Published online 6 June 2011
Nucleic Acids Research, 2011, Vol. 39, No. 15 e102
doi:10.1093/nar/gkr424
Homogeneous antibody-based proximity extension
assays provide sensitive and specific detection
of low-abundant proteins in human blood
Martin Lundberg, Anna Eriksson, Bonnie Tran, Erika Assarsson and Simon Fredriksson*
Olink Bioscience, Uppsala Science Park, 75183 Uppsala, Sweden
Received February 24, 2011; Revised May 6, 2011; Accepted May 11, 2011
ABSTRACT
Convenient and well-performing protein detection
methods for a wide range of targets are in great
demand for biomedical research and future diagnostics. Assays without the need for washing steps
while still unaffected when analyzing complex biological samples are difficult to develop. Herein, we
report a well-characterized nucleic acid proximitybased assay using antibodies, called Proximity
Extension Assay (PEA), showing good performance
in plasma samples. Target-specific antibody pairs
are linked to DNA strands that upon simultaneous
binding to the target analyte create a real-time PCR
amplicon in a proximity-dependent manner enabled
by the action of a DNA polymerase. 30 Exonucleasecapable polymerases were found to be clearly superior in sensitivity over non-30 exonuclease ones. A
PEA was set up for IL-8 and GDNF in a user-friendly,
homogenous assay displaying femtomolar detection sensitivity, good recovery in human plasma,
high specificity and up to 5-log dynamic range in
1 kL samples. Furthermore, we have illustrated the
use of a macro-molecular crowding matrix in combination with this homogeneous assay to drive target
binding for low-affinity antibodies, thereby improving the sensitivity and increasing affinity reagent
availability by lowering assay development dependency on high-affinity antibodies. Assay performance
was also confirmed for a multiplex version of PEA.
INTRODUCTION
Detection and quantification of proteins in complex biological samples can pose several technical challenges.
Assay performance as of recovery, specificity and linearity
can especially be negatively affected. The homogenous
proximity ligation assay (PLA) has been shown to
provide sensitive protein detection in very small sample
volumes (1,2). PLA is based on the analyte becoming
bound by two so called proximity probes which are antibodies coupled with DNA strands, and when these strands
come in close proximity upon by target binding they are
united through the activity of a DNA ligase enzyme. The
newly formed joint ligation product then serves as a
template for quantitative PCR reflecting the amount of
target protein present. As this assay is homogeneous,
meaning no washing steps, all the components of the sample are present throughout the assay. Such components
might interfere with the assay and lower the efficiency of
the enzymatic processes involved, thereby impairing assay
recovery. The use of DNA ligases for PLA has proven
difficult in human plasma requiring data normalization
(3). Therefore, we investigated the use of DNA polymerases to improve homogenous nucleic acid proximity reactions when using biological samples. A few previous
reports have used DNA polymerase-based proximity assays (4–6). However, those assays were not based on antibodies, nor were their analyses performed on human
plasma samples, and only modest low pM sensitivity
was reported.
In endeavors to develop a wider range of sensitive protein detection assays ultimately covering the entire human
proteome, suitable affinity reagents are lacking. Antibody
affinities vary greatly with different target antigens and
different batches. This directly affects assay performance
as of sensitivity and causes prolonged assay development
time in a search for better antibodies. In an attempt to
enable the use of antibodies of lower affinities in proximity
extension assay (PEA), we sought to use a water exclusion
matrix to drive target analyte binding by increasing the
effective concentration of the PEA probes by the use of
sephadex bead expansion (7).
MATERIALS AND METHODS
Plasma samples, antigen standards and antibodies
EDTA blood samples were collected from healthy subjects.
The samples were centrifuged at 2500g for 10 min at 4 C.
*To whom correspondence should be addressed. Tel: +46 18 444 3984; +46 18 509 300; Email: [email protected]
ß The Author(s) 2011. Published by Oxford University Press.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/3.0), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
PAGE 2 OF 8
e102 Nucleic Acids Research, 2011, Vol. 39, No. 15
After centrifugation the plasma was aspirated, aliquoted
and stored at 20 C. All polyclonal antibody (Ab) and
their respective recombinant human proteins were
purchased from RnD Systems, besides CA19-9 that was
a kind gift from Fujirebio Diagnostics AB. Recombinant
proteins were all reconstituted in PBS +0.1% BSA and
stored at 80 C.
performed as above, but using a set of 23 unique probe
oligo pairs, 23 corresponding extension primers and 23
unique primer pairs for qPCR detection and a universal
molecular beacon probe for detection (Supplementary
Table S1). Each multiplex PEA sample was split across
the individual qPCRs readouts each using a target-specific
primer pair.
