Biological Journal of the Linnean Society (2001), 73: 2341. With 7 figures
doi:10.1006/bijl.2000.0520, available online at http;//www.idealibrmy.ry.comon
1BE h
L@
Nucleotide sequence differences reveal genetic
variation in Neotricula aperta (Gastropoda:
Pomatiopsidae), the snail host of schistosomiasis in
the lower Mekong Basin
S. W. ATTWOOD and D. A. JOHNSTON
The Natural History Museum, Cmmwell Road, South Kensington, London SW75BD
Received 22 October 1999; accepted for publication 14 October 2000
To investigate the phylogenetic relationships among the different strains of the polytypic snail Neotricula aperta,
mitochondrial-DNA sequence data were sampled from six populations from central and southern Laos, eastern
Cambodia, and northeast Thailand. Part of the cytochrome c oxidase subunit I gene was sequenced for 21 individuals
from 7 populations, with a 598 bp sequence used in the analyses. Evolutionary distances were estimated as the
Kimura two-parameter distance x 100 (0).The samples were taken from the Mekong, Mu1 and Xi! Bang-Fai rivers
of the lower Mekong Basin. The snail Tricula bollingi was used as an outgroup. The least amount of genetic
divergence was found where the Thai y-strain was compared with the other N. aperta samples (D, 1.6-6.4), and
next for the Xe Bang-Fai river y-strain sample when compared with the other N . aperta (D, 2.8-7.5). Large distances
were apparent between the p-strain and all the y-strain populations (D, 4.7-8.3). The y-strain population of northeast
Thailand comprised two cryptic taxa which were relatively well diverged (D=2.1). The findings agreed with those
of earlier studies based on rRNA gene RFLP variation. The findings were consistent with earlier evidence suggesting
dispersal of snails from highland streams in central Laos (e.g. Xe Bang-Fai) into the Mekong river of northeast
Thailand; this is proposed as an explanation for the cryptic taxa in the region. The y-strain of Cambodia and
southern Laos has been shown to act as intermediate host for Schistosoma mekongi. Such findings are important
in the limitation of Mekong schistosomiasis as they relate to the timing and location of snail control measures. A
revised phylogeography is presented for the Triculinae on the basis of the present findings and current palaeo0 2001 The Linnean Society of London
geographic models for Southeast Asia.
ADDITIONAL KEYWORDS: DNA sequencing - Gastropoda - genetic variation - Neotricula aperta - phylogeography
- Schistosoma mekongi.
events. The present study was intended to improve
our understanding of the different strains of N. aperta.
"Wo endemic foci of human schistosomiasis mekongi
are known. One focus is a t Khong Island in southern
Laos (Kitikoon et al., 1973) and the other a t Kratie in
eastern Cambodia (Schneider, 1976); these two foci lie
on the Mekong river, the former approximately 200 km
upstream (north) of the latter (Fig. 1). Three strains
(a, p & y) were originally described for N. aperta a t
Khemmarat in northeast Thailand and in southern
Laos, mainly on the basis of differences in shell size,
mantle pigmentation and ecological habit (Davis, Kitikoon & Temcharoen, 1976). All three strains are
to varying degrees (y>>P>a) capable of transmitting
Schistosoma, although the y-strain alone is epidemiologically significant (Attwood, Kitikoon & Southgate, 1997). N. aperta appears restricted to the lower
Mekong river, which here refers to the Mekong river
INTRODUCTION
Neotricula aperta (Temcharoen, 1971) is a freshwater
hydrobioid snail of northeastern Thailand, southern
Laos and Cambodia; this region together with southern
Vietnam, being known as the lower Mekong Basin. N.
aperta is also the natural host of Schistosoma mekongi
Voge, Bruckner & Bruce, 1978 responsible for transmitting human schistosomiasis in the lower Mekong
Basin. A number of developed nations have expressed
an interest in the development of the lower Mekong
river and one mainstream dam has already been constructed on the Mu1 river, a tributary of the Mekong,
a t Pak-Mu1 in northeast Thailand (Attwood, 1996).
There is concern that water resource development will
attenuate the natural flood cycle of the Mekong river
drainage, thereby facilitating the dispersal of snail
intermediate hosts and promoting hybridization
0024-4066/04/050023 + 19 $35.00/0
23
0 2001 The Linnean Society of London
24
S. W. ATTWOOD and D. A. JOHNSTON
Figure 1. The lower Mekong Basin showing the more important rivers and tributaries. The location of Khong Island
(A)is also indicated. International boundaries and scale are approximate.
and its tributaries in the lower Mekong basin. Whilst
the ;)- and p-strains are fluviatile, found in the Mekong
and Mu1 rivers respectively, the r-strain is restricted
to ephemeral pools along the banks and islands of the
lower Mekong river. Relatively little is known of the
ecology and phylogeny of these snails; this is mainly
due to problems of snail culture in the laboratory
and the severe annual flood in the lower Mekong
(July-November) which interrupts direct observations
of the snails in nature. In the Mekong and Mu1 rivers
N. aperta is apparently semelparous (Attwood, 1995),
the eggs take 4-5 weeks to hatch and longevity is
unlikely to exceed 15 months. The snails are also
relatively small, with mean (maximum) shell length
ranging from 1.8mm, y-strain, to 3.5 mm, %-strain,
thus exacerbating known difficulties of extracting DNA
from snail tissue.
Mekong schistosomiasis causes severe morbidity
among the riparian peoples, particularly around Kratie
(Maunoury et al., 1990). In spite of the public health
impact of this disease, the work of Staub et al. (1990),
Attwood, Kitikoon & Southgate (1998) and Attwood
(1999) remain the only reports on the molecular systematics of N . aperta. The present work builds upon
our insight into N. aperta phylogeography, provided
by RFLP (restriction fragment length polymorphism)
analysis of rRNA-gene sequences (Attwood, 1999), t o
resolve better the N. aperta strain-complex by in-
VARIATION IN NEOTRICULA APERTA
cluding data for a mitochondria1(mt) genome sequence.
The endemic fauna occurring along the 480 km stretch
of the Mekong river (from Khemmarat to Kratig) is
also important as it represents the largest known
assemblage of endemic hydrobioid snails. The data on
Tricula bollingi will also be of use in future studies of
this endemic triculine fauna.
N. aperta is assigned to the Pomatiopsidae, a family
of conservative rissoacean snails in that there is a
relationship between a bursa copulatrix, seminal receptacle and a bipartite pallial oviduct. The Pomatiopsidae are most readily distinguished from taxa
of the European Hydrobiidae, with which there is
considerable convergence, by the nature of the central
tooth and the observation that, in the pomatiopsid
female, sperm enter the bursa1 complex via a spermathecal duct (Davis, 1980). There are two pomatiopsid
subfamilies; the Pomatiopsinae, to which the intermediate hosts of Schistosoma japonicum Katsurada,
1904 (i.e. Oncomelania hupensis sub-spp.; Gredler,
1881) are assigned, and the Triculinae, which includes
Neotricula (see Davis, 1980). The modern Triculinae
are entirely Southeast Asian and southern Chinese in
distribution. Neotricula aperta was first reported from
the region around Khong Island and was called Lithoglyphpsis aperta Temcharoen, 1971. Re-examination
of the holotype suggested the a-strain, and the type
locality was recorded as Ban Na on Khong Island, Laos
(Davis et al., 1976). However, no definitive anatomical
descriptions were provided and shell (photographic)
and radula data do not suggest N. aperta; therefore it
is unclear which of the three original strains (a,p and
y), if any, was involved (Attwood, 2001). The presence
of the a-strain at Khong Island has not been substantiated, although the y-strain is common there. In
addition, the types deposited by Temcharoen (shells
only) are in poor condition and reportedly difficult to
distinguish from sympatric species such as Manningiella conica Temcharoen, 1971. Manningiella is
no longer a valid genus and most species have been
transferred to Hubendickia and Halewisia, see Davis,
1980), unfortunately M. conica is anatomically unknown. Consequently, and for reasons of convenience,
the y-strain of N. aperta from Khong Island is used to
represent N. aperta in systematic studies until the
taxonomic history has been clarified. Davis (1980) referred t o L. aperta as Tricula aperta on the basis of
both shell and radula characters. T aperta was later
transferred to NeotricuZa on the basis of differences in
reproductive anatomy (Davis, Subba Rao & Hoagland,
1986).
Several taxa allied to Neotricula are also known t o
act as intermediate host for species of Schistosoma.
The snail Robertsiella kaporensis Davis & Greer, 1980
(Pomatiopsidae: Triculinae: Pachydrobiini) transmits
Schistosoma malayensis Greer, Ow-Yang & Yong, 1988
25
in Pahang State, peninsular Malaysia; this schistosome mostly affects the Orang Asli peoples of the
region. An unknown species of Tricula transmits a
rodent schistosome named Schistosoma sinensium
Bao, 1958 on the Yangtze river Platform in Sichuan
Province, China. In the mountains of Chiang-MaiProvince, northern Thailand, the snail Tricula bollingi
Davis, 1968 (Triculinae: Triculini) transmits Schistosoma ‘sinensium’ (see Baidikul et al., 1984); this is
again a parasite of rodents but is unlikely t o be the
same species as that found in Sichuan (see Discussion).
Finally,J i n h n g i a jinhngensis (Guo & Gu, 1985) (Triculinae: Pachydrobiini) is reported t o transmit a species of Schistosoma in tributaries of the Mekong river
in Yunnan Province, China. Clearly, several lineages
within the Pomatiopsidae are characterized by the
ability to act as host for Schistosoma and this contributes t o the importance of the group.
Earlier biogeographic data, such as those employed
by Davis et al. (1992), indicated that the major isolating
events affecting pomatiopsid taxa occurred around
12 M y ago [Mya]. Consequently, the mid-Miocenewas
considered to be the point at which pre-Schistosoma
japonicum became established in amphibious Pomatiopsinae of the Yangtze river drainage (southern
China), and pre-S. mekongi/malayensis became isolated in Triculinae of the evolving Mekong and Salween
river systems. However, more recent palaeogeographic
models suggest a later separation of the two drainage
systems (see Xu, 1981; Hutchinson, 1989; Hall, 1998)
and isolation of the S. japonicum and S. mekongi clades
during the Pliocene. There is also evidence for the
colonization of Thailand and Laos by N. aperta and S.
mekongi via an extended Irrawaddy-Salween system
in the Pleistocene (see Hutchinson, 1989), rather than
via the upper Mekong in a ‘linear’fashion as proposed
by Davis (1979, 1982, 1992). The role of such palaeogeographic data, in the reconstruction of N. aperta
phylogeography and the origins of Asian Schistosoma,
will be discussed in this paper.
