Steroids and oxysterols in adipocytes:
biosynthesis and function
Jiehan Li
Department of Pharmacology & Therapeutics
McGill University, Montreal
December, 2014
A thesis submitted to McGill University in partial fulfillment of the
requirements for the degree of Doctor of Philosophy
© Jiehan Li, 2014
1
DEDICATION
To my parents Jun Li & Hongju Li
2
Abstract
Local levels of cholesterol metabolites, such as steroids or oxysterols within endocrine
organs, have been recognized as a more accurate indicator of local steroid/sterol actions than the
measurement of circulating levels. Adipose tissue, one of the most important endocrine organs in
the human body, is the largest storage site for free cholesterol. However, little attention has been
directed toward the utilization of cholesterol for steroid or oxysterol synthesis within adipocytes
and its impact on the pathophysiology of obesity. The overall goal of this thesis was to
investigate the existence of a steroid and/or oxysterol biosynthesis pathway in adipocytes in
order to explore the role of these local products in modulating adipocyte function and
development.
The first objective was to examine the ability of adipocytes to synthesize steroids and/or
oxysterols de novo. Steroid formation is initiated by the mitochondrial enzyme, CYP11A1,
converting cholesterol to pregnenolone, the precursor of all the other steroids. We identified the
presence of mitochondrial cholesterol transport machinery, as well as a CYP11A1 enzyme
system, in adipocytes. However, the observed slow catalysis of CYP11A1 in producing
pregnenolone may be due to competition from another mitochondrial enzyme, CYP27A1, for the
same substrate, converting cholesterol to 27-hydroxycholesterol (27HC). By using different cell
lines and primary cells from rodents and humans, we confirmed that 27HC might be a major
mitochondrial cholesterol product synthesized de novo in adipocytes.
The next objective was to investigate the local biological influence of 27HC in adipocyte
development and function. It is well known that 27HC plays an important role in the elimination
of excess cholesterol from various cells, particularly macrophages, thus protecting against
atherosclerosis and hyperlipidemia. In adipocytes, we observed that 27HC treatment reduced
3
triglyceride accumulation, upregulated cholesterol efflux, and induced insulin-stimulated glucose
uptake. Further, blockade of the 27HC biosynthesis pathway in adipocytes resulted in the
compensatory induction of other local cholesterol-metabolizing pathways, which led to increased
secretion of proinflammatory cytokines from adipocytes. CYP27A1-deficient preadipocytes or
pre-fat cells isolated from Cyp27a1-/- mice exhibited increased differentiation potential, which
may have resulted in the enlargement of the adipose compartment. Taken together, the local
production and action of 27HC in normal adipocytes may be part of the host’s defense
mechanism to maintain the healthy functions of adipocytes and prevent the formation of excess
fat cells.
The last objective was to explore the potential regulators of the de novo steroid/oxysterol
synthesis in adipocytes. Translocator protein (18 kDa) (TSPO), a cholesterol- and drug-binding
protein, is a key component involved in delivering cholesterol into the mitochondria, which is the
rate-limiting step in the synthesis of steroid hormones and oxysterols, such as 27HC. In
adipocytes, TSPO ligand PK 11195 stimulated the formation of 27HC and some steroidal
products from the cholesterol precursor, mevalonate. In addition, PK 11195 inhibited the
secretion of pro-inflammatory cytokine interleukin (IL)-6 from adipocytes and induced insulinstimulated glucose uptake into the adipocytes. These beneficial effects of PK 11195 in
adipocytes are likely mediated through the increased local production of anti-obese
steroids/oxysterols. Thus, TSPO may serve as a pharmacological target to modulate the
intracellular dynamics of adipocytes.
In conclusion, we have demonstrated for the first time that adipocytes may have the
potential to synthesize steroids and oxysterols de novo. Multiple enzymatic pathways may
coexist in adipocytes, and they may compete for the same substrate cholesterol. As one of the
4
major cholesterol metabolites of adipocytes, 27HC exerts anti-adipogenic activity. By inducing
the local levels of “fat-burning” steroids or oxysterols, such as 27HC in adipocytes, the
activation of TSPO may represent a promising therapeutic strategy for the treatment of obesityrelated diseases.
5
Résumé
La détermination des niveaux des dérivés du cholestérol, tels que les stéroïdes ou les
oxystérols, au sein des organes endocriniens, a été reconnue comme un indicateur plus précis de
l'action locale des stéroïdes / stérols locaux que la mesure des taux circulants. Le tissu adipeux,
un des organes endocriniens les plus importants du corps humain, est le principal site de
stockage du cholestérol libre. Cependant, peu d’études ont été mené sur l'utilisation du
cholestérol pour la synthèse des stéroïdes ou des oxystérols dans les adipocytes et sur son impact
sur la physiopathologie de l'obésité. L'objectif principal de cette thèse était d'étudier l'existence
d'une voie de biosynthèse des stéroïdes et / ou oxystérol dans les adipocytes, afin de déterminer
le rôle potentiel de ces composés locaux dans la modulation de la fonction et du développement
des adipocytes.
Le premier objectif était d'examiner la capacité des adipocytes à synthétiser des stéroïdes
et / ou oxystérols de novo. La formation de stéroïdes est initiée par l'enzyme mitochondriale,
CYP11A1, qui convertit le cholestérol en prégnénolone, le précurseur commun à tous les
stéroïdes. Nous avons mis en évidence la présence d’un système de transport mitochondrial du
cholestérol, ainsi que celles de CYP11A1 et des enzymes associées au CYP11A1 dans les
adipocytes. Cependant, la catalyse par CYP11A1 observée dans la production de prégnénolone
est lente, peut-être due à la compétition pour le même substrat d’une autre enzyme
mitochondriale, CYP27A1, qui convertit le cholestérol en 27-hydroxycholestérol (27HC). Nos
études utilisant différentes lignées cellulaires et des cellules primaires issues de rongeurs et
d’humains, nous ont permis de confirmer que 27HC est peut-être un important produit
mitochondrial du cholestérol qui est synthétisés de novo dans les adipocytes.
6
Le deuxième objectif était d'étudier l'influence locale du 27HC sur le développement et la
fonction des adipocytes. Dans la littérature, il est reconnu que 27HC joue un rôle important dans
l'élimination de l'excès de cholestérol dans de nombreux types cellulaires, en particulier les
macrophages, protégeant ainsi contre l'athérosclérose et l'hyperlipidémie. Dans les adipocytes,
nous avons observé que le traitement avec 27HC réduisait l'accumulation des triglycérides, qu'il
augmentait l'efflux de cholestérol, et l'absorption de glucose en réponse à l’insuline. De plus, le
blocage de la voie de biosynthèse de 27HC dans les adipocytes conduisait à l'induction
compensatoire d’autres voies métaboliques du cholestérol, menant à une augmentation de la
sécrétion de cytokines pro-inflammatoires par les adipocytes. Les préadipocytes dépourvus de
CYP27A1 ou préadipocytes primaires isolés à partir de souris CYP27A1-/-, montrent un potentiel
de différenciation accrue, ce qui peut avoir entraîné l'expansion du compartiment adipeux. En
conclusion, la production et l'action locales de 27HC dans les adipocytes pourraient faire partie
du mécanisme de défense de l'hôte visant à maintenir les fonctions normales des adipocytes et à
empêcher la formation excessive d’adipocytes.
Le troisième objectif était d'explorer les régulateurs potentiels de la voie de synthèse de
novo des stéroïdes / oxystérol dans les adipocytes. Le Translocator protein (18 kDa) (TSPO), est
une protéine qui se lie à des substances médicamenteuses et au cholestérol, et représente un
élément clé du transport du cholestérol dans les mitochondries. Cette étape est le facteur limitant
de la synthèse d'hormones stéroïdiennes et oxystérols tels que le 27HC. Dans les adipocytes, le
ligand du TSPO, PK 11195, stimule la formation de 27HC et celle d'autres produits à partir du
précurseur du cholestérol, le mévalonate. De plus, PK 11195, inhibe la sécrétion de la cytokine
pro-inflammatoire IL-6 par les adipocytes et induit l'absorption de glucose stimulée par
l'insuline dans les adipocytes. Ces effets bénéfiques de PK 11195 dans les adipocytes, sont
7
probablement médiés par augmentation de la production locale de stéroïdes / oxystérols antiobésité. Cela suggère que TSPO pourrait être une cible pharmacologique dans la modulation des
dynamiques intracellulaires des adipocytes.
En conclusion, nous avons démontré pour la première fois que les adipocytes ont la
capacité de synthétiser de novo des stéroïdes et oxystérols. Plusieurs voies enzymatiques peuvent
coexister dans les adipocytes, et elles peuvent entrer en compétition pour le substrat cholestérol.
En tant que l'un des principaux dérivés du cholestérol dans les adipocytes, 27HC exerce une
activité anti-adipogénique. En induisant la formation de stéroïdes ou oxystérols tels que 27HC
dans les adipocytes, l'activation de la TSPO pourrait représenter une stratégie thérapeutique
prometteuse pour le traitement des maladies liées à l'obésité.
8
Table of Contents
Abstract ........................................................................................................................................... 3
Résumé ............................................................................................................................................ 6
Table of Contents ............................................................................................................................ 9
List of Figures ............................................................................................................................... 13
Abbreviations ................................................................................................................................ 15
Acknowledgements ....................................................................................................................... 18
Contribution of Authors ................................................................................................................ 19
Chapter 1 ....................................................................................................................................... 21
Introduction ................................................................................................................................... 21
1.1 Adipose tissue ................................................................................................................... 21
1.1.1 Adipocyte as the major component of adipose tissue................................................. 22
1.1.2 Adipocyte function ..................................................................................................... 23
1.1.2.1 Lipid metabolism ................................................................................................. 23
1.1.2.2 Adipokine secretion ............................................................................................. 24
1.1.3 Adipogenesis .............................................................................................................. 25
1.1.4 In vitro adipocyte models ........................................................................................... 26
1.2 Steroid hormones and adipose tissue ................................................................................ 29
1.2.1 Adipose tissue as a steroid reservoir........................................................................... 29
1.2.2 Local steroid conversion and action in adipose tissue ................................................ 30
1.2.2.1 Metabolism of glucocorticoids and mineralocorticoids ....................................... 32
1.2.2.1.1 11β-hydroxysteroid dehydrogenase (11βHSD)............................................. 32
1.2.2.1.2 11β-hydroxylase (CYP11B1) and aldosterone synthase (CYP11B2) ........... 33
1.2.2.1.3 Steroid 21-hydroxylase (CYP21) .................................................................. 35
1.2.2.2 Metabolism of sex steroids .................................................................................. 36
1.2.2.2.1 Aromatase...................................................................................................... 36
1.2.2.2.2 17β-hydroxysteroid dehydrogenase (17βHSD)............................................. 37
1.2.2.2.3 5α-reductase .................................................................................................. 39
9
1.2.2.3 Other steroid-converting enzymes ....................................................................... 41
1.2.2.3.1 3β-hydroxysteroid dehydrogenase/isomerase (3βHSD) ............................... 41
1.2.2.3.2 CYP17A1 ...................................................................................................... 42
1.2.3 Can adipose tissue synthesize steroids de novo? ........................................................ 45
1.2.3.1 CYP11A1 enzymatic system ............................................................................... 48
1.2.3.2 Mitochondrial cholesterol transport machinery ................................................... 50
1.2.3.2.1 STAR............................................................................................................. 50
1.2.3.2.2 TSPO ............................................................................................................. 51
1.3 Oxysterols and adipose tissue ........................................................................................... 53
1.3.1 Presence of oxysterols in adipose tissue ..................................................................... 53
1.3.2 Interconversion of oxysterols in adipose tissue .......................................................... 54
1.3.3 Cholesterol-metabolizing cytochrome P450 (CYP) enzymes for oxysterol
biosynthesis ........................................................................................................................... 55
1.3.3.1 CYP27A1 ............................................................................................................. 59
1.3.3.2 CYP7A1 ............................................................................................................... 59
1.3.3.3 CYP3A4 ............................................................................................................... 60
1.3.4 Functional roles of oxysterols in adipose tissue ......................................................... 61
1.3.4.1 Liver X Receptor (LXR) ...................................................................................... 61
1.3.4.2 Oxysterol-binding protein (OSBP) and OSBP-related proteins (ORPs) ............. 64
Rational ......................................................................................................................................... 65
Connecting text between Chapter 1 and 2 .................................................................................... 67
Chapter 2 ....................................................................................................................................... 68
De novo synthesis of steroids and oxysterols in adipocytes ......................................................... 68
2.1 Abstract ............................................................................................................................. 69
2.2 Introduction ....................................................................................................................... 70
2.3 Experimental procedures ................................................................................................... 72
2.4 Results ............................................................................................................................... 83
10
2.5 Discussion ......................................................................................................................... 93
2.6 Acknowledgments ........................................................................................................... 100
Connecting text between Chapter 2 and 3 .................................................................................. 114
Chapter 3 ..................................................................................................................................... 115
27-hydroxycholesterol is a regulatory oxysterol in adipocytes .................................................. 115
3.1 Abstract ........................................................................................................................... 116
3.2 Introduction ..................................................................................................................... 117
3.3 Materials and Methods .................................................................................................... 119
3.4 Results ............................................................................................................................. 125
3.5 Discussion ....................................................................................................................... 132
3.6 Acknowledgments ........................................................................................................... 138
Connecting text between Chapter 3 and 4 .................................................................................. 152
Chapter 4 ..................................................................................................................................... 154
Translocator protein (18 kDa) as a pharmacological target in adipocytes to regulate cellular
homeostasis ................................................................................................................................. 154
4.1 Abstract ........................................................................................................................... 155
4.2 Introduction ..................................................................................................................... 156
4.3 Materials and Methods .................................................................................................... 159
4.4 Results ............................................................................................................................. 164
4.5 Discussion ....................................................................................................................... 170
4.6 Acknowledgments ........................................................................................................... 174
Chapter 5 ..................................................................................................................................... 184
General Discussion ..................................................................................................................... 184
5.1 De novo steroids in adipocytes ........................................................................................ 184
5.1.1 Final de novo steroid products in adipocytes............................................................ 185
11
5.1.2 Role of adipocyte steroidogenesis ............................................................................ 188
5.1.2.1 Local impact of steroidogenic pathway ............................................................. 188
5.1.2.2 Systemic diseases possibly involving adipose steroidogenesis ......................... 189
5.1.2.2.1 Cardiovascular diseases............................................................................... 190
5.1.2.2.2 Reproductive diseases ................................................................................. 191
5.2 De novo 27HC in adipocytes ........................................................................................... 194
5.2.1 Co-expression of the steroid and 27HC biosynthesis pathway in adipocytes .......... 194
5.2.2 Potential contribution of adipocyte-derived 27HC at the physiological level.......... 195
5.2.3 27HC and obesity-related diseases ........................................................................... 196
5.2.3.1 27HC and atherosclerosis .................................................................................. 197
5.2.3.2 27HC and breast cancer ..................................................................................... 198
5.3 TSPO in adipocytes ......................................................................................................... 199
5.3.1 TSPO and steroid or 27HC biosynthesis in adipocytes ............................................ 199
5.3.2 Metabolic consequences of TSPO activation as related to obesity .......................... 202
5.4 Final Conclusion ............................................................................................................. 205
Original contributions ................................................................................................................. 208
Reference List ............................................................................................................................. 210
12
List of Figures
Figure 1.1 Schematic representation of steroid metabolism present in adipose tissue ............... 31
Figure 1.2 Depiction of the pathway of active steroid formation from cholesterol in endocrine
tissues ............................................................................................................................................ 46
Figure 1.3 Mitochondrial cholesterol transport .......................................................................... 47
Figure 1.4 Major cytochrome P450 enzymes that initiate cholesterol metabolism in different
tissues ............................................................................................................................................ 57
Figure 1.5 Summary of functions attributed to LXR in white adipocytes .................................. 63
Figure 2.1 De novo synthesis of steroids, oxysterols, and bile acids from cholesterol ............ 101
Figure 2.2 Steroidogenic pathway is present in 3T3-L1 adipocytes ......................................... 103
Figure 2.3 CYP11A1 is active in adipocytes ............................................................................ 105
Figure 2.4 3T3-L1 adipocytes can synthesize 27HC de novo .................................................. 106
Figure 2.5 Adipocytes differentiated from rat SVF, human SGBS preadipocytes and human
primary preadipocytes can synthesize 27HC de novo ................................................................ 108
Figure 2.6 Adipocytes do not synthesize bile acids .................................................................. 110
Figure 2.7 CYP27A1 is a negative regulator of adipocyte differentiation ............................... 111
Figure 2.8 SVFs isolated from Cyp27a1-/- mice have higher adipogenic potential than wild type
controls ........................................................................................................................................ 113
Figure 3.1 27HC decreases lipid accumulation in adipocytes by upregulating basal lipolysis 140
Figure 3.2 27HC upregulates the basal lipolysis of adipocytes by activating LXR ................. 142
Figure 3.3 27HC affects multiple intracellular pathways attributed to LXR in adipocytes ..... 143
Figure 3.4 The local 27HC biosynthetic pathway regulates cholesterol metabolism in adipocytes
..................................................................................................................................................... 145
Figure 3.5 Disruption of the local 27HC biosynthetic pathway upregulates cytokine release
from adipocytes ........................................................................................................................... 147
Figure 3.6 Role of 7α-HC in differentiated adipocytes ............................................................ 148
Figure S3.1 Dose effects of 27HC action in differentiated adipocytes..................................... 149
Figure S3.2 Role of CYP7A1 and 7α-HC in adipocyte differentiation .................................... 151
13
Figure 4.1 TSPO ligands up-regulates stimulated-lipolysis in adipocytes ............................... 175
Figure 4.2 Activation of TSPO reduces IL-6 production and secretion from adipocytes ........ 176
Figure 4.3 Activation of TSPO induces leptin production and secretion from adipocytes ...... 178
Figure 4.4 Activation of TSPO improves glucose uptake in adipocytes .................................. 179
Figure 4.5 Activation of TSPO promotes adipogenesis............................................................ 180
Figure 4.6 TSPO expression in human primary preadipocytes and adipocytes ....................... 182
Figure 4.7 A hypothetical model of the diverse roles of TSPO during differentiation and in
adipocytes ................................................................................................................................... 183
Figure 5.1 Regulation of local steroid and oxysterol biosynthesis in adipocytes ..................... 206
Figure 5.2 Inhibition of CYP11A1 suppresses adipogenesis.................................................... 207
14
Abbreviations
3βHSD: 3β-hydroxysteroid dehydrogenase/delta (5)-delta (4) isomerase
4β-HC: 4β-hydroxycholesterol
7α-HC: 7α-hydroxycholesterol
11βHSD1: 11β-hydroxysteroid dehydrogenase 1
17βHSDs: 17β-hydroxysteroid dehydrogenases
27HC: 27-hydroxycholesterol
AT: Adipose tissue
ATGL: Adipose triglyceride lipase
cAMP: Cyclic adenosine monophosphate
C/EBPs: CCAAT-enhancer-binding proteins
CYP: Cytochrome P450
CYP7A1: Cholesterol 7α-hydroxylase
CYP7B1: Oxysterol and steroid 7α-hydroxylase
CYP11A1: Cholesterol side-chain cleavage enzyme
CYP11B1: Steroid 11β-hydroxylase
CYP11B2: Aldosterone synthase
CYP17A1: 17α-hydroxylase/17, 20-lyase
CYP19A1: Aromatase
CYP27A1: Sterol 27-hydroxylase
15
DBI: Diazepam binding inhibitor
DHEA: Dehydroepiandrosterone
DMEM: Dulbecco’s modified Eagle medium
EPI: Epididymal adipose tissue
ER: Endoplasmic reticulum
FABP4: Fatty acid binding protein 4
FBS: Fetal bovine serum
FDX: Ferredoxin
FNR: Ferredoxin reductase
HFD: High-fat diet
HPLC: High-performance liquid chromatography
HSD: Hydroxysteroid dehydrogenases
HSL: Hormone-sensitive lipase
IBMX: 3-isobutyl-1-methylxanthine
IL-6: Interleukin 6
LXR: Liver X receptor
MS: Mass spectrometry
PCOS: Polycystic ovary syndrome
PPAR: Peroxisome proliferator-activated receptor
16
qPCR: Quantitative real-time PCR
RETRO: Retroperitoneal adipose tissue
SAT: Subcutaneous adipose tissue
SF-1: Steroidogenic factor 1
SGBS: Simpson–Golabi–Behmel syndrome
siRNA: Short interfering ribonucleic acid
SREBP: Sterol regulatory element binding protein
STAR: Steroidogenic acute regulatory protein
SVF: Stromal vascular fraction
T2DM: Type 2 diabetes mellitus
TG: Triglyceride
TLC: Thin layer chromatography
TNFα: Tumor necrosis factor α
TSPO: Translocator protein (18 kDa)
VAT: Visceral adipose tissue
WAT: White adipose tissue
17
Acknowledgements
I would first like to thank my supervisor Dr. Vassilios Papadopoulos, for his intellectual
guidance and constant support on this long and twisting, but rewarding road. Thank you for your
enormous patience, trust and valuable insight guiding me through difficult times. Your genuine
enthusiasm for science has been inspirational and your dedication to trainees has set a high
example in academic research. I am forever grateful for all you have taught me.
A special word of gratitude goes to Dr. Martine Culty, for her encouragement and advice
on scientific research and other aspects of life.
Thanks to my thesis committee members, Dr. Bernard Robaire, Dr. Robert Scott Kiss, Dr.
Suhad Ali, Dr. Greg Miller and Dr. Guillermina Almazan, for the comments and suggestions
provided throughout the years.
To the staff members of the Department of Pharmacology & Therapeutics, thank you all
for the continuous assistance.
I acknowledge and thank all the past and present members of the Papadopoulos/Culty
laboratory, for creating a stimulating and fun environment for me to perform my thesis work.
Above all, I would love to thank my parents for their unconditional love and unwavering
support every step on the way.
18
Contribution of Authors
This thesis is presented in manuscript format as permitted by the McGill University
Faculty of Graduate Studies, and it is comprised of three original manuscripts. The contribution
of each author is described below.
Chapter 2:
De novo synthesis of steroids and oxysterols in adipocytes.
Journal of Biological Chemistry. 2014. 289(2): 747-764.
Jiehan Li, Edward Daly, Enrico Campioli, Martin Wabitsch and Vassilios Papadopoulos
-
All experiments were performed by Jiehan Li, except for the figures indicated below.
-
Edward Daly performed the GC-MS analysis and generated the graphs presented in
Figure 2.4F - 2.4I.
-
Dr. Enrico Campioli established the protocol for isolating the stromal vascular fraction of
cells from rat adipose tissue, and took the microscopic pictures presented in Figure 2.5A.
-
Dr. Martin Wabitsch provided us the human Simpson-Golabi-Behmel syndrome (SGBS)
preadipocyte cells.
-
The manuscript was prepared by Jiehan Li and Dr. Vassilios Papadopoulos.
19
Chapter 3:
27-Hydroxycholesterol is a regulatory oxysterol in adipocytes.
Manuscript in preparation
Jiehan Li and Vassilios Papadopoulos
-
All experiments were performed by Jiehan Li.
-
The manuscript was prepared by Jiehan Li and Dr. Vassilios Papadopoulos.
Chapter 4:
Translocator protein (18 kDa) as a pharmacological target in adipocytes to regulate
cellular homeostasis
Manuscript in preparation
Jiehan Li and Vassilios Papadopoulos
-
All experiments were performed by Jiehan Li.
-
The manuscript was prepared by Jiehan Li and Dr. Vassilios Papadopoulos.
20
Chapter 1
Introduction
This chapter will introduce the function and development of adipocytes, as well as
discuss the experimental models used in adipocyte research. A detailed review of the metabolism
and action of steroids and oxysterols in adipose tissue is presented, along with evidence
indicating that alterations in steroid and/or oxysterol metabolism within adipose tissues are
associated with the metabolic complications of obesity.
1.1 Adipose tissue
Obesity is defined as the accumulation of excess amounts of adipose tissue to the extent
that one’s heath is negatively affected, resulting in the development of a broad range of diseases
such as type 2 diabetes, coronary heart diseases, high blood pressure, reproductive problems,
osteoarthritis, and certain types of cancer (Ogden et al., 2006). During the past two decades, the
discovery of a large variety of adipose-derived products, including protein hormones, growth
factors, cytokines, and steroid hormones, collectively known as “adipokines” (Kershaw and Flier,
2004), has put adipose tissues at the center of a complex network that modulates a diverse
physiological and pathophysiological processes. With the recognition of obesity as one of the
most significant causes of poor health in modern society (Ogden et al., 2006), a deep
understanding of the regulatory roles of adipose tissue, either via endocrine or
paracrine/autocrine systems, has become a priority in research.
21
1.1.1 Adipocyte as the major component of adipose tissue
Adipose tissue is primarily made up of adipocytes. In mammals, there are two types of
classical adipocytes: brown and white. Brown adipocytes, characterized by a high number of
mitochondria and multiple small lipid droplets with a centrally located nucleus, are specialized to
dissipate energy in the form of heat (Cannon and Nedergaard, 2004). In humans, brown fat
makes up 5% of the body mass in newborn children, but it is negligible in adults. White adipose
tissues, on the other hand, account for 10%–20% of body weight in male adults and 20%–30% in
female adults, and this percentage could reach 50% in morbidly obese patients (Fruhbeck, 2008).
A mature white adipocyte contains a single large lipid droplet, which squeezes the nucleus and
the reminder of cytoplasm to the peripheral of the cell, resulting in its “signet-ring” morphology.
The few mitochondria of white adipocytes are located predominantly in the thicker portion of the
cytoplasmic rim. Despite its low percentage of occupation in adipocyte volume (10%), the
cytoplasm contents of adipocytes are considered to be highly metabolically active, producing a
vast array of adipokines that exert local or endocrine actions (Trujillo and Scherer, 2006). Upon
metabolic challenges, white adipocytes can be significantly enlarged (hypertrophy) before
recruiting and generating new adipocytes (hyperplasia) (Arner et al., 2010). Thus, impaired
adipose tissue function in obesity is more closely linked to adipocyte cell size increases than to
cell number increases (Bluher, 2009). In the recent years, the discovery of beige adipocytes, cells
that possess all of the characteristics of brown adipocytes, and which are interspersed in white
adipose tissue depots, has led to increased interest in the “browning” of white adipose tissues to
combat obesity (Wu et al., 2012). Beige adipocytes are lipid-burning cells, and they can be
activated by many stimuli, including cold exposure, peroxisome proliferator-activated receptor
(PPAR)γ agonist thiazolidinedione, and hormones such as irisin and fibroblast growth factor 21
22
(Harms and Seale, 2013). Although it remains highly debatable whether pre-existing white
adipocytes can be transdifferentiated into beige adipocytes, the activation of beige adipocytes or
the induction of de novo differentiation of precursor cells into beige adipocytes have been proven
to result in obesity resistance in mouse models (Seale et al., 2011); this, therefore, represents an
innovative therapeutic perspective for human metabolic diseases (Harms and Seale, 2013).
Apart from adipocytes, which make up 35%–70% of mass volume, adipose tissue also
contains a stromal vascular fraction (SVF) of cells composed of macrophages, fibroblasts,
endothelial cells, vascular smooth muscle cells, and preadipocytes (precursors of adipocytes that
are not yet filled with lipids) (Cornelius et al., 1994). The space between the cells within the
adipose tissue is filled up with extracellular matrix, which contains adipocyte- or SVF-derived
products (Fain et al., 2004). The signaling network between adipocytes, SVF, and the
extracellular matrix regulates the complex functions of adipose tissue. In obesity, macrophage
infiltration into adipose tissue is evident, with changes in the number (Xu et al., 2003) and
phenotype (Lumeng et al., 2007) of macrophages reflecting a more inflammatory state. This
disruption of the structural integrity of adipose tissue may lead to tissue dysfunction in
controlling lipid and glucose metabolism which, in turn, contributes to insulin resistance and
chronic inflammation (Trayhurn and Wood, 2004). From a functional point of view, it is
apparent that adipocytes are the most pivotal cell components within adipose tissue.
1.1.2 Adipocyte function
1.1.2.1 Lipid metabolism
The primary function of adipocytes is to store energy in the form of triglycerides during
times of caloric excess, and they also mobilize this energy by breaking down triglycerides into
free fatty acids and glycerol during times of energy demand (Ramsay, 1996). In adipocytes,
23
triglycerides can be produced from fatty acids, which are either synthesized de novo from
glucose precursors (lipogenesis), or taken up from circulation. Lipogenesis in adipocytes is
tightly controlled by the insulin pathway. In the fed state, insulin stimulates lipogenesis by
inducing glucose uptake into the adipocytes through the recruitment of insulin-sensitive glucose
transporter, GLUT4 (Shepherd and Kahn, 1999). Triglycerides inside the adipocytes undergo
lipolysis in reactions that are catalyzed by hormone-sensitive lipase (HSL) and adipose
triglyceride lipase (ATGL). During fasting, catecholamine binds to the β-adrenergic receptor,
leading to the activation and translocation of HSL and ATGL to the surface of lipid droplets
where triglycerides are stored (Greenberg et al., 2011). The fine-tuning of the lipogenic and
lipolytic balance is important to optimize the metabolic status of adipocytes.
1.1.2.2 Adipokine secretion
The traditional view of adipocytes as inert cells has been dramatically changed since the
discovery of leptin in 1994 (Zhang et al., 1994). This 16 kDa protein is coded by the obese gene
and secreted predominantly by adipocytes. In humans, increased plasma leptin concentrations are
associated with obesity, whereas subjects with lipodystrophy exhibit almost undetectable levels
of leptin (Maffei et al., 1995). Adipocytes have since been found to produce a wide variety of
hormones or other factors, including adiponectin, resistin, visfatin, plasminogen activator
inhibitor-1 (PAI-1), interleukin (IL)-6, tumor necrosis factor α (TNFα), lipoprotein lipase (LPL),
angiotensinogen, fatty acids, and steroid hormones (Kershaw and Flier, 2004). The production
and secretion of numerous adipokines have presaged a growing awareness that adipocytes are
essential in regulating diverse processes such as energy balance, appetite, lipid metabolism,
insulin sensitivity, angiogenesis, blood pressure, and the immune response (Fruhbeck et al.,
2001). Upon release into the blood, adipokines act as endocrine signals and have a profound
24
influence on the metabolism of distant tissues, including muscle, liver, pancreatic β-cells, the
brain, and reproductive organs. Due to the presence of several adipokine receptors (e.g. leptin
receptor, adiponectin receptor, IL-6 receptor, and TNFα receptor) in adipocytes from both
subcutaneous and visceral adipose tissue (Karastergiou and Mohamed-Ali, 2010), the adipocytederived factors are capable of self-regulating adipocyte growth and metabolism in an
autocrine/paracrine manner. Inappropriate adipokine release resulting from adipocyte
dysfunctions is a major cause of many metabolic and reproductive diseases (Rosen and
Spiegelman, 2006; Mitchell et al., 2005). Elucidating the putative roles of adipokines and the
regulatory mechanism of the secretory capacity of adipocytes is of great clinical value in treating
the pathological consequences of obesity. Of particular interest to this thesis is the capacity of
adipocytes in metabolizing steroid hormones, which will be introduced later.
1.1.3 Adipogenesis
Adipogenesis is the differentiation of preadipocytes into lipid-filled mature and
functional adipocytes. The process of adipogenesis is a highly regulated series of transcriptional
events, in which peroxisome proliferator-activated receptor (PPAR)γ is the master regulator and
where several members of the CCAAT-enhancer binding protein (C/EBP) family also play an
essential role. Briefly, the induction of C/EBPβ and C/EBPδ during the early stage of
differentiation leads to the upregulation of C/EBPα and PPARγ, which triggers the expression of
adipose-specific target genes, including fatty acid binding protein 4 (FABP4) (Rosen et al., 2000).
Although it remains unclear how adipogenesis is triggered in vivo, in vitro differentiation of
preadipocytes can be easily achieved using a standard differentiation cocktail usually containing
dexamethasone, 3-isobutyl-1-methylxanthin (IBMX), and insulin (MacDougald and Mandrup,
2002). Dexamethasone is a synthetic glucocorticoid that inhibits Pref-1 (a preadipocyte marker
25
known to suppress adipogenesis) (Smas et al., 1999) and induces C/EBPδ (Shi et al., 2000).
IBMX, an agent that raises the intracellular concentration of cyclic adenosine monophosphate
(cAMP), can stimulate the protein kinase cascade and lead to C/EBPβ upregulation (Hamm et al.,
2001). Therefore, dexamethasone and IBMX are necessary to initiate early differentiation.
Insulin is a lipogenic agent that acts on insulin-like growth factor-1 (IGF-1) receptors, which
contribute to lipid deposition and the elevated expression of C/EBPα and PPARγ (Smith et al.,
1988). PPARγ agonists (e.g. rosiglitazone) are also commonly included in the differentiation
medium to drive the adipogenic potential of preadipocytes, particularly of a primary source, to
their maximal level (MacDougald and Mandrup, 2002).
1.1.4 In vitro adipocyte models
Mature adipocytes isolated from adipose tissue represent one of the most difficult-toculture cell types in research. The high lipid contents make primary adipocytes float on top of the
aqueous medium; the adipocytes tend to aggregate and have poor access to the nutrients or
compound treatment in the medium. Certain special culture techniques, such as ceiling culture,
have been developed for adipocytes (Zhang et al., 2000). However, cultured adipocytes possess
uncharacterized proliferation, de-differentiation, or re-differentiation abilities, which are
distinguished from the terminally differentiated primary mature adipocytes (Asada et al., 2011).
Moreover, most adipocytes undergo autolysis within 72 hours of isolation (Dugail, 2001). Thus,
the in vitro culture of primary adipocytes is not applicable for most research purposes.
In vitro-differentiated adipocyte is the most commonly used model system in adipocyte
research. There are different sources of precursor cells that can be differentiated into adipocytes,
each of which has its pros and cons. Classical preadipocyte cell line 3T3-L1 was introduced in
1975 (Green and Kehinde, 1975). This homogenous cell type exhibits a fibroblast-like
26
morphology and can be efficiently induced into adipocytes using a specific differentiation
medium. The ability of the cells to be passaged provides a stable source for preadipocytes. 3T3L1 cells are frequently used for the initial identification or rapid screening of key molecular
events that are affected by drugs or cellular disturbances during preadipocyte differentiation, or
in differentiated adipocytes. 3T3-L1 is an immortalized cell line which does not proliferate
indefinitely (Green and Kehinde, 1975), and its differentiation capability is known to decline
with increasing passage numbers (Ntambi and Young-Cheul, 2000). The unipotent potential of
3T3-L1 preadipocytes excludes its usage in studying the commitment of precursor cells to the
adipocyte lineage, which is the first phase of adipogenesis. Moreover, being a clonal mouse cell
line, 3T3-L1 preadipocytes may not accurately reflect the in vivo condition, especially the depotspecific microenvironment, and it may possess interspecies differences when compared to human
preadipocytes (Poulos et al., 2010).
Attempts to establish human-derived clonal preadipocyte cell lines have not been
successful until 2001, when Wabitsch et al. discovered a human preadipocyte cell derived from
subcutaneous adipose tissue of a patient with Simpson–Golabi–Behmel syndrome (SGBS). This
cell strain retains high differentiation potential at 50 passages. The differentiated SGBS
adipocytes express adipocyte-specific genes and demonstrate the biochemical and functional
characteristics of human white adipocytes (Wabitsch et al., 2001). Despite being the first clonal
cell line used to study human fat cell development and function, this homogenous cell strain
cannot fully reflect the depot-, sex-, and age-specific properties of human adipose tissue.
The SVFs of cells, isolated from adipose tissue following collagenase digestion and
centrifugation, contain preadipocytes (Cornelius et al., 1994) and have the advantage of being
able to mimic the in vivo conditions of adipose tissue following various global treatments, or
27
from different species or fat depots (Poulos et al., 2010). In recent years, it was identified that
mesenchymal stem cells reside in the SVFs of adipose tissues as well, and these are termed
adipose-derived stem cells (ASCs) (Zuk et al., 2002). The multipotency of ASC makes it an ideal
source for the study of the entire adipogenesis process, including lineage commitment and
terminal differentiation (Cawthorn et al., 2012). The numerous cell types contained in SVFs can
be considered as both an advantage and disadvantage of SVFs. On the one hand, SVFs resemble
the complex adipose tissue microenvironment more closely than a homogenous cell line (Poulos
et al., 2010). On the other hand, however, the contamination of preadipocytes and ASCs with
other cell types, such as macrophages or fibroblasts, may increase difficulties to clearly
discriminate between the responses of certain cell types to treatments. Furthermore, the low
percentage of SVFs in adipose tissue may require a large amount of tissue to yield sufficient
preadipocytes or ASCs. Increased research time, financial costs, and the availability of tissue
donors (in the case of human adipose tissue) may be potential drawbacks for the use of SVFs in
the development of adipocytes (Ali et al., 2013).
Taken together, none of the above in vitro models can represent all aspects of native
tissues. It is crucial to choose an appropriate model based on specific research goals. In this
thesis, 3T3-L1 adipocytes were used to establish research directions and to optimize
experimental conditions; then, key findings were validated in in vitro-differentiated adipocytes
from human SGBS cells and SVFs isolated from adipose tissue.
28
1.2 Steroid hormones and adipose tissue
Steroid hormones have been closely linked to the development of obesity and its morbid
metabolic complications (Kershaw and Flier, 2004). However, the production and action of
steroids in humans is much more complex than what can be indicated from a simple
measurement of circulating steroids. Adipose tissue is an important site for steroid storage and
conversion. Given the large volume and vital functions of adipose tissue in the human body,
even minor changes in local steroid concentration may have the potential to impact adipocyte
biology or other metabolic parameters (Belanger et al., 2002).
1.2.1 Adipose tissue as a steroid reservoir
In one study, the total content of a certain steroid in adipose tissue was estimated to be
40–400 times greater than its total plasma content, supposing that the mean fat mass is 20 kg and
the plasma volume is 3 L in a normal human subject (Deslypere et al., 1985). In another study,
the size of the adipose tissue steroid pool was calculated to be 2 to 87 folds higher than that of
plasma (Feher and Bodrogi, 1982). Despite the variable fold difference estimated by different
groups, adipose tissue is undoubtedly a major reservoir for steroid hormones in the human body.
Progesterone, dehydroepiandrosterone, androstenedione, testosterone, estrone, and estradiol
concentrations in adipose tissue were all several-fold higher than those in the serum (Deslypere
et al., 1985; Feher and Bodrogi, 1982; Kinoshita et al., 2014), whereas adipose cortisol and
cortisone levels were only 20% of those found in the serum (Kinoshita et al., 2014). Positive
associations between adipose and plasma levels were found for all of the steroids mentioned
above (Szymczak et al., 1998), except androstenedione, whose plasma concentration correlated
with neither omental nor subcutaneous adipose concentrations (Belanger et al., 2006). The
independent androstenedione level in adipose tissue may suggest the existence of a local
29
enzymatic synthesis and metabolism pathway that regulates the local levels of androstenedione.
The most abundant steroid types in either omental or subcutaneous adipose tissue are
androstenedione and dehydroepiandrosterone (DHEA). Both steroids are precursors for sex
steroids, and their concentrations in omental fat are significantly higher than in subcutaneous fat.
Omental sex steroid levels are closely related to obesity. In men, waist circumference was
negatively related to omental testosterone levels, but positively related to omental estrone and
estradiol levels (Belanger et al., 2006). Regional differences in steroid levels may suggest a
depot-specific impact of these hormones on adipocyte function, and given the vast amount of fat
cells in the human body, the highly variable – but remarkably high – steroid contents in adipose
tissues may exert potentially important local or systemic influences.
1.2.2 Local steroid conversion and action in adipose tissue
Not only acting as a steroid tank, adipose tissue also constitutes an important site for
steroid metabolism. Steroid precursors in plasma, which are produced by other steroidogenic
cells, can be taken up and transformed in adipose tissue by various enzymes (Figure 1.1)
(Belanger et al., 2002). Local steroid metabolism in adipose tissue has been proven to either
quantitatively contribute to the whole body’s steroid levels, or it can functionally regulate
adiposity (Kershaw and Flier, 2004). The gene, protein, or activity of the steroid-metabolizing
enzymes in the different adipose depots is discussed below.
30
Figure 1.1 Schematic representation of steroid metabolism present in adipose tissue
Plasma sources of steroid precursors are indicated on the left. Activities of steroid-converting
enzymes, which have been detected in adipose tissue, are marked in red.
31
1.2.2.1 Metabolism of glucocorticoids and mineralocorticoids
1.2.2.1.1 11β-Hydroxysteroid dehydrogenase (11βHSD)
Glucocorticoids are essential in regulating adipogenesis (Hauner et al., 1987). However,
obesity is not associated with elevated levels of circulating cortisol (Fraser et al., 1999).
Therefore, attention has focused on local sources of cortisol, particularly in adipose tissuespecific glucocorticoid metabolism, which is primarily regulated by 11β-hydroxysteroid
dehydrogenase type 1 (11βHSD1), an enzyme acting predominantly as a reductase in vivo, and
which generates inactive 11β-ketoglucocorticoid metabolites (cortisone in humans and 11dehydrocorticosterone in rodents) to active 11β-hydroxylated metabolites (cortisol in humans
and corticosterone in rodents) (Seckl and Walker, 2001). 11βHSD1 is highly expressed in human
adipose tissue, particularly in visceral fat (Stulnig and Waldhausl, 2004). The reductase activity
of 11βHSD1 in stromal cells derived from human omental adipose tissue is also higher than that
derived from subcutaneous abdominal adipose tissue (Bujalska et al., 1999). Upon differentiation
of omental adipose stromal cells, the activity of 11βHSD1 in regenerating active cortisol is
further induced (Bujalska et al., 2002). The higher production of cortisol in visceral fat may lead
to a site-specific influence in regional adiposity.
Adipose-specific glucocorticoid metabolism amplifies local glucocorticoid concentrations
without significantly altering circulating levels (Masuzaki et al., 2001). Increased adipose
11βHSD1 expression (Desbriere et al., 2006) and reductase activity (Rask et al., 2002) is highly
correlated with obesity and its commonly associated medical complications. However, it is not
clear whether the high 11βHSD1 presence in adipose tissue is a cause or consequence of human
obesity. Experiments with murine models have revealed that adipose-specific overexpression of
11βHSD1 in mice results in a two-fold higher intra-adipose cortisol level and the development of
32
metabolic syndrome, characterized by visceral obesity, dyslipidemia, diabetes, and hypertension
(Masuzaki et al., 2001). Conversely, the adipose-specific overexpression of 11βHSD2, which
inactivates cortisol into cortisone, protects the mice against high-fat diet-induced obesity with
improved insulin sensitivity (Kershaw et al., 2005). In addition, mice with the universally
disrupted 11βHSD1 gene showed resistance to diet-induced visceral obesity, with an enhanced
lipid metabolism and suppressed inflammation profile, particularly in adipose tissue, suggesting
that the reduced intra-adipose cortisol level represents a key mechanism that may counteract
metabolic diseases (Wamil et al., 2011). Selective 11βHSD1 inhibitors are now considered a
novel therapeutic agent in the treatment of central obesity and type 2 diabetes (Feig et al., 2011).
1.2.2.1.2 11β-hydroxylase (CYP11B1) and aldosterone synthase (CYP11B2)
The final steps in glucocorticoid and mineralocorticoid synthesis are mediated by two
mitochondrial P450 enzymes, 11β-hydroxylase and aldosterone synthase. 11β-hydroxylase
(encoded by CYP11B1 in humans) catalyzes the 11β-hydroxylation of 11-deoxycortisol into
cortisol and deoxycorticosterone to corticosterone, whereas aldosterone synthase (encoded by
CYP11B2 in humans) is the sole enzyme capable of synthesizing aldosterone; it achieves this by
catalyzing the combined activity of 11β-hydroxylase, 18-hydroxylase, and 18-methyl oxidase to
convert deoxycorticosterone into aldosterone. CYP11B1 is expressed in zona fasciculata, but not
in zona glomerulosa of the adrenal cortex, whereas CYP11B2 is only found in zona glomerulosa.
Expression of CYP11B1 in the adrenal cortex is regulated by adrenocorticotropic hormone
(ACTH), whereas CYP11B2 expression is regulated by the renin–angiotensin system (Miller and
Auchus, 2011).
Unlike the well-studied 11βHSD in glucocorticoid activation, evidence of the presence
and function of these glucocorticoid- and mineralocorticoid-synthesizing enzymes in adipose
33
cells is sparse. Only recently, CYP11B2 was detected at the gene and protein levels in mature
adipocytes and stromal vascular cells isolated from mouse epididymal adipose tissue and human
subcutaneous adipose tissue. To further support that adipocytes possess an active form of
aldosterone synthase, detectable amounts of aldosterone were observed in the culture medium
released from the mature adipocytes in mice and humans (Briones et al., 2012). Moreover,
mature adipocytes isolated from the epididymal adipose tissue of db/db mice, a model of
diabetes mellitus-associated obesity, displayed higher CYP11B2 gene expression and secreted
greater amounts of aldosterone into the conditional culture medium in comparison to the primary
adipocytes isolated from the control db/+ mice. The correlated induction of plasma aldosterone
levels in db/db mice suggested that the upregulated adipocyte-derived aldosterone in obesity may
contribute to hyperaldosteronism, which is a mechanical link between obesity and cardiovascular
diseases (Briones et al., 2012). Functionally, adipocyte-derived aldosterone may regulate
adipocyte differentiation in an autocrine manner, as suggested by the evidence that CYP11B2
expression and aldosterone production were induced during 3T3-L1 differentiation, and given
that the specific inhibitor of aldosterone synthase, FAD286, suppressed 3T3-L1 adipogenesis
(Briones et al., 2012). Interestingly, incubation of 3T3-L1-differentiated adipocytes with
angiotensin II (Ang II) for 24 hours upregulated CYP11B2 expression and adipocyte-derived
aldosterone production in parallel. These Ang II-induced effects were inhibited by selective Ang
II type 1 receptor (AT1R) antagonists, candesartan and losartan (Briones et al., 2012). Moreover,
3T3-L1 adipocytes can also produce and secrete Ang II by themselves, which indicates the
presence of a complete local renin–angiotensin–aldosterone system (RAAS) in adipocytes
(Nguyen Dinh et al., 2011). Human adipose tissue has been shown to possess gene expression of
all, and protein expression of some, essential components of RAAS (Marcus et al., 2013). In
34
response to caloric excess, active endogenous RAAS in adipocytes is required for fat mass
enlargement which, in turn, induces insulin resistance at both the local and systemic levels. Thus,
disruption of RAAS may protect against obesity and its sequelae (Marcus et al., 2013).
The expression of CYP11B1 has not yet been confirmed in human adipose tissue. In the
cell line model of 3T3-L1, CYP11B1 mRNA levels were not altered during adipogenesis; in
mouse adipose tissue-derived mature adipocytes, the gene expression of CYP11B1 was not
different between db/db and control db/+ mice (Briones et al., 2012). A short-term high-fat
feeding, however, decreased CYP11B1 gene expression in the epididymal adipose tissue of male
mice. Unlike the genetic models of obesity (such as db/db mice), diet-induced obese models may
uncover the metabolic changes that occur during the initial weight-gain stages that eventually
result in obesity. The downregulated CYP11B1 expression in fat cells during high-fat diet
treatment may be an adaptation mechanism to counteract adipose expansion (Van Schothorst et
al., 2005).
1.2.2.1.3 Steroid 21-hydroxylase (CYP21)
Microsomal enzyme CYP21 is specifically involved in the generation of glucocorticoids
and mineralocorticoids, by 21-hydroxylating progesterone or 17α-hydroxyprogesterone into
deoxycorticosterone or 11-deoxycortisol, respectively (Miller and Auchus, 2011). Human
CYP21 protein is only found in the adrenals, but 21-hydroxylase activity has been described in a
variety of adult and fetal tissues (Casey and MacDonald, 1982). Extra-adrenal 21-hydroxylation
appears to be catalyzed by other microsomal P450s such as CYP2C9, CYP2C19, and CYP3A4
(Yamazaki and Shimada, 1997). Gene expression of CYP21 (MacKenzie et al., 2008), CYP3A4,
CYP2C9, and CYP2C19 (Ellero et al., 2010) were all detected in human adipose tissue
(subcutaneous and visceral). However, 21-hydroxylase activity of these enzymes has not been
35
discovered in fat cells. Incubation of radiolabeled progesterone in primary adipocytes, primary
preadipocytes, and differentiated adipocytes from the subcutaneous and omental fat of obese
women identified 20α-hydroxyprogesterone as the main metabolic products of progesterone,
together with a smaller amount of other metabolites including 5α/β-pregnanedione, 5α/βpregnane-20α-ol-3-one, 5α/β-pregnane-3α/β-ol-20-one, and 5α/β-pregnane-3α/β-20α-diol (Zhang
et al., 2009). These metabolites are most likely formed through the activity of 20αHSD, 3αHSD3,
and 17βHSD5, rather than via 21-hydroxylase (Zhang et al., 2009). The influence of a local
presence of CYP21 in adipose tissue warrants future studies.