Proximity probes and antigen standards
Detection by quantitative PCR
Proximity probes were prepared by covalently linking a
single batch of affinity-purified polyclonal antibody or
matched monoclonal antibody pairs to 30 -hydroxyl free
and 50 -phosphate free 40-mer oligonucleotide sequences.
These antibody-oligonucleotide conjugates were generated
by Innova Biosciences (Cambridge, UK) using their
Lightning-LinkTM technology. Conjugation quality was
analyzed by SDS–PAGE (data not shown). The 40-mer
30 and 50 oligonucleotide sequences used for the antibody
conjugation comprised a 20-bp universal sequence used as
hybridization site and target for the Molecular Beacon (8),
and a unique 20-bp sequence for primer targeting in
qPCR. The extension primer was hybridized to the
50 -free oligonucleotide of one of the proximity probe conjugates, at a 2:1 oligo-to-Ab ratio. All sequences used are
reported in (Supplementary Table S1).
For the qPCR detection, 4 ml of the extension products
was transferred to a qPCR plate and mixed with 6 ml
qPCR mix; 25 mM Tris–HCl, 7.5 mM magnesium chloride,
50 mM potassium chloride, 8.3 mM ammonium sulfate,
8.3% Trehalose (Acros Organics), 333 mM (each)
dNTP’s, 1.67 mM dithiothreitol, 833 nM of each primer
(forward: 50 -TCGTGAGCCCAAGTGTTAATTTGCTT
CACGA-30 and reverse: 50 -TGCAGTCTGTAGCGAAG
TTCTCATACTGCA-30 ; or the hairpin primers forward:
50 -TCGTGAGCCCAAGTGTTAATTTGCTTCACGA-30
and reverse 50 -TGCAGTCTGTAGCGAAGTTCTCATA
CTGCA-30 ), 417 nM Molecular Beacon (FAM-CCCGCT
CGCTTATGCTACCGTGACCTGCGAATCCCGAGC
GGG-DABSYL, Biomers), 41.7 U/ml recombinant Taq
polymerase (Fermentas) and 1.33 mM ROX reference
(ROX-TTTTTTT, Biomers). A two-step qPCR was run
with initial denaturation at 95 C for 5 min, followed by
15 s denaturation at 95 C; and 1 min annealing/extension
at 60 C for 45 cycles. Raw real-time PCR profiles are
shown in Supplementary Figure S1.
Proximity extension assay
One microliter sample (PBS+0.1% BSA buffer ± antigen
spike or human EDTA plasma) was mixed with 1 ml plasma dilution buffer (Olink Bioscience, Sweden). Samples
were incubated at 25 C for 20 min. To these samples, 2 ml
of probe mix [25 mM Tris–HCl, 4 mM EDTA, 0.016 mg/ml
single-stranded salmon sperm DNA (Sigma Aldrich),
0.02% sodium azide and 100 pM of each PEA conjugate]
was added and incubated at 37 C for 1 h.
After the probe incubation, the samples were transferred to a thermal cycler and put on hold at 37 C. An