Allozyme-based studies (Attwood et al., 1998) revealed significantmultilocus genetic distances between
the three strains of N. aperta from northeast Thailand
(Nei’s [1978] D, 0.6-1.2) and between the y-strain
from Thailand and southern Laos (D= 1.5). In marked
contrast, Staub et al. (1990) reported only minor genetic
distances between the Thai a-and y-strains (average
D = 0.01). The genetic distance between the p-strain
and the a-and y-strains pooled was 0.66. Staub and
co-workers (1990) also reported two cryptic taxa from
the Mekong river at Khemmarat, and each of these
taxa included both a- and y-strain snails. The 1990
team were able t o obtain significant multilocus distances only after resorting their samples (strains), a
posteriori, into four new groupings with D values ranging from 0.2 t o 0.9; these new taxa had no mor-
26
S. W. ATTWOOD and D. A. JOHNSTON
phological basis. Again in contrast to the 1990findings,
Attwood et al. (1998) did not detect a pair of cryptic taxa
that each included both (x- and y-strain individuals. In
view of the lack of taxonomic data and inconsistency
of the allozyme results, a study was undertaken aimed
at the resolution of the N. aperta sibling-species complex.
The resulting project employed a PCR- (polymerase
chain reaction) based RFLP analysis of N. aperta (see
Attwood, 1999). The analysis involved variation at
the 5.8s rRNA gene and flanking transcribed spacer
regions. This study agreed well with the 1998 allozyme
work however, the Thai SI- and y-strains appeared
more heterogeneous and the relationship with snails
from central Laos was unclear. The N. aperta complex
also showed high levels of variation, in that heteroplasmy was observed in spite of the expected (homogenizing) concerted evolution among such families of
nuclear repeated genes. The mt cytochrome oxidase c
subunit I (COI) is considered to be a more conserved
marker than the rRNA gene sequences above (Dowling
& Brown, 1989). The absence of recombination and
expected homogeneity within populations makes
mtDNA markers particularly suitable for population
phylogeny estimation and studies of historical biogeography. Consequently the present study used
sequence data for the COI gene, and was performed
in order to limit any earlier effects of paralogy and to
help decide between conflicting reports in the literature. A relatively conserved mitochondria1 structural gene was chosen as this was expected to be less
subject to intrapopulation variation than the rRNA
gene used in earlier studies of N. aperta. Such investigations yield requisite data for future phylogenetic or ecological studies in that they define the
basic taxonomic units present and shed light on phylogeography and dispersal.
MATERIAL AND METHODS
SAMPLING
Samples were taken a t various locations spanning the
(known) geographical and habitat range of N. aperta.
The sampling area involved three countries and a
number of politically unstable regions. The habitats
were remote and sometimes difficult to access; consequently, the scale of sampling and inclusion of geographically intermediate populations was limited.
Sample sizes were chosen so as to ensure the probable
inclusion of all within population polymorphism present: however, the emphasis was on sampling across
the known range of N. aperta.
Sampling took place a t six geographical locations
(Fig. 1) and the snails were identified on the basis
of general form, conchology, radula characters and
ecological habit. The Tricula bollingi collected were
shown to act as intermediate host for Thai S. sinensium
in the laboratory. The first site was at Ban Khi-Lek
on the Lao-Thai border (16’2’33’”; 105’18’27’73), near
Khemmarat, Ubon-Ratchathanee Province, northeast
Thailand (Fig. 1);this sample (taxon) is coded TGAM
(see Table 1). Each sample was taken in water < 2 m
deep and along a 10 m transect. Two %-strainsamples
were taken at Ban Khi-Lek, each from a different pool
on the main bank of the river; the sample coded ALPH
(Table 1) comprised two snails from pool 1 and one
from pool 2. The a- and y-strain populations a t Ban
Khi-Lek were thus in neighbour sympatry, all other
populations sampled were allopatric.
The second study locality lay 270km down river,
south of Khemmarat, a t Khong Town on Khong Island
(Fig. l), Champassac Province, southern Laos. The
sample (coded LGAM) was taken from the southeastern limit of the island a t Ban Xieng-Wang
(14’6‘30”;
105’51’45”E) within a n area of about
50 000 m2. The snails here were of the y-strain and
were collected in shallow water about 50m from the
shore. The southernmost sample (coded KHMR) was
taken from the Mekong river a t Krakor, Kratie District,
eastern Cambodia (12’27’10”N; 106’1’45’73) from a
small (-5m2) area close to the shore in water less
than 0.5 m deep.
A further sample was obtained from the Xe Bang-Fai
river (Fig. 1)a t Ban Mahaxai, Khammouane Province,
central Laos (17’24‘45’”; 105’13’15%); this site was
unique in that it lay in a relatively mountainous area
(elevation 500 m). The snail resembled the y-strain
(here referred to as XBFG, see Table 1)and corresponds
to the ‘XBF strain’ discussed by Attwood & Upatham
(1999). The Xe Bang-Fai flows into the Mekong about
120km upstream of Khemmarat (Fig. 1). The fifth
study locality (0-strain, BETA) was at Kaeng-Kao,
Phibun Mangsahan, Ubon-Ratchathanee Province,
northeast Thailand (15’14’30N; 105’17’15’73), in the
Mu1 river near Ubon (Fig. 1).
At all sites the habitats were characterized by shallow, quite rapidly flowing water, with eroding substrata
and where the river is interrupted by many small
islands. Tricula bollingi was collected from a small
mountain stream, 500m downstream of the type locality, in Fang District, Chiang-Mai Province, northwest Thailand (19’38’30N; 99’5’2073). Table 1 gives
the dates of collection for each set of samples. The
samples were collected directly into absolute alcohol.
All N. aperta samples, except possibly that from Kratie,
were likely to have represented a single generation
(Attwood, 1995). Political unrest in Kratie District
prevented the collection of a 1997 sample. The snails
were not sexed because alcohol preserved specimens
are difficult to sex. Further, reabsorption of the verge
has been recorded in males during late low water
(Upatham et al., 1980). It was considered preferable
VARIATION IN NEOTRICULA APERTA
27
Table 1. Codes, localities, strains and collection dates for samples taken from the lower Mekong
Basin
Sample code
Locality
Strain
Date
~
ALPH
BETA
KHMR
LGAM
TBOL
TGAM
XBFG
Ban Khi-Lek, Mekong river, NE Thailand
Kaeng-Kao, Mu1 river, NE Thailand
KratiB, Mekong river, Cambodia
Ban Xieng-Wang, Mekong river, S Laos
Chiang-Mai, Mekong river, NW Thailand
Ban Khi-Lek, Mekong river, NE Thailand
X B Bang-Fai river, central Laos
to use field fixed samples, thereby avoiding problems
of selection in transport and government controls on
live imports. Voucher specimens were deposited in the
Natural History Museum, London and coded ETU 4450
a-f.
DNA AMPLIFICATION AND SEQUENCING
The snails were gently crushed and the body separated
from the shell. The gut and digestive gland were removed and DNA extracted from the remainder by
standard methods (Winnepenninck, Backeljau & De
Wachter, 1993). Amplification of a section of the coding
region of COI was achieved with the HCO-2198 and
LCO-1490 primer pair developed by Folmer et al.
(1994), following the recommended cycling conditions.
PCR products for individual snails were ligated into
the pGEM-Tplasmid vector (PROMEGA),transformed
into JMlO9 (E. coli) competent cells (PROMEGA) and
recombinants determined by bludwhite selection with
X-Gal and I R G . Transformants were confirmed by
PCR (using the above primers) and between 8 and 13
clones (average 11) were pooled for each snail sampled.
The pooled clones were mini-prepped according to the
protocol of the SIGMA plasmid purification mini-prep
kit. Two independent sets of PCR product were used
for one of the BETA samples to examine reproducibility.
The above (Folmer) primers were used separately as
sequencing primers for cycle sequencing reactions
using 20-30 ng of cloned PCR product as template and
AMERSHAM dye terminator cycle sequencing premix kit (following a half-reaction protocol). The dried,
purified, cycle sequencing product was resuspended
with 2.5 pl of loading solution, comprising 5: 1deionized
Formamide:25 mM EDTA with 50 mg/ml of Blue Dextran. A 1.5 p1 aliquot of sample and loading solution
was loaded on a 36 cm, 4% acrylamide gel. The gel was
run and analysed on a n AE3I Prism 377 DNA sequencer.
Any clones bearing contaminant DNA sequences were
identified by a BLASTP search of the translated amino
acid sequence in both the EMBL DNA sequence data
base and Swissprot. All translations were made using
the Dmsophila mtDNA genetic code.
22/04/97
24/04/97
02/05/96
20/04/97
27/03/98
22/04/97
27/0W8
SEQUENCE ANALYSIS
Automated sequence data were edited using Sequencher v. 3.0 (Gene Codes Corp.) with both strands
sequenced to confirm data accuracy. The consensus
sequences were aligned using ClustalX v. 1.0 (Thompson, Higgins & Gibson, 1994). Nucleotide diversity
(R) was estimated using the Jukes & Cantor (1969)
correction following Lynch & Crease (1990). Divergence
estimates between populations based on the number
of nucleotide substitutions per site (Dxy), with Jukes
and Cantor correction, were calculated following Nei
(1987). Both R and Dxy were calculated using the
program DnaSP v. 3.0 (Rozas & Rozas, 1999). Maximum likelihood (ML) and a distance method were
used to infer phylogenetic relationships. ML and FitchMargoliash (FM) trees were generated using the
DNAml and FITCH programs, respectively, of the
PHYLIP v. 3.5 package (Felsenstein, 1995). Distances
were estimated as the Kimura two-parameter distance
x 100, D (Kimura, 1980) and were the basis of the FM
trees.
The robustness of the FM phylogeny was assessed
by implementing bootstrap analysis consisting of 2500
replicates (Felsenstein, 1985). Global branch swapping
(Felsenstein, 1995) was used to overcome the tendency
of stepwise algorithms to converge onto local (sub-)
optima; the input order of taxa was also randomized
during replicate distance calculations to test for convergence. The use of the FM method allowed direct
comparison with the findings of earlier studies (e.g.