1.2.2.2 Metabolism of sex steroids
1.2.2.2.1 Aromatase
Aromatase (product of CYP19 gene) is a cytochrome P450 that generates estrogens from
androgen precursors. Aromatase activities in converting androstenedione to estrone (Cleland et
al., 1983) and in converting testosterone to estradiol (Schmidt and Loffler, 1998) were both
shown to occur in human adipose tissue. Marked regional differences in aromatase expression
and activities were observed, depending on the fat depots. The conversion of androstenedione to
estrone in adipose tissue from the lower body fat of women (thighs and buttocks) was 10 times
higher than that in the upper body fat (breast and abdomen) (Killinger et al., 1990). The highest
level of aromatase expression was also observed in the subcutaneous fat of the lower body, and
its level was induced with aging in women (Bulun and Simpson, 1994). Adipose tissue
contributes up to 100% of circulating estrogens in postmenopausal women, and aromatase
activity in the androstenedione-to-estrone conversion is positively correlated with body weight in
postmenopausal women. Accumulating evidence has suggested that the continuous production of
estrogens in the adipose tissue of elderly obese women is a major risk factor in the pathogenesis
36
of breast cancer (Simpson et al., 1989). Estrogen serves as the fuel in breast cancer growth.
Aromatase activity in breast adipose tissue removed from sites close to the breast tumor was
significantly higher than the activity noted in sites that were distant to the tumor, indicating that
there was a strong connection between local estrogen production in breast adipose tissue and
breast cancer incidence (O'Neill et al., 1988). Aromatase inhibitors (AIs), such as letrozole and
anastrozole, have been used to treat breast cancer or prevent the reoccurrence of breast cancer
after surgery. However, a recent study revealed that long-term (at least 6-month) AI therapy in
breast cancer patients altered the body fat distribution with increased amounts of visceral adipose
tissues relative to subcutaneous fat – a causative factor in the etiology of metabolic disorders
(Battisti et al., 2014). Thus, future assessment of the long-term adverse effects of AI therapy, as
well as the development of new treatments to locally inhibit aromatase activity in breast adipose
tissue, will be urged.
1.2.2.2.2 17β-hydroxysteroid dehydrogenase (17βHSD)
A wide range of enzyme reactions can be catalyzed by 17βHSDs, a family consisting of
at least 14 human isoforms (Miller and Auchus, 2011). Gene expressions of types 1, 2, 3, 5, 7, 8,
and 12 of 17βHSD (Blouin et al., 2009b), as well as the androgenic (androstenedione-totestosterone) (Corbould et al., 2002) and estrogenic (estrone-to-estradiol) (Folkerd and James,
1982) activities of 17βHSD have been shown in human adipose tissue. Expression of the
androgen-activating isoforms, 17βHSD3 (Corbould et al., 1998) and 17βHSD5 (Quinkler et al.,
2004), was detected in both human omental and subcutaneous adipose tissues. The activity of
17βHSD3 was readily observable in cultured preadipocytes derived from abdominal
subcutaneous and omental sites and, more interestingly, the expression ratio of 17βHSD3 to
aromatase was decreased in abdominal subcutaneous tissue and increased in visceral adipose
37
tissue of obese women in comparison to normal weight women (Corbould et al., 2002). These
data suggested an association between local androgen generation in adipose tissue and central
obesity in women, implicating a decline in androgen generation in subcutaneous fat and an
increase in the androgenic ability of visceral fat. The induced testosterone production in the
visceral fat depots of obese women could influence the local lipid turnover by increasing the
lipolysis and release of free fatty acids from visceral fat, which can be drained through the portal
vein and subsequently exert direct effects on the liver, leading to insulin resistance (Meseguer et
al., 2002). Another androgenic form of 17βHSD, 17βHSD5 (also called AKR1C3), was shown to
be present at higher levels in subcutaneous adipose tissue when compared to omental fat. Its
expression in subcutaneous fat was upregulated with obesity and downregulated after weight loss
trials in women (Quinkler et al., 2004). Moreover, the mRNA levels of 17βHSD5 were induced
two-fold in the subcutaneous fat of women with polycystic ovary syndrome (PCOS) when
compared to the control women (Wang et al., 2012b). Hyperandrogenism is an important feature
of PCOS and about 50% of PCOS patients are obese (Dunaif, 1997). Thus, the induced
expression pattern of 17βHSD5 in the adipose tissue of PCOS women may represent one of the
biochemical mechanisms that link the obesity and hyperandrogenism observed in PCOS.
The estrogenic 17βHSD activity in converting estrone to estradiol was increased about
five-fold in differentiated adipocytes in comparison to preadipocytes isolated from both
subcutaneous and visceral adipose tissue. Among the detectable estrogenic isoforms of 17βHSD
(types 1, 7, and 12), only 17βHSD12 expression at both mRNA and protein levels were induced
during adipogenesis, in consistence with the elevated estrogenic 17βHSD activity (Bellemare et
al., 2009). In the whole-tissue extracts, both 17βHSD7 and 17βHSD12 are among the most
abundant steroid-converting enzymes in adipose tissue, with no significant differences between
38
their expressions in omental and subcutaneous adipose tissue (Blouin et al., 2009b). However,
expressions of these estrogenic 17βHSDs in adipose tissue are much lower than those of the
androgenic 17βHSD5 (Blouin et al., 2009b), inferring that adipose tissue may serve as a more
dominant activation site for androgens than estrogens. Thus, the balance between local androgen
and estrogen concentrations may largely depend upon the up- or down-regulation of androgen
levels through its activation and inactivation enzymes.
1.2.2.2.3 5α-reductase
5α-reductase types 1 and 2 (SRD5A1 and SRD5A2) catalyze the A-ring reduction of
steroids, including androgen and glucocorticoid. The most commonly known activity of 5αreductase is the irreversible reduction of testosterone to dihydrotestosterone (DHT), which is
demonstratively the most effective androgen. SRD5A2 is the predominant form in male
reproduction tissues, including the epididymis and prostate, whereas SRD5A1 is expressed in
peripheral tissues (Miller and Auchus, 2011). Gene expression of SRD5A1, but not SRD5A2,
was detected in human adipose tissue (Upreti et al., 2014; Russell and Wilson, 1994), and the
ability of the human fat tissue to convert testosterone to DHT was also demonstrated (Longcope
and Fineberg, 1985). Although there is no difference in SRD5A1 expression between omental
and subcutaneous fat (Blouin et al., 2009b), the local concentration of DHT in omental adipose
tissue is slightly higher than that in the subcutaneous fat of obese men, indicating that there is
possibly increased 5α-reductase activity in omental fat (Belanger et al., 2006). As a nonaromatizable androgen, DHT (within the physiological range) inhibits the adipogenesis of human
mesenchymal stems cells or preadipocytes through its action on androgen receptors (Gupta et al.,
2008). Thus, the physiological level of DHT may have a potential influence on body fat
composition (Duskova and Pospisilova, 2011). In rodents, SRD5A1 deletion accelerates the
39
development of fatty liver (Dowman et al., 2013); in men with benign prostatic hyperplasia,
administration of dutasteride (a dual inhibitor for SRD5A1 and SRD5A2) – rather than
finasteride (inhibitor for SRD5A2 alone) – induces body fat and impairs insulin sensitivity in
other peripheral tissues (Upreti et al., 2014). This implicates that SRD5A1 and its 5α-reductase
metabolites in adipose tissue may play a potentially important part in lipid metabolism and
accumulation.
1.2.2.2.4 3α-hydroxysteroid dehydrogenase (3αHSD)
In addition to generating or activating enzymes, steroid-inactivating enzymes in adipose
tissue can also contribute to the modulation of fat cell exposure to active steroids. 3αHSD3, also
called AKR1C2, is predominately involved in androgen inactivation (Miller and Auchus, 2011).
Gene expression of 3αHSD3 (Blouin et al., 2003) and its activity in converting DHT to weak 3αdiol (5α-androstane-3α, 17β-diol) (Blouin et al., 2006) have been demonstrated in human adipose
tissue. 3αHSD3 mRNA expression and the androgen inactivation rate in omental fat were
associated with increases in several parameters of obesity, including the size of adipocytes, the
cross-sectional area of visceral adipose tissue, and body mass index (BMI) (Blouin et al., 2005;
Blouin et al., 2006). In concordance with these data, the plasma level of 5α-androstane-3α, 17βdiol, was shown to be elevated with obesity or increased visceral adiposity (Tchernof et al.,
1997). Since 3αHSD3 was among the most highly expressed steroid-metabolizing enzymes in
adipose tissue of both men and women (30-fold higher than androgen-activating enzyme
SRD5A1) (Blouin et al., 2009b), it has been proposed that local androgen inactivation is a major
component in intra-adipose sex steroid metabolism that is determinant of adipose tissue
distribution, preferentially driving the android over gynecoid pattern of body fat (Wake et al.,
2007).
40
1.2.2.3 Other steroid-converting enzymes
1.2.2.3.1 3β-hydroxysteroid dehydrogenase/isomerase (3βHSD)
3βHSD is known as a Δ5-to-Δ4-isomerizer that catalyzes the conversion of Δ5-steroid
precursors such as pregnenolone, 17α-hydroxypregnenolone, DHEA, and androstenediol into
their respective Δ4-ketosteroids – namely, progesterone, 17α-hydroxyprogesterone,
androstenedione, and testosterone. Thus, 3βHSD is essential for the generation of all classes of
active steroids, including progesterone, glucocorticoids, mineralocorticoids, and sex steroids.
3βHSD has a dual subcellular localization in which it is found in both mitochondria and the
endoplasmic reticulum (ER). Although the functional significance of its unique localization
pattern is not clear, it has been presumed that ER-localized 3βHSD may have greater substrate
accessibility to steroid precursors in cytosol. In humans, type 1 3βHSD (HSD3B1) is expressed
in peripheral tissues such as the liver, skin, brain, bone, and cardiovascular tissues, whereas type
2 3βHSD (HSD3B2) is predominantly expressed in the adrenals, ovary, and testis (Simard et al.,
2005). HSD3B1 (Blouin et al., 2009a) and HSD3B2 (MacKenzie et al., 2008) genes were
detected in adipose tissue from women, with slightly higher levels of both isoforms noted in
subcutaneous fat. 3βHSD activity in converting DHEA into androstenedione was demonstrated
in breast adipose stromal cells from premenopausal women (Killinger et al., 1995). Due to the
co-expression of 17βHSD5 in adipose tissue discussed above, androstenedione could be quickly
metabolized to testosterone within the tissue. Therefore, changes in the circulating level of the
precursor, DHEA, as well as the local expression of 3βHSD and 17βHSD5 may directly
influence the generation of active androgens in adipose tissue. In PCOS patients, gene transcripts
of HSD3B1, HSD3B2, and HSD17B5 were all induced in subcutaneous fat, suggesting an
elevated local production of testosterone (Wang et al., 2012b). Whether the intra-adipose
41
testosterone synthesis could contribute to hyperandrogenism, a clinical feature of PCOS, is
waiting to be elucidated.
1.2.2.3.2 CYP17A1
Microsomal CYP17A1 catalyzes the transformation of pregnenolone and progesterone
into DHEA and androstenedione, respectively. The presence of CYP17A1 mRNA was first
shown in subcutaneous abdominal adipose tissue from premenopausal women by reverse
transcription polymerase chain reaction (RT-PCR)/Southern blot analysis (Puche et al., 2002).
CYP17A1 can 17α-hydroxylate both pregnenolone and progesterone with approximately equal
efficiency (Gilep et al., 2011). In this study, [14C] progesterone was used as the substrate to study
the 17α-hydroxylase enzyme activity of CYP17A1. After a 4-hour incubation period of adipose
tissue homogenates with the radiolabeled substrate, formation of [14C]17α-hydroxyprogesterone
was detected by thin-layer chromatography (Puche et al., 2002). The results of this paper were
initially not agreed upon by others, as two different groups failed to detect CYP17A1 gene
expression in either subcutaneous or omental adipose tissue from humans (Valle et al., 2006;
MacKenzie et al., 2008). The discrepancy may be explained by the large inter-individual
differences between adipose samples and the difficulty to detect the minimal expression levels of
CYP17A1 in adipose tissue. The presence of CYP17A1 in women’s subcutaneous adipose tissue
was recently confirmed again and, more notably, using an innovative liquid chromatography–
mass spectrometry (LC-MS/MS)-based method, CYP17 in both visceral and subcutaneous
adipose tissues of pre-, postmenopausal, or ovariectomized women was found to have essentially
equal 17α-hydroxylase and 17, 20-lyase catalytic activities, suggesting gonadal type but not
adrenal type of CYP17 activities in adipose tissue (Kinoshita et al., 2014). Surprisingly, the
activity of aromatase, a well-studied microsomal P450 in adipose tissue, was only 3% of CYP17
42
(Kinoshita et al., 2014). The role of CYP17 in modulating the local steroid production in adipose
tissue may be greatly underestimated.
Since CYP17 is a key branch point in steroid biosynthesis, driving the pathway to the
direction of either mineralocorticoid and glucocorticoid production or sex steroid production
(Gilep et al., 2011), the potential differences of adipose CYP17 expression and activities between
gender, age, and depots may be closely related to obesity or reproduction disorders. Studies
regarding a steroidogenic regulatory factor, FOS (FBJ murine osteosarcoma viral oncogene
homologue), an inhibitor of CYP17 expression and subsequent androstenedione production in
the ovary (Patel et al., 2010), showed downregulated FOS expression in the adipose tissue of
PCOS and suggested a potential upregulation of CYP17A1 expression and local androgen
production in adipose tissue (Jones et al., 2012; Chazenbalk et al., 2012), which may contribute
to hyperandrogenism in PCOS (Goodarzi et al., 2011).
A principal factor modulating the enzymatic reactions of CYP17 is the electron transport
from nicotinamide adenine dinucleotide phosphate (NADPH) mediated by P450 oxidoreductase
(POR). In fact, POR is the sole electron transfer protein for all microsomal P450 enzymes
(Pandey et al., 2004). POR deficiency is a newly described disorder of steroidogenesis (Pandey
et al., 2004). Homogenous mutation (G539R) in POR correlates with the clinical phenotype “17,
20-lyase deficiency”, as limited electron supply only favors the 17α-hydroxylase activity of
CYP17 (Hershkovitz et al., 2008). Microarray analysis showed elevated gene expression of POR
during the adipogenesis of 3T3-L1 (Burton et al., 2004).
The 17,20-lyase activity of CYP17 can also be controlled by cytochrome b5, a small
membrane-bound heme-containing protein that acts in concert with POR and allosterically
regulates CYP17 to enhance the interaction of both CYP17 and POR (Auchus et al., 1998). The
43
differential expression of cytochrome b5 in various regions of the brain and adrenals may account
for a zone-specific steroidogenic pathway toward either Δ19 steroid production (through 17, 20lyase) or glucocorticoid production (not through 17, 20-lyase) (Kominami et al., 1992; LeeRobichaud et al., 1995). In rat leydig cells, cytochrome b5 type B (CYB5B; outer mitochondrial
membrane-bound) but not type A (CYB5A; microsomal membrane-bound) functions as an
activator for androgen biosynthesis via CYP17A1 (Ogishima et al., 2003). In 3T3-L1 mature
adipocytes, the protein expression of CYB5B has been recently confirmed in the outer
mitochondrial membrane, and its protein levels were induced in differentiated adipocytes when
compared to preadipocytes, whereas the protein expressions of CYB5A were constant during
adipogenesis (Neve et al., 2012). Knockdown of CYB5B, but not CYB5A, in mature adipocytes
significantly inhibited the activity of amidoxime reductase, through which the fatty acid
synthesis in adipocytes was affected (Neve et al., 2012). The co-expression of CYP5B and
CYP17A1 in adipocytes may potentially activate local androgen production, just as it occurs in
leydig cells (Ogishima et al., 2003), thus providing another mechanism to regulate adipocyte
lipogenesis and adipogenesis.
In the presence of cytochrome b5, CYP17A1 can exert a third type of enzyme activity:
acting as a 16-ene synthetase and converting 10% pregnenolone to a Δ16 andiene product,
androstenone (Soucy et al., 2003), which accumulates in porcine adipose tissue and results in a
phenomenon called “boar taint”. Although androstenone is thought to be synthesized in the
leydig cells of testes (Davis and Squires, 1999), the local presence of CYP17A1 and cytochrome
b5 may potentially contribute to the final concentration of androstenone in the fat tissue of pigs.
44
1.2.3 Can adipose tissue synthesize steroids de novo?
A cell is able to synthesize steroids de novo if it can transform cholesterol into active
steroid hormones. Steroidogenesis is initiated upon mobilization of cholesterol into the inner
mitochondrial membrane, where the first steroidogenic enzyme CYP11A1 resides. CYP11A1
catalyzes the cleavage of the cholesterol side chain and yields pregnenolone, which is then
metabolized to other steroid hormones by a tissue-specific set of steroid-converting enzymes
(Figure 1.2). Many cells can transform steroid precursors produced in other cells, but only cells
expressing CYP11A1 are steroidogenic. De novo steroid synthesis is best characterized in
classical hormone-dependent steroidogenic tissues, such as gonads producing sex steroids and
adrenals producing glucocorticoids and mineralocorticoids. The concentration of cholesterol
inside the mitochondria of these steroidogenic cells, however, is usually very low and as a
consequence, CYP11A1 activity is limited. Increased cholesterol delivery to CYP11A1 by the
action of a mitochondrial protein complex leads to a corresponding increase in pregnenolone
synthesis (Figure 1.3) (Miller and Bose, 2011). In spite of the gene detection of some
components involved in the initial sterodiogenic steps, adipocytes had not been established as
steroidogenic cells prior to our studies in this thesis.
45
Figure 1.2 Depiction of the pathway of active steroid formation from cholesterol in
endocrine tissues
Cholesterol is the building block for the synthesis of all the steroid hormones. The first
enzymatic reaction in steroidogenic pathway takes place in mitochondria, where CYP11A1
coverts cholesterol to pregnenolone. Pregnenolone is then converted to other steroid hormones in
a cell- or tissue-specific manner, such as mineralocorticoids and glucocorticoids in adrenal
glands and sex steroids in gonads.
46
Figure 1.3 Mitochondrial cholesterol transport
Steroid biosynthesis is initiated upon mobilization of cholesterol from the cytoplasmic lipid
stores to the inner mitochondrial membrane (IMM) where CYP11A1 is located. In hormonestimulated classical steroidogenic cells, trophic hormones (e.g. ACTH in the adrenal cortex or
luteinizing hormone [LH] in testis) bind to their specific plasma membrane receptors which, in
turn, activate the cAMP/PKA signaling cascade and result in a corresponding increase of
cholesterol transport into the IMM via the action of the steroidogenic acute regulatory protein
(STAR) and translocator protein (TSPO). Diazepam-binding inhibitor (DBI), an endogenous
ligand of TSPO, facilitates mitochondrial cholesterol transport and stimulates steroidogenesis.
47
1.2.3.1 CYP11A1 enzymatic system
A “steroidogenic” cell is defined by its ability to convert endogenous cholesterol to
pregnenolone. This first and rate-limiting reaction is catalyzed by the mitochondrial enzyme
CYP11A1 in three steps: two sequential hydroxylations with the formation of 22Rhydroxycholesterol (22R-HC) and 20α, 22R-dihydroxycholesterol, followed by oxidative bond
cleavage between carbons 20 and 22. All steroidogenesis was diminished in CYP11A1 knockout
mice and patients with a CYP11A1 gene mutation (Miller and Bose, 2011), thus, the presence of
active CYP11A1 classifies a cell as “steroidogenic”. CYP11A1 is found in all the classical
steroidogenic tissues (i.e. adrenal glands, ovary, testis, and placenta) and non-classical
steroidogenic tissues (i.e. brain, skin, lung, kidney, thymus, and prostate cancer) (Slominski et al.,
2013). Full-length CYP11A1 is exclusively located within the mitochondria (Lambeth and
Stevens, 1984); however, a short isoform of CYP11A1 lacking the N-terminal mitochondrial
localization signal (Nelson et al., 2004) is found in both the cytoplasm and nucleus of mature
osteoblasts, as well as in breast cancer MDA-MB-231 cells, with a suggested role in proliferative
activities (Teplyuk et al., 2009).
The first report showing the presence of CYP11A1 in adipocytes came out in 1990; the
researchers used a murine cell line, 3T3-L1. Northern blot analysis indicated a five-fold
induction of CYP11A1 mRNA levels during adipogenesis (Yamada and Harada, 1990). In 2005,
CYP11A1 transcript was demonstrated in visceral adipose tissue of young adult C57BL/6J male
mice (Van Schothorst et al., 2005). Microarray analysis revealed that the CYP11A1 transcript
was among the genes specifically and significantly downregulated in visceral fat following a
short period (3–5 weeks) of high-fat diet treatment, along with two other steroidogenic genes
involved in the corticosterone biosynthetic pathway, 3βHSD1 and CYP11B1. This study
48
suggested for the first time that murine adipose tissue might synthesize corticosterone de novo
(Van Schothorst et al., 2005). In 2008, MacKenzie et al. were the first group to identify
CYP11A1 gene expression in human adipose tissue. Paired omental adipose tissue and
subcutaneous adipose tissue from the lower abdominal region were taken from 8 women
undergoing caesarean section. Real-time RT-PCR analysis showed that CYP11A1 mRNA levels
were 3-fold greater in omental fat than that in subcutaneous fat. Based on the expression pattern
of another 12 key steroidogenic genes, this study proposed the ultimate product of de novo
adipose steroid biosynthesis as 11-deoxycorticosterone (MacKenzie et al., 2008). The possibility
that pregnancy may alter the adipose expression of steroidogenic enzymes was later ruled out in
2012, when abdominal subcutaneous adipose tissue taken from non-pregnant women also
showed positive expression of the CYP11A1 gene by RT-PCR analysis (Wang et al., 2012b).
Thus far, no studies have reported the gene expression of CYP11A1 in adipose tissue from men,
and no protein expression, enzyme activity, or cellular location of adipose CYP11A1 has been
determined in either humans or animals. One study failed to detect CYP11A1 protein expression
in stromal vascular cells isolated from epididymal adipose tissues of 4-week-old C57BL/6J mice
by Western blot (Tirard et al., 2007). Given the fact that CYP11A1 expression may be low in
preadipocytes (Yamada and Harada, 1990), differentiated adipocytes or mature adipocytes
isolated from adipose tissue may be more suitable for the study of the protein expression and
enzyme activity of CYP11A1. This is one of our focuses in the study performed in Chapter 2.
As a mitochondrial cytochrome P450, the catalytic activity of CYP11A1 requires its
mitochondrial electron transport partners, ferredoxin and ferredoxin reductase (also known as
adrenodoxin and adrenodoxin reductase). Ferredoxin reductase, a flavoprotein located in the
inner mitochondrial membrane, first receives electrons from reduced nicotinamide adenine
49
dinucleotide phosphate (NADPH), and then transfers the electrons to ferredoxin, an iron–sulfur
protein located in the mitochondrial matrix. Ferredoxin then passes the reducing equivalents to
CYP11A1 or other mitochondrial P450s, including CYP11B1, CYP11B2, and CYP27A1 (Miller,
2005). Gene expression of ferredoxin was upregulated during the differentiation of 3T3-L1 cells
(Burton et al., 2004), and this occurred in parallel with the induced CYP11A1 expression during
3T3-L1 differentiation (Yamada and Harada, 1990).
1.2.3.2 Mitochondrial cholesterol transport machinery
Mitochondrial cholesterol transfer occurs through a protein complex called
“transduceosome” (Rone et al., 2009), in which a hormone-regulated mitochondria-targeted
STAR protein acts at the outer mitochondrial membrane to facilitate cholesterol transport into
the inner mitochondrial membrane (Bose et al., 2002) with the support of other outer
mitochondrial proteins, including translocator protein (TSPO) (Hauet et al., 2005) (Figure 1.3).
1.2.3.2.1 STAR
Classic steroidogenic tissues (i.e. the adrenal cortex and gonad) store few steroids; thus, a
rapid synthesis of new steroids in these tissues requires an acute response to trophic hormones
(adrenal cortex to ACTH and gonads to LH). These hormones act through cAMP/PKA signaling
to stimulate STAR expression and phosphorylation. STAR has a sterol-binding pocket to
accommodate cholesterol. However, STAR’s exclusive action on the outer mitochondrial
membrane in promoting steroidogenesis involves its ability to serve as a cholesterol sensor rather
than a cholesterol transporter (Baker et al., 2007; Midzak and Papadopoulos, 2014). Although
STAR is required for acute hormone-regulated steroidogenesis, it is not indispensable in the
50
steroidogenic capacity of some other tissues, such as in the placenta and brain, where STAR
expression is lacking (Miller and Bose, 2011). Whether STAR is involved in adipose
steroidogenesis, if any occurs, is completely unknown.
In young male Sprague-Dawley rats, STAR was identified by Affymetrix microarray as
one of the most differentially expressed genes between visceral and subcutaneous adipose tissue,
with 5-fold higher expression in visceral fat (Atzmon et al., 2002). In agreement with this result,
MacKenzie et al. presented the existence of STAR in both omental and abdominal subcutaneous
adipose tissues from humans for the first time, and by qRT-PCR, they identified STAR as one of
the greatest depot-specific differences among steroidogenic genes, with a 9.5-fold higher mRNA
level in omental fat (MacKenzie et al., 2008). A different group later confirmed the presence of
STAR gene expression in subcutaneous adipose tissue obtained from women (Wang et al.,
2012b). However, due to the relatively low basal levels of STAR in most of the non-classical
steroidogenic tissues, and given the lack of hormone-stimulated regulation, protein assessment
techniques such as Western blot analysis or immunohisto/cyto-chemistry may not be sensitive
enough to detect STAR. The development of sensitive experimental methods to analyze the
presence of proteins was proposed to better understand STAR activities in various tissues,
especially in non-classical steroidogenic tissues where STAR expression is not under hormonestimulated regulation (Anuka et al., 2013).
1.2.3.2.2 TSPO
TSPO is a high-affinity cholesterol- and drug-binding protein involved in mitochondrial
cholesterol transport and steroidogenesis in both classical and non-classical steroidogenic tissues
(Lacapere and Papadopoulos, 2003). Cholesterol binds to the cholesterol recognition/interaction
amino acid consensus (CRAC) motif at the C-terminus of TSPO (Li et al., 2001), while other
51
TSPO ligands bind to a region near the N-terminus (Farges et al., 1994). Some synthetic ligands
of TSPO, as well as the endogenous ligand (diazepam-binding inhibitor [DBI], also known as
acyl-CoA binding domain protein 1 [ACBD1]), were proven to stimulate steroid biosynthesis in
a TSPO-dependent manner (Papadopoulos et al., 1991). Recently, a 3D high-resolution structure
of mammalian (mouse) TSPO in a complex with its most prominent diagnostic ligand, PK 11195,
revealed that drug ligand binding induced the stabilization of TSPO structure, which may suggest
a molecular basis for TSPO ligand-stimulated cholesterol movement and steroid synthesis
(Jaremko et al., 2014).
Gene expression of TSPO (Wade et al., 2005) and its endogenous ligand, DBI (Hansen et
al., 1991; Ross et al., 2002), were both increased during 3T3-L1 preadipocyte-to-adipocyte
differentiation. Expression of DBI antisense RNA in 3T3-L1 preadipocytes inhibited its
differentiation into adipocytes (Mandrup et al., 1998), and treatment of TSPO ligands PK 11195
and Ro5-4864 induced the differentiation of human mesenchymal stem cells into the adipogenic
lineage (Lee et al., 2004). The potential role of TSPO in adipogenesis has been investigated in
Chapter 4. Whether the causal relationship between TSPO expression and adipocyte formation
depends on the involvement of TSPO in steroid biosynthesis in adipocytes remains to be
determined.
52
1.3 Oxysterols and adipose tissue
Oxysterols are naturally occurring 27-carbon oxidized derivatives of cholesterol with
multiple biological functions. They can act as readily transportable forms of cholesterol to
prevent intracellular cholesterol overloading, as obligatory intermediates for bile acid or steroid
hormone biosynthesis, and as signaling molecules to regulate cell differentiation and lipid
metabolism via oxysterol receptors (Bjorkhem and Diczfalusy, 2002). There is evidence that
circulating levels of oxysterols are altered in obesity and metabolic syndromes (Ferderbar et al.,
2007); however, available information about the production and action of oxysterols in adipose
tissue is still lacking.
1.3.1 Presence of oxysterols in adipose tissue
The presence of oxysterols in human adipose tissue has only been reported recently. In
the interstitial fluid of subcutaneous abdominal adipose tissue from healthy volunteers, 7ketocholesterol and 7β-hydroxycholesterol were detected at concentrations ≤1 µM by GC-MS.
The levels of these oxysterols in isolated mature adipocytes from obese individuals with T2DM
were higher than that in non-diabetic controls (Murdolo et al., 2013). A different group has
discovered cholesterol-5α, 6α-epoxide – another cholesterol derivative from autoxidation – in
human omental and subcutaneous adipose tissue, and its concentration was 34% higher in
omental fat (Jove et al., 2014). In male C57BL/6J mice, GC-MS analysis showed the presence of
4β-hydroxycholesterol, 7α-hydroxycholesterol, 7β-hydroxycholesterol, 25-hydroxycholesterol,
27-hydroxycholesterol, 7-ketocholesterol, 5, 6α-epoxycholesterol, and 5,6β-epoxycholesterol in
perigonadal adipose tissue (Wooten et al., 2014). Consistent with the data from humans, local
concentrations of 27-hydroxycholesterol and 4β-hydroxycholesterol in the adipose tissue of diet53
induced obese mice were elevated by 2.5- and 7.5-fold, respectively (Wooten et al., 2014). Taken
together, adipose tissue may provide a sink for these lipophilic oxysterols, and the local synthesis
or metabolism of oxysterols may be different in adipose tissue based on health and disease.
1.3.2 Interconversion of oxysterols in adipose tissue
Wamil et al. first demonstrated that the balance between oxysterols can be actively
modulated in adipocytes (Wamil et al., 2008). 7-ketocholesterol (7-KC) can be converted to 7βhydroxycholesterol in mature 3T3-L1 and 3T3-F442A adipocytes by type 1 isozyme of 11βHSD (11βHSD1), whose primary role is to catalyze inactive glucocorticoid (i.e. 11dehydrocorticosterone) into its active form (i.e. corticosterone), amplifying the activation of
glucocorticoid receptors in promoting obesity (Seckl and Walker, 2001). By sharing the same
enzyme, 7-KC inhibits glucocorticoid metabolism at a physiologically relevant half-maximal
inhibitory concentration (IC50) of 450 nM, and it limits the differentiation of 3T3-L1
preadipocytes (Wamil et al., 2008). Since the concentration of oxysterols in adipose tissue is
much higher than inactive glucocorticoids in adipose tissue (µM versus nM range), when the
enzyme 11βHSD1 and its reaction cofactors are limited, the primary substrate of 11βHSD1 is 7KC, thus maintaining a low level of active glucocorticoid in adipocytes and favoring a lean state
(Yudt and Freedman, 2008). The local presence of active oxysterol turnover and its functional
involvement in adipocyte development triggers our interest in oxysterol biosynthesis in
adipocytes.
54
1.3.3 Cholesterol-metabolizing cytochrome P450 (CYP) enzymes for oxysterol biosynthesis
All quantitatively significant and physiologically important oxysterols in circulation are
generated in cells via the mitochondria or ER cytochrome P450 (CYPs) working directly on
cholesterol. CYP enzymes belong to a superfamily of mono-oxygenases which use heme iron to
carry out the oxidation of their substrates (Denisov et al., 2005). The catalytic cycle of CYPs
starts with the substrate binding to the low-spin ferric enzyme, displacing a water molecule that
is ligated to the central heme and shifting the oxidation state of the iron to a high-spin state. As a
result, the complex can be more readily reduced than the original ligated heme complex. An
oxygen molecule then binds to a site adjacent to the iron ion, followed by two subsequent
protonations, leaving a single active oxygen atom which can then react with the substrate and
yield a hydroxylated product (Denisov et al., 2005). The monoxygenase reaction can be
represented as:
R-H + O2 + 2e- + 2H+  R-OH + H2O
Where R-H is the substrate and R-OH is the oxygenated substrate (White and Coon, 1980).
Some CYP isoforms have specific substrates, such as steroidogenic CYPs, while others,
especially hepatic CYPs, catalyse a broad spectrum of xenobiotic compounds, making them
more water-soluble for clearance (Coon et al., 1992). This thesis focuses on those CYPs acting
directly on cholesterol.
The expression and activity of cholesterol-metabolizing P450s vary tremendously among
tissues, reflecting an adaptive ability of these enzymes in meeting the specific functional
requirements of different tissues in cholesterol degradation (Pikuleva, 2006) (Figure 1.4). In
adipose tissue, the gene expressions of several cholesterol-metabolizing P450s were reported
(reviewed in the following section). Since adipose tissue constitutes the largest buffering pool for
55
free cholesterol, and given that cholesterol imbalance in adipocytes has been linked to adipocyte
malfunction in obesity (Yu et al., 2010; Le et al., 2004), studies about the specific roles of these
cholesterol-metabolizing enzymes in adipose tissue may reveal new targets for cholesterol
lowering effects in obesity treatment.
56
57
Figure 1.4 Major cytochrome P450 enzymes that initiate cholesterol metabolism in
different tissues
Cytochrome P450s initiate all quantitatively significant pathways to degrade cholesterol.
CYP27A1 is a ubiquitously expressed mitochondrial P450, converting cholesterol to 27HC,
which takes place in many extrahepatic cells; CYP11A1, another mitochondrial enzyme which is
mainly expressed in steroidogenic tissues, metabolizes cholesterol to pregnenolone; CYP7A1, a
microsomal enzyme converting cholesterol to 7α-Hydroxychlesterol (7α-HC), is the rate-limiting
enzyme in the primary pathway of bile acid synthesis which plays a major role in hepatic
regulation of overall cholesterol balance; CYP3A4, although widely regarded as a drug
metabolizing enzyme, catabolizes cholesterol to 4β-Hydroxycholesterol (4β-HC), a major
circulating oxysterol ; CYP46A1 is a brain-selective microsomal monooxygenase metabolizing
cholesterol to 24S-Hydroxycholesterol, which represents the dominant mechanism of cholesterol
removal in the brain.
58
1.3.3.1 CYP27A1
CYP27A1 is a ubiquitously expressed mitochondrial enzyme, converting cholesterol to
27-hydroxycholesterol (27HC), the quantitatively most dominant oxysterol in human circulation.
The majority of circulating 27HC originates from extrahepatic tissues (Meaney et al., 2001) and
the CYP27A1 cholesterol-metabolizing pathway accounts for 18–20 mg of cholesterol
elimination on a daily basis (Duane and Javitt, 1999). 27HC can also contribute to the
elimination of cholesterol from various types of cells, particularly macrophages and arterial
endothelial cells, by acting as a signaling molecule that enhances reverse cholesterol transport
(Fu et al., 2001). CYP27A1 deficiency leads to cerebrotendinous xanthomatosis (CTX) in
humans, a lipid disorder characterized by the abnormal deposition of cholesterol in multiple
tissues (Cali et al., 1991). Gene expression of CYP27A1 in human adipose tissue was first
reported by Wamberg et al., and omental adipose tissue in both lean and obese women was
shown to express higher levels of CYP27A1 than subcutaneous adipose tissue (Wamberg et al.,
2013). However, CYP27A1 was regarded as a vitamin D-metabolizing enzyme in this study
(Wamberg et al., 2013). Its role in cholesterol metabolism and potential contribution to
cholesterol balance had not been examined in adipocytes prior to our studies, which are
presented in Chapters 2 and 3.
1.3.3.2 CYP7A1
The 7α-hydroxylase of cholesterol by CYP7A1 is the first and rate-limiting step of the
quantitatively most important bile acid synthetic pathway in the liver. 7α-Hydroxycholesterol
(7α-HC) “leakage” from the liver corresponds to its circulating level, thus serum 7α-HC serves
as the in vivo marker to reflect hepatic CYP7A1 activity (Bjorkhem et al., 1987). Gene
expression of CYP7A1 was not detected in mouse adipose tissue; however, the local
59
concentration of 7α-HC in mouse adipose tissue was about 7-fold higher than that in the liver
(Wooten et al., 2014). Thus, adipose tissue may be a key storage tank for this oxysterol. Unlike
the side-chain oxysterols (e.g. 27HC), oxysterols with an extra hydroxyl group on the steroid
nucleus (e.g.7α-HC) seem to be much weaker molecules signaling through oxysterol-binding
protein liver X receptors (LXR) α and β (Janowski et al., 1999). Although the regulatory
importance of the CYP7A1 product 7α-HC in cellular activities has not been demonstrated, the
expression (Zurkinden et al., 2014) and activity (Honda et al., 2001) of hepatic CYP7A1 were
inversely associated with CYP27A1. It is interesting to explore whether the orchestration of
different cholesterol metabolic pathways also exists in adipocytes, and this represents one of the
cellular mechanisms that can control cholesterol levels locally.
1.3.3.3 CYP3A4
The conversion of cholesterol to 4β-hydroxycholesterol (4β-HC) by CYP3A4 is a minor
contributor to cholesterol elimination (Bodin et al., 2001). Despite a slow rate of formation, the
circulating level of 4β-HC is relatively high, mainly due to its exceptionally slow elimination
rate (half-life ≈50 h). Almost all CYP enzymes tested to date exhibit weak metabolic activity
toward 4β-HC (Bodin et al., 2002). Once formed, 4β-HC may accumulate and act as a potent
ligand for LXRα to transcriptionally regulate cholesterol metabolism (Janowski et al., 1996).
As the most abundant P450 in human liver, CYP3A4 is more commonly referred to as a
drug-metabolizing enzyme, as are many other members in the CYP family (1, 2, and 3) (Rendic
and Di Carlo, 1997). The expression of these P450s is inducible by xenobiotics (Dogra et al.,
1998), a common cellular mechanism leading to upregulated detoxification of many endogenous
and exogenous compounds (Nebert and Dalton, 2006). Adipose tissue is known as a reservoir for
lipophilic environmental pollutants (Russo et al., 2002); more interestingly, gene and/or protein
60
expression among several members of xenobiotic-metabolizing enzymes, including CYP3As,
have been detected in rodent (Yoshinari et al., 2004) and human (Ellero et al., 2010) adipose
tissues. Typical P450 inducers (e.g. 2,3,7,8-tetrachlorodibenzo-p-dioxin) and lipophilic
pollutants (e.g. prochloraz) were able to enhance the expression of these P450 enzymes, probably
through the same transcriptional mechanism as in the liver (Ellero et al., 2010). These data
suggest that the drug-metabolizing enzymes in adipose tissue may play an underestimated role in
eliminating xenobiotics, and the xenobiotics themselves may also regulate the expression pattern
of these enzymes, leading to altered adipocyte metabolism toward other substrates of the
enzymes, such as cholesterol. Some lipophilic endocrine disruptors, such as phthalates, have also
been shown to induce adipocyte differentiation (Feige et al., 2007; Campioli et al., 2011), thus
supporting the hypothesis that the accumulation of lipophilic xenobiotics in adipose tissue is
linked to the development of obesity-related disorders. The drug- and cholesterol-metabolizing
enzyme, CYP3A4, may represent a mechanical link through which chemicals can modulate
adipocyte development and function.
1.3.4 Functional roles of oxysterols in adipose tissue
During the past few years, oxysterols have emerged as signaling molecules that are
mainly involved in lipid metabolism or sterol transport. Growing interest in the biological
influence of oxysterols has drawn research efforts to the proteins that mediate the effects of
oxysterols in various tissues.
1.3.4.1 Liver X receptor (LXR)
61
Oxysterols are endogenous ligands for LXRs (Janowski et al., 1996). Both LXRα
(NR1H3) and LXRβ (NR1H2) bind to DNA sequences associated with target genes as
heterodimers via the retinoid X receptor (RXR). LXRs are best known as metabolic regulators in
cholesterol, lipid, bile acid, and glucose homeostasis in multiple metabolically active tissues and
cell types such as macrophages, the liver, intestine, kidney, and adipose tissue (Oosterveer et al.,
2010). Both LXRα and LXRβ are present in adipocytes. Expression of LXRα is elevated during
adipogenesis, while LXRβ levels remain constant (Juvet et al., 2003; Seo et al., 2004). The
oxysterol, 22R-hydroxycholesterol, and its stereoisomer, 22S-hydroxycholesterol, have been
shown to act as the LXR agonist and antagonist, respectively, in 3T3-L1 adipocytes (Juvet et al.,
2003), suggesting that LXR may be constitutively active in adipocytes. Different research groups
have reported a complex and sometimes opposing role of LXRs in adipocyte metabolism (Figure
1.5). The limited data thus far regarding adipocytes support the notion that the activation of
adipocyte LXR can have both positive and negative metabolic outcomes. For instance, adiposespecific treatments with an LXR agonist exert several beneficial effects, including enhanced
reverse cholesterol transport (Laffitte et al., 2001) and suppressed secretion of proinflammatory
factors (Fernandez-Veledo et al., 2009). However, it should also be noted that LXRα activation
induces basal lipolysis in adipocytes, which is a well-known risk factor associated with insulin
resistance (Ross et al., 2002). Therefore, the development of partial LXR agonists or isoformspecific ligands has been proposed as a practical therapeutic option in treating metabolic
disorders (Laurencikiene and Ryden, 2012). Since adipose tissue harbors large amounts of
endogenous oxysterols as potential sources of LXR ligands, it is worth studying the effects of
different oxysterols mediated by LXRs in adipocytes, as well as to investigate the outcomes at a
whole-body level.
62
Figure 1.5 Summary of functions attributed to LXR in white adipocytes
The existing literature has reported a complex and sometimes-contradictory role of LXR in
different intracellular processes. Positive (↑), negative (↓), or no (–) effects following LXR
activation in white adipocytes are summarized (Laurencikiene and Ryden, 2012).
63
1.3.4.2 Oxysterol-binding protein (OSBP) and OSBP-related proteins (ORPs)
OSBP and its homologues, ORPs, comprise a 12-member gene family characterized by a
C-terminal β-barrel-like ligand-binding domain, which has been shown to accommodate a
variety of lipids including oxysterols, cholesterol, ergosterol, and phosphatidylinositol-4phosphate (Yan and Olkkonen, 2008; Weber-Boyvat et al., 2013). Gene expressions of all the
ORP members were found in the visceral and subcutaneous adipose tissue of morbidly obese
patients, with similar expression patterns noted in both fat depots. Among them, ORP11 protein
expression was upregulated during the differentiation of human SGBS preadipocyte cells, and
ORP11-silenced preadipocytes displayed limited adipogenic potential (Zhou et al., 2012). In
agreement with its pro-fat activity, ORP11 is one of the most responsive adipose genes to caloric
restriction, with a significantly downregulated expression noted in the subcutaneous adipose
tissue of high-responders (high weight loss), as compared to low-responders (Bouchard et al.,
2010). ORP11 was also found to be more abundantly expressed in the visceral adipose tissue of
obese subjects with cardiovascular diseases than in subjects without metabolic syndrome
(Bouchard et al., 2009). Therefore, adipose ORP11 may serve as a target for the treatment of
obesity and its related disorders. Members of the ORP family may exert distinct functional
impacts on adipocyte phenotype and metabolism. ORP8 was downregulated during the
preadipocyte differentiation and overexpression of ORP8 in preadipocyte-inhibited adipogenesis
(Zhou et al., 2012). In agreement with its anti-fat function to maintain metabolic activity, the loss
of ORP8 expression in cultured liver cells showed impaired glucose metabolism through the
inhibited insulin-stimulated AKT activation (Jordan et al., 2011). Rising evidence about the
functional roles of adipose oxysterol-binding proteins in metabolic diseases may bring the
signaling properties of oxysterols in adipocytes to the center of lipid metabolism research.
64
Rationale
Adipose tissue is an important storage and conversion site for steroids and oxysterols.
The local metabolism of steroids or oxysterols could either quantitatively contribute to its
systemic levels or functionally regulate adiposity in a local manner. With the exception of taking
up the steroid precursors from plasma and transforming them into other forms through various
enzymes, adipocytes have not been recognized as cells that synthesize steroids or oxysterols de
novo. Cholesterol is the building block for the biosynthesis of steroid hormones and oxysterols.
Prior to our study, only the gene expression of certain key components involved in the initial
steps of steroid or oxysterol biosynthesis from cholesterol was detected in either an adipocyte
cell line or adipose tissues from rodents or humans. There are no protein expression studies or
activity studies that have ever been reported. Therefore, we hypothesize that adipocytes have the
ability to synthesize steroids and/or oxysterols de novo, and that these endogenous products exert
local biological influence.
In order to address this hypothesis, the aim of this thesis is to answer the following
questions:
(1) Can adipocytes synthesize steroids and/or oxysterols de novo?
(2) Can these de novo products play a meaningful role in adipocyte function and
development?
(3) How can the local synthesis of steroids and oxysterols in adipocytes become regulated?
The findings of this work may dramatically change the traditional view that adipocytes
are solely a conversion site for steroid/oxysterol precursors that are drawn from the circulation.
Our work may lead to a new understanding of how locally synthesized steroids or oxysterols,
through the de novo production directly from cholesterol, modulate adipocyte function and other
65
metabolic parameters. The discovery of steroid/oxysterol biosynthetic pathways in adipocytes
may offer new therapeutic targets to treat obesity and its related diseases.
66
Connecting text between Chapter 1 and 2
In Chapter 1, we reviewed the presence of steroid- and oxysterol-converting enzymes in
adipose tissues, as well as their functional influence in either a local or endocrine manner.
Despite the discovery of the gene expression of certain steroidogenic components in adipose
tissue, adipocytes were not established as steroidogenic cells due to lack of studies conducted on
the protein expression and activity of the first steroidogenic enzyme, CYP11A1. Thus, in
Chapter 2, we began by investigating the expression and activity of CYP11A1 and mapped the
whole steroidogenic pathway using the in vitro-differentiated mouse 3T3-L1 adipocytes. Due to
the discovery of significant amounts of cholesterol products other than typical steroid hormones,
we extended our hypothesis to other enzymatic pathways that shared the same substrate
(cholesterol) with the steroidogenic pathway. The oxysterol 27-hydroxycholesterol (27HC),
synthesized from cholesterol by CYP27A1, was identified as one of the cholesterol metabolites
in mouse 3T3-L1 adipocytes, human SGBS adipocytes, and differentiated adipocytes from rat
and human pre-fat cells isolated from adipose tissue. To determine the local functional
significance of the 27HC biosynthetic pathway, we supplemented a specific inhibitor of
CYP27A1 into differentiation medium, transfected Cyp27a1 siRNA into 3T3-L1 preadipocytes
before differentiation, or obtained pre-fat cells from the adipose tissue of Cyp27a1 knockout
mice and exposed them to differentiation. As a result, we proved that the active 27HC
biosynthesis pathway is a negative local regulator of adipogenesis, preventing abnormal amounts
of adipocyte formation and limiting adipose compartment expansion.
67
Chapter 2
De Novo Synthesis of Steroids and Oxysterols in Adipocytes
Jiehan Li 1,2, Edward Daly 1, Enrico Campioli 1,3, Martin Wabitsch 4, and
Vassilios Papadopoulos1,2,3,5*
1
2
Research Institute of the McGill University Health Centre and the Departments of
Pharmacology and Therapeutics, 3Medicine, and 5Biochemistry, McGill University,
Montreal, Canada
4
Division of Pediatric Endocrinology and Diabetes, Department of Pediatrics and Adolescent
Medicine, University of Ulm, Germany
Journal of Biological Chemistry. 2014. 289(2): 747-764.
*
Correspondence: Dr. V. Papadopoulos, Research Institute of the McGill University Health
Centre, Montreal General Hospital, 1650 Cedar Avenue, Room C10-148, Montréal, Québec H3G
1A4, Canada; phone: 514-934-1934 ext. 44580; fax: 514-934-8439; e-mail:
[email protected]
68
2.1 Abstract
Local production and action of cholesterol metabolites such as steroids or oxysterols
within endocrine tissues are currently recognized as an important principle in the cell type- and
tissue-specific regulation of hormone effects. In adipocytes, one of the most abundant endocrine
cells in the human body, the de novo production of steroids or oxysterols from cholesterol has
not been examined. Here, we demonstrate that essential components of cholesterol transport and
metabolism machinery in the initial steps of steroid and/or oxysterol biosynthesis pathways are
present and active in adipocytes. The ability of adipocyte CYP11A1 in producing pregnenolone
is demonstrated for the first time, rendering adipocyte a steroidogenic cell. The oxysterol 27hydroxycholesterol (27HC), synthesized by the mitochondrial enzyme CYP27A1, was identified
as one of the major de novo adipocyte products from cholesterol and its precursor mevalonate.
Inhibition of CYP27A1 activity or knockdown and deletion of the Cyp27a1 gene induced
adipocyte differentiation, suggesting a paracrine or autocrine biological significance for the
adipocyte-derived 27HC. These findings suggest that the presence of the 27HC biosynthesis
pathway in adipocytes may represent a defense mechanism to prevent the formation of new fat
cells upon overfeeding with dietary cholesterol.
69
2.2 Introduction
Adipocytes are not passive storage depots for fat; rather, they are active
endocrine/paracrine/autocrine/intracrine cells that produce a wealth of factors that regulate lipid
homeostasis, insulin sensitivity, glucose metabolism, and inflammation (Kershaw and Flier,
2004). In addition to secreting proteins such as leptin and adiponectin, adipocytes are major sites
of steroid conversion. Indeed, adipocytes express several steroid-metabolizing enzymes
(Belanger et al., 2002) and can modulate local steroid concentrations. Thus, local production of
steroids by adipocytes may contribute substantially to steroid action. To initiate the production of
any steroid hormone, cholesterol must be delivered to the cytochrome P450 cholesterol sidechain cleavage enzyme (CYP11A1) located in the inner mitochondrial membrane. CYP11A1,
aided by the electron transport partners ferredoxin (FDX) and ferredoxin reductase (FNR),
converts cholesterol to pregnenolone, which is transformed into different steroid products
through enzymatic reactions in a tissue-specific manner (Fig. 2.1A) (Miller and Auchus, 2011).