amount of 76 ml of dilution mix containing 70.5 mM Tris–
HCl, 17.7 mM ammonium sulfate, 1.05 mM dithiothreitol
and 40 mM of each dNTP’s were added. After a 5-min
incubation at 37 C, a 20 ml extension mix containing
66.8 mM Tris–HCl, 16.8 mM ammonium sulfate, 1 mM
dithiothreitol, 33 mM magnesium chloride, 62.5 U/ml T4
DNA Polymerase [or 62.5 U/ml Klenow fragment exo(),
125 U/ml Klenow fragment, 125 U/ml DNA Polymerase I
(Fermentas), 250 U/ml Exonuclease I (New England
Biolabs)] was added. The extension reactions were run at
37 C for another 20 min followed by a 10-min heatinactivation step at 80 C.
Sephadex G100 experiments were performed as above,
but using incubation tubes containing 500 mg of lyophilized sephadex G100 at the bottom. Sephadex G100
(Pharmacia) was resolved at 2.5 w/v% in 20% EtOH,
and kept shaking at 200 rpm at room temperature (RT)
for at least 24 h. Before each experiment, 20 ml of the
sephadex G100 slurry was added per well and lyophilized
using a SpeedVac SPD1010 (Thermo Scientific), 60 min at
65 C and 10 torrs.
PEA was also performed in multiplex using the 23-plex
panels given in Supplementary Table S1. All steps were
RESULTS AND DISCUSSION
Proximity extension assay
We have previously developed a highly sensitive and specific protein detection method based on antibodies coupled
to DNA oligos (proximity probes) (1,2). Proximity probes
joined with a DNA ligase can in some cases suffer from
recovery loss in some complex biological fluids, such as
blood plasma (3). Therefore, we set out to develop a new
method for protein detection not based on DNA ligases
but instead based on a proximity-dependent DNA polymerization event taking place between the two proximity
probes (Figure 1). Antibodies [either two matched monoclonal antibody (mAb), or one batch of polyclonal antibody (pAb) split in two fractions] are covalently linked
with two different 40-mer oligonucleotides, one being attached at the 30 -end, and the other at the 50 -end (for details
on the sequence design, see ‘Materials and Methods’
section and Supplementary Table SI). To the 30 -linked
probe, a 56-mer DNA oligo comprising 40-nt complementary to that probe, a 7-nt spacer and 9-nt complementary
to the corresponding 50 -linked probe is hybridized. Next,
the hybridized proximity probe pair is incubated with a
sample containing the antigen of interest. This results in
binding between the proximity probe pair and the antigen,
and as a result, the oligonucleotides come in close proximity and are hybridized to each other. The addition of a
DNA polymerase leads to an extension of the hybridizing oligo over the other probe arm. Finally, the DNA
PAGE 3 OF 8
Nucleic Acids Research, 2011, Vol. 39, No. 15 e102
template generated can be detected and quantified by
qPCR.
To enable an effective hot start when using native Taq
DNA polymerase in the qPCR reaction, some primer
pairs where designed as hairpins with limited stability,
thereby not exposing free 30 -ends at room temperature
during reaction set up (9). The hairpin comprised 6 nt of
the 30 -end, and 6 nt of the 50 -end of each primer (see
‘Material and Methods’ section).
To optimize the sensitivity of the PEA reaction, different designs of the extension primer were evaluated, in this
experiment using T4 DNA polymerase. This included
varying the length of the sequence being complementary
to the 50 -linked probe (n = 7–11) as shown in Figure 2A.
The extension primer that generated high signal, enabling
robust qPCR data, in combination with good sensitivity
for detecting different analytes was chosen for the experiments presented below. The selected primer had a 9-nt
sequence complementary to the 50 -linked probe. The
PEA reaction was further optimized by varying the salt
concentrations and comparing different reaction temperatures (data not shown).
Below, a detailed characterization and evaluation of the
PEA method are described. Immunoassay parameters
including sensitivity, precision, recovery, specificity, assay
range and detectability in plasma are assessed for several
analytes.
Exonuclease activity reduces non-specific background and
improves assay sensitivity
An experiment was designed to assess whether 30 !50
exonuclease activity possessed by some polymerases can
affect the extension reaction. We investigate the signalto-noise ratio for the detection of 50 pM interleukin-8
(IL-8). T4 DNA Polymerase, DNA Polymerase I,
Klenow Fragment, Klenow Fragment exo were used in
the extension reaction, and compared with respect to the
resulting signal-to-background for IL-8 detection. When
using DNA polymerases that have a 30 !50 exonuclease activity (T4 DNA Polymerase, DNA Polymerase I, Klenow
Fragment), there was a clear difference in signal relative to
the background (Figure 2B). In contrast, the Klenow
Fragment lacking exonuclease activity (Klenow exo)
generated a much higher background than the Klenow
Fragment (Klenow exo+). By adding Exonuclease I to
the Klenow Fragment exo reaction, the background
was lowered and, thereby, the signal-to-noise level was restored. This showed that the reduced background observed
with the Klenow exo+ compared to Klenow exo was due
to the exonuclease activity and not due to intrinsic differences between the polymerases. The increased sensitivity
observed for exonuclease-able assays, can be explained by
a degradation of the free non-proximal DNA ends, which
prevent them from accumulating extension products over
Figure 1. Schematic description of the PEA. Upon sample incubation, the proximity probe pair binds its specific antigen. As a result, the probe
oligos come in close proximity and hybridize to each other. The addition of a DNA polymerase leads to an extension of the hybridizing oligo.