Attwood et al., 1998; Attwood, 1999). In order to compensate for any violation of assumptions specific to
the FM method and to examine congruence between
phylogenetic methods, the ML method was also used.
ML seemed appropriate where the taxa were not well
understood and few assumptions, such as constancy
of evolutionary rate between lineages, could be made
about the data (see Nei, 1991). Further, the use of a
painvise distance method alone may fail to detect any
under compensation for homoplasy in the data due to
the common evolutionary history of the sequences
compared. ML is not subject to this systematic error
28
S. W. ATI'WOOD and D. A. JOHNSTON
"
25
125
225
325
425
Nucleotide position
525
Figure 2. Distribution of (R) variable and (0)
phylogenetically informative sites for all aligned Neotricula
aperta and Tricula bollingi sequences.
and makes fuller use of the information available in
the sequences.
The ML model was that of Felsenstein (1981) with
modifications, following Hasegawa, Kishino & Yano
(1985), to distinguish transitions from transversions
and to accommodate different rates of evolution between sites. A transition bias was considered in view
of the marked predominance of transitions over transversions in the evolution of animal mtDNA (Brown et
al., 1982). Multiple transitions may be common along
mt DNAs and the model must account for this unobserved variation. The expected transitiodtransversion ratio (T) was estimated from the observed ratio
under the above model; that is, it was corrected taking
into account the overall frequencies for the different
nucleotides in the data set. T was used as a n input
parameter in DNAml and in the computation of D.
The present analysis assumed that the alternative
outcomes of transversion events occurred with equal
probability.
RESULTS
SEQUENCE VARIATION
The analyses were confined to a 598 bp segment of the
PCR products, limited by the length of the shortest
legible sequence among the samples after alignment.
Considering the data for all snails there were 16 haplotypes and 88 polymorphic (segregating) sites and, of
these, 25% would be considered phylogenetically informative for parsimony analyses (i.e. showed a minimum of two alleles at each position, with each allele
present more than once), the rest were singleton sites
(Fig. 2).
Over 68Vo of the informative sites had only two
variants and the remainder showed three or, in one
case, four variants. Of the 88 segregating sites only
three of the changes corresponded to amino acid replacements, one involved ALPH and two TBOL; there
was only one non-synonymous replacement and this
occurred a t the start of the TBOL sequence. Figure 2
shows the distribution of polymorphic sites across the
DNA sequences for all taxa and this does not appear
to be markedly clustered.
Direct counting revealed that, in N . aperta, over
96% of polymorphic sites corresponded to third codon
positions and the remainder to first positions. Among
the TBOL sequences, 85% of segregating sites were
third codon positions, 1.5%second positions, and 13.5%
first positions. Consequently, these variations in substitution rate were incorporated into both the ML
analyses and calculations of D, using the rates estimated from the data. Phylogenetic noise caused by
variation a t the first positions of leucine codons was
negligible, as only 3 out of 30 such positions were
variable and two of these were singletons. The
sequence of each haplotype has been lodged in GenBank (Accession numbers AF188210 to AF188227 N.
aperta, and AF339847 I: bollingi).
Table 2 presents statistics for the aligned sequences
corresponding to each OTU (operational taxonomic
unit) involved in the study, as defined by collection
locality o r habitat. Nucleotide diversity estimates and
numbers of polymorphic sites indicated that BETA and
TGAM were the most heterogeneous taxa, especially
the latter with n =0.0285 iO.0071. T k o sub-taxa were
recognized among the four TGAM haplotypes; for example, of the 33 polymorphic sites found among the
TGAM sequences, the three snails assigned to TGI are
monomorphic a t 27 (82%) of these positions. Division
of TGAM into TGI and TGII reduced the nucleotide
diversity of TGI to 0.0067 0.0032 (from the 0.0285 of
TGAM; Table 2). The nucleotide diversity of TGII was
not reduced relative t o that of TGAM.
Agreement with earlier phylogenetic studies (Attwood, 1999) further supported the case for the division
of TGAM, and TGI and TGII were used in all subsequent analyses. A similar division of BETA was not
possible as no correlation between alleles in different
snails could be discerned. ALPH and KHMR appeared
most homogeneous (Table 2), although relatively low
sample size may have led to apparent homogeneity in
KHMR. ALPH populations may be expected to be less
heterogeneous owing to the pool-dwelling, isolated,
habit of this strain. Aside from TGAM, the samples
were considered sufficiently homogeneous to constitute
coherent taxa. The haplotypes for each OTU were
therefore combined into a single consensus sequence
for further analysis.
The appropriate IUB ambiguity code was introduced
wherever a polymorphic site occurred within an OTU;
the resulting sequences are given in Figure 3 and
29
VARIATION IN NEOTRICULA APERTA
Table 2. Statistics relating to the COI sequences for each OTU: number of sequences (N); number of
haplotypes found; number of polymorphic sites, with phylogenetically informative sites in parentheses;
number of replacement amino acid substitutions; nucleotide diversity (TI) with Jukes & Cantor (1969)
correction
OTU
N
Haplotypes
Polymorphic sites
ALPH
BETA
KHMR
LGAM
TBOL
TGAM
TGI
TGII
XBFG
TOOL :
AIPH
:
BET<
'
KHUR :
LGAhl :
TC.L
TCll
:
:
\WC :
Replacements
R ~ S D
0.0022 k 0.0007
0.0076 0.0016
0.0000 f0.0000
0.0067 k 0.0033
0.0022 f0.0011
0.0285 f0.0071
0.0067 k0.0032
0.0290 k0.0142
. . . .G . A. .T.....T.........T.A.....G..............GT.A..T.....A..A.....G..............A...........A........G.............,....,.,....,TC,.,....A....,A,.
. . . . . . .G............... . . . . . . . . . . G . . . . . . . . . . . G . . . . . . . . A . . A . .
................................. . . . ........................................
.....
. - . .YR........G . . Y . . . .............................................................................. ....................................... A. . . . . . . .
. ........................................................
........................ ...............................................................
. . . . . . . . . . . ........................................................................................................... . . . . . . . . . . . . . . . .A..............
. . . . . . . . . . . . . .......................................................................
. . . . . . . . . . . . . . ..................................... R........
. . . . . . . . . . . . . . ..............................................................................................................................
........
...............................
, .C . .......................................... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
: 150
: 150
'
:
:
:
:
:
150
150
150
150
150
150
ATGAtctGGaTTaGT GGtACTGCtsTtAGATTatTaATTCGAGCTGA CTtGG CA CC GGgGCgTTaTTAGG G A t G A T C l s C T t T A T M T G T t n T t G T T A C ~ G U U T ~ T T T G T M T a A T T T T T T T = t T q G T T A TCCAATqAT
.........................
........
. . . . . . ....................................
..............................
.............................................
..
. . . . . . . . . . . . . . . . ......................
. . .......................................
................. .........
. . . . . . . . . . . . . ...............................................
..................................
.....................
................................
...............
TBOL : . . . . .A. . . . . . . . . .C . . . . . . A . . . . A . . . . . . . . . . . . . . .
. . . .C.....A . . . . . . .AC
C..A..A..A..G..............A..A..
. .C..A.....A..A..C.... : 300
AI.PII : . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
.....................
A,....... : 300
..
: .................... G....................G.....T........R
C..................
.A,. . . . . . . . . . . . . . . . . . . .
LHWR : A , . . . . . . . . . . . . . . . .
C.............
G.......
. . . . . . . . . . . . . . . . . . . . .C....
IC&V :
G.
..................................
rct
:
.
c.........
G...c.G..................... . . . . . . . . .
lGll
:
RY.R
........................................................................
\BPI;
:
.......................................................................................................................................
BE14
:
....
300
300
: 300
: 300
....................
: 300
.
300
T........T..A . . . . . . . .T.A .................................................................................... . . . . . . . . . . . . . . . . . . T........ . . _ . . . . . . . :
. . . . . . . . .R..... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .............................. . . . . . . .C. . . . . . .T . . . . . . . . . . . _ . . . . . .:
. . .G..G. . . C.. . ..................................................... ............................ C..G....................R..T..... . . . . . . . . . . . :
.......................................... ............................................................................................................ :
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................................................................................. . . . . . . . . . . . . . . . . . . .R. :
450
A T T G G t G G T T T T G G m t T G tTaqTTCCtTTMTATTaGGlGCTCCaGAtATAGC TTtCCTCG tTAMTUTATMGaTTTTGATTACTtCCtCC GC TTITTATT TTAtT TCtTC GcTGCtGTtGAAAGtGuJGctGGTAC
. . . . . . . . . . . . . . . . . . ....................................... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
.... ................ :
. . . . . . . . . . . . . . . ....................
............................ . . .Y . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
T . . . . . . _ . . . . . . . . . . . .:
................................................ C..A.............. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . :
aGGaTGaACaGTtTATCCTCCacTtGCtgGaAAtTTAGCtCAtGCaGG GG TCTGTTGA TTAGCTATTTTTTCTTTACA TTAGCTGGTGTTTCTTCaATtTTaGGtGCTGTAMTTTtATTACaAC
1S"L
ALPH
:
:
BET4
:
: 598
: 598
. . . . ................................................................................................................................... . . . . . . . . . . . :
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . , . . . . . . , . . . . . . . , . . . :
. . . . . . . .R....... . . . . . G........Y. ..................... ........................................................................................... :
. . . . . . . . . . . . . . . . . ...................................................................................................................... . . . . . . :
YHUR :
,GI\,
:
Itit
:
,till
: . . . . ........................................................
...............................................................
W...
\WL :
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
C...........A...
........................
...........................
450
450
450
450
450
ATtATTAATATACGATGaCG
. . . . . .A..G..............T....................................T.A.........T.G.....T..A.....T..T.....A..A.....G...........C........T..................
. . . . . .A. . . . . . . . . . . ..................................
....................
. . . . . . .A........ . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
...........
................
450
450
..
.
598
598
598
598
598
598
TGGAAT UaTTTGAACGACTTCC TTaTTTqTtTGATCAGTaAAMTTACTGCTGTITT.ETtTTATTaTCAoTtCCtGTTT GCTGG GCaATTACtAT C T T T T a A C T G A T C a t T T T A A T A C GCtTTTTTTGATCCtGCT
Figure 3. Nucleotide identities for the aligned 598 bp of the COI sequences for all OTUs. Standard IUB codes are
used.
represent the data set used in phylogeny reconstruction. This qualitative approach to population
phylogeny analysis was considered sufficient in the
present case, where variation was greater between
rather than within populations, and for the questions
being posed. The expected transition ratio for the
revised data set was 3.08, implying a transition bias
common among animal mtDNA sequences. The average base composition was, including the outgroup,
A, 24.7%; T, 40.2%; G, 19.7%; C, 15.4%. Tajima's test
(Tajima, 1989) indicated that a hypothesis of neutral
mutation could not be rejected for these data (6=
- 1.33494, BO.10); thus the present data appear to
satisfy the assumptions of most phylogenetic methods,
such as ML, in this respect.
