1 Stable transformation of ferns C. Neal Stewart

Plant Physiology Preview. Published on August 9, 2013, as DOI:10.1104/pp.113.224675
Stable transformation of ferns
C. Neal Stewart, Jr.
University of Tennessee
Knoxville, TN 37996
865 974 6487
[email protected]
http://plantsciences.utk.edu/stewart.htm
1
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Copyright 2013 by the American Society of Plant Biologists
Stable transformation of ferns using spores as targets: Pteris vittata (Chinese brake fern)
and Ceratopteris thalictroides (C-fern ‘Express’)
Balasubramaniam Muthukumar1, Blake L. Joyce1, Mark P. Elless2 and C. Neal Stewart,
Jr.1
1. University of Tennessee Knoxville, TN 37996. 2. Edenspace Systems Corporation, 1500
Hayes Dr, Manhattan, KS 66502.
2
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
This project was supported by Edenspace Systems Corporation through an NSF grant, the
University of Tennessee Ivan Racheff Endowment and the USDA-NIFA.
[email protected]
3
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Abstract
Ferns (Pteridophyta) are very important members of the plant kingdom that lag behind other taxa
with regards to our understanding of their genetics, genomics, and molecular biology. We report
here the first instance of stable transformation of fern with recovery of transgenic sporophytes.
Spores of the arsenic hyperaccumulating fern Pteris vittata (Chinese brake fern) and tetraploid
Ceratopteris thalictroides (C-fern ‘Express’) were stably transformed by Agrobacterium
tumefaciens with constructs containing the P. vittata actin promoter driving a GUSPlus reporter
gene. Reporter gene expression assays were performed on multiple tissues and growth stages of
gametophytes and sporophytes. Southern blot analysis confirmed stable transgene integration in
recovered sporophytes and also confirmed that no plasmid from Agrobacterium was present in
the sporophyte tissues. We recovered seven independent transformants of P. vittata and four
independent C. thalictroides transgenics. Inheritance analyses using GUS histochemical staining
revealed that the GUS transgene was stably expressed in second (T2) generation C. thalictroides
sporophytic tissues. In an independent experiment, the gusA gene that was driven by the 2x
CaMV 35S promoter was bombarded into P. vittata spores using biolistics in which putatively
stable transgenic gametophytes were recovered. Transformation procedures required no tissue
culture or selectable marker genes. However, we did attempt to use hygromycin selection, which
was ineffective to recover transgenic ferns. This simple stable transformation method should
help facilitate functional genomics studies in ferns.
4
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
INTRODUCTION
Ferns (Pteridophyta) are non-flowering vascular plants comprising of 250 genera, the second
largest group of diversified species in the plant kingdom (Gilford and Foster, 1989). Many
interesting traits are inherent in various fern species, such as arsenic hyperaccumulation (Pteris
vittata, Ma et al., 2001) insecticide production and allelopathy (Pteridium aquilinum, Marrs and
Watts, 2006), and antimicrobial compound production (Acrosticum aureum, Lai et al., 2009).
Ferns occupy the evolutionary niche between non-vascular land plants, bryophytes, and higher
vascular plants such as gymnosperms and angiosperms. Therefore, extant fern species still hold a
living record of the initial adaptations required for plants to thrive on land. Of these adaptations,
the most important is tracheids that comprise xylem tissues for water and mineral transport and
structural support. The vascular system allowed pteridophytes to grow upright during the
sporophyte generation leading to greater resource acquisition capacity. Ultimately, sufficient
resources allowed for greater spore production and upright growth, which facilitated spore
spread. Recent endeavors have investigated lower plant genomics including the sequencing of
the bryophyte, Physcomitrella patens (Rensing et al., 2008) and the lycophyte, Selaginella
moellendorfii (Banks et al., 2011). Both basic and applied biology of ferns lag far behind that for
angiosperms and even bryophytes.
Stable genetic transformation has been accomplished in a few species outside angiosperms and
gymnosperms, especially among bryophytes (Schaefer et al., 1991; Chiyoda et al., 2008; Ishizaki
et al., 2008), but never in the Pteridophyta. Transient transformation methods have been
developed both in C-fern (Ceratopteris richardii) and Chinese brake fern (Pteris vittata), which
were limited to heterologous expression in gametophytes (Rutherford et al., 2004; Indriolo et al.,
2010). While transient expression of transgenic constructs does enable research, there is no
substitute for stable transformation in functional genomics and plant biology. Researchers have
resorted to studying fern gene function using heterologous expression in the angiosperm model
plant Arabidopsis thaliana (e.g., Dhankher et al., 2006 ; Sundaram et al., 2009; Sundaram and
5
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Rathinasabapathi, 2010), which is far from optimal. Overexpression and knockdown analysis of
individual genes in a wide variety of fern species would undoubtedly accelerate our ability to
learn more about their biology and subsequently develop novel products from ferns.
Furthermore, a facile transformation system would accelerate functional genomics and systems
biology of ferns. For example, knockdown analysis of genes involved in interesting biosynthetic
pathways can greatly facilitate gene and biochemical discovery.
Pteris vittata has the unparalleled ability to accumulate more arsenic per gram biomass than any
other plant species, and is highly tolerant to arsenic (Gumaelius et al., 2004). It can thrive in soils
containing up to 1500 µg ml-1 arsenic, whereas most plants cannot survive 50 µg ml-1 arsenic
(Ma et al., 2001). Therefore, P. vittata has been the subject of extensive basic and applied
research for arsenic hyperaccumulation, translocation and resistance (Gumaelius et al., 2004) and
has been used for arsenic phytoremediation (Shelmerdine et al., 2009). For example, this fern
might be of great utility for the production of a safer rice crop; arsenic can be transported and
stored in the grain, resulting in serious human health ramifications (Srivastava et al., 2012). In a
recent greenhouse study P. vittata has been used to remediate arsenic contaminated soil.
Following remediation, rice plants were subsequently grown, and it was found that arsenic
uptake by rice grains was reduced by 52%, resulting in less than 1 µg ml-1 arsenic after two
rounds of remediation using P. vittata phytoremediation (Mandal et al., 2012).Furthermore, this
treatment also resulted in increased rice grain yield by 14% (w/w) compared to control.
Ceratopteris is a subtropical-to-tropical fern genus containing four-to six species living in
aquatic habitats. Ceratpteris richardii (C-fern)was developed as a model fern for teaching
(www.c-fern.org) and research owing to its small size, short life cycle (120 d), and its
amenability for in vitro culture (Banks, 1999). C- fern ‘Express’ was developed by Leslie G.
Hickok by crossing two Japanese varieties of Ceratpteris thalictroides (Hickok-personal
communication). C-fern ‘Express,’ a tetraploid, develops spores in 60 days of culture. Though Cfern spores have been shown to be a useful single cell model system and as a rapid and efficient
system for studying RNAi in ferns (Stout et al., 2003), no stable transformation studies have
been reported. In bryophytes, immature thalli are most often used as explants (Chiyoda et al.,
6
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
2008; Ishizaki et al., 2008), whereas in fungi, spores are routinely used for stable transformation
studies (Michielse et al., 2005; Utermark and Karlovsky, 2008).
The objective of our research was to develop, for the first time, a facile stable transformation
system for P. vittata and C. thalictroides using spores as the transformation targets. This method
can be used as an additional tool to further substantiate and strengthen the molecular mechanism
studies in pteridophytes.