Finally, this results in a DNA template that can be detected and quantified by qPCR.
B
18
26
22
28
26
30
0 pM VEGF
30
100 pM VEGF
Signal (Ct)
Signal (Ct)
A
0 pM IL-8
50 pM IL-8
32
34
34
36
38
7
8
9
10
Hybridization length (nt)
11
T4 DNA Pol
DNA Pol I
Klenow Exo(-) Klenow Exo(+) Klenow Exo(-)
+ Exo I
DNA Polymerase
Figure 2. Exonuclease activity and hybridization length affects assay sensitivity. (A) VEGF assays were designed with different lengths of the
hybridization site and compared with respect to sensitivity. A 9-nt hybridization site was found to give the best signal-to-noise levels and was
selected for further studies. (B) Different DNA polymerases were tested with regards to their ability to generate good sensitivity in an IL-8-specific
assay. T4 DNA polymerase I, DNA polymerase I and Klenow fragment exo+ all possess a 30 !50 exonuclease activity and performed well in the IL-8
detection. Klenow fragment exo, on the other hand, generated a background signal that was almost at the level of the antigen-induced signal. When
exogenous Exonuclease I was added to the reaction, the signal-to-noise level was restored.
e102 Nucleic Acids Research, 2011, Vol. 39, No. 15
time caused by continuous random proximity events
occurring during the extension reaction.
DNA polymerase I and T4 DNA polymerase were the
most potent polymerases for this assay, based on the
signal-to-noise levels. However, the recovery in plasma
was generally somewhat lower for DNA polymerase I
(Figure 2B; and data not shown). Therefore, T4 DNA
polymerase was selected for the remaining experiments
of this study. Two additional DNA polymerases, T7 and
phi-29, were also tested in this initial experimental setup.
These enzymes generated a much lower signal over all, and
were therefore not considered for further studies (data not
shown). However, both of these polymerases possess a
strong 30 !50 exonuclease activity, and should still be considered as potential candidates for PEA and could benefit
from further optimization of their specific reaction
conditions.
Precision, recovery and detection of low-abundant analytes
in blood plasma
One of the major challenges in biomarker research is to
develop highly sensitive methods that allow for the detection of proteins present only in minute amounts in biological samples. Therefore, we examined the ability of
PEA to accurately detect low-abundant proteins in a
complex matrix, human EDTA-prepared plasma, using
the 30 !50 exonuclease-efficient T4 DNA polymerase.
Human IL-8 was spiked at increasing concentrations
into either a non-complex matrix, PBS with 0.1% BSA,
or into plasma and quantified by PEA (Figure 3A). As a
second example, the human protein glial cell line-derived
neurotrophic factor (GDNF) was spiked into human
plasma (Figure 3B). The sensitivity of both assays was
found to be very good. Both analytes were detected and
could be quantified at concentrations as low as 0.1 pM. In
fact, the signal-to-noise for the GDNF detection at 0.1 pM
was more than eight times over background. This suggests
that even lower concentrations of GDNF would be detectable. The detection dynamic range of these IL-8 and
GDNF assays spanned at least four orders of magnitude
(between 0.1 and 100 pM), and the lower limit of detection
(2 SD above buffer background) for was determined to
48 and 9 fM, respectively. Both proteins are of very low
abundance (low picomolar) in plasma and therefore difficult to detect with some standard technologies (10,11).
Despite this, both analytes were readily detected in
human blood plasma demonstrating the sensitivity of
PEA. In addition, as PEA consumes only 1 ml of sample
for analysis, it is highly suitable for biomarker research
studies when clinical samples often are in shortage.
Another critical parameter to study in immunoassay
evaluations is precision. To address the intraassay variation, the experiments in Figure 3 were run using triplicate
samples. The average coefficient of variation (CV) across
all concentrations was 11 and 14% for the two assays,
respectively. This was similar to the results observed for
PLA, for which an average CV of 11% was determined for
a set of around 70 PLA assays (3).