Divergence estimates Dxy ( x 100) are given in Table
3. Several of the Dxy values exceeded 10, suggesting
that transition bias (and multiple substitutions) or
rate variation among nucleotide positions may have
a n effect on the analyses. A likelihood ratio test (Lm
Felsenstein, 1988) was performed using the ML values
obtained using T set to 3.08 and to 2.0; the test
30
S. W. ATTWOOD and D. A. JOHNSTON
Table 3. Above diagonal, average number of nucleotide substitutions per site between populations of Neotricula aperta
and 7'ricula bollingi (outgroup), with the Jukes & Cantor correction, Dxy (Nei, 1987) fSD; below diagonal, Kimura
two-parameter evolutionary distance estimates & SE. All distances are reported x 100 and to two significant figures
1
2
3
4
6
5
8
7
9
~
1. TBOL
2. ALPH
3. BETA
4. KHMR
5. LGAM
6. TGAM
7. TGI
8. TGII
9. XBFG
-
18k2.3
20 _+ 2.8
19k2.4
21 k2.0
18k3.0
20 k 3.0
17k2.9
20 f2.2
13k4.9
-
6.8f1.1
4.8 kO.9
5.9 1.0
2.0k1.0
4.3 k 0.8
2.8 k 0.7
6.3 kO.8
*
14 f4.8
6.8k2.4
-
6.3 f0.9
8.3k1.1
4.9k 1.1
6.4 k 1.0
4.7k0.9
7.5 k 0.8
13k5.1
4.6k1.8
6.3 k 2.0
15f6.5
5.7 k2.5
8.4 f3.0
4.8 k2.1
4.8 kO.9
2.2k0.9
3.3k0.8
2.6k0.6
5.4 f0.9
-
-
indicated that the larger value of T did improve the
fit of the tree to the data under the (phylogenetic)
hypothesis (?=15.5, P<O.OOOl). Similarly, a n LRT
comparing the results with and without distinction
between the three codon positions also showed considerable improvement (xz= 91.6, P<O.OOOOOl). A molecular clock hypothesis was not supported by these
data under the ML methods ( L m x2 = 34.0, R0.05).
As the Dxy values were low there was no need to
exclude any taxon for reasons of possible alignment
error or errors in distance estimation.
Among the N. aperta samples, BETA and ALPH
exhibited the greatest divergence estimates from the
other taxa, whilst TGI and TGII showed the least
divergence from other OTUs. The largest distances
were between BETA and LGAM (8.4 k 3.0), BETA and
XBFG (7.2 & 2.9), and BETA and ALPH/TGI (6.8 i2.1).
The smallest distances were found between LGAM
and TGI (2.6*1.1), and KHMR and TGI (3.7k1.4).
The distance between TGI and TGII was 3.9k 1.8.The
trends shown by D were the same except that the
third largest distance was between LGAM and XBFG
(7.0 k 1.0). The smallest distance was again between
LGAM and TGI (1.8i0.6); however, the next smallest
was between TGI and TGII (2.1 k0.6); this last distance
lies near the upper limit of the range of values among
the Mekong y-strain samples (1.8 k0.6, 3.6 k0.8). The
largest distances were observed with the outgroup
Tricula bollingi (TBOL) and D ranged from 17 (LGAM)
to 21.
PHYLOGENETIC RELATIONSHIPS
The phylogeny estimated for the revised OTUs (i.e.
with TGI and TGII) was the same regardless of the
method employed. However, the ML and FM trees
for the original taxa (i.e. with TGAM considered as
homogeneous) differed with respect t o the positioning
of the p-strain sample, BETA. The ML phylogeny for
the original taxa shows the p-strain clustered with the
1.6f0.6
1.8k0.6
3.6 k 0.8
7.0f1.0
~
14 f4.2
4.4 f1.4
6.5f 1.7
3.7 f1.2
3.5 f 1.5
15 f3.9
4.5 5 1.8
6.8k2.1
3.7 f 1.4
2.6k1.1
13k4.5
4.2 f1.9
6.022.2
3.8 f 1.7
5.0 f2.5
-
-
-
-
-
3.9 f1.8
-
2.1 k0.6
4.5 kO.7
-
14 f6.6
5.9 f2.8
7.2k2.9
5.0 f2.4
6.6 f3.3
4.4k 1.8
4.8 f2.3
4.022.1
2.8 f0.7
-
2.8 & 0.9
y-strain from central Laos, XBFG, both arising from
a clade typified by the Kratie y-strain, KHMR (Fig.
4A). This grouping was not well supported and the
branch lengths between the KHMR lineage and that
bearing BETA and XBFG were not significantly different from zero. In contrast, the phylogram for the
revised OTUs shows BETA as basal to a clade bearing
all y-strain taxa, and Tricula bollingi and x-strain N.
aperta as basal t o the rest of the N . aperta clade (Fig.
4B). The Fitch tree for the revised data (Fig. 5A)
indicated a phylogeny identical to that obtained by the
ML method with these OTUs. However, the Fitch tree
for the original data set places ALPH as an offshoot
of the lineage bearing the Lao and Thai y-strains
(TGAM and LGAM), whilst BETA is basal to the rest
of the N. aperta clade and closest to the outgroup T
bollingi.
As the relationships of the p-strain remained unresolved, a third phylogeny was estimated using a
maximum parsimony (MP) method employing the
branch-and-bound algorithm of Hendy &Penny (1982).
The MP analysis yielded 15 equally most-parsimonious
trees and the consensus tree, with a proportion given
for each major branch to indicate in how many of the
15 trees that branch occurred, is given in Figure 5B.
The consensus MP tree is identical to the Fitch and
ML trees for the revised OTUs except that the p-strain
appears closer to the outgroup than to the other N .
aperta. However, it can be seen from Figure 5B that
the alternative topology, which would be identical to
the ML and Fitch trees (in Figs 4B and 5A), occurred in
47% of the 15most-parsimonious trees. Unfortunately,
the MP method lacks corrections for factors such as
superimposed substitutions or codon usage even
though these corrections have been recognized as important in parsimony methods (Penny et al., 1993;
Steel et al., 1993). Correction for such factors was
made for the distance and ML methods. In addition,
greater evolutionary stochasticity often follows from
the shorter time scales involved with intraspecific trees
VARIATION IN NEOTRICULA APERTA
A
Tricula bollingi
\
Tricula bollingi (TBOL)
r
y-strain (Ban Xieng-Wang) Laos (LGAM)
y-strain (Ban Kh-Lek) N E Thailand (TGAM)
L
1.0
1.0
y-strain (KratiB)Cambodia (KHMR)
r
1. 0.99
2.0.57
3.0.51
4.0.50
(Kaeng-kao)
p-strai+
p-strain (Kaeng-kao)N E Thailand (BETA)
y-strain (Xi. Bang-Fail Laos (XBFG)
y-strain
5.0
Tricula b o l h g i (TBOL)
31
(Ban Xieng-Wang)
B
(Ban
a-strain
Khi-Lek)
y-strain
(X6 Bang-Fail
TGII y-strain (Ban Khi-Lek)
r-strain r-strain
TGI (Kratie)
(Ban Khi-Lek)
p-strain
(Kaeng-kaof
\
p-strain (Kaeng-kao)N E Thailand (BETA)
-
a-strain
Tricula bollingi
(Ban Khi-Lek)
-y-strain (Xi! Bang-Fai)Laos (XBFG)
Y5.
&
0.60\
y-strain
(Ban Xieng-Wang)
l.oo
~
/
Figure 4. Maximum likelihood derived phylograms (unrooted) for (A) the original data set and (B) the revised
data set.
(Templeton, 1993) and this can confound parsimony
analyses. Difficulties in resolving relationships around
the outgroup may also be expected as this taxon differs
from the major group of congeners (N. apertu) at many
positions, the latter on the other hand are relatively
homogeneous. In these cases one may expect a number
of alternative trees differing little from one another
under a variety of methods. The APSD (average percent
SD, an ‘optimality’ criterion based on the sum-ofsquares of the squared deviations) for the FM tree
with TGAM was 13.70%, whilst the APSD for the
revised data was 3.75% indicating a much better fit of
the branch lengths to the revised data.
These findings support. the biological relevance of
TGI and TGII and support argument for the phylogeny
given in Figure 5A. Prior to ML analysis X2-testswere
y-strain
TGI
(Ban I(hi-L&)
y-strain
(Xk Bang-Fai)
1
y-strain
(Kratic)
y-strain
TGII
(Ban I(hi-Lek)
Figure 5. (A) An unrooted Fitch tree based upon the
Kimura two-parameter evolutionary distance estimate.
Line lengths are proportional to branch lengths and the
numbers assigned to branches reflect bootstrap support
(proportion of 2500 replicate trees). (B) Consensus tree
by maximum parsimony, the numbers on the branches
represent the proportion of 15 equally most-parsimonious
trees in which that branch occurred.
used to compare the nucleotide composition of each
sequence ( O W ) to the frequency distribution assumed
by the ML model. All sequences passed this test with
a confidence level >95%. The ML values for the TGAM
and revised trees did not show a significant improvement following the resorting of TGAM (In likelihoods - 1513.41 and - 1482.34, respectively);
however, these values cannot be used to compare directly non-adjacent trees (Felsenstein, 1988). In view
32
S. W. ATTWOOD and D. A. JOHNSTON
of the above, the phylogeny represented by Figures 4B
and 5A, which includes the cryptic y-strain-taxa of
northeast Thailand, TGI and TGII, is the best supported hypothesis for the phylogeny of N . aperta on
the basis of the data so far available.