MATERIALS AND METHODS
Actin Promoter Isolation and Vector Construction
Since there were no available fern promoters for transformation studies, we sought likely
candidates in P. vittata. The P. vittata actin gene was isolated from genomic DNA using plantconserved degenerate primers: (forward primer- 5’-ATGGCNGAYGGNGARGA-3’ and reverse
primer (Bhattacharya et al., 1993) 5’-GAAGCAYTTGCGRTGSACRAT-3’). The 5’ upstream
region of the putative actin gene was isolated by two-step genome-walking procedure using the
Genomewalker kit (Clontech, Mountain View CA). The putative actin promoter was used to
regulate the expression of the GUSPlus reporter gene. Two GUSPlus variants, one with and one
without a rice signal peptide sequence, were used to determine if one was more effective than the
other in fern transformation. pCAMBIA1305.2 (Genbank accession number AF354046) features
GUSPlus that contains a castor bean intron and a rice apoplastic signal peptide. This version was
used to transform P. vittata. For C. thalictroides transformation studies, the same P. vittata actin
promoter was used to control GUSPlus gene taken from pCAMBIA 1305.1 (Genbank accession
number AF354045), which lacks the rice apoplastic signal peptide. The actin promoter and
GUSPlus genes were subcloned into pDONRP4P1R and PCR8/GW/TOPO (Life Technologies
Carlsbad, CA 92008) respectively, using the manufacturer’s instructions for primer design and
cloning. The promoter and the GUSPlus fragments were cloned into the Gateway binary vector
R4pGWB 501, which also harbors a hygromycin phosphotransferase gene (hpt) for plant
7
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
hygromycin selection (Nakagawa et al., 2008, Fig. 1) using a multisite Gateway three fragment
vector construction kit (Life Technologies Carlsbad, CA 92008). After sequence confirmation
the binary vector (12.6 kb with T-DNA of 6.0 kb) was transformed into A. tumefaciens strain
EHA105 (Hood et al., 1993) using a freeze-thaw method (Hofgen and Willmitzer, 1988). The P.
vittata actin promoter and actin gene sequences were deposited into Genbank (KC463697).
Agrobacterium tumefaciens-Mediated Transformation of Spores
P. vittata was acquired from Edenspace Systems Corporation (Manhattan, Kansas) and spores
were collected from mature sporophyte fronds. C. thalictroides C-fern ‘Express’ spores were
obtained from Carolina Biological Supply Company (Burlington, NC). One hundred milligrams
of spores were suspended in 2 ml of sterile deionized water and cleaned using a 60 µm nylon
mesh followed by surface sterilization using 2.5 % (v/v) commercial bleach containing a few
drops of Tween-20 for 5 min and then washed five times in equal volumes of sterile water. After
each wash the spores were pelleted using a tabletop centrifuge at 10,000 for 3 min. Spores
were suspended in 0.5 ml 1.5 % (w/v) CMC (carboxy methyl cellulose low viscosity, Fisher
Scientific) as described in Sheffield et al., (2001). The spore concentration was calculated based
on hemocytomter counts. Based on the hemocytometer counts the spore volume was adjusted to
300 spores 50 ul -1. To increase the efficiency of spore germination, the suspended spores were
incubated at room temperature for 15 h before transformation or germination.
A 2 ml Agrobacterium inoculant culture was started in IM medium with the required antibiotic
(Utermark and Karlovsky, 2008) but without acetosyringone. After 8 h, 250 µl from the 2 ml
culture was inoculated into 25 ml of the same medium. The culture was grown to 0.8 OD for 15
h, at 28ºC, and then 10 ml of the culture was centrifuged at 5,000
for 15 min and resuspended
in 20 ml of the same Agrobacterium growth medium.200 µM acetosyringone was then added to
induce vir gene expression. The culture was further incubated for 24 h by shaking the suspension
at 60 rpm at room temperature (25°C) on a rotary shaker. Then, 0.5 ml of induced culture was
8
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
mixed with 0.5 ml of sterilized spore suspension. This mixture was incubated for 15 min and the
entire suspension was plated as 50 µl (300 spores/plate) aliquots on top of a hydrophilic PVDF
membrane (Fisher Scientific) in 100 mm co-cultivation agar plates containing Agrobacterium
growth medium, with 200 µM acetosyringone and 2 g l-1 gellan gum for 72 h. Membranes were
then transferred to ½ MS + 20 g sucrose plates containing 400 mg l-1 timentin to kill the residual
Agrobacterium. The spores were sub-cultured every 2- weeks in the same medium. The
transformation experiment was repeated five times and efficiency was calculated from three
independent experiments. After transformation, we simply allowed the ferns to progress
naturally through their life cycle. Spores germinated into gametophytes, which were transferred
to ½ MS (0 g sucrose) plates containing 200 mg l-1 timentin for sporophyte development. All
fern cultures were grown at 22ºC with 65 µmol m-2 s-1 light intensity using fluorescent lights
with 16 h/ 8 h light/dark cycle. Mature sporophytes were eventually transferred to 4 L pots
containing PRO-MIX potting media. Spores were collected and analyzed for transgene
inheritance analyses. The mature sporophytes were grown in growth chambers at 24ºC with 105
µmol m-2 s-1 irradiance from fluorescent lights under a 16 h / 8 h light/dark cycle. We used nontransgenic ferns from the same accessions as controls and they were treated identically (except
transformation).T1 spores were germinated in pots and allowed to grow until they formed
gametophytes and sporophytes. Tissues were collected and analyzed for GUS expression.
Hygromycin Sensitivity Assay
To determine whether hygromycin could be used as a selection agent, we performed a toxicity
analysis by plating spores on ½ MS medium containing 20 g sucrose and 400 mg l-1 timentin
supplemented with hygromycin (0, 3, 5, 10, 15, and 25 mg l-1). After 4 weeks, hygromycin
toxicity was determined based upon live/dead status of each fern. The experiment was repeated
twice.
Particle Bombardment of P. vittata Spores
9
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
P. vittata spores were surface sterilized using 70% (v/v) ethanol and 10% (v/v) bleach. Surface
sterilized spores were then plated onto PVDF membranes on ½ MS with 20 g sucrose medium in
1 ml aliquots for biolistic transformation. Fresh spores, five-day old germinating spores or
protonemata and fifteen-day old multicellular protenemata was used for transformation. The
pMDC32 vector containing a dual 35S promoter driving the gusA was used for transformation
(Curtis and Grossniklaus, 2003). Biolistic transformation was carried out using conditions
described for Glycine max that used 0.6 µm gold particles (Hazel et al., 1998). Nicotiana
tabacum cv. Xanthi leaves grown from in vitro cultures were used as a positive control. P. vittata
gametophytes and N. tabacum leaves were GUS stained after 3-weeks, after the gametophytes
were fully developed.
Marker Gene Analysis
GUS histochemical staining was performed using a standard protocol (Cervera, 2005), with
modifications to help infiltrate the P. vittata sporophyte fronds, which were recalcitrant to
standard staining. Fronds were perforated with carborundum 600 (Fisher Scientific) using cotton
swab by painting on both adaxial and abaxial surfaces, which was subsequently removed by
washing three times with 0.1 M Tris-HCl buffer pH 7.0. Fern tissues were incubated in GUS
staining solution, destained using 70% (v/v) ethanol to remove chlorophyll, rinsed with 50%
(v/v) glycerol, and viewed under a light stereoscope.
Southern Blot Analysis
Genomic DNA from each fern species was isolated using a CTAB method (Dong et al., 2005).