Recovery (the difference in signal between a complex
and a non-complex matrix) reflects the ability of an
PAGE 4 OF 8
assay to accurately quantify an analyte in biological materials. As mentioned above, we and others have previously used PLA to detect a number of biomarkers in blood
plasma (3,12–14). However, the activity of DNA ligase
utilized in these assays was impaired in blood plasma,
sometimes resulting in poor recovery (3). The average
recovery determined for 13 PLA assays was only 33%
(data not shown). By performing those PLA assays in
multiplex, and using an exogenous spike-in normalizer,
the recovery issue was solved. However, for measurements
of single markers, PLA was still unsatisfactory. The T4
DNA polymerase used in the current PEA reaction
seemed to perform well in blood plasma. At concentrations between 1 pM and 1 nM, the average recovery for
IL-8 and GDNF was as high as 81 and 110%, respectively
(Figure 3). It should be emphasized that these results were
obtained without any optimization of the specific buffer
conditions for each probe/target binding, which is
standard procedure in immunoassay development. When
IL-8 and GDNF were analyzed previously with PLA with
the recovery was significantly lower; 18 and 24%, respectively (data not shown). This is a demonstrated a significant improvement compared to the PLA, allowing for
accurate analyte quantification without the need for
internal normalizations.
Enhancement of PEA performance through increased
target binding upon water exclusion
Target binding in this homogeneous immunoassay is dependent on the probe concentration and their target
affinity (2). In an ideal homogeneous proximity assay,
one would like to have a high probe concentration
during sample incubation to drive probe/target binding.
This incubation is subsequently diluted prior to the extension reaction in order to lower the probability of random
proximity events. The ratio of probe concentration during
incubation versus extension should be as high as possible
but still within practical limits and provide sufficient
amounts of template for the qPCR to maintain its robustness. Thus, simply raising the probe concentration during
incubation would increase the background signal due to
increased chances for random events of proximity. To get
around this, the effective probe concentration was artificially raised by macro-molecular crowding, and the PEA
performance was re-evaluated for a number of assays. Dry
sephadex beads can upon rehydration in water expand
and thereby also take up water into the beads while
larger molecules, such as proteins and proximity probes,
would remain outside the beads and thereby effectively
enhance their concentrations and promote target binding
(7). To test this, 500 mg of sephadex G10, G25, G100,
G150 or G200 was lyophilized at the bottom of the PEA
incubation tubes onto which the probe mix and a sample
containing three different concentrations of ICAM were
added, followed by a regular PEA protocol. This experiment demonstrated that while G10 to G50 did not affect
the assay performance, the inclusion of G100, G150 or
G200 led to a dramatic increase in signal (Figure 4A).
G100 was found to give the best signal-to-noise levels at
all antigen concentrations, most likely due to its high
PAGE 5 OF 8
Nucleic Acids Research, 2011, Vol. 39, No. 15 e102
Signal (Ct)
A
B
IL-8
22
22
24
24
26
26
28
28
30
30
GDNF
Buffer
32
32
34
34
36
36
Plasma
38
38
0
0,1
1
10
100
1000 10000
Antigen concentration (pM)
0
0,1
1
10
100
1000 10000
Antigen concentration (pM)
Figure 3. Detection of low-abundant analytes in human blood plasma. Assays were generated for human IL-8 (A) and GDNF (B). Buffer or a blood
plasma sample were spiked with either IL-8 or GDNF at concentrations between 0.1 pM and 10 nM, and measured with PEA. Signal is plotted as Ct
values. Both IL-8 and GDNF, two low-abundant analytes, were detectable in plasma. Both assays showed a good sensitivity with the lower detection
limit at, or below, 0.1 pM.
degree of swelling and a smaller pore size compared to
G150 and G200. Next, a complete standard curve was
generated for ICAM and analyzed with or without
sephadex G100 present during the incubation step. This
revealed dramatic improvements in specific target binding
seen as enhanced sensitivity (Figure 4B). Most striking
was the dramatic increase in signal-to-noise level
obtained for the lowest antigen concentration.