The FM, ML and MP phylogenies indicated a grouping of TGII and the Xi, Bang-Fai y-strain, and a separate cluster of the Ban Xieng-Wang (LGAM) and
Kratie (KHMR) y-strains with TGI. BETA appeared to
represent a separate lineage from the aforementioned
taxa and ALPH is grouped with TBOL, the latter was
predefined as the outgroup. Bootstrap resampling was
performed for the FM analysis in order to test the
strength of the phylogeny (see Fig. 5A). Strongest
bootstrap support was for the LGA.M/TGI grouping
(found in 100°/o of the bootstrap trees) which arose
from a lineage bearing KHMR (in 57% of trees). Consequently, KHMR appears to arise from the lineage
leading to the tightly clustered LGAM and TGI. The
grouping of TGII with the Xe Bang-Fai y-strain was
less well supported (50% of trees). The major cluster,
carrying all the y-strain taxa and no other strain,
occurred in only 36% of trees; this edge is represented
by the short central branch in Figure 5A.
DISCUSSION
THE RADIATION OF NEOTRZCULA APERTA AND THE
TRICULINAE
The consensus view of the evolution and colonization
history of the Triculinae has largely been based on the
ideas presented by Davis (1979, 1980, 1982, 1992).
These hypotheses exploit the reciprocal illumination
gained by a n examination of phylogenies for both the
snails and the schistosomes they transmit, and are
based on an extensive set of morphological characters
(e.g. see Davis et al., 1994). The Pomatiopsidae have
a Pangaean distribution, although that of the Pomatiopsinae is Gondwanan with extant taxa showing
a 'southern continental' (vicariant) distribution (Davis,
1979). A Gondwanan origin was thus proposed for
Asian Pomatiopsidae and Schistosoma, with the ancestors of Schistosoma mansoni and S. haematobium
being isolated on the African Plate. These taxa were
therefore separated as Gondwana broke up in the late
Mesozoic (Davis, 1979, 1980).
Colonization of mainland Southeast Asia would have
begun after the collision with the Indian Plate (about
40Mya) and the onset of the Tibetan uplift which
initiated the main rivers of Asia (Hutchinson, 1989).
Davis (1979) suggested that the main route of colonization was via the northwest Burma-Brahmaputra
corridor which opened approximately 18Mya. In the
lower Mekong river of Laos, Thailand and Cambodia,
the Triculinae represent a remarkable adaptive radiation of 11 genera and over 90 recognized species,
within a single clade, the tribe Pachydrobiini. A second
tribe, the Triculini, shows a similar radiation in southern China and is associated with the Yangtze river
drainage. Palaeogeographic models adopted by Davis
(1979) indicated that separation of the Yangtze and
Mekong river systems occurred in the late Miocene.
This event would have isolated the Mekong river
Pachydrobiini (including N. aperta) from the
Pomatiopsinae in Yunnan; therefore, according to this
model Oncomelania hupensis sub-spp. (transmitting
Schistosoma japonicuin in the Yangtze) and N . aperta
have been geographically separated for around 12 M y .
Davis (1979, 1982) suggested that the snails had
kept pace with the evolution of the main rivers of Asia
as they cut their way to the sea from Yunnan following
their inception a t the time of the Himalayan orogeny.
It is likely that the extensive adaptive radiation was
driven by rapid change in the aquatic environments
and the occurrence of new and vacant habitats; however, the traditional view of 'linear' radiation down the
major rivers of the region from a common origin in
southern China (Yunnan) is questionable in the light
of new palaeogeographic models.
It now appears likely that connections between upper
Mekong and Yangtze rivers were broken in the late
Miocene (7-5 Mya) rather than the 12 Mya suggested
above. Current palaeogeographic models suggest that
until the Pliocene the mountains of Tibet were of
moderate stature, similar to those of northern Burma
and Thailand in which Tricula bollingi is found today
(Mitchell, 1981), and would have been suitable for
colonization by the ancestors of Oncomelania and extant Triculinae introduced from India.
Following the initial orogeny, to a n average elevation
of 2500m, the Tibetan Plateau is thought to have
experienced a second uplift in the Pliocene to achieve
the present average of 5000 m (Xu, 1981). The second
uplift probably initiated the separation of the Mekong
and Yangtze rivers in Yunnan, as the faster waters
cut deeper channels into the Plateau. As the climatic
changes associated with the second uplift would have
been intolerable, any pomatiopsid snails present must
have dispersed separately into the middle reaches of
their respective rivers in Yunnan before the second
uplift.
Consequently, the progenitors of Mekong Triculinae
and Chinese Pomatiopsinae, together with those of
attendant schistosomes (S. mekongi and S. japonicum,
respectively), were separated no later than 5 Mya. The
explosive radiation of the Pachydrobiini in the Mekong
river around Khong Island was considered to have
begun in the late Miocene (Davis et al., 1985). However,
such hypotheses were based on the concept of a stable
Caenozoic geology in the region. It is now known that
Southeast Asia experienced marked tectonic activity
VARIATION IN NEOTRICULA APERTA
throughout this era, with extensive changes in drainage configuration (see Tapponier et al., 1982, 1986;
Hall, 1998). Triculine snails were thought to have
colonized northeast Thailand and Laos as the Mekong
river cut its way across the Khorat Basin (Davis &
Greer, 1980); however, the Mekong is unlikely to have
been a major river in southern Indochina until the
mid-Pleistocene. Consequently, this new hypothesis
for the evolution of the Triculinae places the divergence
of the N. aperta complex at around 1Mya.
The genetic distances in Table 3 appear rather large
if we assume that the N. aperta complex diverged as
recently as the mid-Pleistocene. However, as mentioned above, speciation in the Triculinae appears t o
have occurred rapidly and continually throughout the
late Tertiary. Spolsky, Davis & Yi (1996) studied the
evolution of Oncomelania h. hupensis on the Chinese
mainland using sequence divergence for the mt cytochrome b gene. These authors reported similarity values ( F ) of 0.96 between populations from Sichuan
and Yunnan Provinces (separated by approximately
400 km). By comparison, the levels of interpopulation
genetic divergence observed in the present study again
appear rather high. Hope & McManus (1994) examined
the same Oncomelania taxa as did Spolsky et al. (1996)
but reported genetic distances much closer to those of
the present study. Hope & McManus considered such
levels of divergence as indicating sibling species, as
did Woodruff et al. (1999). On this basis the p- and
Xe Bang-Fai-y-strains both appear, according to the
current data, t o be sibling species of N. aperta. However, the case for sibling species is weakened when one
considers the level of 'background (interpopulation)
variation expected in N. aperta; for example, the distance between the p-strain and the Ban Xieng-Wang
y-strain (LGAM) is 8.3, which is similar in magnitude
t o the distance between LGAM and the Kratie y-strain
(D=4.8). In addition, molecular systematic data should
not be used t o define species in the absence of other
corroborative data (e.g. morphological characters).
POPULATION PHYLOGENY
High levels of interpopulation divergence in N. aperta
may be attributed t o low dispersal rates linked to
an inability to aestivate and survive desiccation or
transport out of water. The severe annual flood in
the lower Mekong also has an effect, as habitats are
regularly destroyed and populations reduced or eliminated. Recovery from the annual flood may be through
recruitment in diminished but surviving populations,
leading t o population bottlenecks that heighten the
impact of genetic drift, or through the extinction and
recolonization (turnover) of local populations between
years (i.e. metapopulation dynamics; Hanski, 1994),
involving possible founder effects.
33
The long-termpersistence of N. aperta in the Mekong
river as a metapopulation would imply rapid differentiation of populations through recurrent founder
effects. Snail dispersal between local populations may
have a homogenizingeffect within the metapopulation.
However, the severe conditions in the lower Mekong
could limit gene flow by regularly destroying neighbouring populations and thereby isolating breeding
groups. In view of this, the high genetic distances
between samples may be a consequence of metapopulation dynamics rather than low vagility per se.
Indeed, Attwood (1994) demonstrated that the colonization potential of N. aperta can be high outside
the spate period.
The expected fixation time for new (neutral) mutations, assuming Wright-Fisher demography, is a
number of generations roughly proportional t o the
population size (Kingman, 1982; Tajima, 1983); this
implies that fixation by genetic drift alone would require over 1Myr for most r-selected annual populations. As N. aperta probably colonized its present
range during the Pleistocene, the geographic discontinuity of genetic variants observed is most likely
due to some population level effect along the lines of
the metapopulation process described above. Habitats
left vacant in the Mekong river at Khemmarat each
year (by extinct local populations) could be recolonized
by snails originating in tributaries of the Mekong, such
as the Xi! Bang-Fai river, and washed downstream on
twigs or leaves. The disappearance of N . aperta from
certain stretches of the Mekong river, with reappearance in subsequent years, has been observed in
northeast Thailand; these 'local' populations appear t o
cover about 2500m'.
One possible explanation for the genetic subdivision
of the y-strain at Khemmarat in northeast Thailand,
into TGI and TGII, is as a result of some past colonization event. Snails arising in one or more of the
smaller rivers draining the highlands of central Laos
may have colonized the Mekong river, and now comprise part of the y-strain population at Khemmarat in
the form of taxon TGII. Average shell length for TGI
was 1.82_+0.10mm,significantly less than that of
TGII, 2.17 A0.35 mm (P<O.Ol). Attwood (1999) also
found TGI to be more common than TGII (- 3:1) and
have smaller shells. Taxon TGI, with lower genetic
heterogeneity and lesser affinity with the Xe Bang-Fai
y-strain (XBFG), was regarded by Attwood (1999) as
the 'pure' y-strain endemic in northeast Thailand.
Clearly, TGII is not identical to XBFG and the source
of colonists at Khemmarat is more likely to be a river
such as the Xe Banghieng. Indeed, this author has
recently found a y-strain population in the Banghieng
river of southern Laos. The Banghieng river flows into
the Mekong river just north of Khemmarat and, like
the Xe Bang-Fai, drains the southwest slope of the
34 S. W. ATI'WOOD and D. A. JOHNSTON
Annam mountains in Laos. In addition, the substrata
are more eroded and the waters more turbulent in the
Mekong river north of Khemmarat, this again making
the Banghieng a more likely source of colonists. The
spate is less severe in minor rivers such as the Xi:
Bang-Fai and the majority of N.aperta in such habitats
will have copulated by June.
The greater shell length of TGII may be explained
by the fact that the life-cycle in Mekong tributaries is
generally ahead of that in the Mekong river (as a result
of shallower waters and a shorter spate period). The
greater heterogeneity of TGII in the present study
probably occurs because the colonists from Laos originate in a constellation of populations and streams.