In classic steroidogenic tissues, such as adrenal and testis, cholesterol availability to
CYP11A1 limits steroidogenesis; the transport of cholesterol from the outer to the inner
mitochondrial membrane is the rate-limiting step in steroidogenesis overall (Lacapere and
Papadopoulos, 2003). The translocator protein (18 kDa) TSPO and the steroidogenic acute
regulatory protein (STAR) are the two major components of the mitochondrial cholesterol
transport machinery. Binding of the endogenous ligand diazepam-binding inhibitor/acyl-CoA
binding domain 1 to TSPO accelerates the translocation of cholesterol into mitochondria and
thus accelerates pregnenolone formation (Fig. 2.1A) (Papadopoulos et al., 2007). Because of the
lack of evidence supporting the presence of mitochondrial cholesterol transport and metabolism
in adipocytes, the ability to make steroids de novo has not been examined in these cells.
70
Recent findings in hepatic cells suggest that the mitochondrial cholesterol transport
system may also be crucial for the activity of a second mitochondrial enzyme, the cytochrome
P450 sterol 27-hydroxylase (CYP27A1). CYP27A1 metabolizes cholesterol into 27hydroxycholesterol (27HC; Fig. 2.1A) (Pandak et al., 2002), the most abundant oxysterol in
human circulation (Bjorkhem et al., 2002). Based on isotope-labeling experiments that allow for
monitoring the incorporation of labeled cholesterol into oxysterols in vivo, 80% of circulating
27HC is believed to be derived from a slowly exchangeable pool of cholesterol, representing
production by extrahepatic tissues, including adipose, skeletal muscle, and skin (Meaney et al.,
2001). Thus, adipose tissue may be one of the sources for 27HC production.
There is evidence that Tspo gene transcription is induced during 3T3-L1 mouse
preadipocyte differentiation (Wade et al., 2005) and that silencing of Acbd1 inhibits 3T3-L1
adipocyte differentiation (Mandrup et al., 1998). Based on these preliminary findings, we
hypothesized that adipocytes are able to synthesize steroids or oxysterols, such as 27HC, de novo
and that these endogenous products play a role in adipocyte differentiation and function. Here,
we provide evidence that the expression and activity of the mitochondrial cholesterol delivery
and metabolism machinery responsible for steroid hormone and 27HC biosynthesis are present in
adipocytes. Moreover, inhibition of the CYP27A1 enzymatic pathway induces adipocyte
differentiation, suggesting a local regulatory role of this pathway in adipocyte development and
function.
71
2.3 Experimental procedures
2.3.1 Cell Culture, Differentiation, and Treatments
Mouse 3T3-L1 preadipocytes were cultured and differentiated as described previously
(Wade et al., 2005; Baumann et al., 2000). In brief, 3T3-L1 preadipocytes (ATCC) were cultured
in high glucose Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with
10% heat-inactivated fetal bovine serum (FBS; Invitrogen) and antibiotics (100 IU/ml penicillin
G and 100 µg/ml streptomycin) and maintained in a humidified chamber at 37 °C with 5% CO2.
Two days postconfluency (designated day 0), cells were induced to differentiate by addition of
DMEM supplemented with the same antibiotics and a standard induction mixture composed of
10% FBS, 0.5 mM 3-isobutyl-1 methylxanthine (IBMX), 1 µM dexamethasone, and 1 µg/ml
insulin. After 48 h, the media were replaced with DMEM supplemented with the same antibiotics,
10% FBS, and 1 µg/ml insulin. The media were replaced every 48 h for an additional 8 days. For
the treatment with 27HC or the specific CYP27A1 inhibitor GI268267X (a gift from
GlaxoSmithKline), appropriate concentrations of compounds were added at the start of the
differentiation, and the same concentrations of the compounds were added at a 2-day interval
when the culture medium was replenished.
Simpson-Golabi-Behmel syndrome (SGBS) preadipocyte cell culture and differentiation
was performed as described previously (Wabitsch et al., 2001). SGBS preadipocytes were
maintained in DMEM/Nutrient Mix F-12 (Invitrogen), supplemented with 8 g/ml biotin, 4 g/ml
pantothenic acid, 10% FBS (not heat-inactivated, Wisent), and antibiotics (100 IU/ml penicillin
and 100 µg/ml streptomycin) at 37 °C with 5% CO2. Three days postconfluency, SGBS
preadipocytes were induced to differentiate using the “quick” differentiation medium (DMEM/F12, 8 g/ml biotin, 4 g/ml pantothenic acid, 0.01 mg/ml human transferrin, 100 nM cortisol, 200
72
pM triiodothyronine, 20 nM human insulin, 25 nM dexamethasone, 500 µM IBMX, 2 µM
rosiglitazone, and antibiotics). On day 4 of differentiation, the medium was replaced by
adipogenic medium lacking the dexamethasone, IBMX, and rosiglitazone of the quick
differentiation medium. The adipogenic medium was replaced every 2–3 days. SGBS cells were
fully differentiated on day 15.
Human mature adipocytes in culture (2-week post-differentiation) from subcutaneous or
omental adipose tissues of nondiabetic male subjects were obtained from Zenbio Inc. Upon
arrival, excess medium added to each well for shipping was immediately removed, and only
sufficient volume of medium was left to cover the cell monolayer. After overnight incubation at
37 °C with 5% CO2, adipocytes were fed with fresh Omental Adipocyte Medium (OM-AM,
Zenbio) for omental adipocytes and Adipocyte Maintenance Medium (AM 1, Zenbio) for
subcutaneous adipocytes for another 24 h before using for de novo steroid or oxysterol studies.
MA-10 mouse Leydig cells were a gift from Dr. Mario Ascoli (University of Iowa) and
cultured in DMEM/F-12 supplemented with 5% FBS and 2.5% heat-inactivated horse serum as
described previously (Liu et al., 2006). HepG2 human liver hepatocellular carcinoma cell lines
were obtained from ATCC and cultured in DMEM supplemented with 10% FBS.
2.3.2 Isolation, Culture, and Differentiation of Stromal Vascular Fraction (SVF)
10-Week-old male B6.129-Cyp27a1tm1Elt/J (Cyp27a1-/-) and their respective control male
C57BL/6J (wild type) mice were purchased from The Jackson Laboratory. 55–58-Day-old male
Sprague-Dawley rats were purchased from Charles River Laboratories. Following CO2
euthanasia, animals were decapitated, and adipose tissues were collected. Animals were handled
according to protocols approved by the McGill University Animal Care and Use Committees.
73
SVF isolation from adipose tissue and cell differentiation was performed as described previously
(Gregoire et al., 1990). In brief, adipose tissue was rinsed immediately in phosphate-buffered
saline (PBS), and connective tissues and blood vessels were carefully dissected and removed.
The remaining tissues were minced into small pieces and digested in a collagenase solution
containing 2% bovine serum albumin for 60 min at 37 °C under continuous shaking. The
collagenase used was type II collagenase (Sigma, 1.2% v/v) for rat adipose tissue and type 1
collagenase (Worthington, 1 mg/ml) for mouse adipose tissue. The dispersed tissue was
centrifuged for 5 min at 250 g to give rise to the floating adipocytes and the sedimented SVF.
The SVF pellets were resuspended in erythrocyte lysis buffer (8.26 g of NH4Cl, 1 g of KHCO3,
and 0.037 g of EDTA in 1 liter of water (pH 7.3)) for 5 min at room temperature (RT) before
adding complete growth medium (10% fetal bovine serum, 1% penicillin/streptomycin solution,
and 1% amphotericin B in DMEM/Nutrient Mixture F-12) to stop the reaction. The resulting
suspension was filtered through 100 µm nylon strainers and 40 µm nylon strainers. After
centrifuging at 350 x g for 5 min at 4 °C, the pellets were resuspended in complete medium and
cultured at 37 °C in a humid 5% CO2 environment. Three days post-seeding, SVF cells from rat
adipose tissue were differentiated into adipocytes with complete growth medium supplemented
with 0.5 mM IBMX, 1 µM dexamethasone, and 1.6 µM insulin for 2 days, followed by
supplementation of 1.6 µM insulin alone for an additional 8 days. The medium was replaced
every 2 days. The differentiation of SVF cells from mouse adipose tissue followed the same
procedure as above, except that 5 µM rosiglitazone was added into the differentiation medium
during the first 2 days.
2.3.3 Knockdown of Cyp27a1 in 3T3-L1 Preadipocytes
74
At 80% confluence, 3T3-L1 preadipocytes were transfected with 50 nM siRNA for
Cyp27a1 (Dharmacon, M-058118-01, siGENOME SMARTpool) using Lipofectamine 2000
reagent (Invitrogen) according to the protocol recommended by the manufacturer. The
transfected cells were incubated for 48 h and subjected to differentiation.
2.3.4 Quantitative Real Time PCR (qPCR) Analysis
Total RNA was isolated from cells using the RNeasy mini kit (Qiagen) according to the
manufacturer’s instructions. The concentration and quality of the purified RNA samples were
determined spectrophotometrically using NanoDrop ND-1000 (Thermo Scientific) at A260 and
by the A260/A280 ratio, respectively. Total RNA (700 ng) was reverse-transcribed into cDNA
using random hexamers (Roche Applied Science) according to the manufacturer’s instructions.
RNA expression levels were quantified using SYBR Green on a Light Cycler System 480
(Roche Applied Science). Briefly, samples were preincubated at 95 °C for 5 min, followed by 45
cycles of denaturation at 95 °C for 10 s, annealing at 63 °C for 10 s, and elongation at 72 °C for
10 s. For each primer pair, the identity of the qPCR amplification product was verified by
electrophoresis on a 2% agarose gel and by melting curve analysis. Ribosomal protein S18
(Rps18) mRNA expression was constant under the experimental conditions, and all results were
normalized to Rps18 mRNA levels.
The primers (upstream and downstream) used were as follows: Tspo, 5’- CCC GCT TGC
TGT ACC CTT ACC – 3’ and 5’ - CAC CGC ATA CAT AGT AGT TGA GCA CGG TG – 3’;
Acbd1, 5’ - GCT TGT TCC ACG AGT CCC ACT – 3’ and 5’ - CGG TAG ACA GTC ACT
TCA AAC AAG CTA CCG – 3’; Star, 5’ - ATC TCC TTG ACA TTT GGG TTC CA – 3’ and 5’
- CGG TCT CTA TGA AGA ACT TGT GGA CCG – 3’; Cyp11a1, 5’ - GGT TCT CAG GCA
75
TCA GGA TGA G – 3’ and 5’ - CGG AGC AGA ATT GAA GTT CAA AAT CTC CG – 3’;
Fdx, 5’ - CGG ATC AAC AGA CTG TCG GAC ATC CG – 3’ and 5’ - CAA GGT TGG GCT
GCC AAG TT – 3’; Fnr, 5’ - CGG CAG CAG CAG TTC TGT TAG CCG – 3’ and 5’ - TTG
GGC CTC CAG GAC AGA ATT A – 3’; Cyp17a1, 5’ – ATG AGG AGG TGA GTC CGG TCA
– 3’ and 5’ - CGA CTG TGA CCA GTA TGT AGG CTT CAG TCG – 3’; Hsd3b1, 5’ - TGT
TGG TGC AGG AGA AAG AAC TG – 3’ and 5’ – CGA CCT CCT CCT TGG TTT CTG GTC
G – 3’; Cyp21, 5’ - CGG CTT ATC CTT AGG GAT GTC ATA GCC G – 3’ and 5’ - ATT GCC
GAG GTG CTG CGT TT – 3’; Cyp11b1, 5’ - AAG TCC CTT GCT ATC CCA TCC A – 3’ and
5’ - CGG CAA TGT TCT GTC ACC AAA AGC CG – 3’; Cyp11b2, 5’ - TCA GAC TCG GCA
GCT CTC AGA C – 3’ and 5’ - CGG AAA AGA TCC CTG AGA TAT TAG TTC CG – 3’;
Hsd11b1, 5’ - CAT GAC CAC GTA GCT GAG GAA G – 3’ and 5’ - CGC ACG ACG ACA
TCC ACT CTG TGC G – 3’; Cyp19a1, 5’ - AGG GTC AAC ACA TCC ACG TAG C – 3’ and 5’
- CGG TCA TCA AGC AGC ATT TGG ACC G – 3’; Hsd17b7, 5’ - CGC AAT GCA AAG
AAG GCT AAC TT – 3’ and 5’ - CGG AAT GGA AGA GCT GTA GGG TTC CG – 3’;
Cyp27a1, 5’ - CGG CCA TTC CTG AGG ACA CTG CCG – 3’ and 5’ - TCC ATT TGG GAA
GGA AAG TGA T – 3’; Cyp7b1, 5’ - GGT CTG CCT GGA AAG CAC TA – 3’ and 5’ - TTC
TCG GAT GAT GCT GGA GT – 3’; Cyp7a1, 5’ - CGG GAC AAG TGA ATA GGG ACG
CCC G – 3’ and 5’ - TGA CAG CTT CAA ACA ATT TGA CCA – 3’; Nr5a1, 5’ - GCT GGC
ATA GGG CTC TGG AT – 3’ and 5’ - CGG TTC TCT ATC CTG CCT TCT CTA ACC G – 3’;
Pparg, 5’ - CGG AAA TAA AGT CAC CAA AGG GCT TCC G – 3’ and 5’ - CTC ATC TCA
GAG GGC CAA GGA – 3’; Fabp4, 5’ - TTT GGT CAC CAT CCG GTC AG – 3’ and 5’ - CGA
GAT CCC AGT TTG AAG GAA ATC TCG – 3’; Cebpa, 5’ – TTG GCT TTA TCT CGG CTC
TTG C – 3’ and 5’ - CGG TAA CAA GAA CAG CAA CGA GTA CCG – 3’; Rps18, 5’ – CAC
76
GGG CTC CAC CTC ATC CTC CGT G – 3’ and 5’ - TGA GGA AAG CAG ACA TCG ACC T
– 3’.
2.3.5 Mitochondrial Preparation
Mitochondria were isolated as described previously (Krueger and Papadopoulos, 1990),
with minor modifications. All steps of the procedure were performed at 4 °C. Briefly, 3T3-L1
adipocytes (in 150-mm dishes) were rinsed twice in PBS, harvested in Buffer A (10 mM HepesKOH (pH 7.5), 200 mM mannitol, 70 mM sucrose, 1 mM EDTA, and 1X Complete Protease
Inhibitor Mixture Tablet (Roche Diagnostics)) using a cell lifter and centrifuged at 500 x g for 10
min. The cell pellets were resuspended in 5 volumes of Buffer A, incubated for 10 min, and
centrifuged at 500 x g for 10 min. The cell pellets were resuspended in Buffer B (40 mM HepesKOH (pH 7.5), 250 mM sucrose, 80 mM potassium acetate, 5mM magnesium acetate, and 1X
Complete Protease Inhibitor Mixture Tablet) and homogenized with an electric Teflon-glass
homogenizer. The homogenate was centrifuged at 500 x g for 10 min; the supernatant was
collected, and the pellet was homogenized and centrifuged again. The two supernatants were
pooled and centrifuged at 10,000 x g for 10 min. The resulting mitochondrial pellet was
resuspended in 1 ml Buffer B and centrifuged at 10,000 x g for another 10 min to enrich
mitochondrial purity. The final mitochondrial pellets were either solubilized in Laemmli buffer
for immunoblot analysis or resuspended in import buffer for pregnenolone or 27HC synthesis.
2.3.6 Protein Measurement
Protein concentrations were determined using a bicinchoninic acid assay (Thermo Fisher
Scientific) according to the manufacturer’s instructions.
2.3.7 Immunoblot Analysis
77
Whole cells or mitochondrial pellets were solubilized in Laemmli buffer, and proteins (30
µg) were separated by electrophoresis on a 4–20% SDS-polyacrylamide gradient gel and
transferred to a polyvinylidene fluoride membrane. Nonspecific binding was blocked with 5%
skim milk in Tris-buffered saline solution for 1 h at RT. Membranes were incubated with
specific antibodies overnight at 4 °C. Antibodies used were as follows: anti-CYP11A1 (1:1000,
Abcam, ab75497); anti-CYP27A1 (1:1000, Abcam, ab64889); anti-FDX (1:1000, Abcam,
ab108257); anti-FNR (1:1000, Abcam, ab16874); anti- TSPO (1:500) (16); anti-ACBD1 (1:1000,
Abcam, ab16871); anti-STAR (1:1000, provided by Dr. Buck Hales, Southern Illinois
University); anti-adipocyte fatty acid-binding protein (FABP4; 1:1000, Cell Signaling, 3544);
anti-β-actin (1:1000, Cell Signaling, 4970); and anti-cytochrome c oxidase (COX IV; 1:1000,
Abcam, ab16056). Membranes were incubated with anti-rabbit IgG horseradish peroxidaselinked secondary antibodies for 1 h at RT. After developing membranes using an enhanced
chemiluminescence kit (Amersham Biosciences), signals were visualized with a Fujifilm LAS4000. The same membrane was probed with either anti-β-actin or anti-cytochrome c oxidase to
detect the expression of the internal housekeeping control in cell or mitochondrial lysates.
2.3.8 CYP11A1 and CYP27A1 Activity Assays
In both isolated mitochondria and whole adipocytes, the activities of CYP11A1 or
CYP27A1 were tested by using 22(R)-hydroxycholesterol (22RHC) or cholesterol, respectively,
as substrate. When using isolated mitochondria for the activity assay, procedures from previous
studies were followed (Culty et al., 2002). Freshly prepared adipocyte mitochondria pellets were
suspended at a final concentration of 1 mg/ml in import buffer (250 mM sucrose, 10 mM
potassium phosphate buffer (pH 7.5), 15 mM triethanolamine-HCl, 20 mM KCl, 5 mM MgCl2, 3%
bovine serum albumin, and 1X Complete Protease Inhibitor Mixture tablet). Either 22RHC
78
(substrate for CYP11A1, 20 µM) or cholesterol (substrate for CYP11A1 and CYP27A1, 1.5 µCi
[3H]cholesterol (specific activity of 43 Ci/mmol, Amersham Biosciences), and 20 µM unlabeled
cholesterol) was added to the import buffer. For the CYP11A1 assay, the import buffer was also
supplemented with 5 µM trilostane, a 3β-hydroxysteroid dehydrogenase (3β-HSD) inhibitor.
These mitochondrial suspensions were incubated at 37 °C for 5 min in a shaking platform. The
reaction was started by the addition of 15 mM sodium isocitrate and 0.5 mM NADP in a 250 µl
final volume. After incubating for the indicated time periods at 37 °C, the reaction was stopped
by adding 1 ml of ethyl acetate. After extraction, the organic phase was collected and evaporated
to dryness. Pregnenolone formation was measured by RIA. Radiolabeled 27HC formation was
detected by HPLC-radiometric assay.
When using the whole cells for the activity assay, fully differentiated adipocytes grown
on 100-mm culture plates were washed twice with PBS before the incubation with 22RHC (1.5
µCi of 22(R)-[22-3H] hydroxycholesterol (specific activity of 20 Ci/mmol, American
Radiolabeled Chemicals) and 20 µM unlabeled 22RHC) or cholesterol (1.5 µCi of
[3H]cholesterol and 20 µM unlabeled cholesterol) in Aim-V serum-free medium. After different
time intervals, cells and media were collected, extracted with ethyl acetate, and dried. The
residues were reconstituted in methanol, and the radiolabeled products were analyzed by HPLCradiometric assay.
2.3.9 De Novo Steroid or Oxysterol Synthesis
Mature adipocytes differentiated from mouse 3T3-L1 preadipocytes, rat SVFs, human
SGBS preadipocytes, and human primary preadipocytes were used for de novo synthesis of
steroids or oxysterols. As described previously (Guarneri et al., 1992), cells were washed twice
79
with warm PBS and incubated at 37 °C with either cholesterol (1.5 µCi of [3H]cholesterol and 20
µM unlabeled cholesterol) or its direct precursor mevalonate (1.5 µCi of [3H]mevalonolactone
(specific activity, 37.1 Ci/mmol, PerkinElmer Life Sciences) and 20 µM unlabeled
mevalonolactone) in the media, which are as follows: for 3T3-L1 adipocytes, Aim-V serum-free
medium; for human SGBS adipocytes, DMEM/F-12 supplemented with 8 µg/ml biotin, 4 µg/ml
pantothenic acid; for differentiated adipocytes from rat primary SVF, DMEM/F-12
supplemented with 5% charcoal-stripped FBS; for human omental adipocytes, Omental
Adipocyte Medium; and for human subcutaneous adipocytes, Adipocyte Maintenance Medium.
After terminating the reaction at various time points, media were collected, and cells were
harvested in PBS. Aliquots of cell suspensions were frozen at -20 °C for protein concentration
measurement later. The remaining cell suspensions were combined with the media and stored at 20 °C before extraction and analysis.
2.3.10 HPLC Radiometric Assay and TLC
Cell and media homogenates collected at various intervals of the substrate treatment were
extracted three times with 4 volumes of ethyl acetate and evaporated. Extracts were reconstituted
in 200 µl of methanol. Steroid or oxysterol products were separated by a Beckman Gold HPLC
system using a Beckman Ultrasphere ODS column (250 x 4.6 mm, 5 µm) at RT and monitored
by ultraviolet detection (190–300 nm). HPLC separation was achieved with a gradient of
solution A (acetonitrile/methanol/water, 40:40:20) and solution B (100% methanol) at a flow rate
of 1.5 ml/min, as described previously (Pikuleva et al., 1998). Runs were started with 0%
solution B (100% solution A) increasing linearly to 100% solution B during the initial 15 min,
after which the flow was kept at 100% solution B for another 15 min. Fractions were collected
every 30 s and counted by liquid scintillation spectrometry. Products were identified by
80
respective retention time compared with standards under the same chromatographic conditions.
Results were presented as counts/min minus background and normalized to the protein
concentrations of the sample. In some experiments, steroid or oxysterol products were also
separated by TLC on silica gel plates (Fluka) and developed in hexane/ ethyl acetate/acetic acid
(50:50:1, by volume). The bands were detected with iodine vapor.
2.3.11 Gas Chromatography-Mass Spectrometry (GC-MS) Analysis
Pooled extracts from de novo 27HC assays were air-dried, derivatized with bis
(trimethylsilyl)trifluoroacetamide/trimethylchlorosilane (99:1), and subjected to GC-MS using a
Shimadzu 17A/QP5050A single quadrupole mass spectrometer operated in the electron impact
ionization mode. The gas chromatograph was equipped with a 3 m x 0.25 mm 0.25 µm film
thickness analytical column (Restek Canada, Chromatographic Specialties Inc., catalog no.
12223; serial no. 559805). A 0.5 µl sample was injected in splitless mode (inlet was set at 280 °C
with the helium flow at 59 µl/min) at the initial 120 °C. The oven was first kept at 120 °C for 3
min, ramped at 40 °C/min to 310 °C, and held for 7 min isothermally. Based on the full scan
(total ion current, m/z = 50–650) of the trimethylsilyl-derived reference standard 27HC, the ions
detected at m/z 75 (C4H11O+), m/z 129 (C6H13OSi+), and m/z 457 (C30H53O2Si+) were used to
confirm the production of 27HC by selected ion monitoring (SIM).
2.3.12 Quantification of the Rate of Bile Acid Synthesis
Rates of bile acid synthesis were determined via time point conversion of [3H]cholesterol
to 3H-labeled bile acids, which were methanol/ water-extractable products. As described
previously (Pandak et al., 2002), cells grown on 150-mm tissue culture dishes were washed twice
with PBS and incubated in Aim-V serum-free medium containing 2.5 µCi of [3H]cholesterol.
81
Aliquots (100 µl) of the medium were collected in duplicate in microcentrifuge tubes at various
time points and kept frozen until analysis. A mini-Folch extraction buffer (50 µl of water, 250 µl
of methanol, 537 µl of chloroform, and 3 µl of 1 M Na2CO3) was added to each 100 µl culture
medium sample. After vortexing vigorously, the tubes were centrifuged at 16,000 x g for 6 min.
The phases were collected separately and counted.
2.3.13 Oil Red O Staining
Cells were washed twice with PBS and fixed with 10% formaldehyde solution in PBS for
1 h. After removing the formaldehyde, cells were washed with 60% isopropyl alcohol and dried
completely. Diluted Oil Red O solution (6 parts 0.35% Oil Red O in isopropyl alcohol and 4
parts water) was added for 10 min. After repeatedly washing with water, cells were visualized
microscopically.
2.3.14 Statistical Analysis
Statistical analyses were performed using GraphPad Prism 4.02 software. The
significance of the results was determined by using Student’s t test or one-way analysis of
variance followed by Bonferroni’s post hoc test for multiple comparisons.
82
2.4 Results
2.4.1 Characterization of the Steroidogenic Pathway and Ability of 3T3-L1 Cells to Form
Steroids during Differentiation
The 3T3-L1 preadipocyte cell line is a well-established model used to study adipocyte
differentiation. The differentiation stages of this cell line were defined by Oil Red O staining of
lipid droplets (Fig. 2.1B). Upon induction of 3T3-L1 differentiation into adipocytes, Tspo gene
expression was significantly elevated, rising approximately 4-fold at D10 post-differentiation
(Fig. 2.2A). In cell extracts, TSPO protein was present in preadipocytes, and TSPO levels
increased during differentiation. In these studies, undifferentiated (control) cells were maintained
in growth medium, whereas other cells were incubated in differentiation medium. TSPO levels in
these cells were not changed compared with D0 preadipocytes. TSPO was observed in
mitochondria isolated from D5 differentiating adipocytes, and TSPO levels were greatly
increased in D10 mature adipocyte mitochondria (Fig. 2.2A). Similarly, Acbd1 mRNA and
protein levels were induced during 3T3-L1 differentiation (Fig. 2.2B). Although Star (Stard1)
mRNA levels at D10 were 4.7-fold higher than those at D0, STAR protein was not detected in
isolated mitochondria from either preadipocytes or mature adipocytes (Fig. 2.2C).
CYP11A1 is the first enzyme in the steroidogenic pathway, acting by converting
cholesterol into pregnenolone. The enzymatic activity of mitochondrial P450s is regulated by the
rate of electron transfer from the P450 redox partners FDX and FNR. qPCR analysis revealed
that Cyp11a1 was elevated approximately 80-fold in D10 mature adipocytes compared with D0
preadipocytes (Fig. 2.2D). Fdx and Fnr mRNA levels were both induced significantly at D5 and
D10 during differentiation (Fig. 2.2, E and F). Each of these three proteins was present at low
83
levels in preadipocyte mitochondria. However, these mitochondrial proteins were up-regulated in
differentiated adipocytes (Fig. 2.2, D–F).
To further map the presence of components of the steroidogenic pathway in adipocytes
and identify the final steroid products, we evaluated the expression levels of transcripts encoding
steroidogenic enzymes during 3T3-L1 adipocyte differentiation. The enzymes investigated
included the following: pregnenolone- metabolizing enzymes 17α-hydroxylase/17,20-lyase
(CYP17A1) and 3β-HSD; 21-hydroxylase (CYP21), 11β-hydroxylase (CYP11B1), aldosterone
synthase (CYP11B2), and 11β-hydroxysteroid dehydrogenase (11β-HSD), which are involved in
glucocorticoid and mineralocorticoid biosynthesis; and 17β-hydroxysteroid dehydrogenase (17βHSD) and aromatase (CYP19A1), which are involved in sex steroid synthesis. Regarding
pregnenolone-metabolizing enzymes, Cyp17a1 mRNA expression (Fig. 2.2G) was induced at
D10, whereas Hsd3b1 mRNA levels (Fig. 2.2H) in D5 and D10 cells were lower than those in
D0 preadipocytes. However, no statistical difference was detected in Hsd3b1 gene expression
throughout differentiation. The mRNA levels of Cyp21, a key enzyme in the synthesis of both
glucocorticoids and mineralocorticoids, increased in D10 adipocytes (Fig. 2.2I). Gene expression
of Cyp11b2 (Fig. 2.2K) also increased during differentiation. The mRNA levels of Cyp11b1, the
enzyme converting 11-deoxycortisol to cortisol, were not significantly different between
preadipocytes and adipocytes (Fig. 2.2J). Not surprisingly, Hsd11b1, which predominantly
catalyzes the reduction of metabolically inactive cortisone to active cortisol, was induced over
200-fold during 3T3-L1 adipogenesis (Fig. 2.2L). In the sex steroid synthesis pathway, Cyp19a1
(Fig. 2.2M) gene expression was higher in preadipocytes. Although Hsd17b3, encoding the
androgenic form of 17β-HSD, was not detected in 3T3-L1 cells (data not shown), the Hsd17b7
gene encoding the estrogenic 17β-HSD (Fig. 2.2N) was slightly induced in differentiated cells.
84
To further confirm the steroidogenic potential of adipocytes, we evaluated the expression
of steroidogenic factor 1 (SF-1; NR5A1), a nuclear receptor positively regulating steroidogenic
protein and enzyme expression (Jameson, 2004). As shown in Fig. 2.2O, Nr5a1mRNA levels
were significantly increased during 3T3-L1 adipogenesis. Gene expression of dosage-sensitive
sex reversal gene 1 (Dax1), another nuclear receptor that acts as a global negative regulator of
steroid hormone production (Lalli and Sassone-Corsi, 2003), was not detected during adipocyte
differentiation (data not shown). Taken together, these data suggest that differentiated adipocytes
express the enzymes and proteins needed to produce steroids.
2.4.2 CYP11A1 Enzymatic Activity in 3T3-L1 Adipocytes
The ability of CYP11A1 to convert cholesterol to pregnenolone defines a “steroidogenic”
cell. Based on the elevated expression pattern of the CYP11A1 enzyme system during 3T3-L1
adipogenesis, we used D10 mature adipocytes to investigate the enzymatic activity of CYP11A1.
Mitochondria isolated from D10 3T3-L1 adipocytes were incubated in an NADPH-containing
reaction buffer together with the substrate 22RHC. This substrate is a soluble cholesterol analog
that bypasses the mitochondrial cholesterol transport system and reaches CYP11A1 in the inner
mitochondrial membrane to be metabolized to pregnenolone. Fig. 2.3A shows that adding
22RHC to the cells resulted in the time-dependent production of pregnenolone, albeit at low
levels. Statistical differences were only seen after 3 h of 22RHC incubation in adipocyte
mitochondrial suspensions. To test the pregnenolone synthesis rate at the cell level, D10 3T3-L1
adipocytes were incubated with 20 µM 22RHC and [3H]22RHC as a tracer before extraction
followed by HPLC radiometric analysis (Fig. 2.3B). Fig. 2.3C shows that after 48 h only 6% of
[3H]22RHC was converted to pregnenolone (retention time ≈5.5 min), indicating low CYP11A1
enzyme activity in 3T3-L1 adipocytes. However, HPLC-radiometric analysis of radioactive
85
products after 48 h of incubation with [3H]22RHC showed the presence of peaks at a retention
time distinct to that of pregnenolone (Fig. 2.3B), suggesting that the low pregnenolone
production in adipocytes could be the result of pregnenolone metabolism to the downstream
steroid hormones.
2.4.3 CYP27A1 Enzymatic Activity and De Novo Synthesis of 27HC in 3T3-L1 Adipocytes
Because CYP11A1 is present and active in mature 3T3-L1 adipocytes, we incubated
3T3-L1 adipocytes with cholesterol to test whether it could be converted to form de novo
steroids in adipocytes. After a 48-h incubation with [3H]cholesterol, not much radiolabeled
pregnenolone was detected (Fig. 2.4A). However, significant amounts of some unknown
radiolabeled cholesterol products were eluted at different retention times. Thus, we extended our
hypothesis to other pathways that may be involved in cholesterol metabolism. The pathway for
biosynthesis of oxysterols, the oxidized derivatives of cholesterol, is independent of
steroidogenesis. HPLC and TLC separation of the samples incubated with [3H]cholesterol for 48
h indicated the separation of a radiolabeled product eluted at a retention time identical to a 27HC
standard examined under the same HPLC separation conditions or on the same TLC plate (Fig.
2.4A). The inner mitochondrial membrane CYP27A1 generates 27HC from cholesterol. The
presence of CYP27A1 enzymatic activity in D10 3T3-L1 adipocytes was confirmed by
incubating isolated adipocyte mitochondria in an NADPH-containing reaction buffer
supplemented with cholesterol. Under these conditions, formation of radiolabeled 27HC from
[3H]cholesterol was observed after 3 h (Fig. 2.4B). CYP27A1 protein was also detected in both
3T3-L1 cells and mitochondrial lysates (Fig. 2.4C). Both Cyp27a1 mRNA and protein levels of
CYP27A1 were induced during 3T3-L1 adipocyte differentiation. When treated with
[3H]mevalonolactone (MVA, a cell permeable form of mevalonate, the direct precursor of
86
cholesterol), de novo formation of radiolabeled cholesterol was observed at a significant rate
after 24 h (Fig. 2.4D). Thus, cells treated with MVA for 24 h or longer were used in subsequent
experiments to generate a readily detectable amount of cholesterol metabolites. Incubation of
mature 3T3-L1 adipocytes for 48 h with [3H]MVA generated the metabolite 27HC, detected both
by HPLC-radiometric assay and TLC (Fig. 2.4E). These data suggest that oxysterol synthesis
might be dominant over the steroid biosynthesis pathway in cholesterol metabolism in adipocytes,
with 27HC being the major mitochondrial cholesterol product. The other peaks seen in the
HPLC-radiometric assays of cells incubated with [3H]cholesterol or [3H]MVA (Fig. 2.4, A and E)
suggest the existence of other oxysterols or cholesterol metabolites in adipocytes to be identified.
The 27HC formed de novo by 3T3-L1 adipocytes was further identified by GC-MS
analysis. The serum-free medium (AIM-V medium) used to incubate 3T3-L1 adipocyte cells in
27HC synthesis assays was used as a control and shown to contain no 27HC (Fig. 2.4F). A 27HC
standard (50 ng/ml) was used as a positive control (Fig. 2.4G). Extracts of cells incubated with
unlabeled MVA for 72 h contained material with a retention time identical to the reference 27HC
and had the expected selected ions at m/z of 75 and 129 (Fig. 2.4H). This material was not
detected in zero time reaction mixtures (Fig. 2.4I). These measurements corroborate HPLCradiometric assay and TLC data on the formation of 27HC from MVA in mature adipocytes.
2.4.4 De Novo Synthesis of 27HC in Rat or Human Primary Adipocytes
To determine whether the biosynthesis of 27HC in 3T3-L1 adipocytes is a cell-specific
event, we examined mature adipocytes that were differentiated in culture from isolated SVF from
Sprague-Dawley rat retroperitoneal adipose (RETRO) or epididymal adipose (EPI) tissues. The
differentiation stages of the SVF cells were defined by Oil Red O staining of lipid droplets (Fig.
87
2.5A). TSPO and CYP27A1 proteins were detected in SVF cells (D0) and differentiated
adipocytes (D10) from both sites (Fig. 2.5B). During SVF cell differentiation, TSPO expression
remained constant. CYP27A1 was seen mainly as a dimer in differentiated rat adipocytes, as
reported previously in retina (Lee et al., 2006). Radiolabeled 27HC was formed from [3H]MVA
in adipocytes differentiated from SVF cells derived from both RETRO and EPI depots (Fig. 2.5,
C and D).
The mitochondrial P450 system (CYP27A1, CYP11A1, FDX, and FDR) was also present
and elevated during the differentiation of SGBS human preadipocytes (Fig. 2.5F). The
differentiation stages of this cell line were defined by Oil Red O staining of lipid droplets (Fig.
2.5E). After incubating D10 adipocytes with [3H]MVA for 5 h (Fig. 2.5G) or 4 days (Fig. 2.5H),
27HC was detected.
In normal human subjects with body mass index between 24 and 27, expression levels of
CYP27A1 protein were enriched in both subcutaneous and omental newly differentiated
adipocytes, compared with their corresponding primary preadipocytes (Fig. 2.5, I and J). In
contrast to the newly differentiated adipocytes, CYP27A1 expression was further induced in
primary mature adipocytes isolated directly from human subcutaneous adipose tissue (Fig. 2.5I),
suggesting that our discovery of CYP27A1 metabolic pathway in newly differentiated adipocytes
could be extrapolated to mature adipocytes already present in the adipose tissue. Moreover,
differentiated omental adipocytes from a diabetic donor (body mass index = 42.4) exhibited a
higher CYP27A1 expression than those from normal subjects (Fig. 2.5J), indicating a potential
elevation of 27HC production in adipose tissues of obese patients. In terms of the enzyme
activity, a significant amount of 27HC was synthesized after incubating the newly differentiated
human omental adipocytes with [3H]MVA for 48 h (Fig. 2.5L). However, despite the similar
88
expression levels of CYP27A1 between the two depots, the activity of CYP27A1 in synthesizing
27HC was tremendously reduced in subcutaneous adipocytes (Fig. 2.5K), implying that omental
fat, often associated with central obesity, might have a more pronounced capacity in producing
27HC.
2.4.5 Accumulation of 27HC and Absence of Bile Acid Synthesis in Adipocytes
The cellular level of 27HC depends on the expression of both generating and
metabolizing enzymes. CYP27A1 is the sole enzyme metabolizing cholesterol to 27HC, whereas
oxysterol and steroid 7α-hydroxylase (CYP7B1) is the most important enzyme to metabolize
27HC in extrahepatic cells (Martin et al., 1997). During 3T3-L1 differentiation, the increased
CYP27A1 (Fig. 2.4C) and reduced CYP7B1 expression (Fig. 2.6A) suggest high production and
low elimination rates for 27HC in mature adipocytes. This would increase local concentrations of
27HC in adipocytes.
Oxysterols, such as 27HC, are obligatory intermediates for bile acid synthesis
(Crosignani et al., 2011). There are two bile acid formation pathways in mammalian cells. The
classical pathway starts with the 7α-hydroxylation of cholesterol by cholesterol 7α-hydroxylase
(CYP7A1), and the alternative pathway is initiated with the 27 hydroxylation of cholesterol by
CYP27A1 (Fig. 2.1A) (Thomas et al., 2008). During 3T3-L1 adipogenesis, the mRNA levels of
Cyp7a1 reached the highest point in D5 differentiating cells and fell when the cells were fully
differentiated (Fig. 2.6B), whereas Cyp27a1 mRNA levels gradually increased during
differentia-tion (Fig. 2.4C). Therefore, if mature adipocytes are able to synthesize bile acid, the
alternative pathway involving CYP27A1 might be favored over the classical pathway involving
CYP7A1.
89
Upon production in extrahepatic cells, 27HC is transported to the liver, where it serves as
an intermediate for bile acid synthesis (Javitt, 2002). Thus, the presence of the bile acid
biosynthesis pathway in adipocytes could also modulate local levels of 27HC. To test this
hypothesis, the conversion of [3H]cholesterol to 3H-labeled methanol/water-extractable products
over time was examined in D0, D5, and D10 3T3-L1 cells. HepG2 liver cells, known for their
high capacity to form bile acids, were used as a positive control. Bile acid synthesis rates steadily
increased in HepG2 cells up to 48 h, and no changes were observed in D0 preadipocytes or
differentiating D5 or mature D10 adipocytes (Fig. 2.6C). To determine whether this difference
between HepG2 and 3T3-L1 cells in bile acid synthesis is due to differences in cholesterol
uptake, the rate of cholesterol uptake was determined by measuring [3H]cholesterol
“disappearance” (chloroform phase) from the cell culture medium. Data shown in Fig. 2.6D
indicate that the cellular cholesterol uptake rates were similar in all cell types used. These data
exclude the possibility that adipocytes synthesize bile acids from cholesterol. This conclusion
was further supported by the absence of Tgr5 and Fxr mRNA, two major targets of bile acidmodulated effects (Thomas et al., 2008), in 3T3-L1 cells throughout differentiation (data not
shown). Therefore, 27HC could be accumulated in adipocytes as an end product rather than an
intermediate for bile acid synthesis.
2.4.6 Potential Role of CYP27A1 in Adipogenesis
To investigate the role of CYP27A1 in adipogenesis, we assessed the effects of
GI268267X (a specific inhibitor of CYP27A1) (Lyons and Brown, 2001) on 3T3-L1
differentiation. GI268267X-treated 3T3-L1 cells subjected to differentiation had higher mRNA
and protein levels of the differentiation marker fatty acid-binding protein (FABP4) (Fig. 2.7, A
and D) compared with untreated differentiated 3T3-L1 adipocytes. mRNA levels of other
90
differentiation markers such as CCAAT/enhancer-binding protein-α (Cebpa) and peroxisome
proliferator-activated receptor-γ (Pparg) were also induced in GI268267X-treated cells (Fig. 2.7,
B and C). Oil Red O staining of the cells treated with GI268267X revealed a dose-dependent
induction of lipid droplets (Fig. 2.7E).
To ascertain that the effects of GI268267X on adipogenesis were due to CYP27A1
inhibition, 3T3-L1 preadipocytes at 80% confluence were transfected with Cyp27a1 siRNA,
before the initiation of differentiation. Two days after transfection, CYP27A1 protein levels in
preadipocytes (D0) were significantly knocked down by 50% (Fig. 2.7F). CYP27A1-deficient
cells seemed to have a higher rate of differentiation compared with mock-transfected controls as
assessed by the increased mRNA expression of adipogenesis markers Fabp4, Cebpa, and Pparg
(Fig. 2.7, G–I) in differentiated adipocytes. Thus, CYP27A1 likely acts as a negative regulator of
adipogenesis.
Considering the finding that 27HC is the major product synthesized by CYP27A1 in
adipocytes, we hypothesized that 27HC might inhibit adipogenesis. Supplementation of the
differentiation mixture with 27HC moderately decreased the differentiation of 3T3-L1 cells, as
measured by mRNA and/or protein expression of the differentiation markers FABP4 (Fig. 2.7, J
and L) and C/EBPα (Fig. 2.7K), as well as indicated by the amount of Oil Red O staining in lipid
droplets (Fig. 2.7M) on day 10 after addition of the differentiation media. Taken together, these
data suggest that the local 27HC biosynthesis pathway in adipocytes might act as a protective
mechanism by limiting the potential of adipocyte differentiation.
2.4.7 Potential Local Effects of CYP27A1 Metabolic Pathway in Adipose Tissues
91
To further analyze the impact of the 27HC biosynthetic pathway in adipose tissue
function, we isolated and characterized the properties of adipose tissues from 10-week-old
Cyp27a1 knock-out mice. There was no significant difference in body weights (Fig. 2.8A), total
white adipose tissue composition (Fig. 2.8B), or the weights of various fat depots (Fig. 2.8C)
between male Cyp27a1-/- mice and the wild-type controls. However, as determined by the
induced gene expression levels of the differentiation marker Fabp4 in differentiated adipocytes,
there was a marked elevation in the adipocyte differentiation potential of SVF cells isolated from
Cyp27a1-/- mouse adipose depots, including retroperitoneal (Fig. 2.8D) and epididymal adipose
tissues (Fig. 2.8E) compared with those obtained from wild-type mice. These data are consistent
with our previous findings in CYP27A1-deficient 3T3-L1 cell line studies. Cyp27a1-/- mice at a
relatively young age (10 weeks) might not have developed obesity, but the absence of the
CYP27A1 pathway may be associated with the accelerated ability of adipose tissue to recruit
newly committed preadipocytes and to promote their subsequent differentiation, which might
make the mice prone to obesity when given a high fat diet.
92
2.5 Discussion
Investigation of cholesterol transport and metabolism machinery responsible for steroid
and oxysterol synthesis in adipocytes is an essential step in understanding how locally produced
steroids or oxysterols mediate adipocyte function and other metabolic parameters.
A steroidogenic cell is defined by its ability to convert endogenous cholesterol to
pregnenolone (Miller and Auchus, 2011). “Classical” steroidogenic tissues include gonads and
adrenal glands, in which the biosynthesis of steroids is regulated by the action of trophic
hormones, and placenta, a hormone-independent steroidogenic tissue. Several other tissues, such
as brain (Mellon and Griffin, 2002; Baulieu et al., 2001), heart (Kayes-Wandover and White,
2000), and skin (Thiboutot et al., 2003), also express CYP11A1 and therefore can be considered
steroidogenic. Although the absolute amount of steroids synthesized in these “nonclassical”
tissues is small, local steroid concentrations achieved within tissues could be high enough to
exert significant biological influence in an intracrine, autocrine, or paracrine manner. For
instance, locally produced progesterone and estradiol in the brain are neuroprotective
(Schumacher et al., 2004; Azcoitia et al., 2005); disturbance of local glucocorticoid biosynthesis
in the skin affects the functions of epidermis and adnexal structures, leading to inflammatory
disorders (Slominski et al., 2013). Adipose tissue is one of the largest steroid reservoirs and sites
of steroid metabolism. Modulation of active steroid levels in adipose tissue through steroidconverting enzymes regulates adipocyte functions at the local level (Belanger et al., 2002). It has
been widely recognized that the increased local regeneration of cortisol from circulating inert
cortisone, through the increased activity of 11β-HSD1 in adipose tissues of obese individuals,
amplifies fat cell differentiation and accounts for the metabolic complications of obesity
(Masuzaki et al., 2001). Most recently, adipocyte-derived aldosterone is found to induce
93
adipocyte differentiation in an autocrine manner and contributes to vascular dysfunctions in
obesity (Briones et al., 2012). Despite the association between abnormal adipocyte functions and
local steroid levels, adipocytes have not been regarded as steroidogenic cells. MacKenzie et al.
(MacKenzie et al., 2008) were the first to detect the transcription of STAR, CYP11A1, HSD3B2,
CYP21B, and HSD17B7 in both human omental and subcutaneous adipose tissues by qRT-PCR.
However, no protein expression, localization, or activity studies about STAR and CYP11A1 in
adipocytes have ever been reported. In this study, we demonstrated for the first time that the
mitochondrial cholesterol transport machinery and CYP11A1 enzyme system is present and
active in adipocyte cells. This finding substantially broadens our knowledge of the steroidogenic
capacities of adipocytes.
SF-1 (NR5A1) and DAX-1 are positive and negative transcriptional regulators of genes
involved in steroidogenesis, including Star, Cyp11a1, and Cyp17a1 (Jameson, 2004; Lalli and
Sassone-Corsi, 2003), and are therefore important indicators of steroidogenic capacity. Our study
confirmed the gene expression and induction of Sf1 (Nr5a1) during 3T3-L1 adipocyte
differentiation. This may be responsible for the increased levels of Star, Cyp11a1, and Cyp17a1
mRNAs during adipogenesis. Although we did not detect gene expression of Dax1, it has been
reported that Dax1 levels are significantly lower in differentiated 3T3-L1 cells compared with
preadipocytes (Kim et al., 2008). These authors suggested that DAX-1 acted as a co-repressor of
peroxisome proliferator-activated receptor-γ (Pparg) gene and was involved in regulating
peroxisome proliferator-activated receptor γ-mediated adipogenesis. Although additional
experiments are needed to determine whether SF-1 or DAX-1 can also regulate the transcription
of genes involved in adipocyte steroidogenesis, the elevated levels of Sf1 and the reduced levels
of Dax1 suggest that mature 3T3-L1 adipocytes possess enhanced steroidogenic capacity.
94
The rate-determining step of all steroid hormone biosynthesis is transport of cholesterol
from the outer to the inner mitochondrial membrane, where CYP11A1 is located. This process is
regulated mainly by TSPO and STAR (Papadopoulos et al., 2007). Although mitochondrial
TSPO expression in adipocytes was confirmed in this study, STAR protein was not seen in the
various stages of 3T3-L1 cells during differentiation by immunoblotting, probably due to an
inability of the method to detect STAR protein when the overall level of STAR is relatively low.
In human omental adipose tissues, the mRNA level of STAR is only 0.6% of that in the adrenal
gland (MacKenzie et al., 2008). There might also be a possibility that adipocyte steroidogenesis
is STAR-independent. In tissues that lack STAR but express the CYP11A1 enzyme system, such
as placenta and brain, conversion of cholesterol to pregnenolone occurs at approximate 14% of
the STAR-induced rate (Miller and Auchus, 2011). The cholesterol content in adipocyte
mitochondria may be at near saturating concentrations, like that in placenta (Tuckey, 1992). The
electron supply by the P450 redox partners, rather than cholesterol transport, may limit the rate
of cholesterol metabolism in mitochondria. Oxysterols accumulated inside adipocytes could also
serve as the direct substrate for the CYP11A1 enzyme system, bypassing the action of STAR.
We next focused on the presence and activity of the first enzyme in the pathway,
CYP11A1, which metabolizes cholesterol to pregnenolone, the precursor of all of the other
steroids, an event that defines a cell as steroidogenic. Our results clearly indicate the presence of
CYP11A1 in adipocyte mitochondria and its ability to synthesize pregnenolone. However, the
limited rate of formation of pregnenolone indicated that this steroid might be quickly used up for
the synthesis of downstream steroids, because both pregnenolone-metabolizing enzymes 3β-HSD
and CYP17A1 are present. The fact that blocking the pregnenolone metabolism by trilostane or
SU10603, enzyme inhibitors for 3β-HSD and CYP17A1, respectively, failed to increase the rate
95
of pregnenolone formation (data not shown) suggests that CYP11A1 does not play a major
metabolic role in adipocyte cholesterol consumption. Besides cholesterol, vitamins D2 and D3
and their precursors can also serve as substrates for CYP11A1 either in a reconstituted system or
isolated adrenal mitochondria (Nguyen et al., 2009; Guryev et al., 2003; Slominski et al., 2005).