Between 3 to 5 g of young transgenic and non-transgenic control sporophyte fronds were
collected and frozen in liquid nitrogen. Tissues were homogenized in 500 l extraction buffer
μ
containing 2% (w/v) CTAB, 100 mM Tris–HCl pH 8.0, 1.4 M NaCl, 20 mM EDTA, 0.2% (v/v)
10
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
2-mercaptoetanol and incubated at 65°C for 20 min with 50 µg ml -1 RNAse A. Then, an equal
volume of chloroform:isoamyl alcohol (24:1,v/v) was added and mixed vigorously. The mixture
was centrifuged immediately at 6,000 for 20 min. The aqueous phase was transferred to a
fresh tube and 0.7 ml-1 of isopropyl alcohol was added and incubated at -20°C for at least 2 h.
The DNA was pelleted by centrifuging the mixture at 6,000 for 20 min. The DNA pellet was
washed twice with 70% (v/v) ethanol and resuspended in 400 l sterile distilled water. DNA was
μ
quantified using fluorometry as well as visual estimation using agarose gel electrophoresis.
For each sample, 15 µg genomic DNA was digested with BamHI or Cla I restriction
endonucleases (Fig. 1) and electrophoresed in 0.8% (w/v) agarose gels for 22 h. All gels were
loaded with 3 to 4 µl of DIG labeled lambda DNA marker III (HindIII-EcoRI digested-Roche
Applied Science) as size marker and 100 pg ml-1 ClaI or BamHI digested R4pGWB501 plasmid
DNA containing P. vittata actin promoter and GUSPlus, both of which can be detected in X-ray
film along with experimental samples. DNA was transferred to a nylon membrane (GE
Healthcare) by capillary blotting (Sambrook et al., 1989) and cross-linked by UV irradiation.
Membranes were hybridized with a 570-bp GUSPlus fragment gene or a 580-bp hpt fragment as
probes in 35 ml DIG EasyHyb solution at 42oC (for GUS probe 40oC) for 2 h,. The GUSPlus
primers were FP- 5 -CAAGCACCGAGGGCCTGAGC-3 and RP 5 ′
′
′
CTCAGTCGCCGCCTCGTTGG-3 .The hpt primers were FP 5’′
GCGCTTCTGCGGGCGATTTG and RP 5’- GTCCGAATGGGCCGAACCCG. Each probe was
DIG labeled (Roche Applied Science) and hybridizations were conducted at 42oC for the hpt
gene and 40oC for the gus gene in a rotating hybridization oven. The hybridization temperature
was based on Tm of the probe and the formula based on DIG hybridization buffer as specified in
the manufacturer’s protocol (Roche DIG application manual for filter hybridization).The
membranes were then washed twice in 2x SSC (SSC; Sambrook et al.,1989), 0.1% (w/v) sodium
dodecyl sulfate (SDS) at room temperature for 5 min each and twice in 0.1x SSC, 0.1% (w/v)
SDS at 60oC for 15 min each (Neuhaus-Url and Neuhaus, 1993; Dietzgen et al., 1999). Detection
of the hybridized probe DNA was carried out as described in the manufacturer’s protocol. Tenfold diluted CDP-Star chemiluminescent reagent (Roche Applied Science) was used (incubation
11
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
time 10 min) and signals were visualized on X-ray film after 6 h to 18 h exposure. The GUSplus
probe was used for BamHI digested blots and the hpt probe was used for ClaI digested blots.
RESULTS AND DISCUSSION
Isolation of a Putative Fern Actin Gene and its Promoter
An important missing component of fern molecular biology is effective promoters that can be
used for transgene expression. Actin genes are likely candidates to have constitutive promoters.
Thus, we identified P. vittata actin genes using degenerate primers designed from algae, ferns
and angiosperms, which resulted in a 1.4 kb PCR fragment. BlastN and tblastX sequence
analyses confirmed that the isolated PCR product from P. vittata was an actin gene. A neighborjoining tree was constructed based on Blast searches that revealed that the closest neighbors to
fern actin were Physcomitrella patens actin1 and Chlamydomonas reinhardtii actin
(Supplemental Fig. S1).
Once the actin gene structure was confirmed, we performed genome walking upstream to isolate
the actin promoter. During the first genome walk using a PvuII library, a 720-bp PCR product
was obtained. Sequencing results confirmed the isolation of 520-bp putative promoter region
located 5’ upstream of 200-bp actin gene template. A second genome walk was performed using
the 520-bp and a new 369-bp upstream region that was obtained from an EcoRV library. An 889bp putative promoter sequence was sequence-confirmed and assembled, and further used to drive
the expression of the GUSPlus gene. Motif analyses using PlantCARE and PLACE regulatory
element databases showed that the actin promoter contained several characterized higher plant
promoter motifs (Supplemental Table. I).
In Vitro Generation of Transgenic P. vittata and C. thalictroides Sporophytes
12
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
In our initial experiments, no antibiotic selection was used throughout the transformation studies
for both ferns. In parallel, non-transgenic control spores were also germinated and compared to
Agrobacterium-transformed spores (Fig. 2). Incubating suspended spores in CMC for 15 h at
room temperature before transformation increased the synchronization of growth of as well as
increased spore germination by 40% in P. vittata and 20% in C. thalictroides. GUS staining was
used to identify transformants at various life cycle stages. In P. vittata, mature prothalli (more
than 90%) began to form 6-weeks after spore transformation in ½ MS medium with 20% (w/v)
sucrose in both transgenic and non-transgenic control samples (Fig. 2A and B). After an
additional 6-weeks, approximately 90% of prothalli formed gametophytes in the same medium
(Fig. 2C and D). The 3-week-old gametophytes that were transferred to the same basal medium
without sucrose started to produce sporophytes after 5-weeks from both non-transgenic control
and transgenic gametophytes (Fig. 2E and F). Approximately 85% of the gametophytes gave rise
to sporophytes. Efficiency calculations were based on visual estimation for 3 different
transformation experiments. The sporophytes were established in potting media after 3-weeks
(Fig. 2G and H). Approximately 60% of the transferred sporophytes were established in soil. The
total time to obtain mature sporophytes from spores was 23 to 27 weeks. The efficiency of
sporophyte formation from spores was approximately 55 to 65%.
In C. thalictroides, 95% of prothalli were formed in 3-weeks both in control and transgenic
samples (Fig. 2I and J), which gave rise to 80% efficiency of gametophyte production at 4-weeks
post-transformation in both samples (Fig. 2K and L). Seventy percent of gametophytes produced
sporophytes 3 to 4 weeks after gametophytes were transferred to sucrose-free half strength basal
medium (Fig. 2M and N). About 60% of the transferred sporophytes survived to grow in potting
mix (Fig. 2O and P). Mature C. thalictroides sporophytes were obtained after 11 to 13-weeks of
culture from spores with 50 to 60% efficiency. All the calculations were based on three
independent experiments. The established sporophytes started sporulating after 8-weeks in pots
(Fig. 2O and P).
Spores from both species germinated normally in ½ MS medium with 20% sucrose and
continued to grow and produce gametophytes both in non-transgenic control and transgenic
13
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
samples). Previous studies have suggested that sucrose is necessary for germination and early
growth development of ferns (Camloh, 1993; Sheffield et al., 2001), yet the influence of sucrose
on the later stages of fern development was unknown. We found that sucrose was not necessary
for sporophyte development from gametophytes; however, the critical effect of sucrose on
growth stages was not studied. As expected, C. thalictroides was able to generate sporophytes
much quicker than the slower growing P. vittata (Gumaelius et al., 2004), but nonetheless,
generation of sporophytes was possible in both of these hermaphroditic ferns (Schedlbauer,
1976; Gumaelius et al., 2004) using same media and similar growth conditions. Samples that
were subjected to Agrobacterium appeared to lag a few days behind the controls, but there was
no other phenotypic differences observed between non-transgenic control and transgenic ferns.