Attwood (1999) assayed variation in rRNA gene sequences, such nuclear DNA markers would be sensitive
to the effects of hybridization but this author was still
able to detect the cryptic taxa TGI and TGII. Indeed,
the rRNA gene-based phylogeny was identical to that
presented here except that ALPH clustered with XBFG
and no outgroup was used. Attwood (1999) proposed
a mechanism by which such population structure may
occur; this was based on N. aperta demography, and
hybridization between colonists and only certain Mekong river cohorts.
The affinity of LGAM, TGI and (less so) KHMR
suggests a geographical component to this part of the
tree, as D increases with downstream distance from
TGI a t Khemmarat. The genetic isolation of BETA also
appears to have a geographical basis. In the present
study ALPH showed relatively large distances from
the other taxa; this disagrees with the RFLP data of
Attwood (1999), although the smallest distances were
again with TGI and TGII. In contrast to the findings
of Staub et al. (1990) no cryptic taxon was found which
included both 2- and y-strain individuals; in fact, the
1990 study found two such taxa. In further contrast
to these authors, significant genetic distances were
detected between the three strains of N . aperta. TGI
and TGII cannot represent the cryptic taxa of Staub
et al. (1990) because they do not include a-strain individuals. The genetic distance between TGI and TGII,
when compared with average interpopulation distances for the y-strain (2.1 cp 3.9), suggests that they
represent different populations rather than sibling
species.
Tricula bollingi is a member of the Triculini, not
Pachydrobiini, and as expected shows large genetic
distances with all other taxa (D, 17-21). Trends in the
shift of the position of the opening of the seminal
receptacle (from the oviduct to the bursa or its duct)
indicate that taxa such as N. aperta were derived from
the basic triculine ground plan typified by T bollingi
(see Davis et al., 1992); this was the reason for the
choice of outgroup. The shortest distances observed
with the outgroup were with the 8-strain sample and
TGII (18 and 17, respectively). COI-based genetic distances have also been reported between taxa of the
Triculini and Pachydrobiini by Davis et al. (1998);
these authors reported a distance (0)
of only 13.2
between Tricula and Gammatricula. The larger distances between Tricula and Neotricula in the present
study may be a long-term result of rapid population
turnover in the more unstable Mekong river environment.
Revision of the N. aperta phylogeography in the
context of a n unstable Caenozoic geology affords the
possibility of the direct colonization of Thailand, by
antecedent Triculinae from Burma, rather than via
China and the upper Mekong river. The ancestors of
both Chinese and Southeast Asian Triculinae probably
dispersed throughout northern Burma until 5 Mya.
Isolation of the Chinese and southern taxa would then
occur during the Pliocene orogeny. For example, taxa
may have dispersed separately into the upper and
lower Irrawaddy rivers, which then existed as two
separate drainages (Hutchinson, 1989).
Precursors of S. japonicum, Oncomelania and
Yangtze river Triculinae then diverging in the upper
Irrawaddy could disperse into the Yangtze, whilst those
in the lower river could disperse into Thailand via
the extended MekondSalween (Fig. 6). Consequently,
antecedents of Southeast Asian Triculinae and S. mekongi would have entered the MekonglSalween independent of the upper Mekong river in Yunnan (Fig.
7A).
Volcanic activity, separating the Irrawaddy and
Salween rivers, declined during the Pliocene allowing
snails and schistosomes to reach this river. S. mekongi
and Neotricula thus entered Thailand and Laos during
the Pleistocene (approximately 1.5Mya) when both the
Mekong and Salween rivers flowed as one into the
present Chao Phrya river Basin. Subsequent introductions of fauna from Burma into northern Yunnan
(Yangtze river) were probably prevented by the ongoing
elevation of the West Burma Block (see Hutchinson,
1989).
A second possible scenario is one in which oncomelanid snails (proto-Pomatiopsinae) and Schistosoma entered southern China much earlier in the
Miocene off one of the Tibetan (Cimmerian) Blocks
which collided with Asia before the Indian Plate. This
would permit the direct colonization of the upper
Yangtze in Tibet by Pomatiopsinae, which then dispersed southwards to the Sichuan Basin (Fig. 7B). The
Yangtze platform basin has remained quite stable over
the last 600Myr, and the course of the Yangtze has
changed relatively little throughout its history (Hutchinson, 1989). In addition, the mountains of southern
Yunnan, northern Laos and northern Vietnam are
likely to have provided a barrier to dispersal over
the last 200Myr. The absence of Oncomelania o r S.
VARIATION IN NEOTRICULA APERTA
35
Figure 6. Major course changes along the Mekong river during the late Caenozoic. Prehistoric river courses are shown
as broken lines; the names of the captured rivers are shown along with the approximate times of capture ( x
years) in parentheses. Based on the palaeogeographic maps of Gregory (1925) and Hutchinson (1989).
japonicum from mainland Southeast Asia is evidence
for this barrier. Consequently,an origin for the Yangtze
river taxa, including S. japonicum and triculine snails,
in northern Yunnan, and separate from that of N.
aperta and S. mekongi in Burma, is supported. Davis
& Greer (1980) observed that snails of the Triculini
and Pachydrobiini (including Neotricula spp.) show
most derived anatomical character states in the lower
reaches of the Yangtze river. Such a ‘linear’ evolution
appears appropriate for the Yangtze river fauna but
not the Southeast Asian fauna.
As mentioned above, the Mekong river is unlikely
to have assumed its present course along the eastern
border of the Khorat Basin and on to Kratie (Fig. 1)
until the late Pleistocene (Hutchinson, 1989). Neotricula aperta populations south of Khong Island cannot be much more than 500000 years old, and those
at Kratie little over 10 000 years old. Snail populations
around Khemmarat, in northeast Thailand, are likely
to be the oldest of the Mekong river populations. In
addition, prior to the mid-Pleistocene uplift of the
western margin of the Khorat Basin, it is likely that
36
S. W. ATTWOOD and D. A. JOHNSTON
500 km
TIRETAN PLATEAU
gtze taxa diverge in upper
diverges in Yangtze river
Ridge separating upper
and lower Irrawaddy
during Pliocene
Figure 7. Semi-schematic illustration showing two possible scenarios for the radiation of Sehistosoma across China
and Southeast Asia. A, isochronous colonization by ancestors of Yangtze taxa (S. sinensium/S. japonicum and the
Pomatiopsidae) and Mekong taxa (Thai S. sinensium, S. mekongvmalayensis and the Triculinae) during the Pliocene.
Prehistoric river courses are denoted by broken lines. B, heterochronous colonization during the Cretaceous and late
Tertiary. The ancestor of S. mekongi (and other Mekong taxa) enters Southeast Asia, from Burma, after the Indian
Plate collides with Asia, having arisen in India from S. indieurn-like taxa able to utilize triculine snails. The Mekong
taxa thus colonize Southeast Asia during the Pliocene much later than the ancestors of the Yangtze taxa. The Yangtze
taxa are shown to have colonized southern China after rafting northwards on one of the Cimmerian terranes accreted
during the Cretaceous. Scale and palaeogeographic features approximate.
VARIATION IN NEOTRICULA APERTA
~
37
~
the Mu1 river flowed west towards the current location
of the Chao Phrya river headwaters (Hutchinson,
1989).
The zoogeographyof N. aperta is further complicated
by the occurrence of extensive lava flows in southern
Laos approximately 800 000 years ago; these flows
extended the central (Annam) highlands of Laos southwards to produce the Bolovens Plateau and hills of
Champassac Province and to cover the mouth of the
Mu1 river, severing its connection with the Mekong
(Workman, 1977).
Accordingly, colonization of the lower Mekong by
ancestors of N. aperta is likely t o have begun well
within the last 1Myr. The a-strain appears to be a
basal taxon in the phylogeny represented by Figure
5A, and one may postulate that the ancestral character
of N. aperta resembled that of the a-strain today. The
pre-Mekong river could have introduced a-strain-like
snails t o the hills of central Laos in the late Pliocene.
These snails would then be in a position to colonize
the eastern margin of the Khorat Basin (i.e. northeast
Thailand) after the tilting of the basin in Thailand,
which could easily have effected the necessary flow
reversals (see Gibling & Ratanasthien, 1980). The
accompanying elevation of the hills in southern Laos
may then have driven the evolution of the y-strain,
perhaps through XBFG-like intermediates, in rivers
such as the Xe Bang-Fai and Xe Banghieng. The ystrain is better suited to the more fluviatile conditions
which formed as the uplift progressed in Laos. The
colonization of northeast Thailand by early y-strain
like taxa would have begun after the Mekong river
assumed its present course along the east of the Khorat
Basin towards Paxse. Block faulting throughout Northeast Thailand, at the close of the Tertiary, no doubt
produced numerous dams and lakes from the evolving
pre-Mekong. The a-strain of N. aperta is adapted to
life in shallow pools and backwaters and may have
evolved this ability after becoming trapped in the lentic
habitats created as the river cut south t o Khemmarat.
A parsimonious hypothesis for the @-strainof N.
aperta considers its evolution from the same antecedent form as the present a-strain, entering the
Mekong river at about the same time. The (3-strain
is basal to the lineage bearing the y-strain populations
of southern Laos and Cambodia and perhaps arose
when ancestral N. aperta became isolated in the fast
flowing headwaters of the Mu1 river, which at that
time apparently flowed west towards central Thailand. The p-strain would have remained a geographical isolate throughout the mid-Pleistocene,
until the Mu1 river flow had reversed and found a
channel across the lava flows at its junction with
the Mekong; this isolation would explain the large
genetic distances observed with the other strains of
N. aperta. The lava flows which occurred in southern
Laos 800000 years ago have provided many of the
habitats occupied by modern N. aperta, with extensive
stretches of shallow rapids, rock outcrops and minor
water falls. It is most likely that major colonization
of the lower Mekong by the y-strain of N. aperta
occurred after these habitats became available. Similarly, the p-strain would have colonized its present
range only after new fluviatile habitats became
available in the form of these lava flows; this
ecological requirement may also explain the absence
of the p-strain from the middle Mu1 river (or Chao
Phrya river) and its apparent isolation at the mouth
of the Mul. Support for this theory would be gained
if surveys of the present day Mu1 river headwaters
revealed snails resembling N . aperta.