To study whether other assays would benefit from the
sephadex G100 incubation, a panel of 15 different analytes were tested in multiplex. This data are displayed in
Figure 4C in which the change in signal-to-noise upon
sephadex G100 inclusion (ddCt) is plotted as a function
of the signal-to-noise for each assay (dCt). Five assays
were improved in the presence of G100, three assays were
impaired and seven remained unchanged. The reduced
sensitivity observed for some assays was due to a substantial increase of their background signals. Such background
increase could occur if the two proximity probes have a
slight affinity to each other. Overall, there was a trend that
less sensitive assays (lower antibody affinities) seemed to
benefit the most from water exclusion. Therefore, for
improved assay performance for a certain assay, enclosure
of G100 in the probe/target incubation step could be
worthwhile considering.
In clinical diagnostics, rapid protocols are highly desirable. Therefore, we assessed whether sephadex G100 inclusion could increase the rapidity of probe/target binding.
VEGF was spiked into buffer at 100 pM and PEA was
performed at different time points after incubation
(1, 10, 30 and 60 min). This demonstrated that when
G100 was present during the incubation, the signal was
significant already after 1 min of incubation, when
compared to reactions lacking G100 (Figure 4D).
Furthermore, already after 10 min of incubation as much
as 80% of the maximum signal-to-noise was detected for
the G100 reaction, compared to 20% for reactions lacking
G100. All-in-all, these analyses bring forward macromolecular crowding as a way to improve both assay
sensitivity and velocity.
Specificity and detection in plasma
One of the hallmarks of both PEA and PLA is the requirement for dual and proximal binding of the PEA probes. In
theory, this should reduce any signal derived from nonspecific antibody binding. The standard curves of IL-8 and
GDNF (Figure 3) indicate very low limit of detection even
in plasma, indicating that the proximity probes are
binding specifically even in very complex samples that
contain a broad repertoire of proteins.
We generated 4 panels of 23 different assays using
analyte-specific sequences and ran the PEA in multiplex
(Supplementary Table S1). The performance of singleplex
PEA was compared to that of multiplex analysis for IL-8,
GDNF, CAIX and IL-17. A key feature of these multiplexed assays is that antibody cross reactivity will not
result in a non-specific signal since each probe carries a
unique DNA sequence and the generated DNA reporters
operate independently. This is evidenced by the similarity
of the standard curves generated with singleplex or multiplex PEA analysis (Figure 5).
Assay linearity was also assessed using multiplex PEA.
Four panels were generated each comprising 23 PEA
assays: one with high-abundant, two with low-abundant
PAGE 6 OF 8
e102 Nucleic Acids Research, 2011, Vol. 39, No. 15
A
B
- G100
+ G100
12
10
0 pM
10 pM
100 pM
Signal-to-noise (dCt)
1 pM
23
Signal (Ct)
27
31
8
6
4
2
35
0
39
-2
Original G10
G25
G100 G150 G200
No Ag -1
Sephadex
0
1
2
3
4
5
6
Ag conc (log pM)
C
D
Not affected
Improved
- G100
Impaired
+ G100
9
8
8
6
Signal-to-noise (dCt)
7
ddCt (+/- G100)
4
2
0
-2
6
5
4
3
2
-4
1
-6
0
-2
3
8
13
dCt (no G100)
18
1 min
10 min
30 min
60 min
Incubation time
Figure 4. Increased target binding and enhancement of the PEA performance by upon macro-molecular crowding. (A) Different sephadex matrices
were used during the probe/target incubation of an ICAM assay to test if exclusion of water from the reaction could improve assay performance.
Signal is plotted as Ct values. (B) Complete standard curve for ICAM (10 nM–0.1 pM) is shown for assays performed with (gray) or without (white)
sephadex G100. (C) Multiplex PEA was performed for 15 assays, and the signal-to-noise was determined at 200 pM antigen concentration.