Hygromycin as a Potential Selection Agent for Ferns
Hygromycin at 3 mg l-1 and 15 mg l-1 were the lowest concentrations that severely inhibited
growth of P. vittata and C. thalictroides, respectively, spores (Supplement Fig. S2). Thus, these
concentrations were used to attempt to select transformants for these species in separate
transformation experiments.
After co-cultivation with Agrobacterium for 90 h, P. vittata spores were immediately transferred
to ½ MS medium with and without hygromycin. Apparent normal growth was observed in
control plates (0 mg l -1 hygromycin and 400 mg l-1timentin) containing transformed and nontransformed spores, whereas on the hygromycin-containing plates, none of the spores germinated
at 4 weeks. In addition, GUS expression was observed in gametophytes obtained from
transformed control plates. The same result was obtained for C. thalictroides.
In another set of experiments both ferns were cultured on hygromycin-containing plates
following 2-weeks of incubation on plates without hygromycin after co-cultivation. The spores
germinated and formed prothalli, but then no further growth was observed after transfer to
hygromycin-containing plates, wherein the plants subsequently died.
14
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Thus, we conclude that more experiments are needed to determine whether hygromycin selection
is feasible. Selection regimes can be fine-tuned and/or a promoter stronger than nos is likely
required. Since the nos promoter is not a strong constitutive promoter, even in angiosperms
(Wilkinson et al., 1997; Christensen and Quail 1996; Bhattacharya et al., 2012), the next likely
step would be to replace it with a stronger promoter in the selectable marker cassette. We noted
that young prothalli are sensitive to hygromycin; lower amounts of hygromycin might be
required if antibiotic selection is desired.
Stable GUS Expression in Ferns Transformed by Agrobacterium and Particle
Bombardment
Since spores were used as the transformation targets, the resulting sporophytes that arise from
hermaphrodite gametophytes after fertilization of sperm and eggs are referred to as T1
transformants for both species. GUS expression was observed in all life stages of both fern
species: prothalli, gametophyes and sporophytes. In non-transgenic control prothalli, no GUS
expression was observed (Fig. 3A), but expression was detected as early as 6-weeks posttransformation in transgenic prothalli of P. vittata (Fig 3B). When transgenic P. vittata prothalli
further developed into gametophytes, GUS expression was observed in most of the gametophyte
tissues (Fig. 3D), which was not observed in non-transgenic control gametophytes (Fig 3C).
Particle bombardment of fresh spores as well as five-day-old germinating spores yielded fully
transformed young gametophytes with GUS expression in rhizoids and prothalli (Fig. 3E). When
fifteen-day-old multicellular protonemata were transformed, the result was apparent chimeric
expression of GUS in gametophytes (Fig. 3F). GUS expression driven by the 2x35S promoter
was observed an average of 12 ± 10 out of 100,000 spores which corresponds to a mean
transformation efficiency of 0.012% using biolistics.
15
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
The choice of targets for transformation plays a crucial role in successful stable transformation
by A. tumefaciens (de la Riva et al.,1998; Karami et al., 2009) and by biolistics (Kikkert et al.,
2004; Jones and Sparks, 2009). When spores were transformed using bombardment, evenly
GUS-stained gametophytes were observed, demonstrating that targeting spores for
transformation avoids the potential for chimeras. It also negates the need for tissue culture. Until
this study only fern gametophytes have been targeted for transient transformation (Rutherford et
al., 2004; Indriolo et al., 2010). From our results, it is possible that choosing spores as
transformation targets probably played a crucial role in successful transformation of these two
fern species, which is the same case in fungi (Michielse et al., 2005; Utermark and Karlovsky,
2008) where spores have been used as targets. Moreover, Agrobacterium-growth medium
(Utermark and Karlovsky, 2008) coupled with the phenolic compound acetosyringone, a known
inducer of vir genes (Stachel et al., 1986), has been successfully used in experiments for fungal
spore transformation as well.
Overall there was no visible difference in the GUS expression pattern in the first generation
sporophytes of both ferns. In sporophytes, no endogenous blue histochemical GUS staining was
observed in non-transgenic control tissues that were treated with or without carborundum, in
contrast to the confirmed transgenic plants (Fig. 4B). In P. vittata sporophytes, blue GUS
staining was observed only in carborundum-treated mature sporophyte fronds (Fig. 4A).
Carborundum treatment was not required for effective GUS staining of transgenic C.
thalictroides sporophytes; their fronds GUS-stained evenly (Supplemental Fig. 3). One version
of the GUSPlus marker gene we used contains a rice signal peptide that facilitates GUS
expression in apoplasts. C. thalictroides was transformed with GUSPlus gene with no signal
peptide. Nonetheless, a similar pattern of GUS expression was observed in fronds of both
species.
In P. vittata, GUS expression was visible only after carborundum 600 mesh size treatments,
possibly because random carborundrum perforations helped the GUS staining solution enter into
the otherwise impenetrable frond tissues. Other mesh sizes, i.e., 300 and 1200, were not
effective in GUS assays. The tape sandwich method (Wu et al., 2009), which was used to peel
16
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
off epidermal layers in an Arabidopsis protoplast isolation method, also yielded effective GUS
staining in P. vittata fronds, but resulted in tearing of fronds, whereas the fronds perforated by
carborundum were intact. Although these fronds were intact after carborundum perforation, GUS
staining was observed only in those areas where carborundum perforation removed the epidermal
layers. Carborundum is routinely used to aid screening of plant susceptibility for pathogens
(Thaler et al., 2004); however, to the best of our knowledge, this is the first time carborundum
was used to aid in GUS assays.
GUS Expression Analysis in T1 Gametophytes and T2 Sporophytes of C. thalictroides
The gametophytes along with the T2 sporophytes that developed from T1 spores from two
independent transgenic lines 1 and 7 were assayed using histochemical GUS staining. Out of 15
gametophytes screened from each line, 13 and14 of them were positive in each line. GUS
expression was not observed in non-transgenic control gametophytes (Fig. 4C whereas in
transgenic gametophytes GUS expression was seen throughout the entire gametophyte tissue
(Fig. 4D). Seven sporophytes from transgenic lines 1 and 7 were also screened for GUS
expression. In line 1, five sporophytes were positive for GUS expression and in line 7, four
sporophytes were positive for GUS expression. GUS expression was seen in almost all parts of
the frond tissue (Fig. 4E) while in control tissues no GUS expression was observed (Fig. 4F). In
GUS staining, potassium ferrocyanide and potassium ferricyanide aids in rapid oxidation of XGluc during hydrolysis (Cervera, 2005), which might have prevented GUS gene expression from
being observed in all tissues that were analyzed for GUS expression, including the parts of the
sporophytes. We expected that all C. thalictroides T1 gametophytes and T2 sporophytes from
otherwise-confirmed transgenics would be GUS positive since this is a hermaphrodite species,
but this was not the case. It is possible that T-DNA integration could have occurred in
germinating spores during the 90 h cultivation period, which could have led to chimeric plants.
Fern Actin Promoter Performance
17
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
The 889-bp 5’upstream region of the P. vittata actin gene was sufficient to highly express the
GUSPlus reporter gene in both ferns in all life stages, including prothalli, the sexual
gametophytes, and the asexual diploid sporophytes. Moreover, the actin promoter isolated from
P. vittata was able to function efficiently in another Pteridaceae family member, C. thalictroides,
which might indicate regulatory elements in the actin promoter could be expected to function in
other fern taxa as well.