The above hypothesis involving a highland origin
for N. aperta is supported by observations of other
generalized Triculinae. Snails such as Gammatricula,
Jinhongia, Neotricula and Tricula occupy similar fast
flowing, but relatively stable, highland streams and
minor rivers, and not the major rivers with which they
are associated. This observation reflects the hypothesized origin of the clade in the mountain streams
of northern Burma (Davis et al., 1992).The differences
between the a-strain and the other members of the N.
aperta complex may therefore be due t o recent selection
on the latter during the invasion of a large river. The
rapid diversification leading to the three main strains
of N. aperta (occurringbetween 1Mya and 10000 years
ago) was probably the result of the stochastic nature of
the young Mekong river and the absence of competitors,
such as pulmonate snails, from the newly emerging
habitats.
PHYLOGEOGWHY AND THE TRANSMISSION OF
SCHISTOSOMIASIS
The evolution of compatibility with Schistosoma remains a question if the a-strain is considered to represent the ancestral form of N . aperta. The a-strain is
least compatible with S. mekongi; however, it is possible that this strain evolved resistance to the parasite
in response to the greater parasite pressure expected
in snail populations confined to small pools and flooded
gullies. It is therefore conceivable that the ancestral
form of N. aperta was compatible with S. mekongi and
was involved in the colonization of the lower Mekong
by this parasite.
Recent work in this laboratory has demonstrated an
infection rate of 33% for the Xe Bang-Fai y-strain of
N. aperta with S. mekongi (see Attwood & Upatham,
1999). Accordingly, the ability t o transmit S. mekongi
is held by snails that show considerable genetic divergence (0=7.5, BETA us XBFG) and the most compatible strains do not show any strong phylogenetic
grouping. Yuan et al. (1994) performed reciprocal compatibility experiments for 0. h. hupensis and 0. h.
38
S. W. ATTWOOD and D. A. JOHNSTON
quadrasi with S. japonicum from China and the Philippines and was unable to correlate fully snail biogeography with regional strain compatibility.
Pomatiopsis lapidaria (Pomatiopsidae: Pomatiopsinae) can be experimentally infected with S. japonicum even though their respective ancestors were
separated over 150 Mya (Davis, 1968). Similarly, in
the laboratory, N. aperta is weakly susceptible t o S.
malayensis and Thai S. ‘sinensium’ (see Davis, 1992).
The parasites do not appear to have invaded those
Triculinae which have diverged into lotic (main river)
habitats, and this may be more a result of the low
miracidial and cercarial success in such habitats than
of adaptations by snails to exclude parasites. For example, no species of the derived, fluviatile, genus Lacunopsis (Triculini) or the similarly derived tribe
Jullieniini can be infected with Schistosoma. N. aperta
is lotic but is r-selected and achieves much higher
population densities than other lotic Triculinae (Attwood, 1995);this may support transmission and reduce
parasite pressure on these populations.
During the Pliocene the Mekong probably flowed
due South from Chiang Rai (Fig. 6), down what is today
the Ping river valley, to enter the Gulf of Thailand via
the present Chao Phrya river delta (Hutchinson, 1989).
This may explain the finding of Schistosoma ‘sinensium’ and Tricula in association, within the Ping river
system around Chiang-Dao, in northwest Thailand.
Late Caenozoic faulting probably diverted the Mekong
eastwards along its present course towards Vientiane
(Fig. 1). Later in the Pleistocene, the Mekong once
again flowed toward the present Chao Phrya delta;
however, this time via the valley of the Loepassac
river (Fig. 6) (Hutchinson, 1989); the finding of Neotricula burchi (Davis, 1968) in Loei Province, northeast
Thailand, probably also reflects the introduction of
pachydrobiine snails to the region by the preMekong river.
As both Neotricula and Tricula are found in the
Ping river valley and in the lower Mekong river, their
divergence must have taken place before the late Pliocene (>1.5Mya). After extending its course southwards
to the location of the present Mul-Mekong river junction, the Mekong river appears to have undergone
further course changes. The channel now occupied by
the Mekong south of Khong Island originated around
5000 years ago (Hutchinson, 1989). Indeed, the ‘Mekong’ may have flowed westwards in the late Pliocene,
just south of the mountains along the Cambodian:Thai
border, or down the present Tonle-Sap and into the
Gulf of Thailand near Kampot (Figs 1, 6) (Workman,
1977).
The establishment of S. mekongi in the Mekong river
of southern Laos and Cambodia has probably been
within the last 800 000 and 6000 years respectively (see
above). Low sea levels associated with the Pleistocene
glacial periods would have allowed the pre-Mekong
river to flow directly from the present coast of Cambodia to the Malay Peninsula (Hall, 1998). Consequently, s.malayensis in the Pahang river drainage
of West Malaysia probably diverged from S. mekongi
after its introduction from Cambodia, via the extended
Mekong river during the Pleistocene (around 10 000
years ago).
The timing of separation of N . aperta and Oncomelania, and their respective schistosomes, remains
to be determined. The ancestral form of Schistosoma
that occurred in northern Burma, Tibet and Yunnan
during the Pliocene may have resembled S. sinensium
of Sichuan today. This ancestral schistosome most
probably entered China off the Indian Plate a t the
same time as ancestors of the Southeast Asian taxa,
although it could have dispersed much earlier off one
of the minor Gondwanan fragments accreted before
the Indian collision (see Hall, 1998).
Schistosoma sinensium of Sichuan Province, China,
is crucial to our understanding of the origins of human
schistosomiasis in Southeast Asia. The status of these
taxa has become more important following the report
of Snyder 8z Loker (2000) suggesting that Schistosoma
originated in Asia, rather than Africa as maintained
by Davis (1979). The present host of S. sinensium is
triculine, as is the case for all but one member of
the S. japonicum group, and Schistosoma may have
entered and colonized southern China and Southeast
Asia in a snail of the Triculinae. The later colonization
of the Yangtze Basin by Pomatiopsinae may have
facilitated the divergence of S. japonicum from S.
sinensium-like stock, with subsequent colonization of
the mid-Yangtze Plain by the former in oncornelanid
snails. The extant Triculinae appear well adapted to
mountain streams and small rivers and, as such, represent a better vehicle than the Pomatiopsinae for the
colonization of northern Burma, Laos and Thailand.
The lack of involvement of pulmonate snails in the
transmission of S. japonicum group parasites (and
their utilization in India and elsewhere) may be similarly explained. Once southern China had been colonized the ecological situation would have been
reversed and the amphibious Oncomelania (Pomatiopsinae) was clearly better adapted to the less
fluviatile and more ephemeral habitats of the wetlands
and canals of the middle Yangtze river system. Transmission of S. sinensium in Sichuan occurs in small
streams draining the eastern margin of the Tibetan
mountains and involves a species of Tricula; this would
be expected given an origin for this clade in northern
India and Burma. The definitive hosts of S. sinensium
are bandicoots and other rodents. Humans would have
become available to Asian Schistosoma once the lower
rivers had been colonized. Human settlements are
sparse in the highlands of Tibet and Sichuan but
VARIATION IN NEOTRICULA APERTA
common around the habitats of Oncomelania and N.
aperta in the south of China and of Laos, respectively.
Similarly, the invasion of human hosts by S. mekongi
may have led to its divergence from the highland taxon
S. ‘sinensium’ of Thailand and/or Burma.
In view of this we would expect S. sinensium to be
basal to a clade containing both 5’. mekongi and S.
japonicum. In contrast, the ancestor of S. mekongi
most likely evolved from precursors resembling Thai S.
‘sinensium’in the Irrawaddy drainage, before entering
Thailand via the extended Salweeaekong; this is
supported by the biogeography and phylogenetics of
the intermediate host. This scenario explains the existence of S. sinensium-like worms in northeast Thailand and suggests an independent origin for Chinese
and Thafiao Neotricula within the last 2Myr. Interestingly, N. aperta is conserved (anatomically) relative to Neotricula spp. of the mid-Yangtzeriver (Davis
et al., 1992). A divergence time of 5 Myr is implied for
Chinese and Thai S. sinensium, suggesting that these
taxa are sibling species. In further contrast t o conventional hypotheses, the time of separation between
S. mekongi and Thai S. ‘sinensium’ is estimated as
1.5, rather than 12, Mya.
SUMMARY
Genetically distinct strains have been demonstrated
within N. aperta and the findings agree well with those
of Attwood (1999) based on RFLP data for nuclear
gene sequences. Again the findings contrasted with
those of Staub et al. (1990) in that significant genetic
distances were detected among the original strains in
northeast Thailand, and no composite cryptictaxa were
found. Evidence has been provided for colonization of
the lower Mekong by snails from tributaries in central
Laos. The indication of colonization via tributaries in
Laos and hybridization are important in the planning
of disease limitation programs through snail control,
as they relate t o the timing and location of control
applications.Evidence has also been provided for rapid
diversification within the N. aperta complex throughout the Pleistocene, probably a result of the stochastic
nature of the evolving Mekong river. A revised phylogeographic model has been described which agrees
well with the current biogeographic deployment of the
Triculinae and S. japonicum group taxa. The model
explains the presence of a Schistosoma sp. on the Lao
border in southern Yunnan (transmitted by the snail
Jinhongia),the presence of Schistosoma and Triculinae
in the Ping river valley of Thailand, the absence of
Neotricula from the upper Mekong river, the absence
of S. japonicum and Oncomelania from mainland
Southeast Asia, and the observation of Davis et al.
(1992) that the most conserved taxa of the Triculinae
are found closest t o the rivers of northern Burma.
39
Further work is now necessary using more rapidly
evolving sequences of mtDNA, perhaps the control
regions, to confirm relationships between ALPH and
TBOL and to afford a more quantitative account of
population phylogeny. It is now also important to perform a molecular genetic assessment of the congeneric
status of Chinese and Lao taxa of Neotricula and
TricuZa, currently based on anatomical characters. Revised palaeogeography suggests that the closest relative of S. mekongi, aside from S. malayensis, will be
Thai S. ‘sinensium’ and this requires confirmation.
Careful surveys are required t o determine reliably the
northern limit of NeotricuZa in the Mekong river of
China. Most importantly, molecular data for more taxa,
corresponding t o all recognized clades of Pomatiopsidae and Schistosoma, are now required in order
to resolve better the phylogeography of Schistosoma
in Asia.
ACKNOWLEDGEMENTS
The authors thank Dr M. Van Pelt of Medecins Sans
Frontieres (Phnom Penh and Kratie District) and Dr
V. R. Southgate (Natural History Museum, London)
for providing facilities. This work was supported by
an NERC Fellowship and a NERC Research Grant
(No. GR9/02277) t o SWA.
REFERENCES
Attwood SW. 1994. Rates of recruitment among populations
of the freshwater snail Neotricula aperta (Temcharoen)
in northeast Thailand. Journal of Molluscan Studies 60:
197-200.