Signal-to-noise (dCt) is plotted as a function of the increase in signal-to-noise derived from sephadex G100 inclusion (ddCt). Five assays were
improved (white), eight remained unchanged (gray) and three were impaired (black). (D) Buffer was spiked with 100 pM VEGF, and incubated with
(gray) or without (white) sephadex G100. PEA was performed after different time points after incubation. Signal-to-noise (dCt) is plotted as a
function of incubation time.
and one with mid-abundant analytes. Each analyte was
measured in blood plasma at three different dilutions,
and a buffer background control sample. Dilutions were
5-fold, corresponding to a 2.3 theoretical Ct decrease for
each dilution. Linearity was found to be good for
both high and low PEA signals, for both low-abundant
(Figure 6A; DcR3, IL-17, Her2, CA IX, IL-6, PSA),
mid-abundant (Figure 6B; PDGF BB, TFF3, CA19-9,
Spondin-2, EPCAM, NSE) and high-abundant markers
(Figure 6C; Cystatin C, Tenascin C, sVCAM, PAI-1,
MMP-9, MMP-2). This demonstrates that PEA is
well-suited for the analyses of a broad range of analytes
present in blood plasma and highlights the multiplexing
capacity of PEA.
CONCLUSION
In an attempt to improve the assay performance in
complex biological samples, two main enhancements on
nucleic acid proximity-based protein detection assays were
developed and evaluated. First, a DNA polymerase performing a proximity-dependent DNA polymerization
forming the qPCR amplicon is used instead of using a
DNA ligase. DNA polymerases proved to be less prone
PAGE 7 OF 8
Nucleic Acids Research, 2011, Vol. 39, No. 15 e102
A
B
IL-8
23
GDNF
22
24
25
26
Signal (Ct)
27
28
29
Multiplex
30
Singleplex
31
32
33
34
36
35
No Ag
0.1
C
10
1
No Ag
100
0.1
D
CAIX
1
10
100
IL-17
26
26
28
28
Signal (Ct)
30
30
32
Multiplex
32
Singleplex
34
34
36
36
38
No Ag 0.1
1
10
100
No Ag
0.1
1
10
100
Antigen concentration (pM)
Antigen concentration (pM)
Figure 5. Multiplex PEA protein detection. Buffer was spiked with 23 analytes from panel 1 or 2 (see ‘Materials and Methods’ section and
Supplementary Table SI) at concentrations between 0.1 and 100 pM, and measured either with singleplex (white) or multiplex PEA (gray).
Results for (A) IL-8, (B) GDNF, (C) CAIX and (D) IL-17 are shown. Signal is plotted as Ct values.
Signal-to-noise (dCt)
A
B
Low abundance
C
Mid abundance
10
10
10
8
8
8
6
6
6
4
4
4
2
2
2
0
0
1:1
1:5
Plasma dilution
1:25
High abundance
0
1:10
1:50
Plasma dilution
1:250
1:100
1:500
1:2500
Plasma dilution
Figure 6. Linearity of dilution in plasma. Linearity of dilution was assessed by measuring six low-abundant (A), six mid-abundant (B) and six
high-abundant (C) markers at different concentrations of plasma in multiplex. Signal-to-noise values (dCt) are plotted at three different concentrations of plasma for each set of analytes. Linearity was observed for assays with either high or low signals in plasma, and also for undiluted and
highly diluted plasma samples.
e102 Nucleic Acids Research, 2011, Vol. 39, No. 15
to be enzymatic inhibition in the presence of plasma or
serum in comparison to DNA ligases, thereby improving
assay recovery. Second, the choice of polymerase was
found crucial for the assay sensitivity. We found that
30 !50 exonuclease activity exhibited by certain DNA
polymerases is important for this type of assay as they
reduce the background by degrading remaining
non-proximal DNA strands. We also discovered that for
some assays, in particular those with lower sensitivity, the
inclusion of sephadex G100 in the probe/target incubation
significantly increased the assay sensitivity and rapidity.
All-in-all, PEA was found to perform well in plasma
with regards to sensitivity, specificity, precision and
dynamic range. Furthermore, PEA possess several advantages when compared to other immunoassays, including a
fast and simple experimental protocol, multiplexing
capacity, low sample consumption (1 ml) and the ability
to use lower affinity antibodies without the need for optimizations of specific reaction conditions. We anticipate
this method to contribute to biomarker research, especially for analysis of low-abundant proteins in precious
and limited biobanked human samples, laboratory animals
and other situations when only very small sample volumes
are available.
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online.
FUNDING
Funding for open access charge: Seventh framework
programme theme (FP7-Health-2007-B), European
Commission, under the PROACTIVE project (grant
number 222950).