These CYP11A1-derived hydroxyvitamin D products have essential biological activities on skin
cells, such as inhibition of proliferation and induction of differentiation in keratinocytes (Tuckey
et al., 2011). Because vitamin D deficiency is often linked to abnormal metabolic status of
adipose tissue (Vimaleswaran et al., 2013), the possible involvement of adipocyte CYP11A1 in
metabolizing vitamin D and its subsequent impact on adipocyte development and functions are
worth studying in the future.
All mitochondrial P450s receive electrons from NADPH via the same redox chain
consisting of FDX and FNR; a similar ferredoxin-binding site is conserved among all
mitochondrial P450s (Wada and Waterman, 1992). Identification of another mitochondrial P450
enzyme in adipocytes, CYP27A1, raised the possibility that CYP11A1 and CYP27A1 might
compete for the common redox partner FDX to perform the hydroxylation reaction. CYP27A1
binds significantly tighter (~ 30-fold) to FDX than CYP11A1, due to an additional electrostatic
interaction between CYP27A1 and ferredoxin (Pikuleva et al., 1999). Differences in binding
affinity for FDX between CYP27A1 and CYP11A1 may explain why the major mitochondrial
enzyme metabolism of cholesterol in adipocytes involves 27-hydroxylation rather than
conversion to pregnenolone.
CYP27A1 is a ubiquitous enzyme involved in bile acid synthesis by catalyzing multiple
oxidation reactions at the C27 atom of steroids in the classical (hepatic) pathway (Bjorkhem,
1992) and cholesterol in the alternative (peripheral) pathway (Javitt, 2002). The classical
96
pathway begins with CYP7A1 and is considered the quantitatively most important pathway in
bile acid synthesis. However, there is evidence that human CYP7A1 deficiency causes a
doubling of CYP27A1 activity and up-regulation of the alternative pathway (Pullinger et al.,
2002). During 3T3-L1 differentiation, we observed that Cyp7a1 mRNA levels were lower in
mature adipocytes, when Cyp27a1 levels peaked. Thus, there might be a compensatory increase
in 27-hydroxylation of cholesterol by CYP27A1 in mature adipocytes that accounts for the
predominance of the alternative pathway. To yield bile acids via the alternative pathway, 27HC
must be hydroxylated by CYP7B1, and the resulting 7α-hydroxylated products are further
metabolized to bile acids (Fig. 2.1A) (Martin et al., 1997). Human CYP7B1 deficiency impairs
the hydroxylation of 27HC, thus leading to elevated levels of circulating 27HC (Schule et al.,
2010). In our study, the decrease of Cyp7b1 gene expression during 3T3-L1 adipogenesis may
explain the accumulation of 27HC and absence of bile acids in mature adipocytes.
The formation of 27HC by differentiated 3T3-L1 adipocytes was assessed in metabolic
labeling studies using either cholesterol or its precursor, MVA. The steroid formed was
identified by HPLC and TLC, and its identity was further confirmed by GC-MS. These results
are not limited to 3T3-L1 cells. Adipocytes differentiated in culture from stromal vascular cells
of rat retroperitoneal and epididymal adipose tissues, human SGBS cells, and human primary
preadipocytes were all able to produce 27HC. Noteworthy, a depot-specific difference in 27HC
generation was observed in our study, with human omental adipocytes producing significantly
higher amounts of 27HC than subcutaneous adipocytes. This result is consistent with previous
findings that gene expression of CYP27A1 is more pronounced in omental than subcutaneous fat
in both lean and obese women (Wamberg et al., 2013). Compared with subcutaneous adipose
tissue, omental fat, often referred as “central fat,” is more metabolically active and closely
97
involved in the co-morbidities associated with obesity (Wajchenberg, 2000). Thus, disruption of
27HC production in omental fat may offer a causative link between central obesity and metabolic
parameters.
The local concentration of 27HC achieved by de novo adipocyte synthesis may be
notable and most likely play a local regulatory role in adipocyte development. In adult human
white adipose tissues, new adipocytes constantly arise from a pre-existing population of
undifferentiated pre-fat cells and replace the lost adipocytes, in a turnover rate of 10% annually
(Spalding et al., 2008). Thus, adipogenesis is probably responsible for the increase of fat cell
number upon overfeeding and may have a key role in the pathology of obesity. Several studies
have noted the possible role of oxysterols in anti-adipogenic differentiation. For example, the
oxysterols 20(S) - or 22(S)-hydroxycholesterol regulate lineage-specific differentiation of
mesenchymal stem cells in favor of osteoblastic differentiation and against adipogenic
differentiation (Kha et al., 2004). Our data also demonstrate CYP27A1 as a negative regulator of
adipogenesis. The presence of CYP27A1 able to synthesize 27HC in adipocytes might represent
an adaptive mechanism for removal of excess cholesterol from adipose tissue, thus controlling
the number of fat cells in the adipose compartment upon aging or overnutrition. It is evident that
absence of the regulator oxysterol 27HC in patients with CYP27A1 deficiency (cerebrotendinous
xanthomatosis) is associated with accumulation of lipids and accelerated tendency to develop
atherosclerosis (Dubrac et al., 2005). Administration of 27HC to hyperlipidemic mice, followed
by high fat diet, could reduce hepatic inflammation in nonalcoholic fatty liver disease (Bieghs et
al., 2013). Both nonalcoholic fatty liver disease and atherosclerosis are major disorders of lipid
metabolism, often related to obesity or abnormal distribution of body fat (Pagadala and
McCullough, 2012; Alberti et al., 2009). Thus, the existence of de novo 27HC synthesis in
98
adipocytes might provide a new understanding of the connection between adipocyte function and
lipid related disorders.
The mechanism of 27HC action in adipocytes has not yet been established. Many effects
of oxysterols in adipocytes are mediated by the nuclear liver X receptor (LXRα and β) (Lehmann
et al., 1997). Multiple in vitro and in vivo studies in adipose cells have demonstrated that
endogenously expressed LXRs can be activated by oxysterols (Juvet et al., 2003). However, the
role of LXR in regulating adipogenesis is still open to debate. Different studies have reported
induction (Seo et al., 2004), no effect (Hummasti et al., 2004), or even reduction of adipogenesis
(Ross et al., 2002) by LXR ligands. The discrepancies between these studies could be due to the
different degrees of differentiation of the cells used by the different groups. Nevertheless, LXR is
not indispensable and might only act as a modulator for adipogenesis. This suggests that, in
addition to LXR signaling, other adipogenic mediators may contribute to the inhibition of
adipogenesis by 27HC observed in our study. Indeed, the previously reported anti-adipogenic
activity of the oxysterol 20(S)-hydroxycholesterol is mediated predominantly through hedgehog
signaling, despite the activation of LXRs at the same time, and is associated with inhibition of
peroxisome proliferator activated receptor γ levels (Kim et al., 2007). Another mechanism for
27HC action in adipocytes may involve interaction with ERs. As the first identified endogenous
selective estrogen receptor modulator, 27HC has multiple functions in ER-positive tissues,
through either activation or antagonism of ER (Umetani and Shaul, 2011). Human adipocytes
express both functional ERα and ERβ (Dieudonne et al., 2004), indicating that 27HC action may
occur through either of these ERs in adipocytes.
In conclusion, this study provides the first evidence that adipocytes have the potential to
synthesize steroids and/or oxysterols de novo from cholesterol and its precursors. The presence
99
and activity of adipocyte mitochondrial cholesterol transport and metabolism machinery
involved in the initial steps of steroid or oxysterol synthesis have been confirmed in our study.
We propose that CYP11A1 activity in adipocytes is diminished due to competition from
CYP27A1 for the same substrate and redox partners, which leads to the release of 27HC as the
major mitochondrial cholesterol metabolite rather than pregnenolone. However, given the large
inter-individual variations in adipocyte metabolic pathways, the final product of de novo
synthesis could vary. The finding that local inhibition of CYP27A1 induced adipogenesis
suggests that the presence of de novo adipocyte oxysterol synthesis might represent a defense
mechanism for adipocytes to protect against intracellular cholesterol overloading and formation
of new fat cells.
2.6 Acknowledgments
We thank M. Vindigni for expert technical assistance with the mass spectrometry studies
and Drs. J. Fan, A. Midzak, and A. Batarseh for helpful discussions. We are grateful to GlaxoSmithKline for providing us the CYP27A1 inhibitor GI268267X. We also thank Drs. M. Ascoli
(University of Iowa) for the MA-10 cells and D. B. Hales (Southern Illinois University) for the
anti-STAR antiserum. The Research Institute of McGill University Health Centre is supported in
part by a center grant from Fonds de Recherche du Quebec-Santé.
100
101
Figure 2.1 De novo synthesis of steroids, oxysterols, and bile acids from cholesterol
(A) Various specialized tissues can use cholesterol as the building block for the synthesis of
steroid hormones, oxysterols, or bile acids. Cholesterol endogenously synthesized through the
mevalonate pathway is transported by TSPO and STAR into the inner mitochondrial membrane,
where it can be converted to the steroid pregnenolone or the oxysterol 27HC by CYP11A1 or
CYP27A1, respectively. Pregnenolone is the precursor of all of the other steroids (e.g.
aldosterone and cortisol in adrenal glands or sex steroids in gonads). The oxysterol 27HC serves
as an intermediate for bile acid synthesis in hepatic cells. (B) Oil Red O staining of lipid droplets
in 3T3-L1 cells during differentiation (magnification, 40 x).
102
103
Figure 2.2 Steroidogenic pathway is present in 3T3-L1 adipocytes
(A–F) qPCR and immunoblot analysis of TSPO (A), ACBD1 (B), STAR (C), CYP11A1 (D),
FDX (E), and FNR (F). C: control cells maintained in growth medium; D: Cells exposed to the
differentiation medium. (G–O) qPCR analysis of Cyp17a1 (G), Hsd3b1 (H), Cyp21 (I), Cyp11b1
(J), Cyp11b2 (K), Hsd11b1 (L), Cyp19a1 (M), Hsd17b7 (N), and Nr5a1 (O). qPCR results are
expressed as means ± S.E. (n = 3) and presented as fold increase compared with the value on day
0 (*, p<0.05; **, p<0.01; ***, p<0.001). Immunoblot results shown are representative of three
independent experiments.
104
Figure 2.3 CYP11A1 is active in adipocytes
(A) RIA of pregnenolone levels formed from 22RHC in isolated mitochondria of mature 3T3-L1
adipocytes. Results shown are means ± S.E. (n=3); *p<0.05. (B) HPLC-radiometric assay of
[3H]pregnenolone formation from [3H]22RHC in mature 3T3-L1 adipocyte cells after 48 h. The
results shown are representative of 3 separate experiments. (C) Conversion rate of [3H]22RHC
into [3H]pregnenolone in 3T3-L1 adipocytes, measured by HPLC-radiometric assay. Results
shown are means ± S.E. (n=3); *p<0.05.
105
106
Figure 2.4 3T3-L1 adipocytes can synthesize 27HC de novo
(A) HPLC-radiometric assay and TLC analysis of [3H]27HC formation from [3H]cholesterol in
3T3-L1 adipocytes after 48 h. (B) HPLC-radiometric assay of [3H]27HC formation from
[3H]cholesterol in mitochondria isolated from 3T3-L1 adipocytes after 3 h. (C) RT-PCR and
immunoblot analysis of CYP27A1 during 3T3-L1 differentiation. Results shown are means ±
S.E. (n=3); **p<0.01. (D) De novo cholesterol synthesis rate from MVA in 3T3-L1 adipocytes,
measured by HPLC-radiometric assay. Results shown are means ± S.E. (n=3); ***p<0.001. (E)
HPLC-radiometric assay and TLC analysis of [3H]27HC formation from [3H]MVA in 3T3-L1
adipocytes after 48 h. All results from HPLC-radiometric and TLC assays are representative of at
least 3 independent experiments. (F) SIM chromatogram of the extracts from the serum-free
medium (AIM-V medium) used to incubate 3T3-L1 adipocytes during the de novo 27HC
synthesis assay; TIC, total ion current. (G) SIM chromatogram of the reference standard 27HC
(50 ng/ml) dissolved and extracted from the AIM-V medium. RT, retention time. (H) SIM
chromatogram of the extracts from 3T3-L1 adipocytes incubated with unlabelled MVA in AIMV medium for 72 h. (I) SIM chromatogram of the extracts from the zero-time control of 3T3-L1
adipocytes incubated in AIM-V medium.
107
108
Figure 2.5 Adipocytes differentiated from rat SVF, human SGBS preadipocytes and
human primary preadipocytes can synthesize 27HC de novo
(A) Oil Red O staining of lipid droplets in rat RETRO and EPI SVF during differentiation
(Magnification: 20×). (B) Immunoblot analysis of TSPO and CYP27A1 during differentiation of
rat primary SVF. (C) HPLC-radiometric assay of [3H]27HC formation from [3H]MVA in
adipocytes differentiated from rat retroperitoneal adipose tissues (RETRO) SVF after 48 h. (D)
HPLC-radiometric assay of [3H]27HC formation from [3H]MVA in adipocytes differentiated
from rat epididymal adipose tissue (EPI) SVF after 48 h. (E) Oil Red O staining of lipid droplets
in human SGBS cells during differentiation. (Magnification: 20×). (F) Immunoblot analysis of
CYP27A1, CYP11A1, FDX, and FNR during differentiation of human SGBS preadipocytes. (G)
TLC analysis of [3H]27HC formation from [3H]MVA in human SGBS adipocytes after 5 h. (H)
HPLC-radiometric assay of [3H]27HC formation from [3H]MVA in human SGBS adipocytes
after 4 d. The data presented are representative of 3 independent experiments. (I) Immunoblot
analysis of CYP27A1 in primary preadipocytes, differentiated adipocytes and mature adipocytes
from human subcutaneous adipose tissue of healthy subjects. (J) Immunoblot analysis of
CYP27A1 in primary preadipocytes and differentiated adipocytes from human omental adipose
tissue of healthy subjects, or differentiated omental adipocytes from diabetic donors. (K-L)
HPLC-radiometric analysis of [3H]27HC formation from [3H]MVA in human differentiated
subcutaneous adipocytes (K) and omental adipocytes (L) after 48 h.
109
Figure 2.6 Adipocytes do not synthesize bile acids
(A and B) qPCR analysis of Cyp7b1 (A) and Cyp7a1 (B) during 3T3-L1 differentiation. Results
shown are means ± S.E. (n=3); *p<0.05,**p<0.01. (C and D) Bile acid synthesis rates quantified
as conversion of [3H]cholesterol to methanol/water-extractable products (C), and cholesterol
uptake quantified as a function of change in [3H]cholesterol in the medium (D). Results shown
are the mean values of a single experiment performed in duplicate. Experiments were repeated 3
times, yielding the same conclusion. HepG2 cells were used as the positive control.
110
111
Figure 2.7 CYP27A1 is a negative regulator of adipocyte differentiation
(A-C) qPCR analysis of the differentiation markers Fabp4 (A), Cebpa (B) and Pparg (C) in
GI268267X-treated 3T3-L1 cells subjected to differentiation. Results shown are means ± S.E.
(n=3); ***p<0.001. (D) Immunoblot analysis of the differentiation marker FABP4 in
GI268267X-treated 3T3-L1 cells subjected to differentiation. Immunoblot results shown are
representative of 3 independent experiments. Protein quantification results are shown as means ±
S.E. (n=3); *p<0.05,***p<0.001. (E) Oil Red O staining of lipid droplets in GI268267X-treated
3T3-L1 cells subjected to differentiation. Images are representative of 3 independent experiments.
(Magnification: 10×). DMSO at the concentration of 0.1% v/v was used as the vehicle treatment
in the above experiments. (F) Immunoblot analysis of CYP27A1 in 3T3-L1 preadipocytes after
48 h siRNA transfection. (G-I) qPCR analysis of the differentiation markers Fabp4 (G), Cebpa
(H) and Pparg (I) in mock-transfected or siRNA-transfected 3T3-L1 cells subjected to
differentiation. (J-K) RT-PCR analysis of the differentiation markers Fabp4 (J) and Cebpa (K) in
27HC-treated 3T3-L1 cells subjected to differentiation. Results shown are means ± S.E. (n=3);
***p<0.001. (L) Immunoblot analysis of the differentiation marker FABP4 in 27HC-treated
3T3-L1 cells subjected to differentiation. (M) Oil Red O staining of lipid droplets in 27HCtreated 3T3-L1 cells subjected to differentiation. Images are representative of 3 independent
experiments. (Magnification: 20×). Methanol at the concentration of 0.05% v/v was used as the
vehicle control in 27HC-treated experiments.
112
Figure 2.8 SVFs isolated from Cyp27a1-/- mice have higher adipogenic potential than wild
type controls
(A) Body weight of 10-week old male Cyp27a1-/- vs. wild-type mice. (B) Percentage of total
white fat mass normalized to the body weight. (C) Weights of individual fat depots.
MES=Mesenteric adipose tissue; ING=Inguinal adipose tissue; BAT=Brown adipose tissue. Two
equal depots from one animal were combined for EPI, RETRO, ING and BAT. All results shown
above are means ± S.E. (n=3). (D-E) qPCR analysis of the differentiation marker Fabp4 in 10day post-differentiated RETRO adipocytes (D) and EPI adipocytes (E) compared to
undifferentiated SVFs.
113
Connecting text between Chapter 2 and 3
In Chapter 2, we demonstrated the ability of adipocytes to synthesize steroids and the
oxysterol 27HC de novo. The 27HC biosynthetic pathway is a local protective mechanism that
maintains a normal rate of preadipocyte differentiation. However, the adipocytes are major
components of adipose tissue. The functional significance of 27HC in mature adipocytes may
reflect the influence of 27HC in adipose tissue more accurately. Thus, in Chapter 3, we used
3T3-L1 differentiated adipocytes to investigate the impact of 27HC on the metabolic activities of
fully differentiated adipocytes, including lipid accumulation, glucose metabolism, and adipokine
secretion. To explore the functionality of the 27HC biosynthetic pathway in mature adipocytes,
we treated the differentiated adipocytes with a CYP27A1-specific inhibitor and observed
compensatory increases in the local production of other cholesterol metabolites, which may be
responsible for the elevated secretion of proinflammatory cytokine. Taken together, 27HC may
serve as an intracrine signal in adipocytes to maintain the metabolic status of adipocytes.
114
Chapter 3
27-hydroxycholesterol is a regulatory oxysterol in adipocytes
Jiehan Li1,2 and Vassilios Papadopoulos1,2,3,4,*
1
2
Research Institute of the McGill University Health Centre and the Departments of
Pharmacology and Therapeutics, 3Medicine, and 4Biochemistry, McGill University, Montreal,
Canada
*
Correspondence: Dr. V. Papadopoulos, Research Institute of the McGill University Health
Centre, Montreal General Hospital, 1650 Cedar Avenue, Room C10-148, Montréal, Québec H3G
1A4, Canada; phone: 514-934-1934 ext. 44580; fax: 514-934-8439; e-mail:
[email protected]
115
3.1 Abstract
Obesity is often partnered with high serum levels of cholesterol and 27hydroxycholesterol (27HC). 27HC has recently been established as a mechanistic link between
hypercholesterolemia and cancer risk, as it can promote breast cancer growth and spread in an
estrogen receptor (ER) - and liver X receptor (LXR) - dependent manner. Adipocytes are both
ER- and LXR-responsive and enlarged or dysfunctional adipocytes in obesity are associated with
intracellular cholesterol imbalance. We recently reported the ability of adipocytes to express
CYP27A1 and to synthesize 27HC from cholesterol; CYP27A1 expression was induced in
hypertrophic adipocytes from obese patients. Thus, a study about the direct effect of 27HC on
adipocytes may link the altered circulating 27HC levels and adipocyte function together. Using
fully differentiated 3T3-L1 adipocytes, we report an intriguing role of 27HC in regulating
adipocyte cell homeostasis. Treatment of differentiated adipocytes with 27HC reduced
triglyceride accumulation, increased basal lipolysis, upregulated the expression of cholesterol
reverse transporter ABCG1, and induced insulin-stimulated glucose uptake in adipocytes.
Moreover, blocking the 27HC biosynthetic pathway resulted in the increased production of 4βHC and 7α-HC, which promoted interleukin-6 production and lipogenesis, respectively. These
results suggest that the presence of the CYP27A1 pathway in adipocytes may serve as a
maintenance mechanism to control the local production of pro-inflammatory and lipogenic
oxysterols. Thus, it is likely that 27HC is an intracrine regulator of adipocyte metabolism and
abnormal accumulation of intracellular 27HC may lead to adipocyte malfunction.
Keywords
27-hydroxycholesterol; oxysterols; CYP27A1; CYP7A1; mature adipocyte function; LXR;
obesity
116
3.2 Introduction
27-hydroxycholesterol (27HC) is the most abundant oxysterol in human circulation
(Bjorkhem et al., 2002), and its plasma concentration correlates tightly with that of cholesterol
(Harik-Khan and Holmes, 1990). An elevated level of 27HC was detected in
hypercholesterolemia (Babiker et al., 2005; Brown and Jessup, 1999), which is an established
comorbidity associated with obesity (Miettinen, 1971). As expected, an elevated level of 27HC
has also been found in obesity (Crosignani et al., 2011). In addition, clinical data have shown
decreased serum 27HC concentrations in Grade 3 obese subjects 6 months after weight loss
surgery, along with reduced serum cholesterol levels (Benetti et al., 2013). Obesity is defined by
the expansion or abnormal distribution of adipose tissues. Interestingly, recent studies have
detected the increased local concentration of 27HC in adipose tissues of high-fat diet-induced
obese mice (Wooten et al., 2014), coinciding with elevated serum 27HC (Wu et al., 2013). It is
of particular significance, therefore, that we recently demonstrated the ability of adipocytes to
synthesize 27HC de novo (Li et al., 2014a). The local production and action of 27HC in
adipocytes may serve as a new regulatory mechanism in adipocytes.
The functional impact of 27HC on adipocytes has not been examined. However, a broad
spectrum of physiological functions of 27HC on other cell or tissue types has been reported and
can be split into one of two camps. On the one hand, 27HC plays an appreciated role in the
elimination of excess cholesterol from various cells, particularly macrophages (Fu et al., 2001),
thus protecting against atherosclerosis (Weingartner et al., 2010; Bertolotti et al., 2012;
Zurkinden et al., 2014), hyperlipidemia (Hall et al., 2005), and steatohepatitis (Bieghs et al.,
2013). On the other hand, 27HC functions through estrogen receptors (ER) and liver X receptors
(LXR) to induce bone resorption (Nelson et al., 2011), and most notably, to promote breast
117
cancer growth and metastasis, thus providing a link between hypercholesterolemia and cancer
risk (Nelson et al., 2013; Wu et al., 2013). These data suggest that 27HC could confer both
benefits and risks, depending on the cell/tissue type, the origin of 27HC (local or circulating),
and the disease states of the experimental models. Indeed, adipose tissue is sitting at the
crossroads of lipid homeostasis, atherosclerosis (Rajala and Scherer, 2003), and cancer (Rosen
and Spiegelman, 2014), and adipose tissue is known to be both LXR- (Laurencikiene and Ryden,
2012) and ER-positive (Barros and Gustafsson, 2011). Therefore, the biological effects of 27HC
on adipocyte function may finally connect the diverse roles of 27HC into an integrated network.
Our previous study showed that the 27HC biosynthetic pathway in adipose tissues
inhibited the differentiation of preadipocytes into mature adipocytes (Li et al., 2014a). However,
the majority of the adipose compartment comprises mature adipocytes (Fruhbeck, 2008), and
only 10% of adipocytes are renewed every year by ongoing adipogenesis (Arner et al., 2010).
Thus, the direct effects of 27HC on mature adipocyte function may be a greater indicator of
27HC action in adipose tissues. In the current study, we used the fully differentiated 3T3-L1
adipocytes, which recapitulate critical metabolic and endocrine functions of adipocytes in vivo
(Gregoire, 2001), to study the regulatory roles of 27HC. We propose that 27HC regulates
adipocyte function and the presence of local 27HC biosynthetic pathway in adipocytes is
essential to maintain the normal function of adipocytes.
118
3.3 Materials and Methods
3.3.1 Materials
27HC, 7α-hydroxycholesterol (7α-HC), 4β-hydroxycholesterol (4β-HC), and 3βhydroxy-5-cholestenoic acid (27-COOH) were purchased from Santa Cruz Biotechnology Inc.
(Dallas, TX, USA); isoproterenol (ISO), LXR agonist T0901317, LXR antagonist geranylgeranyl
pyrophosphate (GGPP) ammonium salt, 2-deoxy-D-glucose, cyclosporin A (CsA), (±)mevalonolactone (MVA), cholesterol, 17β-estradiol (E2), dexamethasone, 3-isobutyl-1methylxanthine (IBMX), and insulin were obtained from Sigma-Aldrich Co. (St. Louis, MO,
USA); ER antagonist ICI 182,780 was from Tocris Bioscience (Bristol, UK); 2-[1,2-3H (N)]deoxy-D-glucose (specific activity: 5-10Ci[185-370GBq]/mmol) and RS-[5-3H]-MVA (specific
activity : 20-40Ci [740-1480GBq]/mmol) were purchased from PerkinElmer Inc. (Waltham, MA,
USA); and CYP27A1-specific inhibitor GI268267X was a general gift from GlaxoSmithKline
plc (London, UK). All organic solvents were from Thermo Fisher Scientific (Waltham, MA,
USA). Mouse 3T3-L1 preadipocytes were purchased from the American Type Culture Collection
(ATCC; Manassas, VA, USA).
3.3.2 Cell culture, differentiation, and treatments
3T3-L1 preadipocytes were cultured and differentiated for 10 days, as previously
described (Li et al., 2014a). On day 10, differentiated adipocytes were washed three times with
phosphate buffered saline (PBS) and treated with various compounds. Cell culture media were
collected and used for enzyme-linked immunosorbent assay (ELISA) or glycerol release analysis,
while cell pellets were washed and collected for RNA extraction, triglyceride (TG) quantification,
or protein measurement. 27HC and 4β-HC were dissolved in methanol, while 7α-HC was
dissolved in ethanol.
119
3.3.3 Oil Red O staining
Differentiated 3T3-L1 adipocytes (day 10) with or without treatments were stained by Oil
Red O and visualized by inverted microscope (Olympus Corporation, Tokyo, Japan), as
previously described (Li et al., 2014a).
3.3.4 Triglyceride accumulation
TGs were measured using a TG quantification kit (Abcam plc, Cambridge, UK)
following the manufacturer’s instruction for a colorimetric assay. Briefly, cell pellets of
differentiated 3T3-L1 adipocytes after treatments were homogenized in 1 mL of 5% Triton-X100
and heated at 90°C for 5 min. After centrifugation, the supernatant was collected and diluted in
various amounts of water in order to make the sample concentrations fall into the range of the
standard curve. Absorbance at 595 nm was measured by a VICTORTM X5 multilabel Plate
Reader (PerkinElmer Inc.).
3.3.5 Lipolysis assay
Glycerol release into the culture medium was used as an index of lipolysis and measured
as previously described (Stenson et al., 2011). Under the basal condition, glycerol was measured
in the culture medium of differentiated 3T3-L1 adipocytes after 48 h of treatment using an
adipocyte lipolysis assay kit for 3T3-L1 cells (#LIP-1-NCL1; ZenBio, Research Triangle Park,
NC, USA). In experiments with the lipolytic stimuli ISO, 3T3-L1 adipocytes were pretreated
with 27HC or vehicle for 48 h and then incubated in Aim-V serum-free medium (SFM) for 3 h in
the presence of ISO. Readings were done at a wavelength of 540 nm. Glycerol release into the
culture medium was normalized to the protein concentration quantified from the cell pellets in
each experiment group.
120
3.3.6 Reverse transcription and real-time quantitative PCR
Total RNAs were extracted via the RNeasy mini kit (Qiagen NV, Venlo, the Netherlands)
following the manufacturer’s instruction. cDNA were synthesized using TaqMan reversetranscription reagents kit (Applied Biosystems; Thermo Fisher Scientific). Real-time polymerase
chain reaction (PCR) was performed on a Light Cycler System 480 (Hoffman-La Roche Ltd.,
Basel, Switzerland) using SYBR Green PCR Master Mix (Hoffman-La Roche Ltd.). All data
were normalized to the content of ribosomal protein S18 (Rps18). Primer sequences are listed in
Table 3.1.
3.3.7 Glucose uptake
Glucose uptake in the adipocytes was measured as previously described (Lakshmanan et
al., 2003a). After treatment for 48 h, 3T3-L1 adipocytes in six-well plates were serum-starved for
2 h in DMEM containing 0.5% bovine serum albumin (BSA) and then incubated with Krebs–
Ringer bicarbonate buffer supplemented with 20 mM HEPES, pH 7.4 (KRBH) for 15 min, at
which point insulin (100 nM) or PBS was added to the cells for 15 min. The assay was initiated
by the addition of [3H]-2-deoxyglucose (0.5 µCi/well) and cold glucose (100 µM). After 15 min,
the assay was terminated by washing the cells three times with ice-cold PBS. After drying the
plates at RT, cells were solubilized in 0.2 N NaOH and the internalized radioactivity was
determined by scintillation counting.
3.3.8 ELISA
Interleukin (IL)-6 and leptin in media from differentiated adipocytes with or without
treatments were measured by commercial ELISA kits (IL-6 #M6000B and Leptin #MOB00 from
R&D Systems, Inc., Minneapolis, MN, USA).
121
3.3.9 De novo steroid and oxysterol synthesis
Differentiated 3T3-L1 adipocytes (day 10) were used for de novo synthesis of steroids or
oxysterols. As previously described, cells were washed twice with warm PBS and incubated at
37°C with mevalonolactone (MVA) (1.5 μCi [3H]MVA [specific activity, 37.1 Ci/mmol] and 20
μM unlabeled MVA) in Aim-V SFM. After 48 h, the media and cells were collected and stored
at –20°C before extraction and analysis. In some experiments, cells were pretreated with enzyme
inhibitors in Aim-V SFM for 1 h, and then the medium was changed into Aim-V SFM
containing the enzyme inhibitors and the radiolabeled substrate, MVA.
3.3.10 HPLC-radiometric assay
Cells and media were homogenized and extracted three times with four volumes of ethyl
acetate. After evaporation, extracts were reconstituted in 200 μL of methanol and analyzed as
previously described (Li et al., 2014a; Pikuleva et al., 1999). In brief, steroid or oxysterol
products were obtained by a Beckman Gold high-performance liquid chromatography (HPLC)
system equipped with a Beckman Ultrasphere ODS column (250 × 4.6 mm, 5 μm) connected to
an ultraviolet–visible spectroscopy (UV-vis) detector (190–300 nm) and a fraction collector
(Beckman Coulter, Inc., Pasadena, CA, USA). At a flow rate of 1.5 mL/min, the separation was
started with a linear 15 min gradient from 100% buffer A (acetonitrile/methanol/water/acetic
acid, 40:40:20:1) to 100% buffer B (100% methanol with 0.1% v/v acetic acid) at a column
temperature of 30°C, followed by another 15 min flow in 100% buffer B. Fractions were
collected every 30 seconds and counted by liquid scintillation spectrometry. Authentic steroids
and oxysterols were used to establish the retention times. Results were presented as counts per
minute (CPM) and corrected for the background reading.
122
3.3.11 Immunoblot analysis
Proteins were extracted from 3T3-L1 cells at various differentiation stages (days 0, 5, and
10) using radioimmunoprecipitation assay (RIPA) buffer (Cell Signaling Technology, Beverly,
MA, USA) complemented with protease and phosphatase inhibitors (Sigma-Aldrich Co.). Then,
30 ug total protein was resolved in 4%–20% Tris-glycine gradient gels, transferred to
polyvinylidene fluoride membranes, and probed overnight at 4°C with specific primary
antibodies: anti-CYP7A1 (ab65596; Abcam plc); anti-CYP3A4/3A5 (NBP1-69667; Novus
Biologicals, LLC, Littleton, CO, USA); and anti-β-ACTIN (#4970; Cell Signaling Technology).
Secondary horseradish peroxidase (HRP)-conjugated anti-rabbit antibody (Cell Signaling
Technology) was used for specific protein detection. Membranes were developed using ECL
plus (Amersham plc; GE Healthcare, Little Chalfront, UK) and image acquisition was performed
on a Fujifilm LAS-4000 (Fujifilm, Tokyo, Japan).
3.3.12 Protein quantification
Proteins were quantified using the Bradford Protein Assay Kit (Pierce; Thermo Fisher
Scientific) with BSA as the standard.
3.3.13 siRNA transfection of 3T3-L1 preadipocytes
Transfection of 3T3-L1 preadipocytes with siRNA targeting mouse CYP7A1 (Thermo
Scientific Dharmacon, On-Target Plus SMARTpool, Cat. # L-058661-01) and/or siRNA
targeting mouse CYP27A1 (Thermo Scientific Dharmacon siGENOME SMARTpool, Cat. # M058118-01) was performed when preadipocytes reached 80% confluence, by using
Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocol. After 48 h,
the transfected cells were subjected to differentiation.
123
3.3.14 Statistical analysis
All experiments were reproduced at least three times and means ± standard error of the
mean (SEM) were presented. Student’s t-test or one-way analysis of variance followed by
Bonferroni’s post hoc test was used to determine statistically significant differences between
groups.
124
3.4 Results
3.4.1 27HC reduces lipid accumulation and upregulates basal lipolysis in adipocytes
Treatment of fully differentiated 3T3-L1 adipocytes with 27HC for 48 h decreased lipid
accumulation, as shown by the reduced number of Oil Red O-positive lipid droplets (Figure
3.1A). Approximately 95% of the total lipids stored in lipid particles from adipocytes are TG
(Zweytick et al., 2000). A decrease in the quantity of TG accumulation was also observed in 10
µM of 27HC-treated cells (Figure 3.1B). Although a low-dose treatment of 27HC (1 µM) did not
affect the total quantity of the lipids (Figure 3.1B), it resulted in the accumulation of a large
amount of smaller lipid droplets (Figure 3.1A), a brown adipocyte-like property that usually
possesses increased mitochondrial activity (De et al., 2009). The lipid turnover of adipocytes is
regulated by lipolysis, a pivotal process involving the enzymatic hydrolysis of TG into free fatty
acids (FFAs) and glycerol (Lafontan and Langin, 2009). After 48 h of treatment with 27HC,
basal glycerol release into the cell culture medium from adipocytes was upregulated (Figure
3.1C). However, pretreatment of adipocytes with 27HC for 48 h did not influence glycerol
release into the lipolytic medium during 3 h of acute stimulation by the lipolytic agent ISO
(Figure 3.1D). Under basal conditions, the presence of lipid droplet-coating proteins keeps
lipolysis at a low level by restricting the access of lipases to the lipid droplets. Thus, basal
lipolysis is usually inversely associated with the level of lipid droplet-coating proteins
(Laurencikiene and Ryden, 2012; Stenson et al., 2011). Indeed, gene expression of perilipin 1
(Plin1), the most abundant lipid droplet-coating proteins in adipocytes (Brasaemle et al., 2009),
was downregulated by 27HC (Figure 3.1E), a result indicative of increased basal lipolysis and
TG utilization.
125
3.4.2 Mechanism of 27HC action in adipocyte basal lipolysis
27HC is an endogenous ligand for LXR (Fu et al., 2001), and LXR in adipocytes is
known to regulate basal, but not hormone-stimulated, lipolysis (Ross et al., 2002). By using a
synthetic LXR agonist, T0901317 (1 µM), we confirmed that the activation of LXR in
adipocytes upregulated basal but not hormone-stimulated lipolysis (Figures 3.1C and 3.1D), a
similar effect observed in 27HC-treated cells. Co-treatment with an LXR antagonist, GGPP
(geranylgeranyl pyrophosphate), inhibited the induction of basal lipolysis by T0901317 (Figure
3.2A) and reversed the lipolytic activity of 27HC (Figure 3.2B).
27HC has also been identified as an endogenous selective ER modulator (SERM)
(Umetani and Shaul, 2011). Both ER isoforms (ERα and ERβ) have been found in adipose
tissues (Pedersen et al., 2001).To determine whether 27HC exerts its lipolytic activity through
ER activation, we treated fully differentiated 3T3-L1 adipocytes with 27HC in the presence of
either ER agonist 17β-estradiol (E2) or ER antagonist ICI 182,780. Neither E2 nor ICI 182,780
alone had any impact on the basal lipolysis of 3T3-L1 adipocytes (Figure 3.2C). The lipolytic
activity of 27HC was also not affected by either E2 or ICI (Figure 3.2D). These findings suggest
that 27HC induces basal lipolysis of adipocytes probably through its ability to activate LXR, not
ER.
3.4.3 Other intracellular pathways affected by 27HC in adipocyte
Since 27HC behaves as an LXR agonist to regulate basal lipolysis, based on the
established functions attributed to LXR in adipocytes (Laurencikiene and Ryden, 2012), we
investigated the potential influence of 27HC on other cellular processes for adipocytes. LXRs are
126
sensors of cholesterol metabolism and are well-defined regulators of reverse cholesterol transport
in macrophages and in the liver, where they upregulate the expression of several members in the
superfamily of ATP-binding cassette (ABC) transporters (Oosterveer et al., 2010). In our
experiments, 27HC increased mRNA expression of Abcg1 (Figure 3.3A), suggesting a potential
role of 27HC in eliminating cholesterol from adipocytes.
Glucose uptake in adipocytes plays an important role in modulating whole-body glucose
homeostasis. It has been reported that in 3T3-L1 adipocytes, LXR upregulates both basal
(Laffitte et al., 2003) and insulin-stimulated glucose uptake (Dalen et al., 2003). Under the same
experimental conditions, we showed that 27HC is a positive regulator for insulin-stimulated, but
not basal, glucose uptake (Figure 3.3B). Whether this effect is mediated via the transcriptional
regulation of the insulin-sensitive glucose transporter, GLUT4, remains to be established.
Adipose-derived hormones have been regarded as important parts of the biological
mechanism that controls energy metabolism, among which leptin is almost exclusively
synthesized by white adipocytes and has been identified as a target gene of LXR (Steffensen and
Gustafsson, 2004). Leptin expression was downregulated in white adipocytes of LXR agonistfed mice (Stulnig et al., 2002). Our results also showed a reduction of leptin mRNA expression
in 27HC-treated 3T3-L1 adipocytes (Figure 3.3C). The secretion of leptin from the adipocytes
into the cell culture medium was also decreased by 27HC (Figure 3.3D). Although decreased
leptin levels would eventually lead to increased energy intake (an unwanted metabolic effect in
developing obesity), evidence also suggests that a fall of leptin in obese individuals who already
have high leptin levels will increase the individuals’ intrinsic sensitivity to leptin and thus
improve the energy balance among the obese (Friedman, 2000).
127
Besides the well-studied functions of LXR in cholesterol, glucose, and energy
homeostasis in metabolic tissues, new lines of research about the roles of LXR in steroidogenic
tissues have been carried out (Volle and Lobaccaro, 2007). Administration of the LXR agonist,
T0901317, in mice upregulated the expression of the first steroidogenic enzyme, CYP11A1, and
increased the production of corticosterone and estradiol in the adrenal glands (Cummins et al.,
2006) and ovaries (Mouzat et al., 2009), respectively. Interestingly, 27HC treatment in 3T3-L1
adipocytes also induced the gene expression of Cyp11a1 (Figure 3.3E). Since the activity of
CYP11A1 in converting cholesterol into pregnenolone has been identified (Li et al., 2014b),
there might be a possibility that 27HC could induce the local metabolism of cholesterol to
steroids in adipocytes.
3.4.4 Local 27HC biosynthetic pathway in regulating adipocyte cholesterol metabolism
Adipocytes are the largest storage site for free cholesterol in the human body. Adipocytes
from obese humans contain more cholesterol (up to 50% of the total intracellular cholesterol)
than from lean controls (about 20%), indicating that cholesterol overload exists in enlarged
adipocytes of the obese state (Krause and Hartman, 1984). Subsequently, several lines of
evidence further support that altered adipocyte cholesterol balance is a prominent mechanism
resulting in adipocyte malfunction in obesity (Le et al., 2001). Thus, more attention needs to be
drawn to the crucial factors regulating the cholesterol turnover in adipocytes. Although reverse
cholesterol transport has been considered as the major mechanism that removes cholesterol from
adipocytes, the existence of active cholesterol metabolic pathways in adipocytes may open new
doors for studying cholesterol elimination.
128
Cytochrome P450s including CYP11A1, CYP27A1, CYP7A1, CYP46A1 and CYP3A4
initiate all quantitatively significant pathways to degrade cholesterol in a tissue-specific manner
(Figure 3.4A). In our previous study, we have identified the presence of both CYP27A1 and
CYP11A1 in 3T3-L1 adipocytes (Li et al., 2014b). The protein levels of these two mitochondrial
enzymes were much higher in differentiated adipocytes than in preadipocytes (Li et al., 2014b).
However, in the current study, we observed a reduction in the protein expression of the
microsomal enzymes, CYP7A1 and CYP3A4/3A5, during the differentiation of 3T3-L1 cells
from preadipocytes (D0) to mature adipocytes (D10) (Figure 3.4B). This raised an interesting
possibility that there might be multiple cholesterol-metabolizing pathways coexisting in
adipocytes, and by sharing the same substrate cholesterol, they may be coupled together in a
compensatory manner.
Applying the same experimental settings used to demonstrate the biosynthesis of 27HC
from cholesterol (converted by CYP27A1) (Li et al., 2014b), in this study, we identified several
other de novo cholesterol metabolites, including 7α-HC (Retention time, Rt≈17.5 min)
(converted by CYP7A1) and 4β-HC (Rt≈22.5 min) (converted by CYP3A4) in mature
adipocytes (Figure 3.4C) after 48 h of incubation with the radiolabeled substrate MVA, the direct
precursor of cholesterol. In the presence of GI268267X, a specific inhibitor for CYP27A1
(Lyons and Brown, 2001; Nelson et al., 2013), the formation of radiolabeled peaks matching 7αHC and 4β-HC was induced substantially (Figure 3.4D). Since the levels of de novo synthesized
cholesterol from MVA were stable throughout treatments with or without specific enzyme
inhibitors, we quantified the percentage of cholesterol that had converted to its metabolites, and
both 7α-HC and 4β-HC metabolized from de novo cholesterol were significantly upregulated in
GI268267X-treated adipocytes (Figures 3.4F and 3.4G). This result is in line with the previous
129
findings that in CYP27A1 knockout mice, both the expression (Zurkinden et al., 2014) and
activities (Honda et al., 2001) of CYP7A1 and CYP3A were markedly induced in the liver, and
serum 7α-HC levels were upregulated 4 to 10 folds (Rosen et al., 1998). The role of CYP27A1 in
modulating the metabolic fate of cholesterol in adipocytes has also been confirmed with another
published inhibitor of CYP27A1, cyclosporine A (CsA) (Princen et al., 1991; Dahlback-Sjoberg
et al., 1993) (Figures 3.4E–3.4G).
We should point out that 27HC is not the only product synthesized by CYP27A1 from
cholesterol. It is known that in macrophage, lung, and vascular endothelial cells where CYP27A1
is highly expressed, 27HC can be further metabolized to 3β-hydroxy-5-cholestenoic acid (27COOH) by two sequential oxidation reactions catalyzed by CYP27A1 (Babiker et al., 1997;
Babiker et al., 1999). Under identical in vitro conditions, the enzyme CYP27A1 is known to be
more efficient in converting 27HC into 27-COOH than converting cholesterol into 27HC
(Pikuleva et al., 1998). Therefore, the inhibitors of CYP27A1, GI268267X and CsA, may block
the formation of 27-COOH from 27HC more easily than cholesterol into 27HC. This may
explain the induced ratio of 27HC/27-COOH in mature adipocytes in the presence of CYP27A1
inhibitors (Figure 3.4H).
3.4.5 Overproduction of 4β-HC may induce local inflammation in adipocytes
Next, we explored the biological influence caused by the compensatory increase in 7α-HC and
4β-HC local production. Oxysterols often contribute to the development of major chronic
diseases in which inflammation is regarded as the major driving force (Poli et al., 2013).
Adipocytes treated with 4β-HC had a much higher capacity in secreting the proinflammatory
cytokine, IL-6, than the control cells (Figure 3.5B), while 7α-HC and 27HC could not
130
significantly affect IL-6 secretion (Figures 3.5C and 3.5D). Interestingly, adipocytes treated with
GI268267X (CYP27A1 inhibitor) also secreted more IL-6 than did the control-treated cells
(Figure 3.5A). The induced local synthesis of 4β-HC, due to the inhibition of the CYP27A1
enzymatic pathway, may be responsible for the upregulated IL-6 secretion in GI268267X-treated
adipocytes.
3.4.6 7α-HC regulates lipid metabolism of adipocytes in the opposite direction of 27HC
The local production of 7α-HC in adipocytes was up-regulated when the 27HC
biosynthetic pathway was blocked (Figure 3.4F) but it did not significantly influence proinflammatory IL-6 secretion from adipocytes (Figure 3.5C). Therefore, we decided to test
whether 7α-HC could affect other functions of adipocytes. Treatment with 7α-HC of fully
differentiated adipocytes for 2 days altered the expression of key factors involved in several
major adipocyte activities including lipogenesis (Figure 3.6A), lipolysis (Figure 3.6B),
cholesterol transport (Figure 3.6C) and adipokine secretion (Figure 3.6D). Interestingly, 7α-HC
seems to upregulate lipogenesis and downregulate lipolysis in adipocytes (Figure 3.6A and 3.6B),
both in the opposite direction of 27HC (Figure S3.1A and S3.1B). 27HC was shown to reduce
the lipid accumulation in adipocytes (Figure 3.1A and 3.1B). Thus, upon inhibition of 27HC
biosynthetic pathway in adipocytes, the elevated local production of 7α-HC may increase the
intracellular accumulation of triglycerides and the size of adipocytes.
131
3.5 Discussion
To the best of our knowledge, this is the first study to investigate the effect of 27HC, the
most prevalent endogenous cholesterol metabolite, on the function of adipocytes, the largest
body store for free cholesterol. The results suggest that 27HC, either from circulation or
produced de novo, is an effective regulator of adipocyte functions, including cholesterol
metabolism, lipid storage, glucose uptake, and adipokine secretion.
The oxygenated derivatives of cholesterol, termed as oxysterols, are natural ligands for
LXR. Constitutively active LXR has been proposed in adipocytes, and oxysterols such as 22Rhydroxycholesterol can further activate LXR in differentiated 3T3-L1 adipocytes (Seo et al.,
2004). LXR has been implicated in a vast variety of metabolic processes, including cholesterol,
TG, and glucose homeostasis, as well as in inflammation (Laurencikiene and Ryden, 2012).
Following the established criteria, we tested whether 27HC can also influence adipocyte
functions attributed to LXR. As per the results, 27HC upregulated the expression of the
cholesterol efflux gene, ABCG1, reduced TG levels, induced basal lipolysis, and improved
glucose uptake in 3T3-L1 adipocytes. All of these results are in parallel to the documented roles
of LXR in modulating adipocyte functions (Laurencikiene and Ryden, 2012). Although
increased cholesterol efflux, reduced lipid accumulation, and glucose uptake in adipocytes are
considered as improvements in adipocyte function in regulating whole-body lipid and glucose
homeostasis, the induction of basal lipolysis in hypertrophic adipocytes present in the obese state
is often regarded as a red flag, because the increment in the net release of FFAs can initiate
insulin resistance and diabetes mellitus (Arner, 2005). The rate of basal lipolysis is positively
related to the size of adipocytes (Wueest et al., 2009). Small adipocytes present in the lean state
exhibit significantly lower basal lipolysis; thus, the continued supply of fatty acids resulting
132
from spontaneous adipocyte TG lipolysis under lean conditions are considered as the energy
source for other organs rather than a risk factor for insulin resistance (Guilherme et al., 2008).
Therefore, whether the induction of basal lipolysis by 27HC action on adipocytes is a beneficial
effect or a risk factor in whole-body lipid and energy homeostasis depends on the metabolic state
of the adipocytes (normal versus hypertrophic) already present in the models to be tested. This
study, using an adipocyte cell line, indicates the potential significance to study the action of
27HC in adipocytes. Future studies with primary adipocytes from healthy and obese subjects are
required to explore, in depth, the physiological effects of 27HC.
The impact of 27HC on most of adipocyte activities tested was only effective at the
relatively high dose of 10 µM. The physiological exposure of adipocytes to 27HC in the healthy
as well as the obese human subjects should be evaluated in the future. In healthy human subjects,
circulating 27HC level ranges from 150 to 730 nM and it is positively correlated with circulating
cholesterol levels (Brown and Jessup, 1999). Since plasma cholesterol concentration can be
elevated 20 times in morbidly obese subjects, the circulating level of 27HC is predictably much
higher in obesity (Brown and Jessup, 1999). So far, the concentrations of oxysterols detected in
human adipose tissues are all increased with obesity (Murdolo et al., 2013; Jove et al., 2014).
Adipose tissue may behave as a lipophilic store for oxysterols and the local concentrations of
these oxysterols in adipose compartment may be tightly associated with their circulating levels.
