnepp RW, et al. Menin associates with FANCD2, a protein involved in repair of
DNA damage. Cancer Res. 2003;63:4204-4210.
35. Hess JL, Yu BD, Li B, Hanson R, Korsmeyer SJ.
Defects in yolk sac hematopoiesis in Mll-null embryos. Blood. 1997;90:1799-1806.
21. Erfurth FE, Popovic R, Grembecka J, et al. MLL
protects CpG clusters from methylation within the
Hoxa9 gene, maintaining transcript expression.
Proc Natl Acad Sci U S A. 2008;105:7517-7522.
36. Keller G, Kennedy M, Papayannopoulou T, Wiles
MV. Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell
Biol. 1993;13:473-486.
22. Frank SR, Schroeder M, Fernandez P, Taubert S,
Amati B. Binding of c-Myc to chromatin mediates
37. Ernst P, Mabon M, Davidson AJ, Zon LI,
Korsmeyer SJ. An Mll-dependent Hox program
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
drives hematopoietic progenitor expansion. Curr
Biol. 2004;14:2063-2069.
Hadrys T, Punnamoottil B, Pieper M, et al. Conserved co-regulation and promoter sharing of
hoxb3a and hoxb4a in zebrafish. Dev Biol. 2006;
297:26-43.
Simeone A, Pannese M, Acampora D, D’Esposito
M, Boncinelli E. At least three human homeoboxes on chromosome 12 belong to the
same transcription unit. Nucleic Acids Res. 1988;
16:5379-5390.
Mitjavila-Garcia MT, Cailleret M, Godin I, et al.
Expression of CD41 on hematopoietic progenitors derived from embryonic hematopoietic cells.
Development. 2002;129:2003-2013.
Armstrong SA, Staunton JE, Silverman LB, et al.
MLL translocations specify a distinct gene expression profile that distinguishes a unique leukemia. Nat Genet. 2002;30:41-47.
Ferrando AA, Armstrong SA, Neuberg DS, et al.
Gene expression signatures in MLL-rearranged
T-lineage and B-precursor acute leukemias:
dominance of HOX dysregulation. Blood. 2003;
102:262-268.
Yekta S, Shih IH, Bartel DP. MicroRNA-directed
cleavage of HOXB8 mRNA. Science. 2004;304:
594-596.
Chandrasekharappa SC, Guru SC, Manickam P,
et al. Positional cloning of the gene for multiple
endocrine neoplasia-type 1. Science. 1997;276:
404-407.
Bitoun E, Oliver PL, Davies KE. The mixedlineage leukemia fusion partner AF4 stimulates
RNA polymerase II transcriptional elongation and
mediates coordinated chromatin remodeling.
Hum Mol Genet. 2007;16:92-106.
Mueller D, Bach C, Zeisig D, et al. A role for the
MLL fusion partner ENL in transcriptional elongation and chromatin modification. Blood. 2007;110:
4445-4454.
Mansfield JH, Harfe BD, Nissen R, et al.
MicroRNA-responsive ‘sensor’ transgenes uncover Hox-like and other developmentally regulated patterns of vertebrate microRNA expression. Nat Genet. 2004;36:1079-1083.
Baskerville S, Bartel DP. Microarray profiling of
microRNAs reveals frequent coexpression with
neighboring miRNAs and host genes. RNA. 2005;
11:241-247.
Yan J, Chen YX, Desmond A, et al. Cdx4 and menin co-regulate Hoxa9 expression in hematopoietic cells. PLoS ONE. 2006;1:e47.
Bansal D, Scholl C, Frohling S, et al. Cdx4 dysregulates Hox gene expression and generates
acute myeloid leukemia alone and in cooperation
with Meis1a in a murine model. Proc Natl Acad
Sci U S A. 2006;103:16924-16929.
Schotte D, Chau JC, Sylvester G, et al. Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic
leukemia. Leukemia. 2009;23:313-322.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
2009 113: 3314-3322
doi:10.1182/blood-2008-04-154310 originally published
online February 2, 2009
Regulation of mir-196b by MLL and its overexpression by MLL fusions
contributes to immortalization
Relja Popovic, Laurie E. Riesbeck, Chinavenmeni S. Velu, Aditya Chaubey, Jiwang Zhang, Nicholas
J. Achille, Frank E. Erfurth, Katherine Eaton, Jun Lu, H. Leighton Grimes, Jianjun Chen, Janet D.
Rowley and Nancy J. Zeleznik-Le
Updated information and services can be found at:
http://www.bloodjournal.org/content/113/14/3314.full.html
Articles on similar topics can be found in the following Blood collections
Hematopoiesis and Stem Cells (3430 articles)
Lymphoid Neoplasia (2557 articles)
Myeloid Neoplasia (1686 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.