Conflict of interest statement. M.L., A.E., B.T., E.A. and
S.F. are employees of Olink AB commercializing the
Proximity Extension Assay.
REFERENCES
1. Fredriksson,S., Gullberg,M., Jarvius,J., Olsson,C., Pietras,K.,
Gustafsdottir,S.M., Ostman,A. and Landegren,U. (2002) Protein
PAGE 8 OF 8
detection using proximity-dependent DNA ligation assays.
Nat. Biotechnol., 20, 473–477.
2. Gullberg,M., Gustafsdottir,S.M., Schallmeiner,E., Jarvius,J.,
Bjarnegard,M., Betsholtz,C., Landegren,U. and Fredriksson,S.
(2004) Cytokine detection by antibody-based proximity ligation.
Proc. Natl Acad. Sci. USA, 101, 8420–8424.
3. Lundberg,M., Thorsen,S.B., Assarsson,E., Villablanca,A., Tran,B.,
Gee,N., Knowles,M., Nielsen,B.S., Couto,E.G., Martin,R. et al.
(2011) Multiplexed homogeneous proximity ligation assays for
high throughput protein biomarker research in serological
material. Mol. Cell. Proteomics., 10, M110.004978.
4. Di Giusto,D.A., Wlassoff,W.A., Gooding,J.J., Messerle,B.A. and
King,G.C. (2005) Proximity extension of circular DNA aptamers
with real-time protein detection. Nucleic Acids Res., 33, e64.
5. McGregor,L.M., Gorin,D.J., Dumelin,C.E. and Liu,D.R. (2010)
Interaction-dependent PCR: identification of ligand-target pairs
from libraries of ligands and libraries of targets in a single
solution-phase experiment. J. Am. Chem. Soc., 132, 15522–15524.
6. Yang,X., Wang,L., Wang,K., Tan,W., Tang,H., Meng,X. and
Guo,Q. (2008) Novel protein detection method based on
proximitydependent polymerase reaction and aptamers.
Chinese Sci. Bull., 53, 204–208.
7. Flodin,P., Gelotte,B. and Porath,J. (1960) A method for
concentrating solutes of high molecular weight. Nature, 188,
493–494.
8. Piatek,A.S., Tyagi,S., Pol,A.C., Telenti,A., Miller,L.P.,
Kramer,F.R. and Alland,D. (1998) Molecular beacon sequence
analysis for detecting drug resistance in Mycobacterium
tuberculosis. Nat. Biotechnol., 16, 359–363.
9. Kaboev,O.K., Luchkina,L.A., Tret’iakov,A.N. and
Bahrmand,A.R. (2000) PCR hot start using primers with the
structure of molecular beacons (hairpin-like structure).
Nucleic Acids Res., 28, E94.
10. Reinsberg,J., Dembinski,J., Dorn,C., Behrendt,D., Bartmann,P.
and van Der Ven,H. (2000) Determination of total interleukin-8
in whole blood after cell lysis. Clin. Chem., 46, 1387–1394.
11. Chiaretti,A., Rendeli,C., Antonelli,A., Barone,G., Focarelli,B.,
Tabacco,F., Massimi,L. and Ausili,E. (2008) GDNF plasma levels
in spina bifida: correlation with severity of spinal damage and
motor function. J. Neurotrauma, 25, 1477–1481.
12. Fredriksson,S., Horecka,J., Brustugun,O.T., Schlingemann,J.,
Koong,A.C., Tibshirani,R. and Davis,R.W. (2008) Multiplexed
proximity ligation assays to profile putative plasma biomarkers
relevant to pancreatic and ovarian cancer. Clin. Chem., 54,
582–589.
13. Chang,S.T., Zahn,J.M., Horecka,J., Kunz,P.L., Ford,J.M.,
Fisher,G.A., Le,Q.T., Chang,D.T., Ji,H. and Koong,A.C. (2009)
Identification of a biomarker panel using a multiplex proximity
ligation assay improves accuracy of pancreatic cancer diagnosis.
J. Transl. Med., 7, 105.
14. Fredriksson,S., Dixon,W., Ji,H., Koong,A.C., Mindrinos,M. and
Davis,R.W. (2007) Multiplexed protein detection by proximity
ligation for cancer biomarker validation. Nat. Methods, 4,
327–329.