Transformation Efficiency
For P. vittata, approximately 40,000 to 50,000 spores were subjected to three transformation
experiments with no antibiotic selection (Table I). The average transformation efficiency,
calculated at the prothalli stage, was 0.053%. If calculated at the gametophyte stage, it was
0.045%. Of the 5000 sporophytes that were still associated with gametophytes that were
randomly screened for GUS, only 40 GUS-positive sporophytes were transferred to pots. Of
these, 29 sporophytes survived and were established in pots. This efficiency likely under
represents the actual transformation efficiency because subsampling for GUS expression was
performed at each life stage. Moreover, all sporophytes that were formed from gametophytes
were not recovered and analyzed. Hence for calculating transformation efficiency, sporophytes
were not considered. All of the 29 established sporophytes were GUS-positive and were found to
contain T-DNA inserts using Southern blot analysis.
For C. thalictroides, approximately 60,000 to 90,000 spores were used for three transformation
experiments with no antibiotic selection (Table I). If calculated at the prothalli stage, the
transformation efficiency was 0.02%. If calculated at the gametophyte stage, it was 0.03%. Of
the 6000 sporophytes that were randomly selected for GUS assays, only 28 of these were
transferred to pots. Of these, 10 of the 15 sporophytes that survived transplanting were GUSstain positive. All of the 10 GUS-positive plants were positive for the transgene in the Southern
blot analysis.
18
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Direct comparison of transformation efficiencies among taxa is difficult because each
transformation method is influenced by various factors and efficiency calculations are not
standardized. However, our fern spore transformation efficiency reported here is nearly identical
that found for fungal (Fusarium oxysporum) spore transformation (Mullins, et al., 2001), in
which there was 0.05% (500 transgenic conidia per 106 spores) efficiency. Ten-fold higher
transformation efficiency (0.8 %, 800 sporangia from 105 spores) has been reported for liverwort
transformation based on initial hygromycin resistant sporangial development from prothalli
(Ishizaki et al., 2008). Similarly in Arabidopsis thaliana plants, 0.5% to 3% transformation
efficiency has been reported using the floral dip transformation method (Bechtold et al., 1993;
Clough and Bent, 1998). Nonetheless, floral dip transformation is highly efficient only in A.
thaliana and, apparently, only in some ecotypes. It is important to demonstrate stable
transformation and inheritance, which was shown here in the various life stages of two fern
species.
We conservatively chose GUS as the visible marker for these experiments because of its
sensitivity; we had no apriori knowledge about the strength of promoters controlling marker
gene expression. In the absence of using antibiotic selection, the experimental efficiency could
be increased by using a fluorescent marker such as an orange fluorescent protein gene instead of
GUS (Mann et al., 2102). If an orange fluorescence assay could be used at the prothalli stage,
for example, subjecting a few thousand spores to transformation would lead to selecting just a
few transformed ferns, which would greatly reduce the numbers of ferns handled throughout the
life cycle.
Transgene Integration
Even though the first generation of sporophytes belongs to T1 generation, they are largely
supported by remaining gametophyte tissues and hence we thought it might be possible that
Agrobacterium could persist in the sporophyte tissues. Southern blot analysis was performed to
19
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
test for stable integration of T-DNA in the genomes of both ferns and to estimate T-DNA copy
numbers.
Southern blot hybridization of Cla I digested genomic DNA from fronds of sporophytes of both
ferns using hygromycin phosphotransferase (hpt) gene probe from pGWB501 vector revealed
that a 5.7 kb Agrobacterium plasmid band (Fig. 1) was not present in any of the transgenic ferns
assayed (Fig. 5 and Supplemental Fig. S4A). In all 29 transgenic P. vittata, the hpt probe
hybridized to a ca. 2.0- 2.1 kb ClaI fragment ( Fig. 5 A, B C, Supplemental Fig. S4A), whereas
in all 10 transgenic C. thalictroides (Fig. 5D) strong hybridization was observed at 2.8 kb.
Additionally, in C. thalictroides there was also a weaker hybridization signal observed at 2.6 kb.
In both ferns, similar hybridization signals were observed in most of the individual transgenic
ferns examined. Moreover, all GUS positive lines were also hpt-positive in the Southern blots,
which implies that all transgenic lines had the full T-DNA insert.
In the pGWB501 vector, there is one BamHI site present within the T-DNA (Fig. 1), and BamHI
digestion was utilized to estimate number of T-DNA inserts integrated into the P. vittata and C.
thalictroides genome among transgenic plants. In P. vittata, most of the transgenic lines
apparently contained more than one insert, and the hybridization patterns were similar among
transgenic events. Transgenic lines in lanes 2-7, 9 and 10 had at least 6 inserts of the GUSPlus
gene (Fig. 6A). Only one line (lane 19) had a single insert (Fig. 6B).Transgenic lines loaded in
lanes 14, 18 and 22 had at least three inserts (Fig. 6B). Lines loaded in lanes 13, 15, 16 and 17,
21 and 22 lanes had at least two inserts (Fig. 6B). Lines loaded in lanes 48 to 53 and 55 to 57 in
Fig. S4 had only 2 inserts. The band sizes ranged from 1.8 kb to 9.5 kb. Based on the banding
pattern and the copy number estimation in the Southern blot analysis, there were ca. 7
independent transgenic P. vitatta events recovered.
C. thalictorides genomic DNA was apparently more difficult to digest with BamHI compared to
P. vittata genomic DNA. We used 150 units of BamHI to digest 15 µg DNA of P. vittata DNA,
but C. thalictroides required 400 units of enzyme to digest most of the genomic DNA. Despite
this problem, both Cla I and BamHI enzymes effectively digested genomic DNA of both ferns
20
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
(Supplemental Fig. S5). In. C. thalictorides, 4 lines (lanes 25 to 28) were found to contain only a
single T-DNA insert (Fig. 6C).Transgenic lines loaded in lanes 31 and 32 had an estimated 4
copies and lines in lanes 33 and 34 had at least 6 copies of the T-DNA. Lines in lanes 35 and 36
was also found to have at least 6 copies but in different apparent locations compared to lines
loaded in lanes 31 and 32 (Fig. 6D). The band sizes ranged from 1.8 kb to 8.5 kb. Based on this
analysis, we estimate there were up to 10 independent transgenic events analyzed.