A recent study in rodents showed that the local 27HC concentration in rat adipose tissues was
upregulated in high-fat-diet induced obese rats (Wooten et al., 2014). The elevated circulating
27HC in obesity may “sink” into adipose tissue and the ability of adipocytes to synthesize 27HC
de novo (Li et al., 2014a) may further contribute to the local concentration of 27HC in adipose
tissue. A relatively high local concentration of 27HC, such as 10 µM, in adipose tissue may be
133
reachable in super morbid obesity. In this paper, we chose 1 and 10 µM as the representative
doses to study the effects of 27HC. In the early phase of the experimental setup, when we were
screening the effective doses of 27HC in adipocytes, we found that 27HC at doses of 0.5 and 1
µM did not influence the mRNA expression of key factors involved in adipocyte activities such
as lipogenesis, lipolysis, cholesterol transport and adipokine secretion, whereas 27HC at 5 µM
exerted minor or no effect on these adipocyte functions (Figure S3.1). 10 and 20 µM of 27HC
were more effective in these pathways and their effects were in the same direction of 5 µM
27HC. 27HC at 20 µM, however, seemed to be toxic to mature adipocytes after 2-day treatment
(Figure S3.1E). Therefore, we decided to use 10 µM as the representative of the effective doses.
The reason to include 1 µM dose in the follow-up studies was that this concentration of 27HC
seemed to be more effective than 10 µM to stimulate the insulin-sensitive glucose uptake into
adipocytes (Figure 3.3B). Adipocytes are involved in a vast array of biological activities and
27HC at doses as low as 1 µM may be influential to certain functional activities of adipocytes
without affecting the key regulatory factors in the expression level.
In addition to adipocytes, 27HC also had positive and negative effects on other cell/tissue
types. Thus, the local and systemic effects of 27HC should be carefully separated. Based on the
observed local production and action of 27HC in adipocytes, and the positive association
between adipocyte and serum 27HC levels (Wooten et al., 2014), we propose the following
mechanisms that may potentially connect the differential effects of 27HC together, under
different conditions. First, the presence of the de novo 27HC biosynthesis pathway in adipose
tissues serves as a protective mechanism to limit the expansion of the adipose compartment, as
pre-fat cells isolated from adipose tissues of CYP27A1 knockout mice have the increased
potential to differentiate into fat cells (Li et al., 2014b). Second, following a high-fat diet, the
134
incoming load of cholesterol in circulation may upregulate the local level of cholesterol in
adipocytes, and the de novo 27HC (in addition to the already elevated serum 27HC, which can
also be trapped in adipocytes) may help to eliminate intracellular cholesterol from the adipocytes
and improve glucose metabolism. The active 27HC biosynthesis pathway can also drain the
substrate away from other cholesterol metabolic pathways, thus maintaining a low level of
production of proinflammatory oxysterols, such as 4β-HC. In this way, healthy adipocytes may
act as a sink in which to safely store the lipophilic molecules, including 27HC. Third, in obesity,
the hypertrophic adipocytes, which are known to express a higher level of CYP27A1 (Li et al.,
2014b), may overproduce 27HC and eventually spill it out into the system, resulting in
unfavorable metabolic outcomes on other tissues, including the promotion of breast cancer
growth (Nelson et al., 2013). In conclusion, due to the complicated effects of 27HC, the tissuespecific targeting of 27HC synthesis may be important to maximize the benefit-to-risk ratio.
Under certain circumstances, such as in breast cancer patients who are also obese, the global
targeting of 27HC synthesis may result in more positive (than negative) outcomes.
Another significant point of this study is that several cholesterol metabolic pathways have
been indicated to present in adipocytes in a dynamic balance. Interruption of one pathway could
influence the compensatory upregulation of other pathways to metabolize cholesterol in
adipocytes. In this study, we showed that the specific inhibition of CYP27A1 by GI268267X or
CsA induced the formation of 7α-HC and 4β-HC. We have also showed the upregulation of 7αHC and 4β-HC, as well as 27HC production from cholesterol in adipocytes treated with
aminoglutethimide (AMG), a specific inhibitor of CYP11A1 (Li J. and Papadopoulos V.,
unpublished data). Ketoconazole, a general inhibitor of CYP enzymes, wiped out the generation
of almost all cholesterol products, except one (identified as 7β-HC), which is a product of
135
cholesterol autoxidation (Li J. and Papadopoulos V., unpublished data). The presence of 7β-HC
in human adipose tissue interstitial fluid has been identified by other groups (Murdolo et al.,
2013), and raised plasma 7β-HC has been associated with an increased risk of atherosclerosis
(Brown and Jessup, 1999). This is also the first report showing CYP7A1 protein expression in
adipocytes. Previously, gene expression of CYP7A1 has been reported in human primary
adipocytes (Lee et al., 2005). The functional role(s) of CYP7A1 and its metabolic product 7α-HC
in adipocytes have yet to be established. In our study, knocking down CYP7A1 in 3T3-L1
preadipocytes or the addition of 7α-HC into differentiation cocktail did not affect adipocyte
differentiation, as indicated by the gene expression of differentiation markers (Figure S3.2).
However, treatment of fully differentiated adipocytes with 7α-HC for 2 days altered the gene
expression of key factors involved in several major adipocyte activities including lipid
metabolism and adipokine secretion. Here, we propose a coordinated network of cholesterol
metabolism, either through enzymatic reactions or autoxidation, existing in the adipocytes.
Besides the known functions of cholesterol elimination, as occurred in the other cell types, the
physiological significance of these cholesterol-metabolizing pathways specific for adipocytes
awaits further investigation.
By using a mouse adipocyte cell line of 3T3-L1, we related most of our findings to the
metabolic disorders observed in Cyp27a1 knockout mice. The pathophysiological consequences
of CYP27A1 deficiency in mice and humans, however, are different (Repa et al., 2000). For
example, Cyp27a1 knockout mice do not develop cerebrotendinous xanthomatosis (CTX)
(Rosen et al., 1998) and CTX patients show no signs of adrenal enlargement (Salen, 1971) as
reported in Cyp27a1 knockout mice (Repa et al., 2000). CTX patients are characterized by
several clinical conditions including profound intra-tissue accumulation of lipids and accelerated
136
atherosclerosis (Cali et al., 1991). Although the histology of adipose tissues collected from CTX
patients was indistinguishable from normal, the concentrations of cholesterol by-products in
adipose tissues (Salen, 1971), particularly pericardial adipose tissue (Bhattacharyya et al., 2007),
were 3 to 100 times higher than normal (Salen, 1971). The possibility attributed to the high tissue
level of cholesterol derivatives might be that the biosynthesis of 27HC from cholesterol is
blocked in the absence of CYP27A1, thus diverting the substrate cholesterol to the synthesis of
other products. Our results showed significant increase in the biosynthesis of pro-inflammatory
oxysterols in adipocytes when CYP27A1 enzyme activity was blocked. Although the detailed
features of adipocyte metabolism in CTX syndrome have yet to be documented, the
accumulation of inflammatory cholesterol by-products inside the adipose tissue, especially
pericardial adipose tissue, may increase the risks for the development of atherosclerosis which is
a predominant clinical feature of CTX patients.
In conclusion, our data suggest an important regulatory role of 27HC in adipocyte lipid
and glucose metabolism, probably through the action of LXR. De novo synthesized 27HC may
act as an intracellular signal to sense and influence cholesterol balance in adipocytes. The local
production and action of 27HC in adipocytes may be part of the host defense mechanism to
maintain the healthy functions of adipocytes. Overproduction of 27HC in
hypertrophic/dysfunctional adipocytes, however, may contribute to the elevated levels of serum
27HC observed in hypercholesterolemia or obesity which, in turn, lead to metabolic disorders
and cancer risks.
137
3.6 Acknowledgments
We thank GlaxoSmithKline for providing GI268267X (CYP27A1 inhibitor). This work
was supported in part by a grant from the Canadian Institutes of Health Research (CIHR) and a
Canada Research Chair in Biochemical Pharmacology (to V.P.). J.L. was supported in part by a
predoctoral fellowship from the CIHR McGill Drug Development Training Program. The
Research Institute of McGill University Health Centre is supported in part by a center grant from
Fonds de la Recherche Quebec – Santé.
138
Table 3.1 Primer sequences for qRT-PCR.
Gene
Forward primer 5'-3'
Reverse primer 5'-3'
Plin1
AACGTGGTAGACACTGTGGTACA
TCTCGGAATTCGCTCTCG
Abcg1
GGGTCTGAACTGCCCTACCT
TACTCCCCTGATGCCACTTC
Lep
TTGATGAGGTGACCAAGGTG
GTGGTGGCTGGTGTCAGAT
Cyp11a1
GGTTCTCAGGCATCAGGATGAG
CGGAGCAGAATTGAAGTTCAAAATCTCCG
Rps18
CACGGGCTCCACCTCATCCTCCGTG
TGAGGAAAGCAGACATCGACCT
Cebpa
TTGGCTTTATCTCGGCTCTTGC
CGGTAACAAGAACAGCAACGAGTACCG
Pparg CGGAAATAAAGTCACCAAAGGGCTTCCG
Fabp4
TTTGGTCACCATCCGGTCAG
CTCATCTCAGAGGGCCAAGGA
CGAGATCCCAGTTTGAAGGAAATCTCG
139
140
Figure 3.1 27HC decreases lipid accumulation in adipocytes by upregulating basal
lipolysis.
(A) Oil Red O staining of lipid droplets in differentiated 3T3-L1 adipocytes treated with 27HC
for 48 h. Images are representative of three independent experiments. (Magnification: 10×; Scale
bar: 100 µm). (B) Cellular triglyceride content analysis of 3T3-L1 adipocyte cells after 48 h of
treatment with 27HC. Values were corrected for protein concentration in each treatment, and
they were represented as the fold change compared to the control-treated cells. (C) Glycerol
release measured in culture medium removed from 3T3-L1 adipocytes treated with 27HC for 48
h. LXR agonist, T0901317 (1 µM), was used as a positive control. Values were corrected for
protein concentration in each treatment and represented as the mean ± standard error (SE).
(n=3);***p<0.001. (D) Glycerol release measured in lipolytic medium containing ISO (10 µM)
collected from 3T3-L1 adipocytes pretreated with 27HC for 48 h and then incubated in lipolytic
medium for 3 h. (E) Quantitative (q)PCR analysis of perilipin 1 (Plin1) in 3T3-L1 adipocytes
treated with 27HC for 48 h. Results shown are the mean ± SE (n=3);***p<0.001. All the results
shown at the concentration of 0 µM 27HC were the vehicle control (0.1% v/v methanol).
141
Figure 3.2 27HC upregulates the basal lipolysis of adipocytes by activating LXR.
Glycerol release measured in the cultured medium collected from 3T3-L1 adipocytes 48 h after
treatment with (A) LXR agonist, T0901317 (1 µM), and/or LXR antagonist, GGPP (10 µM); (B)
27HC (10 µM) with or without GGPP (10 µM); (C) ER agonist E2 (1 µM) and/or ER antagonist
ICI 182, 780 (10 µM); (D) 27HC (10 µM) with or without E2 (1 µM) or ICI (10 µM). Values
were corrected for protein concentration in each treatment and were represented as the mean ±
SE (n=3); *p<0.05; ***p<0.001.
142
143
Figure 3.3 27HC affects multiple intracellular pathways attributed to LXR in adipocytes.
After 48 h of treatment with 27HC, 3T3-L1 adipocyte cells or culture media were collected for
(A) qPCR analysis of the gene expression of reverse cholesterol transporter, Abcg1; (B) glucose
uptake (using 3H-labeled 2-deoxyglucose) into cells after 15 min of stimulation with PBS (basal
condition) or insulin (100 nM). Results were corrected for protein concentration in each
treatment and compared to insulin-stimulated controls; (C) qPCR analysis of leptin (Lep)
expression in the cells; (D) ELISA analysis of leptin protein in the cell culture media; (E) qPCR
analysis of Cyp11a1. Results are presented as the mean ± SE (n=3); *p<0.05; **p<0.01. All the
results shown at the concentration of 0 µM 27HC were the vehicle control (0.1% v/v methanol).
144
145
Figure 3.4 The local 27HC biosynthetic pathway regulates cholesterol metabolism in
adipocytes.
(A) Schematic representation of cholesterol-metabolizing enzymatic pathways in different
organs. (B) Immunoblot analysis of CYP7A1 and CYP3A4/3A5 at different stages of 3T3-L1
cells during differentiation (day 0, day 5, and day 10). (C–E) HPLC–radiometric analysis of
radiolabeled cholesterol metabolite formation after 48 h of incubation with [3H]MVA in 3T3-L1
adipocytes in the absence (C) or presence of (D) CYP27A1 inhibitor GI268267X (20 µM) or (E)
cyclosporin A (CsA) (10 µM). All results from HPLC–radiometric assays are representative of at
least three independent experiments. (F and G) Conversion percentage of de novo cholesterol to
(F) 7α-HC or (H) 4β-HC in 3T3-L1 adipocytes treated with or without GI268267X or CsA,
quantified from HPLC–radiometric assays. (H) Ratio between two CYP27A1 products from
cholesterol, 27HC verses 27-COOH, in 3T3-L1 adipocytes treated with or without GI268267X
or CsA, quantified from HPLC–radiometric assays. Results shown are the mean ± SE (n≥3);
*p<0.05; **p<0.01.
146
Figure 3.5 Disruption of the local 27HC biosynthetic pathway upregulates cytokine release
from adipocytes.
ELISA analysis of IL-6 secreted into the culture media from 3T3-L1 adipocytes after 48 h of
treatment with (A) CYP27A1 inhibitor GI268267X (20 µM); (B) 4β-HC; (C) 7α-HC; (D) 27HC.
All the results shown at the concentration of 0 µM were the vehicle control (0.1% v/v methanol
for 27HC, 0.08% v/v methanol for 4β-HC and 0.1% v/v ethanol for 7α-HC)
147
Figure 3.6 Role of 7α-HC in differentiated adipocytes.
(A-D) qRT-PCR analysis of (A) fatty acid synthase (Fasn), (B) perilipin 1 (Plin1), (C) adenosine
triphosphate (ATP)-binding cassette subfamily G member 1 (Abcg1) and (D) leptin (Lep) in 3T3L1 adipocytes treated with 7α-HC for 48 h. Results shown are the mean ± SE (n=3); *p<0.05,
**p<0.01, ***p<0.001. All the results shown at the concentration of 0 µM 7α-HC were the
vehicle control (0.1% v/v ethanol).
148
149
Figure S3.1 Dose effects of 27HC action in differentiated adipocytes.
(A-D) qRT-PCR analysis of (A) fatty acid synthase (Fasn), (B) perilipin 1 (Plin1), (C) adenosine
triphosphate (ATP)-binding cassette subfamily G member 1 (Abcg1) and (D) leptin (Lep) in 3T3L1 adipocytes treated with 27HC for 48 h. Results shown are the mean ± SE (n=3);***p<0.001.
(E) Cell viability of 3T3-L1 adipocytes treated with different doses of 27HC for 48 h. Results
shown are the mean ± SE (n=3);*p<0.05.
150
Figure S3.2 Role of CYP7A1 and 7α-HC in adipocyte differentiation.
(A-C) qRT-PCR analysis of the differentiation markers Cebpa (A), Pparg (B) and Fabp4 (C) in
siRNA-targeting of CYP7A1 or double siRNA-targeting of CYP7A1 and CYP27A1 in 3T3-L1
cells subjected to differentiation. (D-F) qRT-PCR analysis of the differentiation markers Cebpa
(D), Pparg (E) and Fabp4 (F) in 3T3-L1 cells subjected to differentiation in the presence of 7αHC. Results shown are means ± S.E. (n=3); **p<0.01, ***p<0.001.
151
Connecting text between Chapter 3 and 4
In Chapters 2 and 3, we demonstrated the de novo synthesis and function of steroids and
the oxysterol, 27HC, in adipocytes. Given the essential role that adipose tissue plays in wholebody homeostasis, it is interesting to see whether the local production of steroids and/or
oxysterols in adipocytes can be regulated in a way that can result in favorable metabolic
outcomes. As a cholesterol- and drug-binding protein, TSPO (18 kDa) is a key component
involved in mitochondrial cholesterol transport, which is the rate-determining step in the
synthesis of steroid hormones and 27HC. Thus, TSPO provides a pharmacological target to
modulate the rate of steroid/oxysterol biosynthesis. The TSPO ligand PK 11195 is known to
stimulate cholesterol transfer and, subsequently, the biosynthesis of steroid and 27HC in
steroidogenic cells and liver cells, respectively (Lacapere and Papadopoulos, 2003). In
adipocytes treated with PK 11195, metabolic labeling studies using mevalonate as the substrate
indicated that there was elevated formation of 27HC, as well as some steroidal products, isolated
by high-performance liquid chromatography (HPLC) (Figure 5.1B). To better understand the
biological influence of TSPO in adipocytes, in Chapter 4, we knocked down TSPO or activated
TSPO in adipocytes and then investigated the metabolic changes in the cells. We showed that the
local presence of TSPO was essential to safeguard the healthy functions of adipocytes, and that
the activation of TSPO positively regulated the intracellular activities of adipocytes, including
lipid and glucose metabolism, adipokine secretion, and adipogenesis. Future studies are
warranted to determine whether the anti-obese action of TSPO ligands on adipocytes is mediated
through the adjustment of local steroid and oxysterol production. Nevertheless, our study in
Chapter 4 implied that adipocyte TSPO is an emerging target for pharmacological interventions,
152
so as to improve local adipocyte biology while yielding a potential impact on systemic
metabolism.
153
Chapter 4
Translocator protein (18 kDa) as a pharmacological target in adipocytes to
regulate cellular homeostasis
Jiehan Li1,2 and Vassilios Papadopoulos1,2,3,4,*
1
2
Research Institute of the McGill University Health Centre and the Departments of
Pharmacology and Therapeutics, 3Medicine, and 4Biochemistry, McGill University,
Montreal, Canada
*
Correspondence: Dr. V. Papadopoulos, Research Institute of the McGill University Health
Centre, Montreal General Hospital, 1650 Cedar Avenue, Room C10-148, Montréal, Québec H3G
1A4, Canada; phone: 514-934-1934 ext. 44580; fax: 514-934-8439; e-mail:
[email protected]
154
4.1 Abstract
As a major factor in obesity and its associated complications (such as insulin resistance
and type 2 diabetes), the proper functioning of adipocytes is crucial for health maintenance, and
it is of primary importance for the development of therapeutic interventions. There is increasing
evidence that mitochondrial malfunction is a pivotal event in disturbing adipocyte cell
homeostasis and its systemic control. Among major mitochondrial structure components, the
high-affinity drug- and cholesterol-binding outer mitochondrial membrane translocator protein
(18 kDa; TSPO) has shown importance across a broad spectrum of mitochondrial functions.
Recent studies demonstrated that TSPO is present in adipocyte mitochondria, and administration
of the TSPO drug ligand, isoquinoline carboxamide PK 11195, to obese mice reduces weight
gain and lowers glucose levels. Therefore, it is of great interest to assess whether TSPO in
adipocytes could serve as a drug target to regulate the intracellular machinery underlying
changes in systemic weight control and glucose metabolism. In the 3T3-L1 mouse adipocyte cell
model, PK 11195 was shown to improve several key biochemical processes, such as the
production and release of key adipokines, glucose uptake, and adipogenesis. Silencing RNA
(siRNA)-mediated TSPO knockdown in either differentiated adipocytes or preadipocytes
impaired these functions. These findings were confirmed in human primary cells, where TSPO
expression was found to be tightly associated with the metabolic state of primary adipocytes and
the differentiation of primary preadipocytes. Thus, TSPO in adipocytes may serve as a
pharmacologic target to modulate the cellular dynamics aimed at the development of novel
therapies against obesity and diabetes.
155
4.2 Introduction
The translocator protein (18 kDa) TSPO, previously known as peripheral-type
benzodiazepine receptor (Papadopoulos et al., 2006), is mainly located in the outer mitochondrial
membrane (Anholt et al., 1986) and has been implicated in a vast array of important cellular
functions, including apoptosis (Veenman et al., 2007), immune/inflammatory responses (Zavala,
1997), and steroidogenesis (Besman et al., 1989; Papadopoulos et al., 1997). Ubiquitously
expressed, TSPO is well-known for its ability to bind both endogenous (for example, cholesterol
(Li and Papadopoulos, 1998), porphyrins (Verma et al., 1987), and diazepam-binding inhibitor
(Papadopoulos, 1993)), and synthetic ligands (for example, the isoquinoline carboxamide PK
11195 (Le et al., 1983) and indol-acetamide FGIN-1-27 (Romeo et al., 1992)) with high affinity.
While cholesterol binds to the cholesterol recognition/interaction amino acid consensus (CRAC)
motif at the C-terminus of TSPO (Li and Papadopoulos, 1998; Li et al., 2001), all of the other
drug ligands bind to a region near the N-terminus, but they require the presence of other domains
of the protein (Farges et al., 1994; Anzini et al., 2001). The three-dimensional (3D) highresolution structure of mammalian (mouse) TSPO (mTSPO) in complex with its most prominent
diagnostic ligand, PK 11195, was recently reported (Jaremko et al., 2014). The mTSPO–PK
11195 complex is monomeric, comprising five transmembrane α-helices tightly bundled together,
and it reveals that residues essential for cholesterol binding are not involved in PK 11195
binding. The ligand-induced stabilization of the TSPO structure may suggest a molecular basis in
facilitating cholesterol transport into the mitochondria, and it may provide a better understanding
about the role of TSPO as a biomarker and a therapeutic target in various diseases (Jaremko et al.,
2014).
156
A recent study using a whole-organism (zebrafish) high-throughput screening strategy of
2,400 bioactive compounds identified two structurally distinct TSPO ligands – the isoquinoline
PK 11195 and benzodiazepine Ro5-4864 – as new glucose-lowering agents (Gut et al., 2013).
These TSPO drug ligands reduced the weight gain and improved glucose tolerance in the highfat diet-induced obese mice (Gut et al., 2013). Following the same treatment strategy, a different
group reported the downregulation of transcription factors responsible for lipogenesis (i.e.,
SREBP1) and upregulation of lipolysis genes (i.e., HSL) in white adipose tissues (WAT) of PK
11195-treated obese mice compared to vehicle-treated obese mice (Thompson et al., 2013).
These changes in adipose gene expression involved in lipid metabolism may result in the
shrinking of adipose mass volume; thus they are responsible for the reduced weight gain
observed by the previous group. The decreased body weight may then lead to the improvement
of insulin sensitivity in other organs, such as in skeletal muscle, and with the coordinated action
of different organs, blood glucose levels are reduced. Therefore, adipose tissue could be an
integrator of glucose homeostasis (Rosen and Spiegelman, 2006). However, the direct effects of
TSPO ligands on adipose tissue functions controlling glucose balance through either endocrine
(i.e., the secretion of endocrine factors that regulate glucose metabolism) or non-endocrine (i.e.,
glucose uptake in the adipocytes) mechanisms are not yet understood. It is of great interest,
therefore, to assess the local biological influence of TSPO ligands within the adipose tissue in
order to determine whether altered fat tissue functions contribute to the recently reported (see
above) global glucose-lowering effect of TSPO ligands.
Adipose tissues express TSPO ligand binding sites, which are present in mitochondrial
extracts (Thompson et al., 2013). TSPO gene expression is reduced in the WAT of obese mice
compared to the control (Thompson et al., 2013). Immunohistochemical analysis revealed that
157
TSPO expression is lower in adipocytes, but it remains high in macrophages of WAT from obese
mice (Thompson et al., 2013). Considering that adipocytes account for the majority of adipose
mass volume, the reduction of TSPO expression in the total adipose tissue may be due to the
reduced TSPO expression in hypertrophic/dysfunctional adipocytes present in obese states. In
addition, we recently reported that during the process of adipogenesis (the differentiation of
preadipocytes to adipocytes), TSPO expression was induced in both mouse 3T3-L1 (Li et al.,
2014a) and human SW872 liposarcoma (Campioli et al., 2011) cell lines. However, during the
maturation stage of adipocytes (from normal healthy adipocytes to hypertrophic adipocytes),
TSPO expression was also reduced (Campioli et al., 2011). Therefore, TSPO in preadipocytes
may be an important player in initiating and promoting the formation of healthy adipocytes.
Furthermore, in adipocytes, TSPO may act as an intracellular safeguard to defend normal
adipocyte function.
To better understand the involvement of TSPO and its drug ligands in adipocyte
functions, we investigated herein: (1) the ability of TSPO drug ligands to improve adipocyte
function to positively regulate glucose metabolism, by treating differentiated adipocytes with
TSPO drug ligands; (2) the need of TSPO presence for the maintenance of the healthy functions
of adipocytes, which were examined by knocking down TSPO in differentiated adipocytes; and
(3) the role of TSPO in adipogenesis, as assessed by knocking down TSPO in preadipocytes
before differentiation, or by supplementing the differentiation medium with TSPO drug ligands.
The results obtained suggest that TSPO in adipocytes may serve as a drug target for the
development of novel therapies against obesity and diabetes.
158
4.3 Materials and Methods
4.3.1 Materials
1-(2-Chlorophenyl)-N-methyl-N-(1-methylpropyl)-3-isoquinolinecarboxamide (PK
11195), N,N-dihexyl-2-(4-fluorophenyl)indole-3-acetamide (FGIN-1-27), 2-deoxy-D-glucose,
(±)-mevalonolactone (MVA), dexamethasone, 3-isobutyl-1-methylxanthine (IBMX), and insulin
were purchased from Sigma-Aldrich Co. (St. Louis, MO, USA). 2-[1,2-3H (N)]-Deoxy-Dglucose (specific activity: 5-10Ci(185-370GBq)/mmol) was from PerkinElmer Inc. (Waltham,
MA, USA). All organic solvents were from Thermo Fisher Scientific (Waltham, MA, USA). All
cell media, serum, and antibiotics were from Thermo Fisher Scientific. The mouse 3T3-L1
preadipocyte cell line was from ATCC (Manassas, VA, USA). Human primary preadipocyte and
adipocyte extracts from both healthy and diabetic subjects were from Zen-Bio, Inc. (Triangle
Park, NC, USA).
4.3.2 Cell culture
3T3-L1 cells were cultured in regular growth medium (Dulbecco’s Modified Eagle’s
Medium (DMEM) with 10% fetal bovine serum [FBS] and 1× penicillin–streptomycin). For
differentiation, 3T3-L1 preadipocytes were first grown into confluence (day 2) and 2 days after
confluence (day 0), cells were fed with induction medium MDI (regular growth medium with 0.5
mM of IBMX, 1 μM of dexamethasone, and 1 μg/mL of insulin). From day 2 onward, cells were
changed to maintenance medium (regular growth medium with 1 μg/mL of insulin) until use. All
experiments were performed using fully differentiated 3T3-L1 adipocytes.
4.3.3 siRNA transfection of differentiated adipocytes and preadipocytes
159
Transfection of fully differentiated 3T3-L1 adipocytes with silencing RNA (siRNA)targeting mouse TSPO (Thermo Fisher Scientific; Dharmacon, Inc., Lafayette, CO, USA;
siGENOME SMARTpool, Cat. # M-040291-01) in cell suspension conditions was adapted from
Kilroy et al (Kilroy et al., 2009). The siRNA complex was composed of an equal volume of the
stock siRNA (100 µL of 2 uM of siRNA) and Opti-MEM (100 µL), and the transfection reagent
mix was formed by adding 14 µL of DharmaFect Due transfection reagent (Dharmacon, Inc.)
into 186 µL of Opti-MEM. After 5 minutes of incubation at room temperature (RT), the siRNA
complex was mixed together with the transfection reagent complex and incubated at RT for an
additional 20 minutes. While waiting, fully differentiated adipocytes were trypsinized and
resuspended in DMEM containing 10% FBS at a concentration of 7.5 × 105 cells/mL. At the end
of 20 minutes, 400 µL of the siRNA–transfection reagent complex was mixed with 1.6 mL of
adipocyte suspension and plated onto one well of the six-well plate. The ratio of siRNA/cells at
the end of each well of the six-well plate was 100 nM/12 × 105 cells. After 48-hour transfection,
cells were harvested for RNA and protein determination, or they were analyzed for glucose
uptake, or they were replaced into fresh culture medium, which was used for subsequent
enzyme-linked immunosorbent assay (ELISA) analysis.
For the transfection in 3T3-L1 preadipocytes, the same siRNA-targeting TSPO (50 nM)
was transfected when preadipocyte cells reached 80% confluence, by using Lipofectamine®
2000 reagent (Thermo Fisher Scientific) according to the manufacturer’s protocol. After 48
hours, the transfected cells were collected for RNA determination or subjected to differentiation.
4.3.4 ELISA
160
The concentrations of interleukin (IL)-6 and leptin (LEP) in cultured supernatant were
determined with ELISA using the commercially available kits (IL-6 #M6000B and LEP
#MOB00 from R&D Systems, Inc., Minneapolis, MN, USA).
4.3.5 Quantitative PCR
Total RNA was extracted by using RNeasy kit (Qiagen, Limburg, the Netherlands) and
reverse-transcribed with random hexamers using TaqMan reverse-transcription reagents kit
(Thermo Fisher Scientific) following the manufacturer’s protocol. Expression levels of
messenger RNA (mRNA) were quantified using a LightCycler® System 480 (Hoffman-La
Roche Ltd., Basel, Switzerland) and the SYBR green technology (Hoffman-La Roche Ltd.).
Relative gene expression changes were calculated with the comparative Ct method using
ribosomal protein S18 (Rps18) as the internal reference gene. Primer sequences were as follows:
IL-6 (Il6), 5’ – CGG ACC CTT CCC TAC TTC ACA AGT CCG – 3’ and 5’ – CAG GTC TGT
TGG GAG TGG TAT CC -3’; Leptin (Lep), 5’ – TTG ATG AGG TGA CCA AGG TG -3’ and 5’
– GTG GTG GCT GGT GTC AGA T -3’; Pparg, 5′ - CGG AAA TAA AGT CAC CAA AGG
GCT TCC G - 3′ and 5′ - CTC ATC TCA GAG GGC CAA GGA - 3′; Fabp4, 5′ - TTT GGT
CAC CAT CCG GTC AG - 3′ and 5′ - CGA GAT CCC AGT TTG AAG GAA ATC TCG - 3′;
Cebpa, 5’ – TTG GCT TTA TCT CGG CTC TTG C -3’ and 5’ – CGG TAA CAA GAA CAG
CAA CGA GTA CCG 3’; Rps18, 5′ - CAC GGG CTC CAC CTC ATC CTC CGT G - 3′ and 5′ TGA GGA AAG CAG ACA TCG ACC T - 3′.
4.3.6 Glucose uptake assay
Glucose uptake assays were performed as previously described (Lakshmanan et al.,
2003b). Briefly, 48 hours after compound treatment, 3T3-L1 adipocytes were washed twice with
phosphate buffered saline (PBS) and incubated in serum-free medium (DMEM with 0.5% bovine
161
serum albumin [BSA]) for 2 hours, after which, KRBH buffer (Krebs–Ringer bicarbonate buffer
supplemented with 20 mM HEPES, pH 7.4) was added to the cells. After 15 minutes, cells were
stimulated with insulin (100 nM) or PBS (as the basal control). The glucose mixture (0.5 µCi per
sample [3H]-2-deoxyglucose and 100 uM cold deoxyglucose in PBS) was added 15 minutes after
insulin stimulation, and the glucose uptake was allowed to proceed for an additional 15 minutes.
The reaction was stopped by washing the cells with ice-cold PBS for a total of three times, and
cells were dissolved in 1 mL of 0.2 N NaOH. Then, 300 µL of solubilized cells were used to
measure the cell-associated radioactivity by scintillation, counting in triplicates, and the rest of
the lysate was used to quantify the protein concentration. Glucose uptake was corrected for
protein content in each experimental group.
4.3.7 Protein quantification
Protein concentrations were determined by the Bradford Protein Assay Kit (Thermo
Fisher Scientific) using BSA as standard.
4.3.8 Immunoblotting
Protein extracts of human primary preadipocytes or adipocytes were resolved by 4%–20%
sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to polyvinylidene
difluoride membrane. The resolved proteins were immunoblotted by incubating with primary
antibodies toward TSPO (Trevigen, #6361-PC-100) and β-ACTIN (Cell Signaling Technology,
Inc., Beverly, MA, USA; #4970), followed by incubation with secondary horseradish
peroxidase-conjugated anti-rabbit antibody. Immunoreactive bands were visualized by
chemiluminescence on a Fujifilm LAS-4000 camera system (Fujifilm, Tokyo, Japan).
4.3.9 MTT assay
162
Two-day confluent 3T3-L1 preadipocytes, seeded on a 96-well plate, was treated with the
differentiation cocktail MDI with or without PK 11195 for 48 hours. At the end of incubation, 20
µL of 3-(4,5-dimethylthiazol-2-yl)-2,5-dipheny tetrazolium bromide (MTT) was added to each
well and incubated for 4 hours at 37°C. The supernatant was then removed and 200 µL of
dimethyl sulfoxide (DMSO) was added. The absorbance was read at 595 nm and corrected for
the background reading at 690 nm.
4.3.10 Oil Red O staining
To visualize intracellular lipids, differentiated adipocytes were washed and fixed in 10%
formalin for 5 minutes, and then incubated in fresh 10% formalin for at least 1 hour. After
washing with 60% isopropanol, cells were stained for 15 minutes in freshly diluted Oil Red O
solution (six parts 0.35% Oil Red O in isopropanol and four parts water). After a thorough wash
with PBS, the plates were stored in PBS and visualized microscopically.
4.3.11 Statistical analysis
All values are expressed as means ± standard error of the mean (SEM). Data were
analyzed using Student’s t test or one-way analysis of variance (ANOVA), followed by
Bonferroni’s post hoc test. All statistical calculations were performed using GraphPad Prism (v5)
software (GraphPad Software, Inc., La Jolla, CA, USA).
163
4.4 Results
4.4.1 TSPO ligands increased the stimulated lipolysis of adipocytes
Based on the recent study reporting the direct impact of TSPO ligands on adipose tissues
(Thompson et al., 2013), we first tested whether our experimental model, the fully differentiated
mouse 3T3-L1 adipocytes, could respond to TSPO drug ligands in a similar manner. In
agreement with the previous study, the expression of two lipases responsible for more than 95%
of triglyceride hydrolysis in murine adipose tissues (Schweiger et al., 2006), hormone-sensitive
lipase (Hsl) (Figure 4.1A) and adipose triglyceride lipase (Atgl) (Figure 4.1B), were increased in
adipocytes after 48 hours of treatment with PK 11195. In addition, pretreatment of 3T3-L1
adipocytes with PK 11195 for 48 hours induced the maximal rate of glycerol release upon 3
hours of stimulation with the β-adrenergic receptor agonist, isoproterenol (ISO) (Figure 4.1C).
The pro-lipolytic activity of PK 11195 was replicated using another structurally distinct TSPO
ligand – the 2-hexyl-indole-3-acetamide FGIN-1-27 (Figure 4.1D) – rendering TSPO a
biological drug target in adipocytes that can influence hormone-stimulated lipolysis.
4.4.2 Pharmacological activation of TSPO in adipocytes decreased the secretion of “bad”
adipokine IL-6
Proinflammatory cytokines have long been negatively linked to glucose homeostasis.
Circulating levels of both tumor necrosis factor (TNF)α (Tsigos et al., 1999) and IL-6 (Bastard et
al., 2000) are correlated with obesity and insulin resistance. Within adipose tissues, although
macrophages account for nearly the entire production of TNFα, IL-6 is secreted equally from
adipocytes and macrophages (Weisberg et al., 2003). IL-6 production under the influence of
TSPO ligands was examined in 3T3-L1 adipocytes. Following PK 11195 treatment, a significant
reduction in mRNA levels of Il6 (Figure 4.2A), as well as the secretion of IL-6 from adipocytes
164
into the cell medium (Figure 4.2B), were observed. To test whether this TSPO ligand behaves as
an agonist or antagonist of TSPO in adipocytes, siRNA-mediated knockdown of TSPO was
performed in fully differentiated 3T3-L1 adipocytes, which are refractory to transfection. About
75% knockdown of TSPO mRNA expression and 50% knockdown of 18 kDa TSPO protein
levels were achieved (Figures 4.2C and 4.2D) using a protocol specifically designed for siRNA
transfection in fully differentiated adipocytes (Kilroy et al., 2009). After TSPO knockdown, Il6
gene levels in adipocytes (Figure 4.2E) and IL-6 secretion from adipocytes into the cell medium
(Figure 4.2F) were induced, implicating that in adipocytes, the anti-inflammatory effects of PK
11195 are mediated through the activation of TSPO. Reduction of the insulin resistancepromoting IL-6 (Rotter et al., 2003) production from adipocytes via the TSPO ligand may
contribute to their glucose-lowering effects in the system.
4.4.3 Pharmacological activation of TSPO in adipocytes induced the secretion of “good”
adipokine leptin
LEP is secreted almost exclusively by adipocytes. In addition to its well-known functions
in promoting energy expenditure and repressing appetite, it can also improve glucose
homeostasis in lipodystrophic mice (Shimomura et al., 1999) and humans (Oral et al., 2002), and
reverse hyperglycemia in obese mice (Pelleymounter et al., 1995). TSPO activation in 3T3-L1
adipocytes by PK 11195 induced the mRNA levels of leptin (Lep) (Figure 4.3A) and the
secretion of LEP protein from adipocytes (Figure 4.3B), whereas knocking down TSPO
expression decreased both Lep mRNA synthesis and protein secretion from the cells (Figure
4.3C and 4.3D). The upregulated LEP production by TSPO activation in adipocytes may exert
anti-hyperglycemic actions by working on several different organs, including through the
165
regulation of insulin sensitivity in the muscle (Minokoshi et al., 2002) and liver (Kamohara et al.,
1997), and via the induction of insulin secretion from pancreatic β-cells (Covey et al., 2006).
4.4.4 Pharmacological activation of TSPO in adipocytes improved glucose uptake
Adipocytes are a major site for glucose disposal. To delineate the involvement of TSPO
in adipocyte glucose uptake, [3H] glucose accumulation with or without insulin stimulation was
studied after 48 hours of TSPO ligand treatment or in cells where TSPO levels were reduced
using Tspo siRNAs. Basal glucose uptake was not affected by either TSPO activation or
knockdown (Figures 4.4A–4.4C). In the presence of insulin, a significant increase in glucose
uptake was displayed in either PK 11195- (Figure 4.4A) or FGIN-1-27- (Figure 4.4B) treated
adipocytes, whereas a modest reduction in glucose uptake was seen in TSPO siRNA-transfected
adipocytes (Figure 4.4C). Since the cellular content of insulin-sensitive glucose transporter,
GLUT4, is not affected by TSPO activation (data not shown), the insulin signaling cascade in
adipocytes may be the potential mechanism underlying the improvement of insulin-stimulated
glucose uptake in TSPO ligand-treated adipocytes. We should take note here that an
approximately 50% protein knockdown of TSPO in fully differentiated 3T3-L1 adipocytes did
not dramatically affect glucose uptake (Figure 4.4C), as did the functional activation of TSPO by
drug ligands (Figure 4.4A and 4.4B). TSPO may be constitutively active in adipocytes.
4.4.5 Pharmacological activation of TSPO in preadipocyte-induced adipogenesis
In addition to its role as a drug target to modulate the activities of adipocytes, TSPO may
also play a role in adipogenesis, as its expression is upregulated during preadipocyte
differentiation (Li et al., 2014a; Campioli et al., 2011). The process of adipogenesis is divided
into three distinct stages: growth arrest, clonal expansion, and differentiation. When
preadipocytes reach confluence, they enter a temporary quiescent stage of growth arrest at the
166
G0/G1 cell cycle boundary. Upon exposure to a differentiation cocktail (MDI) including IBMX,
dexamethasone, and insulin, post-confluent preadipocytes re-enter the cell cycle and undergo
several rounds of mitosis, termed as mitotic clonal expansion, which is a prerequisite for optimal
differentiation (MacDougald and Lane, 1995). Clonal expansion happens during the first 2 days
after MDI induction (Bernlohr et al., 1985). To examine whether TSPO activation can affect
clonal expansion, 2-day post-confluent 3T3-L1 preadipocytes were treated with MDI in the
absence or presence of TSPO agonist PK 11195 for 48 hours. MTT assay showed that PK
11195-treated preadipocytes proliferate to a higher extent (Figure 4.5A), indicating that TSPO
activation in preadipocytes may induce mitotic clonal expansion and possibly induce
adipogenesis.
The induction of transcription factors, notably peroxisome proliferator-activated receptor
(PPAR) γ, during the early differentiation stage terminates clonal expansion and induces the
abundance of C/EBPα. PPARγ, together with C/EBPα, activate adipocyte-specific genes such as
FABP4 that produce the phenotype of adipocytes (Wu et al., 1999). After significant knockdown
of TSPO by siRNA transfection in 3T3-L1 preadipocytes (Figure 4.5B), we exposed the cells to
differentiation medium for 4 days. TSPO-deficient cells displayed a lower rate of differentiation,
as shown by a lower gene expression of the early differentiation marker Pparg (Figure 4.5C),
suggesting that TSPO is essential for the differentiation ability of preadipocytes. After
supplementing TSPO ligand PK 11195 into the differentiation medium for 10 days, the gene
expression of the terminal differentiation marker Fabp4 was induced in PK 11195-treated cells
(Figure 4.5D), along with a higher amount of lipid staining (Figure 4.5F), indicating increased
adipocyte formation under the influence of TSPO activation. Treatment with FGIN-1-27 also
induced adipogenesis (Figure 4.5E). The pro-adipogenic activity of TSPO ligands (PK 11195
167
and Ro5-5864) was previously identified in human mesenchymal stem cells, with a control
compound (clonazepam), which does not have an affinity to TSPO, and thus does not affect
adipogenesis (Lee et al., 2004).
Interestingly, the stimulatory effect of PK 11195 in differentiation was blocked by the cotreatment of 3,17,19-androsten-5-triol (19-Atriol) (Figure 4.5G), a drug ligand that binds to the
CRAC motif of TSPO and inhibits PK 11195-stimulated steroidogenesis in MA-10 mouse
Leydig tumor cells (Midzak et al., 2011). These data suggest that the effect of TSPO drug
ligands in adipocytes might be mediated through the role that TSPO plays in cholesterol binding
and subsequent cholesterol import into the mitochondria, likely for membrane biogenesis.
4.4.6 TSPO expression in human primary preadipocytes and adipocytes
To evaluate the relevance of our results in human primary cells, we tested TSPO
expression in human primary preadipocytes and adipocytes from two fat depots, omental adipose
tissue and subcutaneous adipocyte tissue. In normal subjects (BMI≈24-27), TSPO protein levels
were increased in both omental (Figure 4.6A) and subcutaneous (Figure 4.6B) differentiated
adipocytes, and they were compared to their corresponding primary preadipocytes. These data
are in agreement with our previous findings that TSPO expression was induced during the
differentiation of mouse 3T3-L1 preadipocytes (Li et al., 2014a) and human SW872 liposarcoma
cells (Campioli et al., 2011), and they imply the involvement of TSPO in the differentiation of
human primary preadipocytes as well.
It was earlier shown (Figures 4.2 and 4.3) that TSPO knockdown in 3T3-L1 adipocytes
altered the production of adipokines and reduced glucose uptake, which may affect peripheral
insulin sensitivity – a characteristic possessed by hypertrophic/dysfunctional adipocytes present
in the obese and diabetic state. Indeed, significantly reduced TSPO levels were observed in
168
adipocytes from high-fat diet-induced obese mice (Thompson et al., 2013). Reduced TSPO
protein levels were observed in omental adipocytes from diabetic donors (body mass index
[BMI]>40) compared to those found in normal subjects (Figure 4.6A), indicating an association
between TSPO expression and adipocyte function in human subjects.
169
4.5 Discussion
In this study, we report that increased TSPO expression during adipogenesis and reduced
TSPO expression in hypertrophic adipocytes are indicative of the potential importance of the
protein in adipocyte formation and function. Moreover, TSPO drug ligands were found to exert
positive effects on the adipocyte intracellular machinery by (1) affecting the production and
secretion of more protective adipokines and less insulin-antagonistic cytokines, (2) inducing
glucose uptake to withdraw glucose from the blood, and (3) enhancing adipogenesis to
accommodate metabolic challenges. Taken together, these data demonstrate a crucial role for
TSPO in adipocytes as a pharmacological target to modulate cellular homeostasis with the
potential to influence systemic glucose metabolism, thus offering new adipocyte-targeting
therapeutic strategies for the treatment of obesity and diabetes.
Glucose homeostasis is controlled by the concerted actions of different organs, including
insulin secretion by pancreatic β-cells in response to elevated glucose, insulin-inhibited glucose
production by the liver, and insulin-stimulated glucose uptake in the muscle and adipose tissues
(Herman and Kahn, 2006). Since the muscle accounts for the majority of glucose disposal (~85%)
after a meal (Kahn, 1996), the contribution of adipose tissue in regulating global glucose levels
was not expected at first. However, this idea is strongly supported by the emergence of the antidiabetic drug and PPARγ ligand, thiazolidinedione, as PPARγ is predominantly expressed in the
adipose tissue and not the muscle (Rosen and Spiegelman, 2006). The mechanism of action of
thiazolidinedione was identified as the enhancement of mitochondrial biogenesis, as well as of
the morphology and function in white adipocytes, thus supporting the concept that altered
adipocyte mitochondrial function might be linked to the pathogenesis of the obesity-driven type
170
2 diabetes mellitus (T2DM) (Kusminski and Scherer, 2012). Thus, targeting adipocyte
mitochondria may be a feasible and attractive pharmacologic means for T2DM treatment.
Mitochondrial TSPO, a protein that has been implicated in several essential
mitochondrial activities ranging from mitochondrial respiration and cholesterol import, to
apoptosis and permeability transition pore function in other cell/tissue types, may have an
underappreciated role in the control of adipocyte mitochondrial function. If such a link exists,
then this could be one of the hidden links to the anti-diabetic actions of TSPO ligands.
In line with the multidimensional role of TSPO in mitochondrial functions, TSPO drug
ligands have been used in a variety of therapeutic applications to alter a diversity of biological
functions such as immune responses, apoptosis, and steroidogenesis, with the latter being the
most extensively studied (Papadopoulos, 1993). The implication of TSPO drug ligands in
treating neurologic and psychiatric diseases, through the ligands’ ability to regulate local steroid
formation in the brain, has been most prevalent in the past decade. Indeed, some TSPO ligands
have entered clinical trials for the treatment of anxiety disorders and diabetic neuropathy
(Rupprecht et al., 2010). In classical steroidogenic cells and hepatic cells, activation of TSPO by
PK 11195 results in increased steroid and 27-hydroxycholesterol (27HC) biosynthesis,
respectively (Lacapere and Papadopoulos, 2003). We recently demonstrated that adipocytes have
the ability to convert cholesterol into pregnenolone and 27HC by the mitochondrial enzymes,
CYP11A1 and CYP27A1 (Li et al., 2014a). Thus, it will be of great interest in the future to
examine whether pharmacological activation of TSPO could also induce the local production of
steroids and/or oxysterols in adipocytes which, in turn, would modulate the metabolic function of
adipocytes. The impact of TSPO drug ligands on other vital adipocyte mitochondrial functions,
however, cannot be ignored. The PPARγ agonist thiazolidinedione, for example, exerts an
171
insulin sensitization effect due, in part, to increased mitochondrial oxidation of the fatty acids in
adipocytes from diabetic patients (Bogacka et al., 2005). The anti-diabetic action of TSPO
ligands may be mediated through the adjustment of multiple mitochondrial functions, as well as
via the intracellular mitochondria number, shape, and distribution. Indeed, the finding that the
CRAC ligand, 19-Atriol, blocked the effect of PK 11195 indicates that the effect of TSPO drug
ligands in adipocytes might be mediated through the cholesterol-binding and transfer into the
mitochondria function of the protein-linked needs for increased membrane biogenesis.
The presence of TSPO by itself may add another layer of protection to normal cellular
activities. Knockdown of TSPO in newly differentiated healthy adipocytes led to negative
metabolic consequences, including the reduction of insulin-stimulated glucose uptake and
irregularities in adipokine release. The changes observed in TSPO-deficient adipocytes could
mimic the metabolic perturbations in hypertrophic adipocytes observed in obese and diabetic
patients, as those dysfunctional adipocytes also contain lower TSPO levels when compared to
normal adipocytes obtained from healthy subjects. Hypertrophic obesity is also associated with a
reduced annual replacement rate of healthy adipocytes (Arner et al., 2010), due to the inability to
recruit preadipocytes and differentiate them into adipocytes (Isakson et al., 2009). Increasing the
number of metabolically active small adipocytes, through the promotion of adipogenesis, may be
another fundamental mechanism underlying the beneficial effects of TSPO drug ligands in
response to different environmental stimuli.
Taken together, based on the published work (Gut et al., 2013; Thompson et al., 2013; Li
et al., 2014a) and the findings presented herein, we propose a model to explain the potential
significance of TSPO during adipogenesis and in adipocytes (Figure 4.7). In this model, (A)
despite a low TSPO expression at the preadipocyte stage, the protein may be essential for the
172
initiation of differentiation. The induction of mitochondrial TSPO expression during
adipogenesis may be a necessary adjustment, as the differentiation program requires sufficient
adenosine triphosphate (ATP) generation to cover energy-demanding processes such as
lipogenesis (Wilson-Fritch et al., 2003; De et al., 2009). TSPO drug ligands might further
enhance the preadipocytes’ adaptive response to over-nutrition by pushing its commitment to
differentiation. (B) Newly differentiated adipocytes have full power of metabolic action, thus
requiring a large amount of ATP to sustain glucose/lipid metabolism (Kusminski and Scherer,
2012). The high expression level of TSPO may contribute to the maintenance of highly activated
mitochondrial functions. (C) Upon chronic metabolic challenges, loss of TSPO expression may
be associated with over-expansion of adipocytes and compromised mitochondrial potential,
leading to a disturbance of cellular homeostasis in hypertrophic adipocytes. (D) Activation of
TSPO by drug ligands, with the ingestion of excess nutrition, may promote lipid consumption
and induce transdifferentiation of white adipocytes into smaller, insulin-sensitive brown-like
adipocytes, thus serving as therapeutic strategies to fight obesity and T2DM.