Southern blot analysis confirmed that there was no Agrobacterium-derived plasmid
contamination and full-length integration of the T-DNA in transgenic plants. The presence of the
2.0 kb hpt gene insert in both ferns and 2.8 and 2.6 kb in C. thalictroides depended on the nearest
Cla I sites near the LB in the genome where it was integrated. It may be possible that a Cla I site
might exist proximal to 2 kb at the LB-plant genome junction. Multiple inserts that might not be
random has been observed previously in transgenic angiosperms (Gelvin and Kim, 2007), fungi
(Michielse et al., 2005) and bryophytes (Ishizaki et al., 2008). Similar to our system, in which no
selection pressure was used to select transgenic lines, it was found that in A. thaliana that TDNA was integrated at multiple locations in the genome without any discrimination of DNA
sequence (Kim et al., 2007). Southern blots for both the hpt gene and GUS gene substantiated the
integration of the entire T-DNA in the fern genome. However, in 8 lines of P. vittata and 2 lines
of C. thalictroides, Southern blot analysis using the GUS probe showed many small-sized bands
in both blots which might be the results of indiscriminate restriction enzyme digestion occurring
in both ferns i.e., BamHI. Although in Agrobacterium-mediated transformation, truncated
transgene integration is less likely to occur than in biolistics, it has been observed in higher
plants especially in Pinus strobus and in wheat (Levee et al., 1999; Hensel et al., 2012). In the
remaining C. thalictroides lines and in P. vittata, it can be concluded that T-DNAs are mostly
integrated intact. Multiple T-DNA insertion events per fern in both species were observed during
this study. Since both ferns are homosporous and hermaphroditic in nature, multiple T-DNA
insertions might have occurred in the initial haploid stages as T-DNA insertion can occur
multiple times during the transformation process. Multiple T-DNA insertions in a single line
have been observed in A. thaliana (Alonso et al., 2003; O’Malley and Ecker, 2010), and multiple
21
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
T-DNA insertions were also observed even within a single locus in A. thaliana (Valentine et al.,
2012). Based on our results, multiple T-DNA insertions might have occurred within a narrow
region of the fern genome. Analyses of more transgenic fern lines will help determine the pattern
of T-DNA insertion, and will also determine whether more single insertion events can be
obtained using this spore transformation method.
Conclusions
We have demonstrated that two fern species can be stably transformed by targeting spores using
either Agrobacterium tumefaciens or biolistics. We also discovered and validated a fern actin
promoter, which is active in two fern species at each life stage. These tools should enable
expanded functional genomics studies in ferns, which will help to provide answers to many
questions currently unknown in fern biology, including those regarding sex determination.
Furthermore, since C-fern ‘Express’ is emerging as a fern model the ability to stably transform it
will enhance its usefulness as a model. Practical research in P. vittata should also be enabled,
especially with regards to arsenic hyperaccumulation (Gumaelius et al., 2004) to further develop
its capabilities for phytoremediation and phytosensing applications. We are encouraged that ferns
are apparently amenable to Agrobacterium-mediated transformation and that spores could be
universal targets for fern transformation.
ACKNOWLEDGEMENTS
We thank Jonathan Willis for helping with DIG Southern blot experiments, Jason Burris for
assistance in transformation experiments, and Kellie Burris, Jennifer Hinds, Reggie Millwood,
Yijia Zhang and Mike Blaylock for their encouragement and help. We also thank Mitra Mazarei
and Reza Hajimorad for their assistance in carborundum perforation experiments. We would like
22
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
to thank Dr. Les Hickok University of Tennessee, Knoxville (retired) for sharing information
about C-fern, which was useful in this study.
LITERATURE CITED
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK,
Zimmerman J, Barajas P, Cheuk R, et al. (2003) Genome-wide insertional
mutagenesis of Arabidopsis thaliana. Science 301: 653–657
Banks JA (1999) Gametophyte development in ferns. Annu Rev Plant Physiol Plant Mol
Biol 50: 163-186
Banks JA, Nishiyama T, Hasebe M, Bowman JL, Gribskov M, dePamphilis C, Albert VA,
Aono N, Aoyama T, Ambrose BA, Ashton NW, Axtell MJ, Barker E, Barker MS,
Bennetzen JL, et al. (2011) The Selaginella genome identifies genetic changes
associated with the evolution of vascular plants. Science 332: 960-963
Bechtold N, Ellis J, Pelletier G (1993) In planta Agrobacterium mediated gene transfer by
infiltration of adult Arabidopsis thaliana plants. C R Acad Sci Paris, Life
Sciences 316:1194–1199
Bhattacharya DS, Stickel D, Sogin ML (1993) Isolation and molecular phylogenetic
analysis of actin coding regions from the prymnesiophyte alga, Emilianiahuxleyi, using
reverse transcriptase and PCR methods. Mol Biol Evol 10:689–703
Bhattacharyya J, Chowdhury A, Ray S, Jha J, Das S, Gayen S, Chakraborty A, Mitra J,
Maiti M, Basu A, Sen S (2012) Native polyubiquitin promoter of rice provides increased
constitutive expression in stable transgenic rice plants. Plant Cell Rep 31:271–279
Camloh M (1993) Spore germination and early gametophyte development of Platycerium
bifurcatum. Amer Fern J 83: 79-85
Cervera M (2005) Histochemical and fluorometric assays for uidA (GUS) gene detection.
In Pena L, ed. Transgenic plants: Methods and Protocols, Vol 286.
23
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Humana Press, NJ, pp 203-213
Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors for high-level expression
of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic
Res 5:213–218
Chiyoda S , Ishizaki K , Kataoka K, Yamato KT, Kohchi T (2008) Direct transformation of
the liverwort Marchantia polymorpha L.by particle bombardment using immature thalli
developing from spores. Plant Cell Rep 27: 1467-1473
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium mediated
transformation of Arabidopsis thaliana. Plant J 16: 735–743
Curtis MD, Grossniklaus U (2003) A Gateway cloning vector set for high-throughput
functional analysis of genes in planta. Plant Physiol 133: 462-469
de la Riva GA, Gonzalez-Cabrera J, Vázquez-Padrón R, Ayra-Pardo C (1998)
Agrobacterium tumefaciens: a natural tool for plant transformation. Electronic J
Biotechnology 1: 18-133
Dhankher OP, Rosen BP, McKinney EC, Meagher RB (2006) Hyperaccumulation of arsenic
in the shoots of Arabidopsis silenced for arsenate reductase (ACR2). Proc Natl Acad Sci
USA 103: 5413–5418
Dietzgen RG, Abedina M, Higgins CM, Karunatratne S, Vickers J (1999) Nonradioactive
detection of transgenes in plant genomic Southern blots. Biochemica 1: 19–20
Dong R, Formentin E , Losseso C, Carimi F, Benedetti P, Terzi M, Schiavo FL (2005)
Molecular cloning and characterization of a phytochelatin synthase gene, PvPCS1, from
Pteris vittata L. J Ind Microbiol Biotechnol 32: 527-523
Gelvin SB, Kim S-I (2007) Effect of chromatin upon Agrobacterium T-DNA integration
and transgene expression. Biochim et Biophys Acta 1769: 410–421
Gifford E, Foster A (1989) Morphology and Evolution of Vascular Plants. Freeman and Co,
NY, pp 626
Gumaelius L, Lahner B, Salt DE, Banks JA (2004) Arsenic hyperaccumulation in
24
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
gametophytes of Pteris vittata: a new model system for analysis of arsenic
hyperaccumulation. Plant Physiol 136: 3198–3208
Hazel CB, Klein TM, Anis M, Wilde HD, Parrott WA (1998) Growth characteristics and
transformability of soybean embryogenic cultures. Plant Cell Rep 17: 765-772
Hensel G, Oleszczuk S, Daghma DES, Zimny J, Melzer M, Jochen Kumlehn J (2012)
Analysis of T-DNA integration and generative segregation in transgenic winter
triticale (x Triticosecale Wittmack). BMC Plant Biol 12:171
Hofgen R, Willmitzer L. (1988) Storage of competent cells for Agrobacterium
transformation. Nucleic Acids Res 16:9877
Hood EE, Gelvin SB, Melchers LS, Hoekema A (1993) New Agrobacterium helper
plasmids for gene transfer to plants. Transgenic Res 2: 208–218
Indriolo E, Na GN, Ellis D, Salt DE, Banks JA (2010) A vacuolar arsenite transporter
necessary for arsenic tolerance in the arsenic hyperaccumulating fern Pteris vittata is
missing in flowering plants. Plant Cell 22: 2045–2057
Ishizaki K, Chiyoda S, Yamato KT, Kohchi T (2008) Agrobacterium-mediated transformation
of the haploid liverwort Marchantia polymorpha L., an emerging model for plant
biology. Plant Cell Physiol 49: 1084–1091
Jones HD, Sparks CA (2009) Stable transformation of plants. In Somers DJ, Langridge P,
Gustafson JP, Eds. Methods in Molecular Biology, Vol 513. Humana Press NY, pp 111130
Karami O, Esna-Ashari M, Kurdistani GK, Aghavaisi B (2009) Agrobacterium-mediated
genetic transformation of plants: the role of host. Biologia Plantarum 53: 201-212
Kikkert JR, Vidal JR, Reisch BI (2004) Stable transformation of plant cell by particle
bombardment/biolistics. In Pena L, Ed., Transgenic Plants: Methods and Protocols.