Although many details remain to be elucidated, the data presented here have shown the
unexplored and underappreciated role of TSPO in adipocyte function. Given the fact that TSPO
drug ligands positively regulate a large spectrum of local events, including adipokine secretion,
glucose metabolism, and adipogenesis, TSPO in adipocytes may emerge as an attractive target
for therapeutic interventions with the potential to impact systemic metabolism.
173
4.6 Acknowledgements
This work was supported in part by a grant from the Canadian Institutes of Health
Research (CIHR grant # 125983) and a Canada Research Chair in Biochemical Pharmacology
(to V.P.). The Research Institute of McGill University Health Centre is supported in part by a
center grant from Fonds de la Recherche Quebec – Santé.
174
Figure 4.1 TSPO ligands upregulate stimulated lipolysis in adipocytes.
(A–B) Quantitative polymerase chain reaction (qPCR) analysis of gene expression of hormonesensitive lipase Hsl (A) and adipose triglyceride lipase Atgl (B) in fully differentiated 3T3-L1
adipocytes after 48 hours of treatment with PK 11195. Results are presented as the mean ±
standard error (n=3); ***P<0.001. (C–D) Glycerol release measured in lipolytic medium
containing ISO (10 µM) collected from 3T3-L1 adipocytes pretreated with PK 11195 (C) or
FGIN-1-27 (D) for 48 hours, and then incubated in lipolytic medium for 3 hours. Values were
corrected for protein concentration in each treatment and were represented as the mean ±
standard error (n=3); *P<0.05.
175
176
Figure 4.2 Activation of TSPO reduces IL-6 production and secretion from adipocytes.
(A–B) After 48 hours of treatment with PK 11195, 3T3-L1 adipocyte cells were collected for (A)
the qPCR analysis of Il6, and cell culture medium was collected for (B) the ELISA analysis of
IL-6 secretion from the cells. (C–E) After 48 hours of TSPO siRNA transfection in differentiated
3T3-L1 adipocytes, cell pellets were collected for (C) the qPCR analysis of Tspo, (D) the
immunoblot analysis of TSPO protein, and (E) the qPCR analysis of Il6; (F) fresh culture
medium was added to 2-day post-transfected 3T3-L1 adipocytes and collected after 48 hours for
ELISA analysis of IL-6 secretion from the TSPO-deficient adipocytes. ELISA results were
corrected for protein concentration in each treatment group. All results are represented as the
mean ± standard error (n=3); *P<0.05; **P<0.01; ***P<0.001.
177
Figure 4.3 Activation of TSPO induces leptin production and secretion from adipocytes.
(A–B) After 48 hours of treatment with PK 11195, 3T3-L1 adipocyte cells were collected for (A)
the qPCR analysis of Lep, and cell culture medium was collected for (B) the ELISA analysis of
leptin secretion from the cells. (C–D) After 48 hours of TSPO siRNA transfection, differentiated
3T3-L1 adipocytes were either collected for (C) the qPCR analysis of Lep or (D) they were
incubated in fresh culture medium for another 48 hours, at which point the medium was collected
for the ELISA analysis of leptin secretion from the cells. ELISA results were corrected for
protein concentration in each treatment group. All results are represented as the mean ± standard
error (n=3); *P<0.05; **P<0.01; ***P<0.001.
178
Figure 4.4 Activation of TSPO improves glucose uptake in adipocytes.
After 48 hours of treatment with (A) PK 11195, (B) FGIN-1-27, or (C) TSPO siRNA, 3T3-L1
adipocytes were serum starved for 2 hours, and then challenged with either PBS (basal) or
insulin (100 nM) for 15 minutes, after which the uptake of 3H-labeled 2-deoxyglucose by the
cells were measured. Results were corrected for protein concentration in each treatment and were
represented as the mean ± standard error (n=3); *P<0.05; **P<0.01.
179
180
Figure 4.5 Activation of TSPO promotes adipogenesis.
(A) Forty-eight hours after exposing 3T3-L1 preadipocytes with the differentiation cocktail, MDI,
in the absence or presence of PK 11195, cell proliferation was measured by MTT assay. (B)
qPCR analysis of Tspo after 48 hours of TSPO siRNA transfection in 3T3-L1 preadipocytes. (C)
48 hours post-transfected 3T3-L1 preadipocytes were induced to differentiation, and after 4 days
into differentiation, cell pellets were collected for the qPCR analysis of early differentiation
marker Pparg. (D–E) qPCR analysis of the terminal differentiation marker, Fabp4, in (D) PK
11195-treated or (E) FGIN-1-27-treated 3T3-L1 cells 10 days after differentiation. (F) Oil red O
staining of lipid droplets in PK 11195-treated 3T3-L1 cells 10 days after differentiation. Images
are representative of the three independent experiments. (Magnification: 4×; Scale bar: 200 µm).
(G) qPCR analysis of Fabp4 in 3T3-L1 cells 10 days after differentiation in the absence or
presence of PK 11195 and/or 19-Atriol. All results are represented as mean ± standard error
(n=3); *P<0.05; **P<0.01; ***P<0.001.
181
Figure 4.6 TSPO expression in human primary preadipocytes and adipocytes.
Immunoblot analysis of TSPO protein levels in primary preadipocytes and adipocytes from (A)
human omental adipose tissues of healthy or diabetic subjects, or from (B) human subcutaneous
adipose tissues of healthy subjects.
182
Figure 4.7 A hypothetical model of the diverse roles of TSPO during differentiation and in
adipocytes.
(A) Albeit at a low level of expression, TSPO in preadipocytes is essential for initiating
differentiation. (B) The high abundance of TSPO in newly differentiated adipocytes maintains
the normal functions of adipocytes. (C) The low expression of TSPO in hypertrophic adipocytes
is associated with adipocyte malfunctions. (D) The administration of TSPO ligand, PK 11195,
together with a high-fat diet, improves adipocyte function and glucose homeostasis.
183
Chapter 5
General Discussion
This thesis addressed the question of whether adipocytes can utilize cholesterol for the de
novo synthesis of steroids and/or oxysterols for the first time. The main findings of this thesis are:
1)
Adipocytes have the ability to synthesize steroids and the oxysterol 27HC de novo
2)
27HC can regulate the differentiation of preadipocytes, as well as the functions of
adipocytes
3)
TSPO in adipocytes serves as a pharmacological target in regulating adipocyte
metabolism
In the following chapter, we will provide a detailed discussion elucidating the
significance of these findings, and we will address how they can advance our current
understanding of adipocyte function and direct future studies in obesity-related research areas.
5.1 De novo steroids in adipocytes
Steroid hormone biosynthesis is initiated in the mitochondria, where CYP11A1 converts
cholesterol to pregnenolone, the parent of all other steroids. Many cells, including adipocytes,
can transform steroids produced by other cells, but only cells possessing the active form of
CYP11A1, which can catalyze this first and rate-limiting step, are defined as “steroidogenic”. In
Chapter 2, we have demonstrated for the first time that CYP11A1 is present in adipocyte
mitochondria at the protein level, and it is active in producing pregnenolone. Thus, we suggested
that adipocytes may have the ability to synthesize steroids de novo. Our findings may present an
184
additional way through which to solve the mysterious relationship between obesity and steroid
hormone disorders.
5.1.1 Final de novo steroid products in adipocytes
The limitation of our study includes that we have not yet identified the final steroid
product(s) in adipocyte steroidogenesis. Since the gene expressions of almost all steroidconverting enzymes downstream of pregnenolone have been discovered previously in human
adipose tissue (reviewed in Chapter 1), I focused my study on the ability of adipocytes to
produce pregnenolone, the unified first step in steroidogenesis of all cells. The HPLCradiometric analysis in Chapter 2 showed that 3T3-L1 differentiated adipocytes were able to
synthesize pregnenolone from 22R-hydroxycholesterol (the soluble analog of cholesterol),
cholesterol, and its precursor mevalonate.
Pregnenolone can then be converted to progesterone, mainly via the mitochondrial form
of 3βHSD, or it can exit the mitochondria and be converted to 17α-hydroxypregnenolone by
CYP17A1 in the ER. 3βHSD and CYP17 are key branch points in steroid biosynthesis, driving
the pathway to the direction of either mineralocorticoid and glucocorticoid production or sex
steroid production (Gilep et al., 2011). As shown by the schematic representation of the classical
steroidogenic pathway (Figure 1.2), without 3βHSD, the pathway cannot proceed with the final
production of mineralocorticoids and glucocorticoids, and without CYP17A1, cells cannot
produce sex steroids. Previous studies predicted the final product of de novo adipose steroid
biosynthesis, if any, as 11-deoxycorticosterone in humans (MacKenzie et al., 2008) and
corticosterone in rodents (Van Schothorst et al., 2005), largely due to the lack of adipose
CYP17A1 presence in their studies. Now, with the identification of equally available 17185
hydroxylase and 17, 20-lyase activities of CYP17A1 in adipose tissue (Kinoshita et al., 2014), de
novo sex steroid biosynthesis in adipose tissue may also be possible. Following the activity of
3βHSD and CYP17A1, the local expression and/or activity of steroid-converting enzymes
specifically involved in mineralocorticoid and glucocorticoid synthesis (CYP21, CYP11B1, and
CYP11B2), as well as in sex steroid synthesis (17βHSDs, aromatase, and 5α-reductase), have
been better studied in adipose tissue, as reviewed in Chapter 1. The relative changes in the
expression or activity of these enzymes may affect the direction of the de novo steroid
biosynthetic pathway in adipose tissue.
One potential problem encountered when predicting the final de novo steroid products in
adipocytes is that studies to date have rarely been performed on primary adipocytes isolated
directly from adipose tissue; rather, they have been conducted on whole adipose tissue or SVF.
Adipocytes are the predominant components of adipose tissue, with the rest of the adipose
compartment composed of extracellular matrix and the SVF of cells, including macrophages,
preadipocytes, fibroblasts, and epithelial cells (Cornelius et al., 1994). The detected
steroidogenic enzymes may be present on different cell types in adipose tissue. To specifically
identify the steroidogenic ability of adipocytes, a pure adipocyte fraction should ideally be
separated from the adipose tissue to demonstrate the expression of all enzymes required for
steroid synthesis from cholesterol, as well as those required for the conversion of the labeled
precursor to active steroids. However, isolated primary adipocytes are quite fragile, and they
remain one of the most difficult cell types to manipulate. Thus far, only the conversion of
cortisone to cortisol has been demonstrated in primary adipocyte fractions (Bujalska et al., 2002),
mainly due to the fast conversion rate (4 hours), and mediated by highly expressed 11βHSD1 in
adipocytes. The steroid production that commences from cholesterol may require a long reaction
186
time, and isolated primary adipocytes may have already lost all their activities before detectable
amounts of steroids can be synthesized. Alternatively, the majority of adipocyte research
initiatives that have studied enzyme activities opt to use adipose tissue explants or in vitrodifferentiated adipocytes from SVF. Adipocytes differentiated from the primary origin can be
easily prepared, and they mimic the metabolic activity of primary adipocytes. In comparison,
tissue explants may have the advantage of maintaining the interaction between different cell
types, allowing the steroids that are produced by one part of the tissue to be further metabolized
in another part. The steroids yielded from tissue explants may truly reflect the final de novo
products from the whole adipose tissue in vivo. The gender-, age-, and depot-specific adipose
steroidogenic pathway may allow for large variance in the identity and amount of the final
steroid products which, in turn, may be related to obesity and its complications.
To accurately identify and quantify adipose steroids in health and disease, different
adipose samples can be extracted and analyzed via liquid chromatography-tandem mass
spectrometry (LC-MS/MS). To prove that a certain steroid is synthesized de novo, rather than
trapped in the tissue from the blood, labeled cholesterol or its precursor should be added into
adipose samples, followed by the LC-MS/MS estimation of de novo products. Since the
steroidogenesis in adipose tissue is quite modest, a large sample volume will be needed to extract
detectable amounts of de novo products. The extremely high content of lipids in adipose tissue
could be a major obstacle to precisely separate and analyze steroid contents in fat cells. The
Folch method (chloroform/methanol (2/1)) applied in Chapter 2, is the most commonly used
method for the extraction of a broad range of lipids (Reis et al., 2013). Based on polarity,
relatively polar lipids (including steroids) are retained to the methanol phase, while lipophilic
lipids are taken by the chloroform phase. In this way, the majority of the neutral lipids contained
187
in fat cells could be separated from steroids. However, due to the toxicity issues associated with
the use of chloroform, especially when dealing with extensive amounts of samples over a long
exposure time, more secure and effective methods for steroid purification from large amounts of
lipid-rich tissues have to be developed in the future.
5.1.2 Role of adipocyte steroidogenesis
After identifying the ability of adipocytes to synthesize steroids de novo, the next
question becomes whether their limited steroidogenic capability could be of physiological
importance. The adipose steroids converted from precursors are known to either contribute
significantly to the circulating level (e.g. estrogen in postmenopausal women) or influence the
local function of fat depots (e.g. cortisol in visceral fat regulates adipogenesis). In the following
section, we will discuss the potential local or systemic implications of adipose steroidogenesis.
5.1.2.1 Local impact of steroidogenic pathway
Research in the past two decades has revealed that tissues other than the adrenals and
gonads express CYP11A1, and that they are capable of the de novo synthesis of biologically
active steroids. These non-classical steroidogenic tissues include the brain, skin, intestine, and
heart (Slominski et al., 2013). It has been noted that the total amount of steroids synthesized de
novo in these tissues is particularly small – usually less than 1% of the hormone-stimulated
steroid synthesis in the adrenals and gonads (Slominski et al., 2013). Therefore, the de novo
synthesis of steroids from these non-classical tissues could not significantly alter circulating
levels, nor could they exert broad physiological effects. Extraadrenal and extragonadal
188
steroidogenesis most likely regulate local homeostasis in a paracrine or autocrine manner (Taves
et al., 2011). In Chapter 2, we noticed upregulated CYP11A1 expression with adipocyte
differentiation of mouse 3T3-L1 and human SGBS cells, suggesting induced steroidogenic
capability in differentiated adipocytes. Previously, 22R-hydroxycholesterol, the direct substrate
of CYP11A1, has been shown to increase adipocyte differentiation (Seo et al., 2004), while
pregnenolone, the product of CYP11A1, inhibits adipocyte differentiation (Lea-Currie et al.,
1998). We then asked whether the steroidogenic activity of CYP11A1 could influence
adipogenesis. Supplementation of aminoglutethimide (AMG), an inhibitor of CYP11A1 activity,
into differentiation media suppressed adipogenesis, as shown by the downregulated gene
expression of the differentiation marker, FABP4 (Figure 5.2B). This result proposed that there
was a local regulatory role of the steroidogenic pathway in adipogenesis. It may be argued that
the inhibitory effect of AMG on adipogenesis is not specific to CYP11A1, as AMG is also an
inhibitor for aromatase (Cocconi, 1994), and adipocytes are well known for the aromatization of
androgens to estrogens (Killinger et al., 1990). The overexpression or knockdown of CYP11A1
in preadipocytes prior to exposure to differentiation media will be undertaken to specify the
involvement of CYP11A1 in preadipocyte differentiation. In addition to adipogenesis, the
biological influence of adipocyte CYP11A1 in modulating adipokine production from the
adipocytes, and in control of the microenvironment within the adipose tissue, also awaits further
investigation.
5.1.2.2 Systemic diseases possibly involving adipose steroidogenesis
Adipose tissue is the largest organ of the human body (by volume), and it has powerful
endocrine functions, which occur mainly through the synthesis and secretion of a wide range of
189
adipokines into circulation. Alterations in the local steroidogenic pathway or the de novo steroid
contents may result in the abnormal production of adipokines, which could then mediate the
systemic influences contributing to the pathogenesis of obesity-related disorders.
5.1.2.2.1 Cardiovascular diseases
Obesity is positively correlated with hyperaldosteronism (Goodfriend et al., 1998).
Concurrently, weight loss results in lower aldosterone and blood pressure levels in obese
hypertensive subjects (Tuck et al., 1981). Thus, aldosterone has been suggested as a biochemical
link between obesity and cardiovascular risk factors. An excess accumulation of fat tissues might
increase circulating aldosterone, as indicated by compelling data that adipocytes can secret a yet
unidentified product that stimulates both STAR expression and aldosterone synthesis in
adrenocortical cells (Ehrhart-Bornstein et al., 2003; Schinner et al., 2007). Of many adipocytederived products are components of the renin–angiotensin system, including angiotensin II (Ang
II) (Thatcher et al., 2009). Ang II is well known as an endogenous stimulus for adrenal
aldosterone synthesis (Miller and Bose, 2011). Moreover, the adipocyte itself may be a
secondary source of aldosterone, as indicated by adipocyte CYP11B2 expression and aldosterone
release into the cell culture medium from adipocytes (Nguyen Dinh et al., 2011). Just like that in
the adrenocortical cells, Ang II can also stimulate aldosterone secretion from adipocytes. In
addition, the levels of aldosterone released from adipocytes isolated from obese mice are higher
than those from lean mice (Briones et al., 2012). Therefore, the increased local renin–
angiotensin–aldosterone system present in the excess adipocytes of obese states may provide an
additional contribution to elevated aldosterone levels. However, whether aldosterone is
synthesized de novo in adipocytes, rather than converted from precursors in cell culture medium,
190
needs to be confirmed. Conversely, plasma aldosterone induced in obesity can negatively affect
adipocyte function via the action of the mineralocorticoid receptor (MR) present on adipocytes
(Caprio et al., 2007); moreover, MR blockade in obese mice can reverse adipocyte dysfunction
(Hirata et al., 2009) and correct hypertension (Tirosh et al., 2010). Taken together, adipocytes
may serve as a putative link between aldosterone and obesity-associated cardiovascular disease.
5.1.2.2.2 Reproductive diseases
It is well known that both obesity and excessive leanness result in reproductive
dysfunction. The local production of androgens and estrogens (through enzyme conversion from
their respective precursors) in adipose tissue significantly contributes to circulating levels of sex
steroids (Boulton et al., 1992), and signaling proteins produced by adipose tissue such as leptin,
adiponectin, and chemerin have demonstrated potential roles in regulating gonadal
steroidogenesis (Campos et al., 2008). Our discovery of the steroidogenic ability of adipose
tissue may represent an additional and interesting view that can connect the available data and
place adipose tissue within the complex equation by which obesity regulates steroid hormone
disorders and reproductive function.
In males, low plasma testosterone levels are tightly associated with obesity (Glass et al.,
1977), especially visceral obesity (the accumulation of abdominal adipose tissue) (Seidell et al.,
1990). The precise mechanism that connects androgen level and adipose tissue
accumulation/distribution remains unclear. One hypothesis is that leptin, an adipocyte-derived
product whose circulating concentrations increase proportionally with fat reserves (Maffei et al.,
1995), may exert a direct and negative action on hCG-stimulated testosterone secretion from
testis, thus contributing to the pathogenesis of androgen reduction in male obesity (Isidori et al.,
191
1999). Among the fat tissues distributed throughout the body, gonadal fat seems to have a special
relationship with reproductive status. The surgical removal of epididymal adipose tissue
(associated with testis), but not inguinal adipose tissue (non-gonadal adipose tissue), appears to
inhibit spermatogenesis in rodents without affecting the circulating testosterone levels (Chu et al.,
2010). This result suggests a yet unidentified local factor that is secreted by epididymal adipose
tissue, and which is necessary to support the production and maturation of sperm (Chu et al.,
2010). Among many other possibilities, the de novo synthesized androgens may serve as a top
candidate, and they may expose adipocytes to a significant amount of active androgens at the
local level. The stimulation of androgen receptors in epididymal adipose tissue was reported to
inhibit lipogenesis in vivo and result in the local accumulation of linoleic acid and α-linoleic acid
(Caesar et al., 2010), the fatty acid species known to promote spermatogenesis (Lenzi et al.,
1996). Unlike that in the adipose tissue of women (MacKenzie et al., 2008; Wang et al., 2012b),
key components of the steroidogenic pathway such as STAR and CYP11A1 have not been
identified in the adipose tissue of men. The physiological relevance of adipocyte steroidogenesis
in regulating male obesity and reproductive function remains to be established.
In females, the hypothesis that adipocyte steroidogenesis plays a potential role in
regulating reproductive disorders may be supported by studies on PCOS, which is frequently
associated with obesity (Pasquali et al., 2006). PCOS is responsible for 75% of anovulatory
infertility and affects about 10% of women of reproductive ages (Franks, 1995). About 50% of
diagnosed PCOS women are overweight, and obese women often display more severe symptoms
such as anovulation and hyperandrogenism than do normal-weight women with PCOS
(Gambineri et al., 2002). Due to its association with a cluster of reproduction and metabolism
disorders (Dunaif, 1997), the etiology of PCOS is complex, and the interrelationship between the
192
accretion of adipose tissue and PCOS is not completely understood. Adipocytes from women
with PCOS are characterized by cell size enlargement, insulin resistance, and the abnormal
secretion of adipokines (Villa and Pratley, 2011). Chemerin, a novel adipokine with increasing
serum levels in obese women and in PCOS subjects (Tan et al., 2009), was proposed as a
negative regulator of ovarian follicular development, contributing partially to the onset of PCOS
(Kim et al., 2013). In a 5α-DHT-induced rat model that recapitulates the reproductive and
metabolic phenotypes of human PCOS, chemerin and its receptor was evident in ovarian cells,
and recombinant chemerin decreased estradiol secretion from granulosa cells by inhibiting
CYP11A1 and aromatase expression (Wang et al., 2012c). In addition to adipokine synthesis, a
complete steroidogenic system was identified in the adipose tissue of women (MacKenzie et al.,
2008; Wang et al., 2012b). In the subcutaneous adipose tissue of women with PCOS, the
enzymes responsible for the synthesis of testosterone (e.g. 3βHSD1, 3βHSD2, and AKR1C3)
were induced, whereas the enzyme that inactivated testosterone (i.e. 5α-reductase) was
downregulated when compared to the controls (Wang et al., 2012b). The local modulation of sex
steroid pre-receptor concentrations may result in the abnormal secretion of adipokines from
adipose tissue, leading to the metabolic impairment observed in PCOS patients. With the
expansion of fat volume in obese women, the imbalance of local androgen to estrogen levels in
adipose tissue may be emphasized to the extent that it could even contribute to
hyperandrogenism in subjects with PCOS. Future studies are vastly needed to better understand
the implications of adipocyte steroidogenesis in hyperandrogenism observed in female
reproductive disorders.
193
5.2 De novo 27HC in adipocytes
Due to low pregnenolone production and the presence of unknown cholesterol
metabolites, other than classical steroid hormones, we decided to explore other possible
cholesterol metabolism pathways in adipocytes. The oxysterol, 27HC, has been confirmed as one
of the cholesterol products from adipocytes of rodents and humans. Unlike the steroid hormones,
the study of oxysterols is a new and emerging area of research. Evidence about the presence and
biological activity of oxysterols in adipocytes is sparse. In this section, we will relate the
potential physiological impact of the 27HC biosynthetic pathway in adipocytes to the existing
literature about 27HC’s influence in obesity and its related diseases.
5.2.1 Co-expression of the steroid and 27HC biosynthesis pathway in adipocytes
CYP11A1 and CYP27A1, the rate-limiting enzymes of steroid and 27HC biosynthesis,
respectively, are both operative in adipocytes. By sharing the same substrate (cholesterol) and
the same redox partner (ferredoxin) to perform the hydroxylation reaction, these two
mitochondrial P450s are most likely in a competitive relationship. In our study, the inhibition of
CYP11A1 activity by the AMG upregulated the de novo synthesis of 27HC in 3T3-L1
differentiated adipocytes, and it increased the production of some other cholesterol metabolites
(7α-HC and 4β-HC) (Figure 5.1C). This raised an interesting possibility that a reduction in the
steroidogenic ability of adipocytes may demand less cholesterol and permit the formation of
other cholesterol metabolites in a higher amount. The inverse relationship between multiple
cholesterol-metabolizing enzymes was also observed in the other cell types where these enzymes
coexpress. For instance, in ovarian mitochondria, CYP11A1 inhibitor AMG substantially
induced CYP27A1 activity, whereas pregnenolone, the product of CYP11A1, lowered 27HC
194
production in a dose-dependent manner (Rennert et al., 1990). To determine which enzymatic
pathway is more predominant in adipocytes, the direct products of the enzymes (i.e.
pregnenolone for CYP11A1 and 27HC for CYP27A1) should be quantified in adipose tissue
homogenates via gas chromatography–mass spectrometry (GC-MS), following the established
procedure in the steroid/oxysterol analysis (Mast et al., 2011). The quantification of
pregnenolone and 27HC may suggest the relative contribution of CYP11A1 and CYP27A1 in
cholesterol metabolism in adipose tissue.
5.2.2 Potential contribution of adipocyte-derived 27HC at the physiological level
In Chapters 2 and 3, we showed the impact of exogenous 27HC in preadipocyte
differentiation and adipocyte function, including lipid metabolism, glucose uptake, and
adipokine secretory activity. However, in most of these functionality studies, 27HC was only
effective at a relatively high dose (i.e. 10 µM). Whether the 27HC synthesized de novo in
adipocytes could contribute to a local level that is high enough to exert significant biological
activity is still unknown. In humans, circulating 27HC levels range from 150–730 nM, and they
are positively correlated with cholesterol levels (Brown and Jessup, 1999). Thus, the level of
27HC is predictably much higher in obesity, as the cholesterol level can be 20 times higher
(Brown and Jessup, 1999). Thus far, the concentrations of oxysterols detected in human adipose
tissue are ≤1 µM in normal subjects, but their local adipose levels are increased with obesity
(Murdolo et al., 2013; Jove et al., 2014). Adipose tissue may behave as a lipophilic store for
oxysterols, and their adipose concentrations may be associated with circulating levels. A recent
study conducted with rodents showed that the 27HC concentration in rat adipose tissue was
induced with obesity (Wooten et al., 2014). Information regarding the in vivo production and
195
concentration of 27HC in human adipose tissue is still lacking. A microdialysis technique was
proposed to measure oxysterols produced in human adipose tissue. Briefly, microdialysis probe
membranes are inserted into the opposite site of subcutaneous abdominal adipose tissue in lean
or obese subjects, and the interstitial fluid of adipose tissue and serum are collected at 1-hour
intervals to check oxysterol concentrations by GC-MS (Murdolo et al., 2008). In this way, the
contribution of adipocyte-produced 27HC to either a local or systemic level could be estimated.
The interstitial concentration of other adipocyte-derived products, such as leptin and cytokines,
can be measured simultaneously to study the potential interplay of de novo oxysterols and
adipokines in adipose tissue.
5.2.3 27HC and obesity-related diseases
Obesity is a health problem that raises the incidence of many diseases including diabetes,
dyslipidemia, atherosclerosis, hypertension, and cancer. The precise mechanisms linking obesity
and these associated diseases are still not clear. Data from recent investigations have postulated
that 27HC, whose plasma concentration is elevated in obesity (Crosignani et al., 2011), is an
exciting new driver for atherosclerosis (Umetani et al., 2014) and breast cancer (Nelson et al.,
2013; Wu et al., 2013). Although the cell or tissue sources from which 27HC originates have not
yet been identified, extra adipose tissues seem to be a promising candidate that contributes to the
induced 27HC level that occurs in obesity.
196
5.2.3.1 27HC and atherosclerosis
27HC is the most prevalent oxysterol accumulated in atherosclerotic lesions (or plaques)
where its concentration is two orders of magnitude higher than the circulating level (Brown and
Jessup, 1999). Atherosclerotic lesions can partially or completely block the blood flow, leading
to a heart attack. To determine the impact of the induced endogenous 27HC in atherosclerosis,
researchers deleted Cyp7b1, the metabolizing enzyme of 27HC, to elevate 27HC levels in mice.
They showed that in the setting of normal cholesterol status, 27HC increases lipid deposition into
the aortic medial layer. The deletion of Cyp7b1 in an atherosclerotic Apoe-/- mouse model
revealed that in the setting of hypercholesterolemia, elevated 27HC promotes the formation of
atherosclerotic plaques. To delineate the underlying mechanisms of 27HC action, the team
employed wild-type mice and indicated that increased 27HC levels enhanced the attachment of
proinflammatory macrophages to the arterial walls through an estrogen receptor-mediated
mechanism, thus allowing more atherosclerotic plaques to form. By antagonizing estrogen
receptors, 27HC was shown to prevent the beneficial effects of estrogen in protecting against
atherosclerosis (Umetani et al., 2014). Since 27HC levels raise with age (Burkard et al., 2007)
and with obesity (Crosignani et al., 2011), the current finding may explain why estrogen
hormone therapy may not offer cardiovascular benefits in postmenopausal women (Mendelsohn
and Karas, 2005) who have greater risks of developing obesity (Carr, 2003). Targeting
CYP27A1 to lower 27HC synthesis may offer new strategies to fight atherosclerosis. The
conclusion of this most recent study by Umetani et al. (Umetani et al., 2014) may be surprising
at the present moment because previous studies have established that 27HC is an
atheroprotective molecule (Bertolotti et al., 2012; Zurkinden et al., 2014), as it acts as a ligand
for liver X receptor and promotes reverse cholesterol transport from the macrophages (Fu et al.,
197
2001). The benefit and risk ratio of 27HC may vary based on different experimental models or
during different developmental stages. These intriguing results require further investigation in
human model systems.
5.2.3.2 27HC and breast cancer
27HC is the first endogenous selective estrogen receptor modulator (SERM) to be
identified (Umetani and Shaul, 2011). In breast cancer cells, 27HC can act as an endogenous
SERM with partial agonist activity, and it stimulates breast cancer growth in vitro (DuSell et al.,
2008). In late 2013, Nelson et al. first reported that in the mouse model of ER-positive breast
cancer (via the implantation of breast cancer cells into mice), not only was 27HC directly
involved in breast cancer progression, but it also increased the cancer spread to other organs
including the lungs. In these mice fed with a high-fat diet, circulating cholesterol and 27HC, as
well as intratumor 27HC levels, were increased, accompanied by a 30% faster growth rate of the
tumor. The tumor-promoting effect was partially reversed by the treatment of statin (to lower
cholesterol levels) or specific CYP27A1 inhibitors (to lower the 27HC synthesis from
cholesterol). Thus, 27HC has been proposed as a link connecting hypercholesterolemia and
breast cancer risks (Nelson et al., 2013). In ER-positive breast cancer patients, 27HC content was
induced about 3-fold in normal breast tissues when compared to the control, and local levels of
27HC in the breast tumors of the patients were even higher. Interestingly, there was no
association between serum 27HC and tumor 27HC content, suggesting that 27HC levels within
breast tumors can be locally modulated. Indeed, CYP27A1 tumor expression was increased with
the aggressiveness of the tumors, and lower level of tumor CYP7B1, the enzyme breaking down
27HC, was associated with the lower survival rate of the patients (Wu et al., 2013). The
198
researchers concluded that 27HC produced within the tumor, in addition to 27HC synthesized
somewhere else and transported into the tumor, may contribute to breast cancer growth (Wu et
al., 2013; Nelson et al., 2013). In terms of the potential local source of 27HC, macrophages
express a high level of CYP27A1 (Quinn et al., 2005), and macrophage infiltration into tumors
has been associated with more aggressive tumors (Coussens and Werb, 2002). Our findings of
27HC biosynthesis in adipocytes may suggest that breast adipose tissue is an additional source of
27HC, which could contribute to the exposure of breast tissues to 27HC in the local environment.
5.3 TSPO in adipocytes
TSPO serves as a drug target that can manipulate steroids and 27HC biosynthesis in
steroidogenic and hepatic cells, respectively. In Chapter 2, we demonstrated that adepocytes had
the ability to synthesize steroids and 27HC de novo, and in Chapter 4, we showed that the
treatment of a TSPO drug ligand in adipocytes positively regulated the metabolic status of
adipocytes. Whether the local production of steroids or 27HC is involved in the beneficial effects
of TSPO drug ligand in adipocytes, and whether adipocyte TSPO could serve as a drug target in
obesity treatment, warrant future investigation.
5.3.1 TSPO and steroid or 27HC biosynthesis in adipocytes
The incubation of mature 3T3-L1 adipocytes for 48 hours with [3H]MVA in the presence
of TSPO ligand PK 11195 increased the local production of oxysterols, including 27HC and
certain steroid analogs (Figure 5.1B) when compared to the control-treated cells (Figure 5.1A).
In addition, the radiolabeled products matching the relative retention times of the oxysterols
199
synthesized through the microsomal cholesterol-metabolizing enzymes, including 7α-HC
(Rt≈17.5 minutes) and 4β-HC (Rt≈22.5 minutes), were decreased in PK 11195-treated
adipocytes (Figure 5.1B). This result suggested that the TSPO ligand may promote the
cholesterol transport to mitochondrial enzymes in favor of 27HC and steroid synthesis in
adipocytes. There are two major questions that remained in this part: (1) What exactly are the
local steroid/oxysterol products that are upregulated by TSPO ligand in adipocytes? (2) Can the
increased local steroid/oxysterol products mediate the TSPO ligand’s effects in adipocyte
function observed in Chapter 4? To confirm the identity of the steroid/oxysterol products
regulated by the TSPO ligand, the HPLC fractions matching the retention times of the products
will be collected and analyzed by LC-MS/MS. After identifying these products, an appropriate
amount of the products will be added to the adipocytes to carry out these functional studies. If
the biological functions of the local products coincide with the TSPO ligand’s activities, the role
that TSPO plays as a pharmacological target in regulating adipocyte steroid/oxysterol synthesis
could be one of the underlying mechanisms mediating the TSPO ligand’s influence in lipid and
glucose metabolism. To fully uncover the functional impact of adipocyte TSPO, an adiposespecific knockout model of TSPO should be generated, and the local concentration of
steroids/oxysterols should be measured in adipose tissue, along with the systemic metabolic
parameters.
One estimate of the elevated local steroid-related products in adipocytes by the TSPO
drug ligand is the steroid esters. The radiolabeled products of adipocytes incubated with
[3H]MVA+PK 11195 and eluted from reverse-phase HPLC between retention times of 6–10
minutes (Figure 5.1B) are more hydrophobic than the standards of classical steroid hormones
(most steroids are eluted before 5.5 minutes), but they are less hydrophobic than the majority of
200
oxysterol standards (most oxysterols are eluted after 12 minutes). Thus, this fraction of products
could belong to a family of steroid derivatives with hydrophobic properties. Given that adipose
tissue is one of the most active sites for the storage, synthesis, and metabolism of steroid fatty
acid esters (Vihma and Tikkanen, 2011), the local lipophilic steroid derivatives modulated by
TSPO ligands in adipocytes could possibly be the fatty acid esters (FAE) of steroids,
characterized as steroids bound to the long fatty acid carbon chain by an ester bond (Hochberg,
1998). The esterification of steroid hormones in human adipose tissue was first characterized by
Kanji et al. in 1999, and the acyltransferase activity of estradiol in adipose tissue was shown to
be several-fold higher than in plasma and 20-fold higher than in placenta (Kanji et al., 1999).
This raised a possibility that the locally formed steroid hormones could be further modified and
stored in FAE form in adipose tissue (Badeau et al., 2007). Early studies have already indicated
that adipose tissue was a reservoir for long-lived steroid esters (Larner et al., 1992), including
DHEA-FAE (Wang et al., 2011) and estradiol-FAE (Badeau et al., 2007). In non-pregnant
premenopausal and postmenopausal women, the concentration of estradiol-FAE in adipose tissue
was several times higher than in plasma, and an overwhelming majority of estradiol in adipose
tissue existed in the form of estradiol-FAE (Badeau et al., 2007). Steroid FAE are hormonally
inactive and capable of performing biological functions only following hydrolysis into free
steroids. HSL, known to break down triglycerides in adipose tissue (Kraemer and Shen, 2002),
can also catalyze the hydrolysis of steroid FAE (Lee et al., 1988). It has been speculated that the
regulation of enzymatic activities in the esterification and de-esterification of steroid hormones
residing or synthesized locally in adipose tissue could modify the local levels of biologically
active steroids and represent a therapeutic interest in treating steroid hormone disorders (Wang et
al., 2012a; Wang et al., 2013).
201
5.3.2 Metabolic consequences of TSPO activation as related to obesity
Obesity is commonly associated with dyslipidemia, which is characterized by an elevated
blood level of triglycerides and low-density lipoprotein (LDL) cholesterol, as well as by a
decreased level of high-density lipoprotein (HDL) cholesterol (Grundy, 2004). Excess nutrient
uptake may lead to the onset of obesity. The possible anti-obesity effect of TSPO has only been
recently suggested using the high-fat diet-induced obese mouse model (Gut et al., 2013). The
administration of TSPO ligand, PK 11195, significantly suppressed the weight gain induced by a
high-fat diet. Although food intake was not altered, PK 11195 treatment improved the serum
lipid profile by lowering LDL and cholesterol levels (Gut et al., 2013). Adipose tissue plays an
important role in lipid homeostasis by regulating lipogenesis, lipolysis, and fatty acid oxidation.
Decreased lipogenesis, increased lipolysis, and fatty acid oxidation in adipose tissue may
orchestrate an improved lipid profile (Arner et al., 2011). Indeed, another independent study has
shown the reduced expression of sterol regulatory element-binding protein 1c (SREBP-1c, a
master regulator of de novo lipogenesis) and the elevated expression of HSL (a major lipolytic
enzyme in hydrolyzing triglycerides) in the white adipose tissue of HFD-fed mice under the
treatment of PK 11195 (Thompson et al., 2013). However, the extent to which the anti-obesity
effect of TSPO activation can be attributed to its involvement in adipose tissue remains debatable.
TSPO is widely distributed in a variety of metabolic tissues such as the liver (Woods et al., 1996),
cardiovascular system (Veenman and Gavish, 2006), pancreatic islet (Giusti et al., 1997), bone
(Rosenberg et al., 2011), and brown adipose tissue (Gonzalez et al., 1988). TSPO activation in
different metabolic tissues may coordinately contribute to the reduced weight gain and lowered
glucose level observed in PK 11195-treated diet-induced obese mice.
202
Both diet-induced obese and genetically modified obese mouse models have revealed a
reduction of TSPO expression in brown and white adipose tissue as a function of obesity
(Thompson et al., 2013). In line with adipose tissue, a HFD was previously shown to decrease
TSPO binding capacity in rat liver and aorta in association with increased local oxidative stress
and serum cholesterol levels (Dimitrova-Shumkovska et al., 2010). It is not clear whether
downregulated TSPO in these tissues is a compensatory reaction to a HFD, or if it is a precipitant
that leads to weight gain. The primary function of adipose tissue is to store and release energy in
response to demand. When there is an upcoming flood of new energy, adipose tissue may
undergo dramatic changes to accommodate more lipids and offer beneficial metabolic effects
before resulting in substantial weight gain (Dahlman et al., 2005; Assali et al., 2001). In human
studies, adipocyte genes regulated by caloric intake, independent of weight alteration, were
identified by analyzing the overlapping changes in the adipocyte gene profile from healthy
subjects undergoing over-feeding and from obese subjects undergoing caloric restriction
followed by re-feeding (Franck et al., 2011). TSPO and its endogenous ligand, DBI, were among
50 upregulated adipocyte genes involved in caloric intake, suggesting that transcriptional
changes in adipocyte TSPO was solely responding to energy intake rather than body weight
changes, and that increased adipocyte TSPO may be related to energy deposition rather than
expenditure when the energy source is abundant (Franck et al., 2011). Therefore, the induction of
TSPO expression may be a combat action of adipose tissue toward weight gain in response to a
HFD; only when obesity is established will TSPO expression decrease in adipocytes. The exact
mechanism through which TSPO is downregulated as a consequence of obesity remains
unknown. The fact that PK 11195 administration inhibited body weight gains to a greater extend
in male rats than in female rats (Jing et al., 2000) suggested the participation of sex steroids,
203
whose biosynthesis could be modulated by TSPO-mediated mitochondria cholesterol transport.
TSPO has a high-affinity cholesterol recognition amino acid (CRAC)-binding domain, and the
CRAC peptide has been recently used as an anti-atherogenic agent to reduce circulating
cholesterol levels and the formation of aortic lesions in guinea pigs fed with a high cholesterol
diet or in ApoE knockout mice (Lecanu et al., 2013). The loss of TSPO in enlarged adipocytes
may decrease the efficiency of mitochondrial cholesterol trafficking, and it may perhaps lead to
the decreased conversion of cholesterol to steroids inside the mitochondria. The unhealthy
adipocytes may then evoke or reinforce immune responses by luring more macrophages to the
adipose tissue depots. The presence of TSPO in macrophages is also important to facilitate
cholesterol efflux, reduce macrophage cholesterol loading, and prevent foam cell formation
(Taylor et al., 2014). Thus, maintaining mitochondria TSPO function in either adipocytes or
macrophages within adipose tissue could be therapeutically useful in managing obesity.
Bioavailable TSPO ligands, which are used in antianxiety treatment without obvious side effects
(Rupprecht et al., 2009), may attract promising development in metabolic diseases as well.
Future studies are necessary to explore the mechanism of TSPO action in metabolic tissues and
to determine the human relevance of the anti-obesity effect of TSPO.
204
5.4 Final conclusion
This thesis demonstrated for the first time that mouse, rat, and human adipocytes are all
capable of synthesizing steroids and oxysterols de novo. 27-Hydroxycholesterol (27HC), the
most abundant endogenous oxysterol in human circulation, has been identified as one of the
major cholesterol metabolites in adipocytes, and its biosynthetic pathway serves as an
intracellular regulator for adipocyte development and function. We believe this thesis can help us
better understand the functions of adipose tissues, the largest endocrine organ in the body, in the
development and progression of obesity-related diseases. The regulation of active
steroids/oxysterols within adipose tissue, through the de novo biosynthesis pathway, may shed
light on new therapeutic approaches in the treatment of obesity.
205
Figure 5.1 Regulation of local steroid and oxysterol biosynthesis in adipocytes
HPLC–radiometric analysis of radiolabeled cholesterol metabolite formation after 48 h of
incubation with [3H]MVA in 3T3-L1 adipocytes in the absence (A) or presence of (B) TSPO
ligand PK 11195 (10 µM) or (C) CYP11A1 inhibitor aminoglutethimide tartrate (AMG) (500
µM). All results from HPLC–radiometric assays are representative of at least three independent
experiments.
206
Figure 5.2 Inhibition of CYP11A1 suppresses adipogenesis
(A) Cell proliferation was measured by MTT assay 4-day after exposing 3T3-L1 preadipocytes
with different concentrations of aminoglutethimide tartrate (CYP11A1 inhibitor). (B) qPCR
analysis of the terminal differentiation marker Fabp4 in 3T3-L1 cells 10 days after
differentiation in the absence or presence of aminoglutethimide tartrate. Results are represented
as mean ± S.E. (n=3); ***p<0.001. (C) Oil red O staining of lipid droplets in aminoglutethimide
tartrate-treated 3T3-L1 cells 10 days after differentiation. Images are representatives of three
independent experiments. (Magnification: 4 x).
207
Original contributions
This thesis has made several significant original contributions to knowledge.
First, we have demonstrated for the first time that adipocytes have the potential to utilize
cholesterol for the synthesis of steroid hormones and oxysterols. This finding may change the
traditional view of adipocytes as a simple storage site for steroids. The ability of adipocytes in
modulating the metabolic fate and the concentrations of local steroids/sterols may provide an
additional mechanistic rationale between steroid disorders and obesity-related diseases.
Second, we have identified 27 hydroxycholesterol (27HC) as one of the cholesterol
metabolites synthesized in adipocytes, originated either from rodent or human cell lines or
primary progenitors. The higher de novo production of 27HC in human omental adipocytes, in
comparison to human subcutaneous adipocytes, suggests a depot-specific role of the local 27HC
biosynthetic pathway in central obesity. The higher expression of CYP27A1 in omental
adipocytes from insulin-resistant obese subjects, in comparison to normal-weight insulinsensitive subjects, implies an increased 27HC production in omental fat of obese and type 2
diabetic patients. This result invites future investigations to evaluate the cause and effect
relationship between the omental 27HC level and clinical features of insulin resistance obesity.
Third, we have discovered that drug ligands of the translocator protein (18 kDa) (TSPO)
are able to improve several key metabolic activities of adipocytes, with potential influence to
control global glucose level. Given the essential role adipocyte plays in energy and glucose
homeostasis, TSPO may serve as a new adipocyte target for therapeutic interventions in obesity
and type 2 diabetes treatments. This result further strengthens the evidence that adipocyte is an
underappreciated and a direct target in treating metabolic diseases.
208
Together, the results presented in this thesis unveiled a new role of adipocytes in
steroid/oxysterol biosynthesis and a new drug target, TSPO, in adipocytes. Future studies are
warranted to address the physiological significance of adipocyte steroid/oxysterol biosynthesis
and the methodologies to directly target adipocytes for therapeutic purposes.
209
Reference List
Alberti,K.G., Eckel,R.H., Grundy,S.M., Zimmet,P.Z., Cleeman,J.I., Donato,K.A., Fruchart,J.C.,
James,W.P., Loria,C.M., and Smith,S.C., Jr. (2009). Harmonizing the metabolic syndrome: a
joint interim statement of the International Diabetes Federation Task Force on Epidemiology and
Prevention; National Heart, Lung, and Blood Institute; American Heart Association; World
Heart Federation; International Atherosclerosis Society; and International Association for the
Study of Obesity. Circulation 120, 1640-1645.
Ali,A.T., Hochfeld,W.E., Myburgh,R., and Pepper,M.S. (2013). Adipocyte and adipogenesis.
Eur. J. Cell Biol. 92, 229-236.
Anholt,R.R., Pedersen,P.L., De Souza,E.B., and Snyder,S.H. (1986). The peripheral-type
benzodiazepine receptor. Localization to the mitochondrial outer membrane. J. Biol. Chem. 261,
576-583.
Anuka,E., Gal,M., Stocco,D.M., and Orly,J. (2013). Expression and roles of steroidogenic acute
regulatory (StAR) protein in 'non-classical', extra-adrenal and extra-gonadal cells and tissues.
Mol. Cell Endocrinol. 371, 47-61.
Anzini,M., Cappelli,A., Vomero,S., Seeber,M., Menziani,M.C., Langer,T., Hagen,B.,
Manzoni,C., and Bourguignon,J.J. (2001). Mapping and fitting the peripheral benzodiazepine
receptor binding site by carboxamide derivatives. Comparison of different approaches to
quantitative ligand-receptor interaction modeling. J. Med. Chem. 44, 1134-1150.
Arner,E., Westermark,P.O., Spalding,K.L., Britton,T., Ryden,M., Frisen,J., Bernard,S., and
Arner,P. (2010). Adipocyte turnover: relevance to human adipose tissue morphology. Diabetes
59, 105-109.
Arner,P. (2005). Human fat cell lipolysis: biochemistry, regulation and clinical role. Best. Pract.
Res. Clin. Endocrinol. Metab 19, 471-482.
Arner,P., Bernard,S., Salehpour,M., Possnert,G., Liebl,J., Steier,P., Buchholz,B.A., Eriksson,M.,
Arner,E., Hauner,H., Skurk,T., Ryden,M., Frayn,K.N., and Spalding,K.L. (2011). Dynamics of
human adipose lipid turnover in health and metabolic disease. Nature 478, 110-113.
Asada,S., Kuroda,M., Aoyagi,Y., Fukaya,Y., Tanaka,S., Konno,S., Tanio,M., Aso,M., Satoh,K.,
Okamoto,Y., Nakayama,T., Saito,Y., and Bujo,H. (2011). Ceiling culture-derived proliferative
adipocytes retain high adipogenic potential suitable for use as a vehicle for gene transduction
therapy. Am. J. Physiol Cell Physiol 301, C181-C185.
Assali,A.R., Ganor,A., Beigel,Y., Shafer,Z., Hershcovici,T., and Fainaru,M. (2001). Insulin
resistance in obesity: body-weight or energy balance? J. Endocrinol. 171, 293-298.
Atzmon,G., Yang,X.M., Muzumdar,R., Ma,X.H., Gabriely,I., and Barzilai,N. (2002).
Differential gene expression between visceral and subcutaneous fat depots. Horm. Metab Res. 34,
622-628.
210
Auchus,R.J., Lee,T.C., and Miller,W.L. (1998). Cytochrome b5 augments the 17,20-lyase
activity of human P450c17 without direct electron transfer. J. Biol. Chem. 273, 3158-3165.
Azcoitia,I., Sierra,A., Veiga,S., and Garcia-Segura,L.M. (2005). Brain steroidogenesis: emerging
therapeutic strategies to prevent neurodegeneration. J Neural Transm 112, 171-176.
Babiker,A., Andersson,O., Lindblom,D., van der Linden,J., Wiklund,B., Lutjohann,D.,
Diczfalusy,U., and Bjorkhem,I. (1999). Elimination of cholesterol as cholestenoic acid in human
lung by sterol 27-hydroxylase: evidence that most of this steroid in the circulation is of
pulmonary origin. J. Lipid Res. 40, 1417-1425.
Babiker,A., Andersson,O., Lund,E., Xiu,R.J., Deeb,S., Reshef,A., Leitersdorf,E., Diczfalusy,U.,
and Bjorkhem,I. (1997). Elimination of cholesterol in macrophages and endothelial cells by the
sterol 27-hydroxylase mechanism. Comparison with high density lipoprotein-mediated reverse
cholesterol transport. J. Biol. Chem. 272, 26253-26261.
Babiker,A., Dzeletovic,S., Wiklund,B., Pettersson,N., Salonen,J., Nyyssonen,K., Eriksson,M.,
Diczfalusy,U., and Bjorkhem,I. (2005). Patients with atherosclerosis may have increased
circulating levels of 27-hydroxycholesterol and cholestenoic acid. Scand. J. Clin. Lab Invest 65,
365-375.
Badeau,M., Vihma,V., Mikkola,T.S., Tiitinen,A., and Tikkanen,M.J. (2007). Estradiol fatty acid
esters in adipose tissue and serum of pregnant and pre- and postmenopausal women. J. Clin.
Endocrinol. Metab 92, 4327-4331.
Baker,B.Y., Epand,R.F., Epand,R.M., and Miller,W.L. (2007). Cholesterol binding does not
predict activity of the steroidogenic acute regulatory protein, StAR. J. Biol. Chem. 282, 1022310232.
Barros,R.P. and Gustafsson,J.A. (2011). Estrogen receptors and the metabolic network. Cell
Metab 14, 289-299.
Bastard,J.P., Jardel,C., Bruckert,E., Blondy,P., Capeau,J., Laville,M., Vidal,H., and Hainque,B.
(2000). Elevated levels of interleukin 6 are reduced in serum and subcutaneous adipose tissue of
obese women after weight loss. J. Clin. Endocrinol. Metab 85, 3338-3342.
Battisti,S., Guida,F.M., Coppa,F., Vaccaro,D.M., Santini,D., Tonini,G., Zobel,B.B., and
Semelka,R.C. (2014). Modification of Abdominal Fat Distribution After Aromatase Inhibitor
Therapy in Breast Cancer Patients Visualized Using 3-D Computed Tomography Volumetry.
Clin. Breast Cancer.
Baulieu,E.E., Robel,P., and Schumacher,M. (2001). Neurosteroids: beginning of the story. Int
Rev Neurobiol. 46, 1-32.
Baumann,C.A., Ribon,V., Kanzaki,M., Thurmond,D.C., Mora,S., Shigematsu,S., Bickel,P.E.,
Pessin,J.E., and Saltiel,A.R. (2000). CAP defines a second signalling pathway required for
insulin-stimulated glucose transport. Nature 407, 202-207.
211
Belanger,C., Hould,F.S., Lebel,S., Biron,S., Brochu,G., and Tchernof,A. (2006). Omental and
subcutaneous adipose tissue steroid levels in obese men. Steroids 71, 674-682.
Belanger,C., Luu-The,V., Dupont,P., and Tchernof,A. (2002). Adipose tissue intracrinology:
potential importance of local androgen/estrogen metabolism in the regulation of adiposity. Horm.
Metab Res. 34, 737-745.
Bellemare,V., Laberge,P., Noel,S., Tchernof,A., and Luu-The,V. (2009). Differential estrogenic
17beta-hydroxysteroid dehydrogenase activity and type 12 17beta-hydroxysteroid
dehydrogenase expression levels in preadipocytes and differentiated adipocytes. J. Steroid
Biochem. Mol. Biol. 114, 129-134.
Benetti,A., Del,P.M., Crosignani,A., Veronelli,A., Masci,E., Frige,F., Micheletto,G., Panizzo,V.,
and Pontiroli,A.E. (2013). Cholesterol metabolism after bariatric surgery in grade 3 obesity:
differences between malabsorptive and restrictive procedures. Diabetes Care 36, 1443-1447.
Bernlohr,D.A., Bolanowski,M.A., Kelly,T.J., Jr., and Lane,M.D. (1985). Evidence for an
increase in transcription of specific mRNAs during differentiation of 3T3-L1 preadipocytes. J.
Biol. Chem. 260, 5563-5567.
Bertolotti,M., Del,P.M., Corna,F., Anzivino,C., Gabbi,C., Baldelli,E., Carulli,L., Loria,P.,
Galli,K.M., and Carulli,N. (2012). Increased appearance rate of 27-hydroxycholesterol in vivo in
hypercholesterolemia: a possible compensatory mechanism. Nutr. Metab Cardiovasc. Dis. 22,
823-830.
Besman,M.J., Yanagibashi,K., Lee,T.D., Kawamura,M., Hall,P.F., and Shively,J.E. (1989).
Identification of des-(Gly-Ile)-endozepine as an effector of corticotropin-dependent adrenal
steroidogenesis: stimulation of cholesterol delivery is mediated by the peripheral benzodiazepine
receptor. Proc. Natl. Acad. Sci. U. S. A 86, 4897-4901.
Bhattacharyya,A.K., Lin,D.S., and Connor,W.E. (2007). Cholestanol metabolism in patients with
cerebrotendinous xanthomatosis: absorption, turnover, and tissue deposition. J. Lipid Res. 48,
185-192.
Bieghs,V., Hendrikx,T., van Gorp,P.J., Verheyen,F., Guichot,Y.D., Walenbergh,S.M.,
Jeurissen,M.L., Gijbels,M., Rensen,S.S., Bast,A., Plat,J., Kalhan,S.C., Koek,G.H., Leitersdorf,E.,
Hofker,M.H., Lutjohann,D., and Shiri-Sverdlov,R. (2013). The cholesterol derivative 27hydroxycholesterol reduces steatohepatitis in mice. Gastroenterology 144, 167-178.
Bjorkhem,I. (1992). Mechanism of degradation of the steroid side chain in the formation of bile
acids. J Lipid Res 33, 455-471.
Bjorkhem,I. and Diczfalusy,U. (2002). Oxysterols: friends, foes, or just fellow passengers?
Arterioscler. Thromb. Vasc. Biol. 22, 734-742.
Bjorkhem,I., Meaney,S., and Diczfalusy,U. (2002). Oxysterols in human circulation: which role
do they have? Curr. Opin. Lipidol. 13, 247-253.
212
Bjorkhem,I., Reihner,E., Angelin,B., Ewerth,S., Akerlund,J.E., and Einarsson,K. (1987). On the
possible use of the serum level of 7 alpha-hydroxycholesterol as a marker for increased activity
of the cholesterol 7 alpha-hydroxylase in humans. J. Lipid Res. 28, 889-894.
Blouin,K., Blanchette,S., Richard,C., Dupont,P., Luu-The,V., and Tchernof,A. (2005).
Expression and activity of steroid aldoketoreductases 1C in omental adipose tissue are positive
correlates of adiposity in women. Am. J. Physiol Endocrinol. Metab 288, E398-E404.
Blouin,K., Nadeau,M., Mailloux,J., Daris,M., Lebel,S., Luu-The,V., and Tchernof,A. (2009a).
Pathways of adipose tissue androgen metabolism in women: depot differences and modulation
by adipogenesis. Am. J. Physiol Endocrinol. Metab 296, E244-E255.
Blouin,K., Richard,C., Belanger,C., Dupont,P., Daris,M., Laberge,P., Luu-The,V., and
Tchernof,A. (2003). Local androgen inactivation in abdominal visceral adipose tissue. J. Clin.
Endocrinol. Metab 88, 5944-5950.
Blouin,K., Richard,C., Brochu,G., Hould,F.S., Lebel,S., Marceau,S., Biron,S., Luu-The,V., and
Tchernof,A. (2006). Androgen inactivation and steroid-converting enzyme expression in
abdominal adipose tissue in men. J. Endocrinol. 191, 637-649.
Blouin,K., Veilleux,A., Luu-The,V., and Tchernof,A. (2009b). Androgen metabolism in adipose
tissue: recent advances. Mol. Cell Endocrinol. 301, 97-103.
Bluher,M. (2009). Adipose tissue dysfunction in obesity. Exp. Clin. Endocrinol. Diabetes 117,
241-250.
Bodin,K., Andersson,U., Rystedt,E., Ellis,E., Norlin,M., Pikuleva,I., Eggertsen,G., Bjorkhem,I.,
and Diczfalusy,U. (2002). Metabolism of 4 beta -hydroxycholesterol in humans. J. Biol. Chem.
277, 31534-31540.
Bodin,K., Bretillon,L., Aden,Y., Bertilsson,L., Broome,U., Einarsson,C., and Diczfalusy,U.
(2001). Antiepileptic drugs increase plasma levels of 4beta-hydroxycholesterol in humans:
evidence for involvement of cytochrome p450 3A4. J. Biol. Chem. 276, 38685-38689.
Bogacka,I., Xie,H., Bray,G.A., and Smith,S.R. (2005). Pioglitazone induces mitochondrial
biogenesis in human subcutaneous adipose tissue in vivo. Diabetes 54, 1392-1399.
Bose,H.S., Lingappa,V.R., and Miller,W.L. (2002). Rapid regulation of steroidogenesis by
mitochondrial protein import. Nature 417, 87-91.
Bouchard,L., Faucher,G., Tchernof,A., Deshaies,Y., Marceau,S., Lescelleur,O., Biron,S.,
Bouchard,C., Perusse,L., and Vohl,M.C. (2009). Association of OSBPL11 gene polymorphisms
with cardiovascular disease risk factors in obesity. Obesity. (Silver. Spring) 17, 1466-1472.
Bouchard,L., Rabasa-Lhoret,R., Faraj,M., Lavoie,M.E., Mill,J., Perusse,L., and Vohl,M.C.
(2010). Differential epigenomic and transcriptomic responses in subcutaneous adipose tissue
between low and high responders to caloric restriction. Am. J. Clin. Nutr. 91, 309-320.
213
Boulton,K.L., Hudson,D.U., Coppack,S.W., and Frayn,K.N. (1992). Steroid hormone
interconversions in human adipose tissue in vivo. Metabolism 41, 556-559.
Brasaemle,D.L., Subramanian,V., Garcia,A., Marcinkiewicz,A., and Rothenberg,A. (2009).
Perilipin A and the control of triacylglycerol metabolism. Mol. Cell Biochem. 326, 15-21.
Briones,A.M., Nguyen Dinh,C.A., Callera,G.E., Yogi,A., Burger,D., He,Y., Correa,J.W.,
Gagnon,A.M., Gomez-Sanchez,C.E., Gomez-Sanchez,E.P., Sorisky,A., Ooi,T.C., Ruzicka,M.,
Burns,K.D., and Touyz,R.M. (2012). Adipocytes produce aldosterone through calcineurindependent signaling pathways: implications in diabetes mellitus-associated obesity and vascular
dysfunction. Hypertension 59, 1069-1078.
Brown,A.J. and Jessup,W. (1999). Oxysterols and atherosclerosis. Atherosclerosis 142, 1-28.
Bujalska,I.J., Kumar,S., Hewison,M., and Stewart,P.M. (1999). Differentiation of adipose
stromal cells: the roles of glucocorticoids and 11beta-hydroxysteroid dehydrogenase.
Endocrinology 140, 3188-3196.
Bujalska,I.J., Walker,E.A., Hewison,M., and Stewart,P.M. (2002). A switch in dehydrogenase to
reductase activity of 11 beta-hydroxysteroid dehydrogenase type 1 upon differentiation of human
omental adipose stromal cells. J. Clin. Endocrinol. Metab 87, 1205-1210.
Bulun,S.E. and Simpson,E.R. (1994). Competitive reverse transcription-polymerase chain
reaction analysis indicates that levels of aromatase cytochrome P450 transcripts in adipose tissue
of buttocks, thighs, and abdomen of women increase with advancing age. J. Clin. Endocrinol.
Metab 78, 428-432.
Burkard,I., von,E.A., Waeber,G., Vollenweider,P., and Rentsch,K.M. (2007). Lipoprotein
distribution and biological variation of 24S- and 27-hydroxycholesterol in healthy volunteers.
Atherosclerosis 194, 71-78.
Burton,G.R., Nagarajan,R., Peterson,C.A., and McGehee,R.E., Jr. (2004). Microarray analysis of
differentiation-specific gene expression during 3T3-L1 adipogenesis. Gene 329, 167-185.
Caesar,R., Manieri,M., Kelder,T., Boekschoten,M., Evelo,C., Muller,M., Kooistra,T., Cinti,S.,
Kleemann,R., and Drevon,C.A. (2010). A combined transcriptomics and lipidomics analysis of
subcutaneous, epididymal and mesenteric adipose tissue reveals marked functional differences.
PLoS. One. 5, e11525.
Cali,J.J., Hsieh,C.L., Francke,U., and Russell,D.W. (1991). Mutations in the bile acid
biosynthetic enzyme sterol 27-hydroxylase underlie cerebrotendinous xanthomatosis. J. Biol.
Chem. 266, 7779-7783.
Campioli,E., Batarseh,A., Li,J., and Papadopoulos,V. (2011). The endocrine disruptor mono-(2ethylhexyl) phthalate affects the differentiation of human liposarcoma cells (SW 872). PLoS.
One. 6, e28750.
214
Campos,D.B., Palin,M.F., Bordignon,V., and Murphy,B.D. (2008). The 'beneficial' adipokines in
reproduction and fertility. Int. J. Obes. (Lond) 32, 223-231.
Cannon,B. and Nedergaard,J. (2004). Brown adipose tissue: function and physiological
significance. Physiol Rev. 84, 277-359.
Caprio,M., Feve,B., Claes,A., Viengchareun,S., Lombes,M., and Zennaro,M.C. (2007). Pivotal
role of the mineralocorticoid receptor in corticosteroid-induced adipogenesis. FASEB J. 21,
2185-2194.
Carr,M.C. (2003). The emergence of the metabolic syndrome with menopause. J. Clin.
Endocrinol. Metab 88, 2404-2411.
Casey,M.L. and MacDonald,P.C. (1982). Extraadrenal formation of a mineralocorticosteroid:
deoxycorticosterone and deoxycorticosterone sulfate biosynthesis and metabolism. Endocr. Rev.
3, 396-403.
Cawthorn,W.P., Scheller,E.L., and MacDougald,O.A. (2012). Adipose tissue stem cells meet
preadipocyte commitment: going back to the future. J. Lipid Res. 53, 227-246.
Chazenbalk,G., Chen,Y.H., Heneidi,S., Lee,J.M., Pall,M., Chen,Y.D., and Azziz,R. (2012).
Abnormal expression of genes involved in inflammation, lipid metabolism, and Wnt signaling in
the adipose tissue of polycystic ovary syndrome. J. Clin. Endocrinol. Metab 97, E765-E770.
Chu,Y., Huddleston,G.G., Clancy,A.N., Harris,R.B., and Bartness,T.J. (2010). Epididymal fat is
necessary for spermatogenesis, but not testosterone production or copulatory behavior.
Endocrinology 151, 5669-5679.
Cleland,W.H., Mendelson,C.R., and Simpson,E.R. (1983). Aromatase activity of membrane
fractions of human adipose tissue stromal cells and adipocytes. Endocrinology 113, 2155-2160.
Cocconi,G. (1994). First generation aromatase inhibitors--aminoglutethimide and testololactone.
Breast Cancer Res. Treat. 30, 57-80.
Coon,M.J., Ding,X.X., Pernecky,S.J., and Vaz,A.D. (1992). Cytochrome P450: progress and
predictions. FASEB J. 6, 669-673.
Corbould,A.M., Bawden,M.J., Lavranos,T.C., Rodgers,R.J., and Judd,S.J. (2002). The effect of
obesity on the ratio of type 3 17beta-hydroxysteroid dehydrogenase mRNA to cytochrome P450
aromatase mRNA in subcutaneous abdominal and intra-abdominal adipose tissue of women. Int.
J. Obes. Relat Metab Disord. 26, 165-175.
Corbould,A.M., Judd,S.J., and Rodgers,R.J. (1998). Expression of types 1, 2, and 3 17 betahydroxysteroid dehydrogenase in subcutaneous abdominal and intra-abdominal adipose tissue of
women. J. Clin. Endocrinol. Metab 83, 187-194.
Cornelius,P., MacDougald,O.A., and Lane,M.D. (1994). Regulation of adipocyte development.
Annu. Rev. Nutr. 14, 99-129.
215
Coussens,L.M. and Werb,Z. (2002). Inflammation and cancer. Nature 420, 860-867.
Covey,S.D., Wideman,R.D., McDonald,C., Unniappan,S., Huynh,F., Asadi,A., Speck,M.,
Webber,T., Chua,S.C., and Kieffer,T.J. (2006). The pancreatic beta cell is a key site for
mediating the effects of leptin on glucose homeostasis. Cell Metab 4, 291-302.
Crosignani,A., Zuin,M., Allocca,M., and Del,P.M. (2011). Oxysterols in bile acid metabolism.
Clin. Chim. Acta 412, 2037-2045.
Culty,M., Luo,L., Yao,Z.X., Chen,H., Papadopoulos,V., and Zirkin,B.R. (2002). Cholesterol
transport, peripheral benzodiazepine receptor, and steroidogenesis in aging Leydig cells. J
Androl 23, 439-447.
Cummins,C.L., Volle,D.H., Zhang,Y., McDonald,J.G., Sion,B., Lefrancois-Martinez,A.M.,
Caira,F., Veyssiere,G., Mangelsdorf,D.J., and Lobaccaro,J.M. (2006). Liver X receptors regulate
adrenal cholesterol balance. J. Clin. Invest 116, 1902-1912.
Dahlback-Sjoberg,H., Bjorkhem,I., and Princen,H.M. (1993). Selective inhibition of
mitochondrial 27-hydroxylation of bile acid intermediates and 25-hydroxylation of vitamin D3
by cyclosporin A. Biochem. J. 293 ( Pt 1), 203-206.
Dahlman,I., Linder,K., Arvidsson,N.E., Andersson,I., Liden,J., Verdich,C., Sorensen,T.I., and
Arner,P. (2005). Changes in adipose tissue gene expression with energy-restricted diets in obese
women. Am. J. Clin. Nutr. 81, 1275-1285.
Dalen,K.T., Ulven,S.M., Bamberg,K., Gustafsson,J.A., and Nebb,H.I. (2003). Expression of the
insulin-responsive glucose transporter GLUT4 in adipocytes is dependent on liver X receptor
alpha. J. Biol. Chem. 278, 48283-48291.
Davis,S.M. and Squires,E.J. (1999). Association of cytochrome b5 with 16-androstene steroid
synthesis in the testis and accumulation in the fat of male pigs. J. Anim Sci. 77, 1230-1235.
De,P.A., Tejerina,S., Raes,M., Keijer,J., and Arnould,T. (2009). Mitochondrial (dys)function in
adipocyte (de)differentiation and systemic metabolic alterations. Am. J. Pathol. 175, 927-939.
Denisov,I.G., Makris,T.M., Sligar,S.G., and Schlichting,I. (2005). Structure and chemistry of
cytochrome P450. Chem. Rev. 105, 2253-2277.
Desbriere,R., Vuaroqueaux,V., Achard,V., Boullu-Ciocca,S., Labuhn,M., Dutour,A., and
Grino,M. (2006). 11beta-hydroxysteroid dehydrogenase type 1 mRNA is increased in both
visceral and subcutaneous adipose tissue of obese patients. Obesity. (Silver. Spring) 14, 794-798.
Deslypere,J.P., Verdonck,L., and Vermeulen,A. (1985). Fat tissue: a steroid reservoir and site of
steroid metabolism. J. Clin. Endocrinol. Metab 61, 564-570.
Dieudonne,M.N., Leneveu,M.C., Giudicelli,Y., and Pecquery,R. (2004). Evidence for functional
estrogen receptors alpha and beta in human adipose cells: regional specificities and regulation by
estrogens. Am. J Physiol Cell Physiol 286, C655-C661.
216
Dimitrova-Shumkovska,J., Veenman,L., Ristoski,T., Leschiner,S., and Gavish,M. (2010).
Chronic high fat, high cholesterol supplementation decreases 18 kDa Translocator Protein
binding capacity in association with increased oxidative stress in rat liver and aorta. Food Chem.
Toxicol. 48, 910-921.
Dogra,S.C., Whitelaw,M.L., and May,B.K. (1998). Transcriptional activation of cytochrome
P450 genes by different classes of chemical inducers. Clin. Exp. Pharmacol. Physiol 25, 1-9.
Dowman,J.K., Hopkins,L.J., Reynolds,G.M., Armstrong,M.J., Nasiri,M., Nikolaou,N., van
Houten,E.L., Visser,J.A., Morgan,S.A., Lavery,G.G., Oprescu,A., Hubscher,S.G., Newsome,P.N.,
and Tomlinson,J.W. (2013). Loss of 5alpha-reductase type 1 accelerates the development of
hepatic steatosis but protects against hepatocellular carcinoma in male mice. Endocrinology 154,
4536-4547.
Duane,W.C. and Javitt,N.B. (1999). 27-hydroxycholesterol: production rates in normal human
subjects. J. Lipid Res. 40, 1194-1199.
Dubrac,S., Lear,S.R., Ananthanarayanan,M., Balasubramaniyan,N., Bollineni,J., Shefer,S.,
Hyogo,H., Cohen,D.E., Blanche,P.J., Krauss,R.M., Batta,A.K., Salen,G., Suchy,F.J., Maeda,N.,
and Erickson,S.K. (2005). Role of CYP27A in cholesterol and bile acid metabolism. J Lipid Res
46, 76-85.
Dugail,I. (2001). Transfection of adipocytes and preparation of nuclear extracts. Methods Mol.
Biol. 155, 141-146.
Dunaif,A. (1997). Insulin resistance and the polycystic ovary syndrome: mechanism and
implications for pathogenesis. Endocr. Rev. 18, 774-800.
DuSell,C.D., Umetani,M., Shaul,P.W., Mangelsdorf,D.J., and McDonnell,D.P. (2008). 27hydroxycholesterol is an endogenous selective estrogen receptor modulator. Mol. Endocrinol. 22,
65-77.
Duskova,M. and Pospisilova,H. (2011). The role of non-aromatizable testosterone metabolite in
metabolic pathways. Physiol Res. 60, 253-261.
Ehrhart-Bornstein,M., Lamounier-Zepter,V., Schraven,A., Langenbach,J., Willenberg,H.S.,
Barthel,A., Hauner,H., McCann,S.M., Scherbaum,W.A., and Bornstein,S.R. (2003). Human
adipocytes secrete mineralocorticoid-releasing factors. Proc. Natl. Acad. Sci. U. S. A 100,
14211-14216.
Ellero,S., Chakhtoura,G., Barreau,C., Langouet,S., Benelli,C., Penicaud,L., Beaune,P., and
de,W., I (2010). Xenobiotic-metabolizing cytochromes p450 in human white adipose tissue:
expression and induction. Drug Metab Dispos. 38, 679-686.
Fain,J.N., Madan,A.K., Hiler,M.L., Cheema,P., and Bahouth,S.W. (2004). Comparison of the
release of adipokines by adipose tissue, adipose tissue matrix, and adipocytes from visceral and
subcutaneous abdominal adipose tissues of obese humans. Endocrinology 145, 2273-2282.
217
Farges,R., Joseph-Liauzun,E., Shire,D., Caput,D., Le,F.G., and Ferrara,P. (1994). Site-directed
mutagenesis of the peripheral benzodiazepine receptor: identification of amino acids implicated
in the binding site of Ro5-4864. Mol. Pharmacol. 46, 1160-1167.
Feher,T. and Bodrogi,L. (1982). A comparative study of steroid concentrations in human adipose
tissue and the peripheral circulation. Clin. Chim. Acta 126, 135-141.
Feig,P.U., Shah,S., Hermanowski-Vosatka,A., Plotkin,D., Springer,M.S., Donahue,S., Thach,C.,
Klein,E.J., Lai,E., and Kaufman,K.D. (2011). Effects of an 11beta-hydroxysteroid
dehydrogenase type 1 inhibitor, MK-0916, in patients with type 2 diabetes mellitus and
metabolic syndrome. Diabetes Obes. Metab 13, 498-504.
Feige,J.N., Gelman,L., Rossi,D., Zoete,V., Metivier,R., Tudor,C., Anghel,S.I., Grosdidier,A.,
Lathion,C., Engelborghs,Y., Michielin,O., Wahli,W., and Desvergne,B. (2007). The endocrine
disruptor monoethyl-hexyl-phthalate is a selective peroxisome proliferator-activated receptor
gamma modulator that promotes adipogenesis. J. Biol. Chem. 282, 19152-19166.
Ferderbar,S., Pereira,E.C., Apolinario,E., Bertolami,M.C., Faludi,A., Monte,O., Calliari,L.E.,
Sales,J.E., Gagliardi,A.R., Xavier,H.T., and Abdalla,D.S. (2007). Cholesterol oxides as
biomarkers of oxidative stress in type 1 and type 2 diabetes mellitus. Diabetes Metab Res. Rev.
23, 35-42.
Fernandez-Veledo,S., Vila-Bedmar,R., Nieto-Vazquez,I., and Lorenzo,M. (2009). c-Jun Nterminal kinase 1/2 activation by tumor necrosis factor-alpha induces insulin resistance in human
visceral but not subcutaneous adipocytes: reversal by liver X receptor agonists. J. Clin.
Endocrinol. Metab 94, 3583-3593.
Folkerd,E.J. and James,V.H. (1982). Studies on the activity of 17 beta-hydroxysteroid
dehydrogenase in human adipose tissue. J. Steroid Biochem. 16, 539-543.
Franck,N., Gummesson,A., Jernas,M., Glad,C., Svensson,P.A., Guillot,G., Rudemo,M.,
Nystrom,F.H., Carlsson,L.M., and Olsson,B. (2011). Identification of adipocyte genes regulated
by caloric intake. J. Clin. Endocrinol. Metab 96, E413-E418.
Franks,S. (1995). Polycystic ovary syndrome. N. Engl. J. Med. 333, 853-861.
Fraser,R., Ingram,M.C., Anderson,N.H., Morrison,C., Davies,E., and Connell,J.M. (1999).
Cortisol effects on body mass, blood pressure, and cholesterol in the general population.
Hypertension 33, 1364-1368.
Friedman,J.M. (2000). Obesity in the new millennium. Nature 404, 632-634.
Fruhbeck,G. (2008). Overview of adipose tissue and its role in obesity and metabolic disorders.
Methods Mol. Biol. 456, 1-22.
Fruhbeck,G., Gomez-Ambrosi,J., Muruzabal,F.J., and Burrell,M.A. (2001). The adipocyte: a
model for integration of endocrine and metabolic signaling in energy metabolism regulation. Am.
J. Physiol Endocrinol. Metab 280, E827-E847.
218
Fu,X., Menke,J.G., Chen,Y., Zhou,G., MacNaul,K.L., Wright,S.D., Sparrow,C.P., and Lund,E.G.
(2001). 27-hydroxycholesterol is an endogenous ligand for liver X receptor in cholesterol-loaded
cells. J. Biol. Chem. 276, 38378-38387.
Gambineri,A., Pelusi,C., Vicennati,V., Pagotto,U., and Pasquali,R. (2002). Obesity and the
polycystic ovary syndrome. Int. J. Obes. Relat Metab Disord. 26, 883-896.
Gilep,A.A., Sushko,T.A., and Usanov,S.A. (2011). At the crossroads of steroid hormone
biosynthesis: the role, substrate specificity and evolutionary development of CYP17. Biochim.
Biophys. Acta 1814, 200-209.
Giusti,L., Marchetti,P., Trincavelli,L., Lupi,R., Martini,C., Lucacchini,A., Del,G.S., Tellini,C.,
Carmellini,M., and Navalesi,R. (1997). Peripheral benzodiazepine receptors in isolated human
pancreatic islets. J. Cell Biochem. 64, 273-277.
Glass,A.R., Swerdloff,R.S., Bray,G.A., Dahms,W.T., and Atkinson,R.L. (1977). Low serum
testosterone and sex-hormone-binding-globulin in massively obese men. J. Clin. Endocrinol.
Metab 45, 1211-1219.
Gonzalez,S.C., Romeo,H.E., Rosenstein,R.E., Estevez,A.G., and Cardinali,D.P. (1988).
Benzodiazepine binding sites in rat interscapular brown adipose tissue: effect of cold
environment, denervation and endocrine ablations. Life Sci. 42, 393-402.
Goodarzi,M.O., Dumesic,D.A., Chazenbalk,G., and Azziz,R. (2011). Polycystic ovary syndrome:
etiology, pathogenesis and diagnosis. Nat. Rev. Endocrinol. 7, 219-231.
Goodfriend,T.L., Egan,B.M., and Kelley,D.E. (1998). Aldosterone in obesity. Endocr. Res. 24,
789-796.
Green,H. and Kehinde,O. (1975). An established preadipose cell line and its differentiation in
culture. II. Factors affecting the adipose conversion. Cell 5, 19-27.
Greenberg,A.S., Kraemer,F.B., Soni,K.G., Jedrychowski,M.P., Yan,Q.W., Graham,C.E.,
Bowman,T.A., and Mansur,A. (2011). Lipid droplet meets a mitochondrial protein to regulate
adipocyte lipolysis. EMBO J. 30, 4337-4339.
Gregoire,F., Todoroff,G., Hauser,N., and Remacle,C. (1990). The stroma-vascular fraction of rat
inguinal and epididymal adipose tissue and the adipoconversion of fat cell precursors in primary
culture. Biol. Cell 69, 215-222.
Gregoire,F.M. (2001). Adipocyte differentiation: from fibroblast to endocrine cell. Exp. Biol.
Med. (Maywood. ) 226, 997-1002.
Grundy,S.M. (2004). Obesity, metabolic syndrome, and cardiovascular disease. J. Clin.
Endocrinol. Metab 89, 2595-2600.
219
Guarneri,P., Papadopoulos,V., Pan,B., and Costa,E. (1992). Regulation of pregnenolone
synthesis in C6-2B glioma cells by 4'-chlorodiazepam. Proc. Natl. Acad. Sci. U. S. A 89, 51185122.
Guilherme,A., Virbasius,J.V., Puri,V., and Czech,M.P. (2008). Adipocyte dysfunctions linking
obesity to insulin resistance and type 2 diabetes. Nat. Rev. Mol. Cell Biol. 9, 367-377.
Gupta,V., Bhasin,S., Guo,W., Singh,R., Miki,R., Chauhan,P., Choong,K., Tchkonia,T.,
Lebrasseur,N.K., Flanagan,J.N., Hamilton,J.A., Viereck,J.C., Narula,N.S., Kirkland,J.L., and
Jasuja,R. (2008). Effects of dihydrotestosterone on differentiation and proliferation of human
mesenchymal stem cells and preadipocytes. Mol. Cell Endocrinol. 296, 32-40.
Guryev,O., Carvalho,R.A., Usanov,S., Gilep,A., and Estabrook,R.W. (2003). A pathway for the
metabolism of vitamin D3: unique hydroxylated metabolites formed during catalysis with
cytochrome P450scc (CYP11A1). Proc. Natl. Acad. Sci. U. S. A 100, 14754-14759.
Gut,P., Baeza-Raja,B., Andersson,O., Hasenkamp,L., Hsiao,J., Hesselson,D., Akassoglou,K.,
Verdin,E., Hirschey,M.D., and Stainier,D.Y. (2013). Whole-organism screening for
gluconeogenesis identifies activators of fasting metabolism. Nat. Chem. Biol. 9, 97-104.
Hall,E.A., Ren,S., Hylemon,P.B., Redford,K., del,C.A., Gil,G., and Pandak,W.M. (2005).
Mitochondrial cholesterol transport: a possible target in the management of hyperlipidemia.
Lipids 40, 1237-1244.
Hamm,J.K., Park,B.H., and Farmer,S.R. (2001). A role for C/EBPbeta in regulating peroxisome
proliferator-activated receptor gamma activity during adipogenesis in 3T3-L1 preadipocytes. J.
Biol. Chem. 276, 18464-18471.
Hansen,H.O., Andreasen,P.H., Mandrup,S., Kristiansen,K., and Knudsen,J. (1991). Induction of
acyl-CoA-binding protein and its mRNA in 3T3-L1 cells by insulin during preadipocyte-toadipocyte differentiation. Biochem. J. 277 ( Pt 2), 341-344.
Harik-Khan,R. and Holmes,R.P. (1990). Estimation of 26-hydroxycholesterol in serum by highperformance liquid chromatography and its measurement in patients with atherosclerosis. J.
Steroid Biochem. 36, 351-355.
Harms,M. and Seale,P. (2013). Brown and beige fat: development, function and therapeutic
potential. Nat. Med. 19, 1252-1263.
Hauet,T., Yao,Z.X., Bose,H.S., Wall,C.T., Han,Z., Li,W., Hales,D.B., Miller,W.L., Culty,M.,
and Papadopoulos,V. (2005). Peripheral-type benzodiazepine receptor-mediated action of
steroidogenic acute regulatory protein on cholesterol entry into leydig cell mitochondria. Mol.
Endocrinol. 19, 540-554.
Hauner,H., Schmid,P., and Pfeiffer,E.F. (1987). Glucocorticoids and insulin promote the
differentiation of human adipocyte precursor cells into fat cells. J. Clin. Endocrinol. Metab 64,
832-835.
220
Herman,M.A. and Kahn,B.B. (2006). Glucose transport and sensing in the maintenance of
glucose homeostasis and metabolic harmony. J. Clin. Invest 116, 1767-1775.
Hershkovitz,E., Parvari,R., Wudy,S.A., Hartmann,M.F., Gomes,L.G., Loewental,N., and
Miller,W.L. (2008). Homozygous mutation G539R in the gene for P450 oxidoreductase in a
family previously diagnosed as having 17,20-lyase deficiency. J. Clin. Endocrinol. Metab 93,
3584-3588.
Hirata,A., Maeda,N., Hiuge,A., Hibuse,T., Fujita,K., Okada,T., Kihara,S., Funahashi,T., and
Shimomura,I. (2009). Blockade of mineralocorticoid receptor reverses adipocyte dysfunction and
insulin resistance in obese mice. Cardiovasc. Res. 84, 164-172.
Hochberg,R.B. (1998). Biological esterification of steroids. Endocr. Rev. 19, 331-348.
Honda,A., Salen,G., Matsuzaki,Y., Batta,A.K., Xu,G., Leitersdorf,E., Tint,G.S., Erickson,S.K.,
Tanaka,N., and Shefer,S. (2001). Side chain hydroxylations in bile acid biosynthesis catalyzed
by CYP3A are markedly up-regulated in Cyp27-/- mice but not in cerebrotendinous
xanthomatosis. J. Biol. Chem. 276, 34579-34585.
Hummasti,S., Laffitte,B.A., Watson,M.A., Galardi,C., Chao,L.C., Ramamurthy,L., Moore,J.T.,
and Tontonoz,P. (2004). Liver X receptors are regulators of adipocyte gene expression but not
differentiation: identification of apoD as a direct target. J Lipid Res 45, 616-625.
Isakson,P., Hammarstedt,A., Gustafson,B., and Smith,U. (2009). Impaired preadipocyte
differentiation in human abdominal obesity: role of Wnt, tumor necrosis factor-alpha, and
inflammation. Diabetes 58, 1550-1557.
Isidori,A.M., Caprio,M., Strollo,F., Moretti,C., Frajese,G., Isidori,A., and Fabbri,A. (1999).
Leptin and androgens in male obesity: evidence for leptin contribution to reduced androgen
levels. J. Clin. Endocrinol. Metab 84, 3673-3680.
Jameson,J.L. (2004). Of mice and men: The tale of steroidogenic factor-1. J Clin Endocrinol
Metab 89, 5927-5929.
Janowski,B.A., Grogan,M.J., Jones,S.A., Wisely,G.B., Kliewer,S.A., Corey,E.J., and
Mangelsdorf,D.J. (1999). Structural requirements of ligands for the oxysterol liver X receptors
LXRalpha and LXRbeta. Proc. Natl. Acad. Sci. U. S. A 96, 266-271.
Janowski,B.A., Willy,P.J., Devi,T.R., Falck,J.R., and Mangelsdorf,D.J. (1996). An oxysterol
signalling pathway mediated by the nuclear receptor LXR alpha. Nature 383, 728-731.
Jaremko,L., Jaremko,M., Giller,K., Becker,S., and Zweckstetter,M. (2014). Structure of the
mitochondrial translocator protein in complex with a diagnostic ligand. Science 343, 1363-1366.
Javitt,N.B. (2002). 25R,26-Hydroxycholesterol revisited: synthesis, metabolism, and biologic
roles. J Lipid Res 43, 665-670.
221
Jing,X., Wala,E.P., and Sloan,J.W. (2000). The effect of PK 11 195, a specific antagonist of the
peripheral benzodiazepine receptors, on body weight in rats chronically exposed to diazepam.
Pharmacol. Res. 42, 227-234.
Jones,M.R., Chazenbalk,G., Xu,N., Chua,A.K., Eigler,T., Mengesha,E., Chen,Y.H., Lee,J.M.,
Pall,M., Li,X., Chen,Y.D., Taylor,K.D., Mathur,R., Krauss,R.M., Rotter,J.I., Legro,R.S.,
Azziz,R., and Goodarzi,M.O. (2012). Steroidogenic regulatory factor FOS is underexpressed in
polycystic ovary syndrome (PCOS) adipose tissue and genetically associated with PCOS
susceptibility. J. Clin. Endocrinol. Metab 97, E1750-E1757.
Jordan,S.D., Kruger,M., Willmes,D.M., Redemann,N., Wunderlich,F.T., Bronneke,H.S.,
Merkwirth,C., Kashkar,H., Olkkonen,V.M., Bottger,T., Braun,T., Seibler,J., and Bruning,J.C.
(2011). Obesity-induced overexpression of miRNA-143 inhibits insulin-stimulated AKT
activation and impairs glucose metabolism. Nat. Cell Biol. 13, 434-446.
Jove,M., Moreno-Navarrete,J.M., Pamplona,R., Ricart,W., Portero-Otin,M., and FernandezReal,J.M. (2014). Human omental and subcutaneous adipose tissue exhibit specific lipidomic
signatures. FASEB J. 28, 1071-1081.
Juvet,L.K., Andresen,S.M., Schuster,G.U., Dalen,K.T., Tobin,K.A., Hollung,K., Haugen,F.,
Jacinto,S., Ulven,S.M., Bamberg,K., Gustafsson,J.A., and Nebb,H.I. (2003). On the role of liver
X receptors in lipid accumulation in adipocytes. Mol. Endocrinol. 17, 172-182.
Kahn,B.B. (1996). Lilly lecture 1995. Glucose transport: pivotal step in insulin action. Diabetes
45, 1644-1654.
Kamohara,S., Burcelin,R., Halaas,J.L., Friedman,J.M., and Charron,M.J. (1997). Acute
stimulation of glucose metabolism in mice by leptin treatment. Nature 389, 374-377.
Kanji,S.S., Kuohung,W., Labaree,D.C., and Hochberg,R.B. (1999). Regiospecific esterification
of estrogens by lecithin:cholesterol acyltransferase. J. Clin. Endocrinol. Metab 84, 2481-2488.
Karastergiou,K. and Mohamed-Ali,V. (2010). The autocrine and paracrine roles of adipokines.
Mol. Cell Endocrinol. 318, 69-78.
Kayes-Wandover,K.M. and White,P.C. (2000). Steroidogenic enzyme gene expression in the
human heart. J Clin Endocrinol Metab 85, 2519-2525.
Kershaw,E.E. and Flier,J.S. (2004). Adipose tissue as an endocrine organ. J. Clin. Endocrinol.
Metab 89, 2548-2556.
Kershaw,E.E., Morton,N.M., Dhillon,H., Ramage,L., Seckl,J.R., and Flier,J.S. (2005).
Adipocyte-specific glucocorticoid inactivation protects against diet-induced obesity. Diabetes 54,
1023-1031.
Kha,H.T., Basseri,B., Shouhed,D., Richardson,J., Tetradis,S., Hahn,T.J., and Parhami,F. (2004).
Oxysterols regulate differentiation of mesenchymal stem cells: pro-bone and anti-fat. J Bone
Miner. Res 19, 830-840.
222
Killinger,D.W., Perel,E., Danilescu,D., Kharlip,L., and Lindsay,W.R. (1990). Influence of
adipose tissue distribution on the biological activity of androgens. Ann. N. Y. Acad. Sci. 595,
199-211.
Killinger,D.W., Strutt,B.J., Roncari,D.A., and Khalil,M.W. (1995). Estrone formation from
dehydroepiandrosterone in cultured human breast adipose stromal cells. J. Steroid Biochem. Mol.
Biol. 52, 195-201.
Kilroy,G., Burk,D.H., and Floyd,Z.E. (2009). High efficiency lipid-based siRNA transfection of
adipocytes in suspension. PLoS. One. 4, e6940.
Kim,G.S., Lee,G.Y., Nedumaran,B., Park,Y.Y., Kim,K.T., Park,S.C., Lee,Y.C., Kim,J.B., and
Choi,H.S. (2008). The orphan nuclear receptor DAX-1 acts as a novel transcriptional corepressor
of PPARgamma. Biochem. Biophys. Res Commun. 370, 264-268.
Kim,J.Y., Xue,K., Cao,M., Wang,Q., Liu,J.Y., Leader,A., Han,J.Y., and Tsang,B.K. (2013).
Chemerin suppresses ovarian follicular development and its potential involvement in follicular
arrest in rats treated chronically with dihydrotestosterone. Endocrinology 154, 2912-2923.
Kim,W.K., Meliton,V., Amantea,C.M., Hahn,T.J., and Parhami,F. (2007). 20(S)hydroxycholesterol inhibits PPARgamma expression and adipogenic differentiation of bone
marrow stromal cells through a hedgehog-dependent mechanism. J Bone Miner. Res 22, 17111719.
Kinoshita,T., Honma,S., Shibata,Y., Yamashita,K., Watanabe,Y., Maekubo,H., Okuyama,M.,
Takashima,A., and Takeshita,N. (2014). An Innovative LC-MS/MS-Based Method for
Determining CYP 17 and CYP 19 Activity in the Adipose Tissue of Pre- and Postmenopausal
and Ovariectomized Women Using (13)C-Labeled Steroid Substrates. J. Clin. Endocrinol. Metab
99, 1339-1347.
Kominami,S., Ogawa,N., Morimune,R., De-Ying,H., and Takemori,S. (1992). The role of
cytochrome b5 in adrenal microsomal steroidogenesis. J. Steroid Biochem. Mol. Biol. 42, 57-64.
Kraemer,F.B. and Shen,W.J. (2002). Hormone-sensitive lipase: control of intracellular tri-(di)acylglycerol and cholesteryl ester hydrolysis. J. Lipid Res. 43, 1585-1594.
Krause,B.R. and Hartman,A.D. (1984). Adipose tissue and cholesterol metabolism. J. Lipid Res.
25, 97-110.
Krueger,K.E. and Papadopoulos,V. (1990). Peripheral-type benzodiazepine receptors mediate
translocation of cholesterol from outer to inner mitochondrial membranes in adrenocortical cells.
J Biol. Chem. 265, 15015-15022.
Kusminski,C.M. and Scherer,P.E. (2012). Mitochondrial dysfunction in white adipose tissue.
Trends Endocrinol. Metab 23, 435-443.
223
Lacapere,J.J. and Papadopoulos,V. (2003). Peripheral-type benzodiazepine receptor: structure
and function of a cholesterol-binding protein in steroid and bile acid biosynthesis. Steroids 68,
569-585.
Laffitte,B.A., Chao,L.C., Li,J., Walczak,R., Hummasti,S., Joseph,S.B., Castrillo,A., Wilpitz,D.C.,
Mangelsdorf,D.J., Collins,J.L., Saez,E., and Tontonoz,P. (2003). Activation of liver X receptor
improves glucose tolerance through coordinate regulation of glucose metabolism in liver and
adipose tissue. Proc. Natl. Acad. Sci. U. S. A 100, 5419-5424.
Laffitte,B.A., Repa,J.J., Joseph,S.B., Wilpitz,D.C., Kast,H.R., Mangelsdorf,D.J., and Tontonoz,P.
(2001). LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages
and adipocytes. Proc. Natl. Acad. Sci. U. S. A 98, 507-512.
Lafontan,M. and Langin,D. (2009). Lipolysis and lipid mobilization in human adipose tissue.
Prog. Lipid Res. 48, 275-297.
Lakshmanan,J., Elmendorf,J.S., and Ozcan,S. (2003a). Analysis of insulin-stimulated glucose
uptake in differentiated 3T3-L1 adipocytes. Methods Mol. Med. 83, 97-103.
Lakshmanan,J., Elmendorf,J.S., and Ozcan,S. (2003b). Analysis of insulin-stimulated glucose
uptake in differentiated 3T3-L1 adipocytes. Methods Mol. Med. 83, 97-103.
Lalli,E. and Sassone-Corsi,P. (2003). DAX-1, an unusual orphan receptor at the crossroads of
steroidogenic function and sexual differentiation. Mol. Endocrinol 17, 1445-1453.
Lambeth,J.D. and Stevens,V.L. (1984). Cytochrome P-450scc: enzymology, and the regulation
of intramitochondrial cholesterol delivery to the enzyme. Endocr. Res. 10, 283-309.
Larner,J.M., Shackleton,C.H., Roitman,E., Schwartz,P.E., and Hochberg,R.B. (1992).
Measurement of estradiol-17-fatty acid esters in human tissues. J. Clin. Endocrinol. Metab 75,
195-200.
Laurencikiene,J. and Ryden,M. (2012). Liver X receptors and fat cell metabolism. Int. J. Obes.
(Lond) 36, 1494-1502.
Le,F.G., Vaucher,N., Perrier,M.L., Flamier,A., Benavides,J., Renault,C., Dubroeucq,M.C.,
Gueremy,C., and Uzan,A. (1983). Differentiation between two ligands for peripheral
benzodiazepine binding sites, [3H]RO5-4864 and [3H]PK 11195, by thermodynamic studies.
Life Sci. 33, 449-457.
Le,L.S., Ferre,P., and Dugail,I. (2004). Adipocyte cholesterol balance in obesity. Biochem. Soc.
Trans. 32, 103-106.
Le,L.S., Krief,S., Farnier,C., Lefrere,I., Le,L., X, Bazin,R., Ferre,P., and Dugail,I. (2001).
Cholesterol, a cell size-dependent signal that regulates glucose metabolism and gene expression
in adipocytes. J. Biol. Chem. 276, 16904-16910.
224
Lea-Currie,Y.R., Wen,P., and McIntosh,M.K. (1998). Dehydroepiandrosterone reduces
proliferation and differentiation of 3T3-L1 preadipocytes. Biochem. Biophys. Res. Commun.
248, 497-504.
Lecanu,L., Yao,Z.X., McCourty,A., Sidahmed,e., Orellana,M.E., Burnier,M.N., and
Papadopoulos,V. (2013). Control of hypercholesterolemia and atherosclerosis using the
cholesterol recognition/interaction amino acid sequence of the translocator protein TSPO.
Steroids 78, 137-146.
Lee,D.H., Kang,S.K., Lee,R.H., Ryu,J.M., Park,H.Y., Choi,H.S., Bae,Y.C., Suh,K.T., Kim,Y.K.,
and Jung,J.S. (2004). Effects of peripheral benzodiazepine receptor ligands on proliferation and
differentiation of human mesenchymal stem cells. J. Cell Physiol 198, 91-99.
Lee,F.T., Adams,J.B., Garton,A.J., and Yeaman,S.J. (1988). Hormone-sensitive lipase is
involved in the hydrolysis of lipoidal derivatives of estrogens and other steroid hormones.
Biochim. Biophys. Acta 963, 258-264.
Lee,J.W., Fuda,H., Javitt,N.B., Strott,C.A., and Rodriguez,I.R. (2006). Expression and
localization of sterol 27-hydroxylase (CYP27A1) in monkey retina. Exp. Eye Res. 83, 465-469.
Lee,Y.H., Nair,S., Rousseau,E., Allison,D.B., Page,G.P., Tataranni,P.A., Bogardus,C., and
Permana,P.A. (2005). Microarray profiling of isolated abdominal subcutaneous adipocytes from
obese vs non-obese Pima Indians: increased expression of inflammation-related genes.
Diabetologia 48, 1776-1783.
Lee-Robichaud,P., Wright,J.N., Akhtar,M.E., and Akhtar,M. (1995). Modulation of the activity
of human 17 alpha-hydroxylase-17,20-lyase (CYP17) by cytochrome b5: endocrinological and
mechanistic implications. Biochem. J. 308 ( Pt 3), 901-908.
Lehmann,J.M., Kliewer,S.A., Moore,L.B., Smith-Oliver,T.A., Oliver,B.B., Su,J.L.,
Sundseth,S.S., Winegar,D.A., Blanchard,D.E., Spencer,T.A., and Willson,T.M. (1997).
Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway.
J Biol. Chem. 272, 3137-3140.
Lenzi,A., Picardo,M., Gandini,L., and Dondero,F. (1996). Lipids of the sperm plasma membrane:
from polyunsaturated fatty acids considered as markers of sperm function to possible scavenger
therapy. Hum. Reprod. Update. 2, 246-256.
Li,H. and Papadopoulos,V. (1998). Peripheral-type benzodiazepine receptor function in
cholesterol transport. Identification of a putative cholesterol recognition/interaction amino acid
sequence and consensus pattern. Endocrinology 139, 4991-4997.