Humana Press, NJ, USA, pp 61–78
Kim S-I, Veena, Gelvin SB (2007) Genome-wide analysis of Agrobacterium T-DNA
integration sites in the Arabidopsis genome generated under nonselective conditions.
Plant J 51: 779–791
25
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Lai Hy, Lim YY, Tan SP (2009) Antimicrobial tyrosinase inhibiting activities of leaf extracts
from medicinal ferns. Biosci Biotechnol Biochem 73: 1362-1366
Levee V, Garin E, Klimaszewska K, Seguin A (1999).Stable genetic transformation of white
pine (Pinus strobus L.) after cocultivation of embryogenic tissues with Agrobacterium
tumefaciens. Mol Breed 5: 429–440
Ma LQ, Komar KMM, Tu C, Zhang W, Cai Y, Kennelley ED (2001) A fern that
hyperaccumulates arsenic. Nature 409: 579
Mandal A, Purakayastha, TJ, Patra, AK, Sanyal SK (2012) Phytoremediation of arsenic
contaminated soil by Pteris vittata. Effect on arsenic uptake and rice yield. Intl J
Phytoremediation 14: 621–628
Mann DGJ, Abercrombie LL, Rudis MR, Millwood RJ, Dunlap JR, Stewart CN Jr (2012)
Very bright orange fluorescent plants: endoplasmic reticulum targeting of orange
fluorescent proteins as visual reporters in transgenic plants. BMC Biotechnol 12: 17.
Marrs RH, Watt AS (2006) Biological flora of the British Isles 245: Pteridium
aquilinum (L.) Kuhn. J Ecol 94: 1272-1321
Michielse CB, Hooykaas PJ, van den Hondel CA, Ram AF (2005) Agrobacterium-mediated
transformation as a tool for functional genomics in fungi. Curr Genet 48: 1-17
Mullins ED, Chen X, Romaine P, Raina R, Geiser DM, Kang S (2001) Agrobacterium
tumefaciens-mediated transformation of Fusarium oxysporum: an efficient tool for
insertional mutagenesis and gene transfer. Phytopathology 91:173–180
Nakagawa T, Nakamura S, Tanaka K, Kawamukai M, Suzuki T, Nakamura K, Kimura
T, Ishiguro S (2008) Development of R4 Gateway binary vectors (R4pGWB) enabling
high-throughput promoter swapping for plant research. Biosci Biotechnol Biochem 72:
624–629
Neuhaus-Url G, Neuhaus G (1993) The use of nonradioactive digoxigenin chemiluminescent
technology for plant genomic Southern blot hybridization: A comparison with
radioactivity. Transgenic Res 2: 115–120
26
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
O’Malley RC, Ecker JR (2010) Linking genotype to phenotype using the Arabidopsis
unimutant collection. Plant J 61: 928–940
Rensing SA, Lang D, Zimmer AD, Terry A, Salamov A, Shapiro H, Nishiyama T, Perroud
P-F, Lindquist EA, Kamisugi Y, Tanahashi T, et al, (2008) The Physcomitrella
genome reveals evolutionary insights into the conquest of land by plants. Science 319:
64-69
Rutherford G, Tanurdzic M, Hasebe M, Banks J (2004) A systemic gene silencing
method suitable for high throughput, reverse genetic analyses of gene function in fern
gametophytes. BMC Plant Biol 4: 6.5
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory
Manual (Cold Spring Harbor Lab Press, Plainview NY, pp 7.6-7.9
Schaefer D, Zryd JP, Knight CD, Cove DJ (1991) Stable transformation of the moss
Physcomitrella patens. Mol Gen Genet 226: 418-424
Schedlbauer MD (1976) Fern gametophyte development: Controls of dimorphism in
Ceratopteris thalictroides. Amer J Bot 63: 1080-1087
Sheffield E, Douglas GE, Hearne SJ, Huxam S, Wynn JM (2001) Enhancement of
fern spore germination and gametophyte growth in artificial media. Amer Fern J 91:179186
Shelmerdine P.A., Black C.R., McGrath S.P., Young S.D. (2009). Modelling
phytoremediation by the hyperaccumulating fern, Pteris vittata, of soils historically
contaminated with arsenic. Environ Pollut 157: 1589–1596
Srivastava S, Suprasanna P, D’Souza SF (2012) Mechanisms of arsenic tolerance and
detoxification in plants and their application in transgenic technology: a critical
appraisal. Intl J Phytoremed 14 : 506-517
Stachel SE, Nester EW, Zambryski PC (1986) A plant cell factor induces Agrobacterium
tumefaciens vir gene expression. Proc Natl Acad Sci USA 83: 379-383
Stout SC, Clark GB, Archer-Evans S, Roux SJ (2003) Rapid and efficient suppression of gene
27
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
expression in a single-cell model system, Ceratopteris richardii. Plant
Physiol 131: 1165–1168
Sundaram S, Rathinasabapathi B (2010) Transgenic expression of fern Pteris vittata
glutaredoxin PvGrx5 in Arabidopsis thaliana increases plant tolerance to high
temperature stress and reduces oxidative damage to proteins. Planta 231: 361-369
Sundaram S, Wu S, Ma LQ Rathinasabapathi B (2009) Expression of a Pteris
vittata glutaredoxin PvGRX5 in transgenic Arabidopsis thaliana increases plant arsenic
tolerance and decreases arsenic accumulation in the leaves. Plant Cell Environ 32:851858
Thaler JS, Owen B, Higgins VJ (2004) The role of the jasmonate response in plant
susceptibility to diverse pathogens with a range of lifestyles. Plant Physiol 135: 530–
538
Utermark J, Karlovsky P (2008) Genetic transformation of filamentous fungi by
Agrobacterium tumefaciens. Nat Protocols 10:1038/nprot.2008.83
Valentine ME, Wolyniak MJ, Rutter MT (2012) Extensive phenotypic variation among
allelic T-DNA inserts in Arabidopsis thaliana. PLoS ONE 7: 9 e44981
Wilkinson JE, Twell D, Lindsey K (1997) Activity of CaMV 35S and nos promoters in pollen:
implications for field release of antisense transgenic plants. J Exp Botany 48: 265–275
Wu FH, Shen SC, Lee LY, Lee SH, Chan MT, Lin CS (2009) Tape-Arabidopsis sandwich–a
simpler Arabidopsis protoplast isolation method. Plant Meth 5: 16
28
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Figure legends
Figure 1. Vector map of R4pGWB501 multisite Gateway binary vector containing the P. vittata
actin promoter driving the GUSPlus gene with or without an apoplastic signal peptide sequence.