Li,H., Yao,Z., Degenhardt,B., Teper,G., and Papadopoulos,V. (2001). Cholesterol binding at the
cholesterol recognition/ interaction amino acid consensus (CRAC) of the peripheral-type
benzodiazepine receptor and inhibition of steroidogenesis by an HIV TAT-CRAC peptide. Proc.
Natl. Acad. Sci. U. S. A 98, 1267-1272.
225
Li,J., Daly,E., Campioli,E., Wabitsch,M., and Papadopoulos,V. (2014a). De novo synthesis of
steroids and oxysterols in adipocytes. J. Biol. Chem. 289, 747-764.
Li,J., Daly,E., Campioli,E., Wabitsch,M., and Papadopoulos,V. (2014b). De novo synthesis of
steroids and oxysterols in adipocytes. J. Biol. Chem. 289, 747-764.
Liu,J., Rone,M.B., and Papadopoulos,V. (2006). Protein-protein interactions mediate
mitochondrial cholesterol transport and steroid biosynthesis. J Biol. Chem. 281, 38879-38893.
Longcope,C. and Fineberg,S.E. (1985). Production and metabolism of dihydrotestosterone in
peripheral tissues. J. Steroid Biochem. 23, 415-419.
Lumeng,C.N., Bodzin,J.L., and Saltiel,A.R. (2007). Obesity induces a phenotypic switch in
adipose tissue macrophage polarization. J. Clin. Invest 117, 175-184.
Lyons,M.A. and Brown,A.J. (2001). Metabolism of an oxysterol, 7-ketocholesterol, by sterol 27hydroxylase in HepG2 cells. Lipids 36, 701-711.
MacDougald,O.A. and Lane,M.D. (1995). Transcriptional regulation of gene expression during
adipocyte differentiation. Annu. Rev. Biochem. 64, 345-373.
MacDougald,O.A. and Mandrup,S. (2002). Adipogenesis: forces that tip the scales. Trends
Endocrinol. Metab 13, 5-11.
MacKenzie,S.M., Huda,S.S., Sattar,N., Fraser,R., Connell,J.M., and Davies,E. (2008). Depotspecific steroidogenic gene transcription in human adipose tissue. Clin. Endocrinol. (Oxf) 69,
848-854.
Maffei,M., Halaas,J., Ravussin,E., Pratley,R.E., Lee,G.H., Zhang,Y., Fei,H., Kim,S., Lallone,R.,
Ranganathan,S., and . (1995). Leptin levels in human and rodent: measurement of plasma leptin
and ob RNA in obese and weight-reduced subjects. Nat. Med. 1, 1155-1161.
Mandrup,S., Sorensen,R.V., Helledie,T., Nohr,J., Baldursson,T., Gram,C., Knudsen,J., and
Kristiansen,K. (1998). Inhibition of 3T3-L1 adipocyte differentiation by expression of acyl-CoAbinding protein antisense RNA. J. Biol. Chem. 273, 23897-23903.
Marcus,Y., Shefer,G., and Stern,N. (2013). Adipose tissue renin-angiotensin-aldosterone system
(RAAS) and progression of insulin resistance. Mol. Cell Endocrinol. 378, 1-14.
Martin,K.O., Reiss,A.B., Lathe,R., and Javitt,N.B. (1997). 7 alpha-hydroxylation of 27hydroxycholesterol: biologic role in the regulation of cholesterol synthesis. J Lipid Res 38, 10531058.
Mast,N., Reem,R., Bederman,I., Huang,S., DiPatre,P.L., Bjorkhem,I., and Pikuleva,I.A. (2011).
Cholestenoic Acid is an important elimination product of cholesterol in the retina: comparison of
retinal cholesterol metabolism with that in the brain. Invest Ophthalmol. Vis. Sci. 52, 594-603.
226
Masuzaki,H., Paterson,J., Shinyama,H., Morton,N.M., Mullins,J.J., Seckl,J.R., and Flier,J.S.
(2001). A transgenic model of visceral obesity and the metabolic syndrome. Science 294, 21662170.
Meaney,S., Hassan,M., Sakinis,A., Lutjohann,D., von,B.K., Wennmalm,A., Diczfalusy,U., and
Bjorkhem,I. (2001). Evidence that the major oxysterols in human circulation originate from
distinct pools of cholesterol: a stable isotope study. J. Lipid Res. 42, 70-78.
Mellon,S.H. and Griffin,L.D. (2002). Neurosteroids: biochemistry and clinical significance.
Trends Endocrinol Metab 13, 35-43.
Mendelsohn,M.E. and Karas,R.H. (2005). Molecular and cellular basis of cardiovascular gender
differences. Science 308, 1583-1587.
Meseguer,A., Puche,C., and Cabero,A. (2002). Sex steroid biosynthesis in white adipose tissue.
Horm. Metab Res. 34, 731-736.
Midzak,A., Akula,N., Lecanu,L., and Papadopoulos,V. (2011). Novel androstenetriol interacts
with the mitochondrial translocator protein and controls steroidogenesis. J. Biol. Chem. 286,
9875-9887.
Midzak,A. and Papadopoulos,V. (2014). Binding domain-driven intracellular trafficking of
sterols for synthesis of steroid hormone, bile acid and oxysterols. Traffic.
Miettinen,T.A. (1971). Cholesterol production in obesity. Circulation 44, 842-850.
Miller,W.L. (2005). Minireview: regulation of steroidogenesis by electron transfer.
Endocrinology 146, 2544-2550.
Miller,W.L. and Auchus,R.J. (2011). The molecular biology, biochemistry, and physiology of
human steroidogenesis and its disorders. Endocr. Rev. 32, 81-151.
Miller,W.L. and Bose,H.S. (2011). Early steps in steroidogenesis: intracellular cholesterol
trafficking. J. Lipid Res. 52, 2111-2135.
Minokoshi,Y., Kim,Y.B., Peroni,O.D., Fryer,L.G., Muller,C., Carling,D., and Kahn,B.B. (2002).
Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415,
339-343.
Mitchell,M., Armstrong,D.T., Robker,R.L., and Norman,R.J. (2005). Adipokines: implications
for female fertility and obesity. Reproduction. 130, 583-597.
Mouzat,K., Volat,F., Baron,S., Alves,G., Pommier,A.J., Volle,D.H., Marceau,G., DeHaze,A.,
Dechelotte,P., Duggavathi,R., Caira,F., and Lobaccaro,J.M. (2009). Absence of nuclear receptors
for oxysterols liver X receptor induces ovarian hyperstimulation syndrome in mice.
Endocrinology 150, 3369-3375.
227
Murdolo,G., Bartolini,D., Tortoioli,C., Piroddi,M., Iuliano,L., and Galli,F. (2013). Lipokines and
oxysterols: novel adipose-derived lipid hormones linking adipose dysfunction and insulin
resistance. Free Radic. Biol. Med. 65, 811-820.
Murdolo,G., Herder,C., Wang,Z., Rose,B., Schmelz,M., and Jansson,P.A. (2008). In situ
profiling of adipokines in subcutaneous microdialysates from lean and obese individuals. Am. J.
Physiol Endocrinol. Metab 295, E1095-E1105.
Nebert,D.W. and Dalton,T.P. (2006). The role of cytochrome P450 enzymes in endogenous
signalling pathways and environmental carcinogenesis. Nat. Rev. Cancer 6, 947-960.
Nelson,D.R., Zeldin,D.C., Hoffman,S.M., Maltais,L.J., Wain,H.M., and Nebert,D.W. (2004).
Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including
nomenclature recommendations for genes, pseudogenes and alternative-splice variants.
Pharmacogenetics 14, 1-18.
Nelson,E.R., DuSell,C.D., Wang,X., Howe,M.K., Evans,G., Michalek,R.D., Umetani,M.,
Rathmell,J.C., Khosla,S., Gesty-Palmer,D., and McDonnell,D.P. (2011). The oxysterol, 27hydroxycholesterol, links cholesterol metabolism to bone homeostasis through its actions on the
estrogen and liver X receptors. Endocrinology 152, 4691-4705.
Nelson,E.R., Wardell,S.E., Jasper,J.S., Park,S., Suchindran,S., Howe,M.K., Carver,N.J.,
Pillai,R.V., Sullivan,P.M., Sondhi,V., Umetani,M., Geradts,J., and McDonnell,D.P. (2013). 27Hydroxycholesterol links hypercholesterolemia and breast cancer pathophysiology. Science 342,
1094-1098.
Neve,E.P., Nordling,A., Andersson,T.B., Hellman,U., Diczfalusy,U., Johansson,I., and
Ingelman-Sundberg,M. (2012). Amidoxime reductase system containing cytochrome b5 type B
(CYB5B) and MOSC2 is of importance for lipid synthesis in adipocyte mitochondria. J. Biol.
Chem. 287, 6307-6317.
Nguyen Dinh,C.A., Briones,A.M., Callera,G.E., Yogi,A., He,Y., Montezano,A.C., and
Touyz,R.M. (2011). Adipocyte-derived factors regulate vascular smooth muscle cells through
mineralocorticoid and glucocorticoid receptors. Hypertension 58, 479-488.
Nguyen,M.N., Slominski,A., Li,W., Ng,Y.R., and Tuckey,R.C. (2009). Metabolism of vitamin
d2 to 17,20,24-trihydroxyvitamin d2 by cytochrome p450scc (CYP11A1). Drug Metab Dispos.
37, 761-767.
Ntambi,J.M. and Young-Cheul,K. (2000). Adipocyte differentiation and gene expression. J. Nutr.
130, 3122S-3126S.
O'Neill,J.S., Elton,R.A., and Miller,W.R. (1988). Aromatase activity in adipose tissue from
breast quadrants: a link with tumour site. Br. Med. J. (Clin. Res. Ed) 296, 741-743.
Ogden,C.L., Carroll,M.D., Curtin,L.R., McDowell,M.A., Tabak,C.J., and Flegal,K.M. (2006).
Prevalence of overweight and obesity in the United States, 1999-2004. JAMA 295, 1549-1555.
228
Ogishima,T., Kinoshita,J.Y., Mitani,F., Suematsu,M., and Ito,A. (2003). Identification of outer
mitochondrial membrane cytochrome b5 as a modulator for androgen synthesis in Leydig cells. J.
Biol. Chem. 278, 21204-21211.
Oosterveer,M.H., Grefhorst,A., Groen,A.K., and Kuipers,F. (2010). The liver X receptor: control
of cellular lipid homeostasis and beyond Implications for drug design. Prog. Lipid Res. 49, 343352.
Oral,E.A., Simha,V., Ruiz,E., Andewelt,A., Premkumar,A., Snell,P., Wagner,A.J., DePaoli,A.M.,
Reitman,M.L., Taylor,S.I., Gorden,P., and Garg,A. (2002). Leptin-replacement therapy for
lipodystrophy. N. Engl. J. Med. 346, 570-578.
Pagadala,M.R. and McCullough,A.J. (2012). Non-alcoholic fatty liver disease and obesity: not
all about body mass index. Am. J Gastroenterol. 107, 1859-1861.
Pandak,W.M., Ren,S., Marques,D., Hall,E., Redford,K., Mallonee,D., Bohdan,P., Heuman,D.,
Gil,G., and Hylemon,P. (2002). Transport of cholesterol into mitochondria is rate-limiting for
bile acid synthesis via the alternative pathway in primary rat hepatocytes. J Biol. Chem. 277,
48158-48164.
Pandey,A.V., Fluck,C.E., Huang,N., Tajima,T., Fujieda,K., and Miller,W.L. (2004). P450
oxidoreductase deficiency: a new disorder of steroidogenesis affecting all microsomal P450
enzymes. Endocr. Res. 30, 881-888.
Papadopoulos,V. (1993). Peripheral-type benzodiazepine/diazepam binding inhibitor receptor:
biological role in steroidogenic cell function. Endocr. Rev. 14, 222-240.
Papadopoulos,V., Amri,H., Boujrad,N., Cascio,C., Culty,M., Garnier,M., Hardwick,M., Li,H.,
Vidic,B., Brown,A.S., Reversa,J.L., Bernassau,J.M., and Drieu,K. (1997). Peripheral
benzodiazepine receptor in cholesterol transport and steroidogenesis. Steroids 62, 21-28.
Papadopoulos,V., Baraldi,M., Guilarte,T.R., Knudsen,T.B., Lacapere,J.J., Lindemann,P.,
Norenberg,M.D., Nutt,D., Weizman,A., Zhang,M.R., and Gavish,M. (2006). Translocator
protein (18kDa): new nomenclature for the peripheral-type benzodiazepine receptor based on its
structure and molecular function. Trends Pharmacol. Sci. 27, 402-409.
Papadopoulos,V., Berkovich,A., Krueger,K.E., Costa,E., and Guidotti,A. (1991). Diazepam
binding inhibitor and its processing products stimulate mitochondrial steroid biosynthesis via an
interaction with mitochondrial benzodiazepine receptors. Endocrinology 129, 1481-1488.
Papadopoulos,V., Liu,J., and Culty,M. (2007). Is there a mitochondrial signaling complex
facilitating cholesterol import? Mol. Cell Endocrinol 265-266, 59-64.
Pasquali,R., Gambineri,A., and Pagotto,U. (2006). The impact of obesity on reproduction in
women with polycystic ovary syndrome. BJOG. 113, 1148-1159.
229
Patel,S.S., Beshay,V.E., Escobar,J.C., and Carr,B.R. (2010). 17alpha-Hydroxylase (CYP17)
expression and subsequent androstenedione production in the human ovary. Reprod. Sci. 17,
978-986.
Pedersen,S.B., Bruun,J.M., Hube,F., Kristensen,K., Hauner,H., and Richelsen,B. (2001).
Demonstration of estrogen receptor subtypes alpha and beta in human adipose tissue: influences
of adipose cell differentiation and fat depot localization. Mol. Cell Endocrinol. 182, 27-37.
Pelleymounter,M.A., Cullen,M.J., Baker,M.B., Hecht,R., Winters,D., Boone,T., and Collins,F.
(1995). Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269,
540-543.
Pikuleva,I.A. (2006). Cholesterol-metabolizing cytochromes P450. Drug Metab Dispos. 34, 513520.
Pikuleva,I.A., Babiker,A., Waterman,M.R., and Bjorkhem,I. (1998). Activities of recombinant
human cytochrome P450c27 (CYP27) which produce intermediates of alternative bile acid
biosynthetic pathways. J. Biol. Chem. 273, 18153-18160.
Pikuleva,I.A., Cao,C., and Waterman,M.R. (1999). An additional electrostatic interaction
between adrenodoxin and P450c27 (CYP27A1) results in tighter binding than between
adrenodoxin and p450scc (CYP11A1). J Biol. Chem. 274, 2045-2052.
Poli,G., Biasi,F., and Leonarduzzi,G. (2013). Oxysterols in the pathogenesis of major chronic
diseases. Redox. Biol. 1, 125-130.
Poulos,S.P., Dodson,M.V., and Hausman,G.J. (2010). Cell line models for differentiation:
preadipocytes and adipocytes. Exp. Biol. Med. (Maywood. ) 235, 1185-1193.
Princen,H.M., Meijer,P., Wolthers,B.G., Vonk,R.J., and Kuipers,F. (1991). Cyclosporin A
blocks bile acid synthesis in cultured hepatocytes by specific inhibition of chenodeoxycholic acid
synthesis. Biochem. J. 275 ( Pt 2), 501-505.
Puche,C., Jose,M., Cabero,A., and Meseguer,A. (2002). Expression and enzymatic activity of the
P450c17 gene in human adipose tissue. Eur. J. Endocrinol. 146, 223-229.
Pullinger,C.R., Eng,C., Salen,G., Shefer,S., Batta,A.K., Erickson,S.K., Verhagen,A., Rivera,C.R.,
Mulvihill,S.J., Malloy,M.J., and Kane,J.P. (2002). Human cholesterol 7alpha-hydroxylase
(CYP7A1) deficiency has a hypercholesterolemic phenotype. J Clin Invest 110, 109-117.
Quinkler,M., Sinha,B., Tomlinson,J.W., Bujalska,I.J., Stewart,P.M., and Arlt,W. (2004).
Androgen generation in adipose tissue in women with simple obesity--a site-specific role for
17beta-hydroxysteroid dehydrogenase type 5. J. Endocrinol. 183, 331-342.
Quinn,C.M., Jessup,W., Wong,J., Kritharides,L., and Brown,A.J. (2005). Expression and
regulation of sterol 27-hydroxylase (CYP27A1) in human macrophages: a role for RXR and
PPARgamma ligands. Biochem. J. 385, 823-830.
230
Rajala,M.W. and Scherer,P.E. (2003). Minireview: The adipocyte--at the crossroads of energy
homeostasis, inflammation, and atherosclerosis. Endocrinology 144, 3765-3773.
Ramsay,T.G. (1996). Fat cells. Endocrinol. Metab Clin. North Am. 25, 847-870.
Rask,E., Walker,B.R., Soderberg,S., Livingstone,D.E., Eliasson,M., Johnson,O., Andrew,R., and
Olsson,T. (2002). Tissue-specific changes in peripheral cortisol metabolism in obese women:
increased adipose 11beta-hydroxysteroid dehydrogenase type 1 activity. J. Clin. Endocrinol.
Metab 87, 3330-3336.
Reis,A., Rudnitskaya,A., Blackburn,G.J., Mohd,F.N., Pitt,A.R., and Spickett,C.M. (2013). A
comparison of five lipid extraction solvent systems for lipidomic studies of human LDL. J. Lipid
Res. 54, 1812-1824.
Rendic,S. and Di Carlo,F.J. (1997). Human cytochrome P450 enzymes: a status report
summarizing their reactions, substrates, inducers, and inhibitors. Drug Metab Rev. 29, 413-580.
Rennert,H., Fischer,R.T., Alvarez,J.G., Trzaskos,J.M., and Strauss,J.F., III (1990). Generation of
regulatory oxysterols: 26-hydroxylation of cholesterol by ovarian mitochondria. Endocrinology
127, 738-746.
Repa,J.J., Lund,E.G., Horton,J.D., Leitersdorf,E., Russell,D.W., Dietschy,J.M., and Turley,S.D.
(2000). Disruption of the sterol 27-hydroxylase gene in mice results in hepatomegaly and
hypertriglyceridemia. Reversal by cholic acid feeding. J. Biol. Chem. 275, 39685-39692.
Romeo,E., Auta,J., Kozikowski,A.P., Ma,D., Papadopoulos,V., Puia,G., Costa,E., and Guidotti,A.
(1992). 2-Aryl-3-indoleacetamides (FGIN-1): a new class of potent and specific ligands for the
mitochondrial DBI receptor (MDR). J. Pharmacol. Exp. Ther. 262, 971-978.
Rone,M.B., Fan,J., and Papadopoulos,V. (2009). Cholesterol transport in steroid biosynthesis:
role of protein-protein interactions and implications in disease states. Biochim. Biophys. Acta
1791, 646-658.
Rosen,E.D. and Spiegelman,B.M. (2006). Adipocytes as regulators of energy balance and
glucose homeostasis. Nature 444, 847-853.
Rosen,E.D. and Spiegelman,B.M. (2014). What we talk about when we talk about fat. Cell 156,
20-44.
Rosen,E.D., Walkey,C.J., Puigserver,P., and Spiegelman,B.M. (2000). Transcriptional regulation
of adipogenesis. Genes Dev. 14, 1293-1307.
Rosen,H., Reshef,A., Maeda,N., Lippoldt,A., Shpizen,S., Triger,L., Eggertsen,G., Bjorkhem,I.,
and Leitersdorf,E. (1998). Markedly reduced bile acid synthesis but maintained levels of
cholesterol and vitamin D metabolites in mice with disrupted sterol 27-hydroxylase gene. J. Biol.
Chem. 273, 14805-14812.
231
Rosenberg,N., Rosenberg,O., Weizman,A., Leschiner,S., Sakoury,Y., Fares,F., Soudry,M.,
Weisinger,G., Veenman,L., and Gavish,M. (2011). In vitro mitochondrial effects of PK 11195, a
synthetic translocator protein 18 kDa (TSPO) ligand, in human osteoblast-like cells. J. Bioenerg.
Biomembr. 43, 739-746.
Ross,S.E., Erickson,R.L., Gerin,I., DeRose,P.M., Bajnok,L., Longo,K.A., Misek,D.E., Kuick,R.,
Hanash,S.M., Atkins,K.B., Andresen,S.M., Nebb,H.I., Madsen,L., Kristiansen,K., and
MacDougald,O.A. (2002). Microarray analyses during adipogenesis: understanding the effects of
Wnt signaling on adipogenesis and the roles of liver X receptor alpha in adipocyte metabolism.
Mol. Cell Biol. 22, 5989-5999.
Rotter,V., Nagaev,I., and Smith,U. (2003). Interleukin-6 (IL-6) induces insulin resistance in 3T3L1 adipocytes and is, like IL-8 and tumor necrosis factor-alpha, overexpressed in human fat cells
from insulin-resistant subjects. J. Biol. Chem. 278, 45777-45784.
Rupprecht,R., Papadopoulos,V., Rammes,G., Baghai,T.C., Fan,J., Akula,N., Groyer,G.,
Adams,D., and Schumacher,M. (2010). Translocator protein (18 kDa) (TSPO) as a therapeutic
target for neurological and psychiatric disorders. Nat. Rev. Drug Discov. 9, 971-988.
Rupprecht,R., Rammes,G., Eser,D., Baghai,T.C., Schule,C., Nothdurfter,C., Troxler,T.,
Gentsch,C., Kalkman,H.O., Chaperon,F., Uzunov,V., McAllister,K.H., Bertaina-Anglade,V., La
Rochelle,C.D., Tuerck,D., Floesser,A., Kiese,B., Schumacher,M., Landgraf,R., Holsboer,F., and
Kucher,K. (2009). Translocator protein (18 kD) as target for anxiolytics without benzodiazepinelike side effects. Science 325, 490-493.
Russell,D.W. and Wilson,J.D. (1994). Steroid 5 alpha-reductase: two genes/two enzymes. Annu.
Rev. Biochem. 63, 25-61.
Russo,M.V., Campanella,L., and Avino,P. (2002). Determination of organophosphorus pesticide
residues in human tissues by capillary gas chromatography-negative chemical ionization mass
spectrometry analysis. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 780, 431-441.
Salen,G. (1971). Cholestanol deposition in cerebrotendinous xanthomatosis. A possible
mechanism. Ann. Intern. Med. 75, 843-851.
Schinner,S., Willenberg,H.S., Krause,D., Schott,M., Lamounier-Zepter,V., Krug,A.W., EhrhartBornstein,M., Bornstein,S.R., and Scherbaum,W.A. (2007). Adipocyte-derived products induce
the transcription of the StAR promoter and stimulate aldosterone and cortisol secretion from
adrenocortical cells through the Wnt-signaling pathway. Int. J. Obes. (Lond) 31, 864-870.
Schmidt,M. and Loffler,G. (1998). Induction of aromatase activity in human adipose tissue
stromal cells by extracellular nucleotides--evidence for P2-purinoceptors in adipose tissue. Eur. J.
Biochem. 252, 147-154.
Schule,R., Siddique,T., Deng,H.X., Yang,Y., Donkervoort,S., Hansson,M., Madrid,R.E.,
Siddique,N., Schols,L., and Bjorkhem,I. (2010). Marked accumulation of 27-hydroxycholesterol
in SPG5 patients with hereditary spastic paresis. J Lipid Res 51, 819-823.
232
Schumacher,M., Guennoun,R., Robert,F., Carelli,C., Gago,N., Ghoumari,A., Gonzalez
Deniselle,M.C., Gonzalez,S.L., Ibanez,C., Labombarda,F., Coirini,H., Baulieu,E.E., and De
Nicola,A.F. (2004). Local synthesis and dual actions of progesterone in the nervous system:
neuroprotection and myelination. Growth Horm IGF Res 14 Suppl A, S18-S33.
Schweiger,M., Schreiber,R., Haemmerle,G., Lass,A., Fledelius,C., Jacobsen,P., Tornqvist,H.,
Zechner,R., and Zimmermann,R. (2006). Adipose triglyceride lipase and hormone-sensitive
lipase are the major enzymes in adipose tissue triacylglycerol catabolism. J. Biol. Chem. 281,
40236-40241.
Seale,P., Conroe,H.M., Estall,J., Kajimura,S., Frontini,A., Ishibashi,J., Cohen,P., Cinti,S., and
Spiegelman,B.M. (2011). Prdm16 determines the thermogenic program of subcutaneous white
adipose tissue in mice. J. Clin. Invest 121, 96-105.
Seckl,J.R. and Walker,B.R. (2001). Minireview: 11beta-hydroxysteroid dehydrogenase type 1- a
tissue-specific amplifier of glucocorticoid action. Endocrinology 142, 1371-1376.
Seidell,J.C., Bjorntorp,P., Sjostrom,L., Kvist,H., and Sannerstedt,R. (1990). Visceral fat
accumulation in men is positively associated with insulin, glucose, and C-peptide levels, but
negatively with testosterone levels. Metabolism 39, 897-901.
Seo,J.B., Moon,H.M., Kim,W.S., Lee,Y.S., Jeong,H.W., Yoo,E.J., Ham,J., Kang,H., Park,M.G.,
Steffensen,K.R., Stulnig,T.M., Gustafsson,J.A., Park,S.D., and Kim,J.B. (2004). Activated liver
X receptors stimulate adipocyte differentiation through induction of peroxisome proliferatoractivated receptor gamma expression. Mol. Cell Biol. 24, 3430-3444.
Shepherd,P.R. and Kahn,B.B. (1999). Glucose transporters and insulin action--implications for
insulin resistance and diabetes mellitus. N. Engl. J. Med. 341, 248-257.
Shi,X.M., Blair,H.C., Yang,X., McDonald,J.M., and Cao,X. (2000). Tandem repeat of C/EBP
binding sites mediates PPARgamma2 gene transcription in glucocorticoid-induced adipocyte
differentiation. J. Cell Biochem. 76, 518-527.
Shimomura,I., Hammer,R.E., Ikemoto,S., Brown,M.S., and Goldstein,J.L. (1999). Leptin
reverses insulin resistance and diabetes mellitus in mice with congenital lipodystrophy. Nature
401, 73-76.
Simard,J., Ricketts,M.L., Gingras,S., Soucy,P., Feltus,F.A., and Melner,M.H. (2005). Molecular
biology of the 3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase gene family. Endocr.
Rev. 26, 525-582.
Simpson,E.R., Merrill,J.C., Hollub,A.J., Graham-Lorence,S., and Mendelson,C.R. (1989).
Regulation of estrogen biosynthesis by human adipose cells. Endocr. Rev. 10, 136-148.
Slominski,A., Semak,I., Zjawiony,J., Wortsman,J., Gandy,M.N., Li,J., Zbytek,B., Li,W., and
Tuckey,R.C. (2005). Enzymatic metabolism of ergosterol by cytochrome p450scc to biologically
active 17alpha,24-dihydroxyergosterol. Chem. Biol. 12, 931-939.
233
Slominski,A., Zbytek,B., Nikolakis,G., Manna,P.R., Skobowiat,C., Zmijewski,M., Li,W.,
Janjetovic,Z., Postlethwaite,A., Zouboulis,C.C., and Tuckey,R.C. (2013). Steroidogenesis in the
skin: implications for local immune functions. J. Steroid Biochem. Mol. Biol. 137, 107-123.
Smas,C.M., Chen,L., Zhao,L., Latasa,M.J., and Sul,H.S. (1999). Transcriptional repression of
pref-1 by glucocorticoids promotes 3T3-L1 adipocyte differentiation. J. Biol. Chem. 274, 1263212641.
Smith,P.J., Wise,L.S., Berkowitz,R., Wan,C., and Rubin,C.S. (1988). Insulin-like growth factor-I
is an essential regulator of the differentiation of 3T3-L1 adipocytes. J. Biol. Chem. 263, 94029408.
Soucy,P., Lacoste,L., and Luu-The,V. (2003). Assessment of porcine and human 16-enesynthase, a third activity of P450c17, in the formation of an androstenol precursor. Role of
recombinant cytochrome b5 and P450 reductase. Eur. J. Biochem. 270, 1349-1355.
Spalding,K.L., Arner,E., Westermark,P.O., Bernard,S., Buchholz,B.A., Bergmann,O.,
Blomqvist,L., Hoffstedt,J., Naslund,E., Britton,T., Concha,H., Hassan,M., Ryden,M., Frisen,J.,
and Arner,P. (2008). Dynamics of fat cell turnover in humans. Nature 453, 783-787.
Steffensen,K.R. and Gustafsson,J.A. (2004). Putative metabolic effects of the liver X receptor
(LXR). Diabetes 53 Suppl 1, S36-S42.
Stenson,B.M., Ryden,M., Venteclef,N., Dahlman,I., Pettersson,A.M., Mairal,A., Astrom,G.,
Blomqvist,L., Wang,V., Jocken,J.W., Clement,K., Langin,D., Arner,P., and Laurencikiene,J.
(2011). Liver X receptor (LXR) regulates human adipocyte lipolysis. J. Biol. Chem. 286, 370379.
Stulnig,T.M., Steffensen,K.R., Gao,H., Reimers,M., Dahlman-Wright,K., Schuster,G.U., and
Gustafsson,J.A. (2002). Novel roles of liver X receptors exposed by gene expression profiling in
liver and adipose tissue. Mol. Pharmacol. 62, 1299-1305.
Stulnig,T.M. and Waldhausl,W. (2004). 11beta-Hydroxysteroid dehydrogenase Type 1 in obesity
and Type 2 diabetes. Diabetologia 47, 1-11.
Szymczak,J., Milewicz,A., Thijssen,J.H., Blankenstein,M.A., and Daroszewski,J. (1998).
Concentration of sex steroids in adipose tissue after menopause. Steroids 63, 319-321.
Tan,B.K., Chen,J., Farhatullah,S., Adya,R., Kaur,J., Heutling,D., Lewandowski,K.C.,
O'Hare,J.P., Lehnert,H., and Randeva,H.S. (2009). Insulin and metformin regulate circulating
and adipose tissue chemerin. Diabetes 58, 1971-1977.
Taves,M.D., Gomez-Sanchez,C.E., and Soma,K.K. (2011). Extra-adrenal glucocorticoids and
mineralocorticoids: evidence for local synthesis, regulation, and function. Am. J. Physiol
Endocrinol. Metab 301, E11-E24.
Taylor,J.M., Allen,A.M., and Graham,A. (2014). Targeting mitochondrial 18kDa Translocator
protein (TSPO) regulates macrophage cholesterol efflux and lipid phenotype. Clin. Sci. (Lond).
234
Tchernof,A., Labrie,F., Belanger,A., Prud'homme,D., Bouchard,C., Tremblay,A., Nadeau,A.,
and Despres,J.P. (1997). Androstane-3alpha,17beta-diol glucuronide as a steroid correlate of
visceral obesity in men. J. Clin. Endocrinol. Metab 82, 1528-1534.
Teplyuk,N.M., Zhang,Y., Lou,Y., Hawse,J.R., Hassan,M.Q., Teplyuk,V.I., Pratap,J., Galindo,M.,
Stein,J.L., Stein,G.S., Lian,J.B., and van Wijnen,A.J. (2009). The osteogenic transcription factor
runx2 controls genes involved in sterol/steroid metabolism, including CYP11A1 in osteoblasts.
Mol. Endocrinol. 23, 849-861.
Thatcher,S., Yiannikouris,F., Gupte,M., and Cassis,L. (2009). The adipose renin-angiotensin
system: role in cardiovascular disease. Mol. Cell Endocrinol. 302, 111-117.
Thiboutot,D., Jabara,S., McAllister,J.M., Sivarajah,A., Gilliland,K., Cong,Z., and Clawson,G.
(2003). Human skin is a steroidogenic tissue: steroidogenic enzymes and cofactors are expressed
in epidermis, normal sebocytes, and an immortalized sebocyte cell line (SEB-1). J Invest
Dermatol 120, 905-914.
Thomas,C., Pellicciari,R., Pruzanski,M., Auwerx,J., and Schoonjans,K. (2008). Targeting bileacid signalling for metabolic diseases. Nat Rev Drug Discov 7, 678-693.
Thompson,M.M., Manning,H.C., and Ellacott,K.L. (2013). Translocator protein 18 kDa (TSPO)
is regulated in white and brown adipose tissue by obesity. PLoS. One. 8, e79980.
Tirard,J., Gout,J., Lefrancois-Martinez,A.M., Martinez,A., Begeot,M., and Naville,D. (2007). A
novel inhibitory protein in adipose tissue, the aldo-keto reductase AKR1B7: its role in
adipogenesis. Endocrinology 148, 1996-2005.
Tirosh,A., Garg,R., and Adler,G.K. (2010). Mineralocorticoid receptor antagonists and the
metabolic syndrome. Curr. Hypertens. Rep. 12, 252-257.
Trayhurn,P. and Wood,I.S. (2004). Adipokines: inflammation and the pleiotropic role of white
adipose tissue. Br. J. Nutr. 92, 347-355.
Trujillo,M.E. and Scherer,P.E. (2006). Adipose tissue-derived factors: impact on health and
disease. Endocr. Rev. 27, 762-778.
Tsigos,C., Kyrou,I., Chala,E., Tsapogas,P., Stavridis,J.C., Raptis,S.A., and Katsilambros,N.
(1999). Circulating tumor necrosis factor alpha concentrations are higher in abdominal versus
peripheral obesity. Metabolism 48, 1332-1335.
Tuck,M.L., Sowers,J., Dornfeld,L., Kledzik,G., and Maxwell,M. (1981). The effect of weight
reduction on blood pressure, plasma renin activity, and plasma aldosterone levels in obese
patients. N. Engl. J. Med. 304, 930-933.
Tuckey,R.C. (1992). Cholesterol side-chain cleavage by mitochondria from the human placenta.
Studies using hydroxycholesterols as substrates. J Steroid Biochem. Mol. Biol. 42, 883-890.
235
Tuckey,R.C., Li,W., Shehabi,H.Z., Janjetovic,Z., Nguyen,M.N., Kim,T.K., Chen,J., Howell,D.E.,
Benson,H.A., Sweatman,T., Baldisseri,D.M., and Slominski,A. (2011). Production of 22hydroxy metabolites of vitamin d3 by cytochrome p450scc (CYP11A1) and analysis of their
biological activities on skin cells. Drug Metab Dispos. 39, 1577-1588.
Umetani,M., Ghosh,P., Ishikawa,T., Umetani,J., Ahmed,M., Mineo,C., and Shaul,P.W. (2014).
The Cholesterol Metabolite 27-Hydroxycholesterol Promotes Atherosclerosis via
Proinflammatory Processes Mediated by Estrogen Receptor Alpha. Cell Metab.
Umetani,M. and Shaul,P.W. (2011). 27-Hydroxycholesterol: the first identified endogenous
SERM. Trends Endocrinol. Metab 22, 130-135.
Upreti,R., Hughes,K.A., Livingstone,D.E., Gray,C.D., Minns,F.C., Macfarlane,D.P., Marshall,I.,
Stewart,L.H., Walker,B.R., and Andrew,R. (2014). 5alpha-Reductase type 1 modulates insulin
sensitivity in men. J. Clin. Endocrinol. Metab jc20141395.
Valle,L.D., Toffolo,V., Nardi,A., Fiore,C., Bernante,P., Di,L.R., Parnigotto,P.P., and Colombo,L.
(2006). Tissue-specific transcriptional initiation and activity of steroid sulfatase complementing
dehydroepiandrosterone sulfate uptake and intracrine steroid activations in human adipose tissue.
J. Endocrinol. 190, 129-139.
Van Schothorst,E.M., Franssen-van,H.N., Schaap,M.M., Pennings,J., Hoebee,B., and Keijer,J.
(2005). Adipose gene expression patterns of weight gain suggest counteracting steroid hormone
synthesis. Obes. Res. 13, 1031-1041.
Veenman,L. and Gavish,M. (2006). The peripheral-type benzodiazepine receptor and the
cardiovascular system. Implications for drug development. Pharmacol. Ther. 110, 503-524.
Veenman,L., Papadopoulos,V., and Gavish,M. (2007). Channel-like functions of the 18-kDa
translocator protein (TSPO): regulation of apoptosis and steroidogenesis as part of the hostdefense response. Curr. Pharm. Des 13, 2385-2405.
Verma,A., Nye,J.S., and Snyder,S.H. (1987). Porphyrins are endogenous ligands for the
mitochondrial (peripheral-type) benzodiazepine receptor. Proc. Natl. Acad. Sci. U. S. A 84,
2256-2260.
Vihma,V. and Tikkanen,M.J. (2011). Fatty acid esters of steroids: synthesis and metabolism in
lipoproteins and adipose tissue. J. Steroid Biochem. Mol. Biol. 124, 65-76.
Villa,J. and Pratley,R.E. (2011). Adipose tissue dysfunction in polycystic ovary syndrome. Curr.
Diab. Rep. 11, 179-184.
Vimaleswaran,K.S., Berry,D.J., Lu,C., Tikkanen,E., Pilz,S., Hiraki,L.T., Cooper,J.D., Dastani,Z.,
Li,R., Houston,D.K., Wood,A.R., Michaelsson,K., Vandenput,L., Zgaga,L., YergesArmstrong,L.M., McCarthy,M.I., Dupuis,J., Kaakinen,M., Kleber,M.E., Jameson,K., Arden,N.,
Raitakari,O., Viikari,J., Lohman,K.K., Ferrucci,L., Melhus,H., Ingelsson,E., Byberg,L., Lind,L.,
Lorentzon,M., Salomaa,V., Campbell,H., Dunlop,M., Mitchell,B.D., Herzig,K.H., Pouta,A.,
Hartikainen,A.L., Streeten,E.A., Theodoratou,E., Jula,A., Wareham,N.J., Ohlsson,C.,
236
Frayling,T.M., Kritchevsky,S.B., Spector,T.D., Richards,J.B., Lehtimaki,T., Ouwehand,W.H.,
Kraft,P., Cooper,C., Marz,W., Power,C., Loos,R.J., Wang,T.J., Jarvelin,M.R., Whittaker,J.C.,
Hingorani,A.D., and Hypponen,E. (2013). Causal relationship between obesity and vitamin D
status: bi-directional Mendelian randomization analysis of multiple cohorts. PLoS Med 10,
e1001383.
Volle,D.H. and Lobaccaro,J.M. (2007). Role of the nuclear receptors for oxysterols LXRs in
steroidogenic tissues: beyond the "foie gras", the steroids and sex? Mol. Cell Endocrinol. 265266, 183-189.
Wabitsch,M., Brenner,R.E., Melzner,I., Braun,M., Moller,P., Heinze,E., Debatin,K.M., and
Hauner,H. (2001). Characterization of a human preadipocyte cell strain with high capacity for
adipose differentiation. Int. J. Obes. Relat Metab Disord. 25, 8-15.
Wada,A. and Waterman,M.R. (1992). Identification by site-directed mutagenesis of two lysine
residues in cholesterol side chain cleavage cytochrome P450 that are essential for adrenodoxin
binding. J Biol. Chem. 267, 22877-22882.
Wade,F.M., Wakade,C., Mahesh,V.B., and Brann,D.W. (2005). Differential expression of the
peripheral benzodiazepine receptor and gremlin during adipogenesis. Obes. Res. 13, 818-822.
Wajchenberg,B.L. (2000). Subcutaneous and visceral adipose tissue: their relation to the
metabolic syndrome. Endocr. Rev 21, 697-738.
Wake,D.J., Strand,M., Rask,E., Westerbacka,J., Livingstone,D.E., Soderberg,S., Andrew,R.,
Yki-Jarvinen,H., Olsson,T., and Walker,B.R. (2007). Intra-adipose sex steroid metabolism and
body fat distribution in idiopathic human obesity. Clin. Endocrinol. (Oxf) 66, 440-446.
Wamberg,L., Christiansen,T., Paulsen,S.K., Fisker,S., Rask,P., Rejnmark,L., Richelsen,B., and
Pedersen,S.B. (2013). Expression of vitamin D-metabolizing enzymes in human adipose tissue -the effect of obesity and diet-induced weight loss. Int. J. Obes. (Lond) 37, 651-657.
Wamil,M., Andrew,R., Chapman,K.E., Street,J., Morton,N.M., and Seckl,J.R. (2008). 7oxysterols modulate glucocorticoid activity in adipocytes through competition for 11betahydroxysteroid dehydrogenase type. Endocrinology 149, 5909-5918.
Wamil,M., Battle,J.H., Turban,S., Kipari,T., Seguret,D., de Sousa,P.R., Nelson,Y.B.,
Nowakowska,D., Ferenbach,D., Ramage,L., Chapman,K.E., Hughes,J., Dunbar,D.R., Seckl,J.R.,
and Morton,N.M. (2011). Novel fat depot-specific mechanisms underlie resistance to visceral
obesity and inflammation in 11 beta-hydroxysteroid dehydrogenase type 1-deficient mice.
Diabetes 60, 1158-1167.
Wang,F., Koskela,A., Hamalainen,E., Turpeinen,U., Savolainen-Peltonen,H., Mikkola,T.S.,
Vihma,V., Adlercreutz,H., and Tikkanen,M.J. (2011). Quantitative determination of
dehydroepiandrosterone fatty acyl esters in human female adipose tissue and serum using mass
spectrometric methods. J. Steroid Biochem. Mol. Biol. 124, 93-98.
237
Wang,F., Vihma,V., Badeau,M., Savolainen-Peltonen,H., Leidenius,M., Mikkola,T.,
Turpeinen,U., Hamalainen,E., Ikonen,E., Wahala,K., Fledelius,C., Jauhiainen,M., and
Tikkanen,M.J. (2012a). Fatty acyl esterification and deesterification of 17beta-estradiol in human
breast subcutaneous adipose tissue. J. Clin. Endocrinol. Metab 97, 3349-3356.
Wang,F., Vihma,V., Soronen,J., Turpeinen,U., Hamalainen,E., Savolainen-Peltonen,H.,
Mikkola,T.S., Naukkarinen,J., Pietilainen,K.H., Jauhiainen,M., Yki-Jarvinen,H., and
Tikkanen,M.J. (2013). 17beta-Estradiol and estradiol fatty acyl esters and estrogen-converting
enzyme expression in adipose tissue in obese men and women. J. Clin. Endocrinol. Metab 98,
4923-4931.
Wang,L., Li,S., Zhao,A., Tao,T., Mao,X., Zhang,P., and Liu,W. (2012b). The expression of sex
steroid synthesis and inactivation enzymes in subcutaneous adipose tissue of PCOS patients. J.
Steroid Biochem. Mol. Biol. 132, 120-126.
Wang,Q., Kim,J.Y., Xue,K., Liu,J.Y., Leader,A., and Tsang,B.K. (2012c). Chemerin, a novel
regulator of follicular steroidogenesis and its potential involvement in polycystic ovarian
syndrome. Endocrinology 153, 5600-5611.
Weber-Boyvat,M., Zhong,W., Yan,D., and Olkkonen,V.M. (2013). Oxysterol-binding proteins:
functions in cell regulation beyond lipid metabolism. Biochem. Pharmacol. 86, 89-95.
Weingartner,O., Laufs,U., Bohm,M., and Lutjohann,D. (2010). An alternative pathway of
reverse cholesterol transport: the oxysterol 27-hydroxycholesterol. Atherosclerosis 209, 39-41.
Weisberg,S.P., McCann,D., Desai,M., Rosenbaum,M., Leibel,R.L., and Ferrante,A.W., Jr.
(2003). Obesity is associated with macrophage accumulation in adipose tissue. J. Clin. Invest
112, 1796-1808.
White,R.E. and Coon,M.J. (1980). Oxygen activation by cytochrome P-450. Annu. Rev.
Biochem. 49, 315-356.
Wilson-Fritch,L., Burkart,A., Bell,G., Mendelson,K., Leszyk,J., Nicoloro,S., Czech,M., and
Corvera,S. (2003). Mitochondrial biogenesis and remodeling during adipogenesis and in
response to the insulin sensitizer rosiglitazone. Mol. Cell Biol. 23, 1085-1094.
Woods,M.J., Zisterer,D.M., and Williams,D.C. (1996). Two cellular and subcellular locations for
the peripheral-type benzodiazepine receptor in rat liver. Biochem. Pharmacol. 51, 1283-1292.
Wooten,J.S., Wu,H., Raya,J., Perrard,X.D., Gaubatz,J., and Hoogeveen,R.C. (2014). The
Influence of an Obesogenic Diet on Oxysterol Metabolism in C57BL/6J Mice. Cholesterol. 2014,
843468.
Wu,J., Bostrom,P., Sparks,L.M., Ye,L., Choi,J.H., Giang,A.H., Khandekar,M., Virtanen,K.A.,
Nuutila,P., Schaart,G., Huang,K., Tu,H., van Marken Lichtenbelt,W.D., Hoeks,J., Enerback,S.,
Schrauwen,P., and Spiegelman,B.M. (2012). Beige adipocytes are a distinct type of thermogenic
fat cell in mouse and human. Cell 150, 366-376.
238
Wu,Q., Ishikawa,T., Sirianni,R., Tang,H., McDonald,J.G., Yuhanna,I.S., Thompson,B.,
Girard,L., Mineo,C., Brekken,R.A., Umetani,M., Euhus,D.M., Xie,Y., and Shaul,P.W. (2013).
27-Hydroxycholesterol promotes cell-autonomous, ER-positive breast cancer growth. Cell Rep.
5, 637-645.
Wu,Z., Rosen,E.D., Brun,R., Hauser,S., Adelmant,G., Troy,A.E., McKeon,C., Darlington,G.J.,
and Spiegelman,B.M. (1999). Cross-regulation of C/EBP alpha and PPAR gamma controls the
transcriptional pathway of adipogenesis and insulin sensitivity. Mol. Cell 3, 151-158.
Wueest,S., Rapold,R.A., Rytka,J.M., Schoenle,E.J., and Konrad,D. (2009). Basal lipolysis, not
the degree of insulin resistance, differentiates large from small isolated adipocytes in high-fat fed
mice. Diabetologia 52, 541-546.
Xu,H., Barnes,G.T., Yang,Q., Tan,G., Yang,D., Chou,C.J., Sole,J., Nichols,A., Ross,J.S.,
Tartaglia,L.A., and Chen,H. (2003). Chronic inflammation in fat plays a crucial role in the
development of obesity-related insulin resistance. J. Clin. Invest 112, 1821-1830.
Yamada,K. and Harada,N. (1990). Expression of estrogen synthetase (P-450 aromatase) during
adipose differentiation of 3T3-L1 cells. Biochem. Biophys. Res. Commun. 169, 531-536.
Yamazaki,H. and Shimada,T. (1997). Progesterone and testosterone hydroxylation by
cytochromes P450 2C19, 2C9, and 3A4 in human liver microsomes. Arch. Biochem. Biophys.
346, 161-169.
Yan,D. and Olkkonen,V.M. (2008). Characteristics of oxysterol binding proteins. Int. Rev. Cytol.
265, 253-285.
Yoshinari,K., Sato,T., Okino,N., Sugatani,J., and Miwa,M. (2004). Expression and induction of
cytochromes p450 in rat white adipose tissue. J. Pharmacol. Exp. Ther. 311, 147-154.
Yu,B.L., Zhao,S.P., and Hu,J.R. (2010). Cholesterol imbalance in adipocytes: a possible
mechanism of adipocytes dysfunction in obesity. Obes. Rev. 11, 560-567.
Yudt,M.R. and Freedman,L.P. (2008). The skinny on fat: how oxysterols may regulate functional
glucocorticoids in adipose tissue. Endocrinology 149, 5907-5908.
Zavala,F. (1997). Benzodiazepines, anxiety and immunity. Pharmacol. Ther. 75, 199-216.
Zhang,H.H., Kumar,S., Barnett,A.H., and Eggo,M.C. (2000). Ceiling culture of mature human
adipocytes: use in studies of adipocyte functions. J. Endocrinol. 164, 119-128.
Zhang,Y., Nadeau,M., Faucher,F., Lescelleur,O., Biron,S., Daris,M., Rheaume,C., Luu-The,V.,
and Tchernof,A. (2009). Progesterone metabolism in adipose cells. Mol. Cell Endocrinol. 298,
76-83.
Zhang,Y., Proenca,R., Maffei,M., Barone,M., Leopold,L., and Friedman,J.M. (1994). Positional
cloning of the mouse obese gene and its human homologue. Nature 372, 425-432.
239
Zhou,Y., Robciuc,M.R., Wabitsch,M., Juuti,A., Leivonen,M., Ehnholm,C., Yki-Jarvinen,H., and
Olkkonen,V.M. (2012). OSBP-related proteins (ORPs) in human adipose depots and cultured
adipocytes: evidence for impacts on the adipocyte phenotype. PLoS. One. 7, e45352.
Zuk,P.A., Zhu,M., Ashjian,P., De Ugarte,D.A., Huang,J.I., Mizuno,H., Alfonso,Z.C., Fraser,J.K.,
Benhaim,P., and Hedrick,M.H. (2002). Human adipose tissue is a source of multipotent stem
cells. Mol. Biol. Cell 13, 4279-4295.
Zurkinden,L., Solca,C., Vogeli,I.A., Vogt,B., Ackermann,D., Erickson,S.K., Frey,F.J.,
Sviridov,D., and Escher,G. (2014). Effect of Cyp27A1 gene dosage on atherosclerosis
development in ApoE-knockout mice. FASEB J. 28, 1198-1209.
Zweytick,D., Athenstaedt,K., and Daum,G. (2000). Intracellular lipid particles of eukaryotic
cells. Biochim. Biophys. Acta 1469, 101-120.
240