There is a unique BamHI site in the T-DNA that was used to determine insertion (copy) number
in transgenic P. vittata and C. thalictroides sporophytes using Southern blot analysis. A 5.7 kb
Cla I fragment is noted; it was utilized to diagnose whether Agrobacterium plasmid derived
contamination was present using Southern blot analysis from putative transgenic frond samples.
Figure 2. In vitro generation of non-transgenic control and transgenic sporophytes of C.
thalictroides (A to G) and P. vittata (H to O). Both Agrobacterium-mediated transformed spores
and non-transgenic control spores were germinated on ½ MS medium. The non-transgenic
prothalli (A and H) and transgenic prothalli (B and I) were transferred to the same medium
where they formed gametophytes. The non-transgenic gametophytes (C and J) and transgenic
gametophytes (D and K) were transferred to ½ MS medium without sucrose and generated nontransgenic sporophytes (E and L) and transgenic sporophytes (F and M), which were
subsequently transferred and established in pots (F and N: non-transgenic, G and O: transgenic).
Scale bar = 3 mm.
Figure 3. GUS histochemical staining of P. vittata T0 prothalli and gametophytes. Six week-old
prothalli (B) and gametophytes (D) derived from transgenic spores obtained from Agrobacterium
tumefaciens-mediated transformation. A and C are non-transgenic control prothalli and
gametophytes, respectively. E. Protonemata of P. vittata showing GUS expression one week
after bombardment of spores with a 2x35S CaMV promoter-gusA gene construct. F. GUS
expression in gametophytes derived from spores of P. vittata after bombardment. Scale bar =
0.25 mm.
Figure 4. GUS histochemical staining of transgenic and control T1 P. vittata, T1 C. thalictroides
gametophytes and T2 sporophytic fronds. Controls are labeled as B, C and F.
Mature
sporophytes were generated from transgenic spores of P. vittata (A). T1 gametophytes (D) and
29
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
T2 sporophytes (E) of C. thalictroides were generated from transgenic T1 spores obtained from
T1 sporophytes. Scale bar = 3 mm.
Figure 5. Southern blot analysis of T1 sporophytes of P. vittata (A, B, C) and C. thalictroides
(D). Genomic DNA from fronds were digested with ClaI and probed with a DIG-labeled hpt
gene fragment. Lanes 2-5, 7-10 and 12-22: transgenic P. vittata. Lanes 1, 6 and 23: nontransgenic P. vittata . Lanes 11 and 24: ClaI digested R4pGWB 501 actin promoter-GUSPlus
plasmid DNA. Lanes 26-35: transgenic C. thalictroides. Lane 34: non-transgenic C.
thalictroides. DIG-labeled Lambda DNA was used as a marker in all blots. Each plant sample
lane represents individual plants arising each from an independent spore.
Figure 6. Southern blot analysis of T1 sporophytes of P. vittata (A, B) and C. thalictroides (C,
D) to determine the number of T-DNA inserts. Genomic DNA from fronds were digested with
BamHI and probed with a DIG-labeled GUSPlus gene fragment. Lane 1: BamHI-digested
R4pGWB 501 actin promoter-GUSPlus plasmid DNA. Lanes 2-7, 9-11 and 13-22: transgenic P.
vittata. Lanes 8 and 12: non-transgenic P. vittata. Lanes 25-28 and 31-36: transgenic C.
thalictroides. Lanes 23 and 29: BamH1-digested plasmid positive control. Lanes 24 and 30: nontransgenic C. thalicroides. DIG labeled Lambda DNA was used as a marker in all the gels. Each
plant sample lane represents individual plants arising each from an independent spore.
Supplemental figure legends
Figure S1: The phylogenetic relationship of the P. vittata actin gene with selected actin genes
from other plant species. The actin genes were selected based on tBlastX analysis of newly
isolated P. vittata actin gene. Multiple alignments were done using Vector NTI 11.5 and the tree
was visualized using TreeViewX software.
30
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Figure S2. Hygromycin kill curve analysis of P. vittata and C. thalictroides, which were scored
based on gametophytes formed after 3-4 weeks of culture on 1/2 MS medium. Scale bar = 3 mm.
Figure S3: GUS histochemical staining of transgenic and control T1 C. thalictroides sporophytic
fronds. Mature sporophytes were generated from transgenic or control spores of C. thalictroides.
Scale bar = 3 mm.
Figure S4. Southern blot analysis of T1 sporophytes of P. vittata to screen for Agrobacterium
plasmid contamination and for T-DNA insert number from a subsample of 10 of 29 T1 P. vittata
sporophytes. Genomic DNA from fronds were digested with either with ClaI (A) or BamHI (B)
and probed with either with DIG-labeled hpt (A) or GUSPlus (B) gene fragments. A. Lanes 1-10,
B. lanes 2-7, and 9-11: transgenic P. vittata. A. Lane 11 and B. lane 8: non-transgenic P. vittata.
B. Lane 1: BamHI-digested R4pGWB 501 actin promoter-GUSPlus plasmid DNA. DIG labeled
Lambda DNA was used as a marker in all the gels.
Figure S5. Agarose gel electrophoresis of Cla I- (B and C) and BamHI- (A and D) digested
samples that were used for P. vittata and C. thalictroides Southern blot analysis. A. Lanes 1-6
correspond with the BamHI-digested samples that are in Fig. 6C. B. Lanes 1-11 correspond with
the ClaI-digested samples in Fig. 5D of C. thalictroides. C. Lanes 1-5 correspond with the ClaIdigested samples in Fig. 5A. D. Lanes 12-22 correspond with the BamHI-digested samples in
Fig. 6B of P. vittata.
31
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Table I. Transformation efficiency of P. vittata and C. thalictroides by Agrobactrerium mediated
transformation using R4pGWB501 containing P. vittata actin promoter driving GUSPlus. Rows
indicate the results of separate experiments.
Fern species
Spores
(numbe
r)
Transformation
Prothalli
analyzed/
GUS
positives
Transformation
efficiency (%)
using prothalli
in the
numerator
Ggameto
phytes
analyzed/
GUS
positives
P. vittata
400
300
200
50000
40000
50000
No-control
No-control
No-control
Yes
Yes
Yes
380
290
185
3/10000
9/15000
12/17000
Not applicable
Not applicable
Not applicable
0.03
0.06
0.07
370
280
180
17/30000
8/17000
4/12000
Transformation
efficiency (%)
using
gametophytes
in the
numerator
Not applicable
Not applicable
Not applicable
0.056
0.047
0.0333
62
76
93
2/10000
3/18000
6/25000
Mean
0.053±0.021
Not applicable
Not applicable
Not applicable
0.02
0.17
0.024
55
73
85
9/20000
13/40000
7/50000
Mean
0.045±0.012
Not applicable
Not applicable
Not applicable
0.046
0.033
0.014
C. thalictroides
70
90
100
60000
70000
90000
No-control
No-control
No-control
Yes
Yes
Yes
Mean
0.02±0.004
Mean
0.031±0.016
Transformation efficiency was calculated based on gametophytes that were GUS positives based
on three independent transformation experiments. Prothalli and gametophytes were used to
calculate the efficiency since more than 90% of spores formed prothalli.. Sporophytes was not
used to calculate efficiency because not all sporophytes were recovered for further growth and
analysis. ANOVA was performed to calculate the average and error rate for transformation.
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Downloaded from on June 15, 2017 - Published b
Copyright © 2013 American Society of Plant Biolog
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.
Downloaded from o
Copyright © 2013 Am
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2013 American Society of Plant Biologists. All rights reserved.