Attwood SW. 1995. A demographic analysis of y-Neotricula
aperta (Gastropoda: Pomatiopsidae) populations in Thailand and southern Laos, in relation to the transmission of
schistosomiasis. Journal of Molluscan Studies 61: 2942.
Attwood SW. 1996. Changes in Neotricula P-aperta population density following construction of the Pak-Mu1 dam
in northeast Thailand, with implications for the transmission of schistosomiasis. South East Asian Journal of
%pica1 Medicine & Public Health 27: 24-28.
Attwood SW. 1999. Genetic variation in Neotricula aperta,
the snail intermediate host of Schistosoma mekongi in the
lower Mekong basin. Journal of Zoology in press.
Attwood SW. 2001. The radular cusp formulae of Neotricula
aperta (Gastropoda: Pomatiopsidae): taxonomic questions.
Journal of Natural History 3 5 175-183.
Attwood SW, Kitikoon V, Southgate VR. 1997. Infectivity
of a Cambodian isolate of Schistosoma mekongi to Neotricula aperta from northeast Thailand. Journal of Helminthology 71: 183-187.
Attwood SW, Kitikoon V, Southgate VR. 1998.Neotricula
aperta (Gastropoda: Pomatiopsidae) the intermediate hosts
of human Schistosoma mekongi: Allozyme variation and
40 S. W. ATI’WOOD and D. A. JOHNSTON
relationships between Khmer, Lao and Thai populations.
Journal of Zoology 246 309-324.
Attwood SW, Upatham ES. 1999.A new strain of Neotricula
aperta found in Khammouanne Province, central Laos, and
its compatibility with Schistosoma mekongi. Journal of
Molluscan Studies 6 5 371-374.
Baidikul V, Upatham ES, Kruatrachue M, Viyanant V,
Vichasri S, Lee P, Chantanawat R 1984. Study on
Schistosoma sinensium in Fang District, Chiang-Mai Province, Thailand. South East Asian Journal of %pica1 Medicine & Public Health 15: 141-147.
Bao DC. 1958. h p o r t on the discovery of a new species
of schistosome in China (Schistosoma sinensium sp. nou.
Schistosomatidae). Chinese Medical Journal 77: 607475.
Brown WM, Prager EM, Wang A, Wilson AC. 1982. Mitochondrial DNA sequences of primates: tempo and mode of
evolution. Journal of Molecular Evolution 1 8 225-239.
Davis GM. 1968. New Z’ricula from Thailand. Archiv fur
Mol luskenkunde 98: 291-3 17.
Davis GM. 1979. The origin and evolution of the gastropod
family Pomatiopsidae, with emphasis on the Mekong river
Triculinae. Academy of Natural Sciences of Philadelphia,
Monograph 2 0 1-120.
Davis GM. 1980. Snail hosts of Asian Schistosoma infecting
man: evolution and coevolution. In: Bruce J I , Sornmani S,
Asch HL, Crawford KA, eds. The Mekong Schistosome.
Malacotogical Review, Suppl. 2, 195-238.
Davis GM. 1982. Historical and ecological factors in the
evolution, adaptive radiation, and biogeography of freshwater molluscs. American Zoology 2 2 375-395.
Davis GM. 1992. Evolution of prosobranch snails transmitting Asian Schistosoma; coevolution with Schistosoma:
a review. Progress in Clinical Parasitology 3: 145-204.
Davis GM, Chen C-E, W u C, Kuang T-F, Xing X-G, Li L,
Liu W-J, Yan Y-L. 1992. The Pomatiopsidae of Hunan,
China (Gastropoda: Rissoacea). Malacologia 34: 143-342.
Davis GM, Chen C-E, Zeng XP, Yu SH, Li L. 1994. Molecular genetic and anatomical relationships among pomatiopsid (Gastropoda: Prosobranchia) genera from
southern China. Proceedings of the Academy of Natural
Sciences of Philadelphia 145: 191-207.
Davis GM, Greer GJ. 1980. A new genus and two new
species of Triculinae (Gastropoda: Prosobranchia) and the
transmission of a Malaysian Mammalian Schistosoma sp.
Proceedings of the Academy of Natural Sciences of Philadelphia 132 245-276.
Davis GM, Kitikoon V, Temcharoen P. 1976. Monograph
on “Lithoglyphopsis”aperta, the snail host of Mekong river
schistosomiasis. Malacologia 15: 241-287.
Davis GM, Kuo Y-H, Hoagland KE, Chen P-L, Yang HM, Chen D-J. 1985. Erhaia, a new genus and new species
of Pomatiopsidae from China (Gastropoda: Rissoacea). Pruceedings of the Academy ofNatura1Sciences ofPhiladelphia
137: 48-78.
Davis GM, Subba Rao NV, Hoagland KE. 1986. In search
of Tricula (Gastropoda: Pomatiopsidae): Tricula defined,
and a new genus described. Proceedings of the Academy of
Natural Sciences of Philadelphia 138: 426442.
Davis GM, Wilke T, Spolsky C, Qiu C-P, Qui D-C, Xia
M-Y, Zhang Y, Rosenberg G. 1998. Cytochrome oxidase
I-based phylogenetic relationships among the Pomatiopsidae, Hydrobiidae, Rissoidae and “runcatellidae
(Gastropoda: Caenogastropoda: Rissoacea). Malacologia
4 0 251-266.
Dowling TE, Brown WM. 1989. Allozymes, mitochondrial
DNA, and levels of phylogenetic resolution among four
species of minnows (Notropis: Cyprinidae). Systematic
Zoology 38: 126-143.
Felsenstein J. 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach. Journal of Molecular Evolution 17: 368-376.
Felsenstein J. 1985. Confidence limits on phylogenies: a n
approach using the bootstrap. Evolution 3 9 783-791.
Felsenstein J. 1988. Phylogenies from molecular sequences:
inference and reliability. Annual Reviews of Genetics 22:
521-565.
Felsenstein J. 1995. PHYLIP version 3.5 documentation.
Seattle, WA: University of Washington.
Folmer 0,Black M, Hoeh W, Lutz R, Vrijenhoek R 1994.
DNA primers for amplification of mitochondrial cytochrome
c oxidase subunit I from diverse metazoan invertebrates.
Molecular Marine Biology & Biotechnology 3 294-299.
Gibling M, Ratanasthien B. 1980. Cenozoic basins of Thailand and their coal deposits: A preliminary report. Bulletin
of the Geological Society of Malaya 1 3 2 7 4 2 .
Gredler PV. 1881. Zur Concylien-Fauna von China. Jahrbiicher der Deutschen Malakozoologischen Gesellschaft 8:
119-132.
Greer GJ, Ow-Yang CK, Yong HS. 1988. Schistosoma
malayensis N. SP.: a Schistosoma japonicum-complex schistosome from peninsular Malaysia. Journal o f Parasitology
74: 471480.
Gregory JW. 1925. The evolution of the river system of
southeastern Asia. Scottish Geographical Magazine 41:
129-141.
Guo YH, Gu JR. 1985. Studies on the intermediate host of
Schistosoma and Paragonimus: 1. Tricula jinhongensis, a
new species of Tricula from Yunnan Province (Gastropoda:
Pomatiopsidae). Acta Zootaxonomica Sinica 1 0 250-252.
Hall R. 1998. The plate tectonics of Cenozoic Asia and the
distribution of land and sea. In: Hall R, Holloway JD, eds.
Biogeography and Geological Evolution of S E Asia. Leiden:
Backhuys, 99-131.
Hanski I. 1994. A practical model of metapopulation dynamics. Journal of Animal Ecology 6 3 151-162.
Hasegawa M, Kishino H, Yano T. 1985. Dating of the
human-ape splitting by a molecular clock of mitochondrial
DNA. Journal of Molecular Evolution 22: 160-174.
Hendy MD, Penny D. 1982. Branch and bound algorithms
to determine minimal evolutionary trees. Mathematical
Bioscience 5 9 277-290.
Hope M, McManus DP. 1994. Genetic variation in geographically isolated populations and subspecies of Oncomelania hupensis determined by a PCR-based RFLP
method. Acta %pica 57: 75-82.
Hutchinson CS. 1989. Geological evolution of South-east
Asia. Oxford: Clarendon Press.
VARIATION IN NEOTRICULA APERTA
Jukes TH,Cantor CR 1969. Evolution of protein molecules.
In: Munro HN, ed. Mammalian Protein Metabolism. New
York Academic Press, 21-132.
Katsurada F. 1904. Schistosoma japonicum, ein neuer
menschlicher Parasit durch welchen eine endemisch
Krankheit in verschiedenen Genenden Japans verursacht
wird. Annotationes Zoologicae Japonenses 5: 147-160.
Kimura M. 1980. A simple method for estimating evolutionary rate of base substitutions through comparative
studies of nucleotide sequences. Journal of Molecular
Evolution 16: 111-120.
Kingman JFC. 1982. On the genealogy of large populations.
Journal of Applied Probability 19A 2743.
Kitikoon V, Schneider CR, Sornmani S, Harinasuta C,
Lanza GR. 1973. Mekong schistosomiasis: 11. Evidence
of the natural transmission of Schistosoma japonicum,
Mekong strain at Khong Island, Laos. South East Asian
Journal of Tropical Medicine & Public Health 4 350-358.
Lynch M, Crease TJ. 1990. The analysis of population
survey data on DNA sequence variation. Molecular Biology
& Evolution 7: 377-394.
Maunoury V, Guillemot F, Mathieu-Chandelier C, Dutoit E, Gower-Rousseau C, Cortot A, Paris JC. 1990.
Bilharzioses a Schistosoma mekongi diagnostiquees par
biopsie rectale et traitees par praziquantel: a propos de 5
cas. Gastroenterology & Clinical Biology 1 4 1032-1033.
Mitchell AHG. 1981. Phanerozoic plate boundaries in mainland S.E. Asia, the Himalayas and Tibet. Journal of the
Geological Society of London 138: 109-122.
Nei M. 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics
8 9 583-590.
Nei M. 1987. Molecular evolutionary genetics. New York:
Columbia University.
Nei M. 1991. Relative efficiencies of different tree-making
methods for molecular data. In: Miyamoto MM, Cracraft
J , eds. Phylogenetic analysis of DNA sequences. Oxford
OUP, 90-128.
Penny D, Watson EE, Hickson RE, Lockhart PJ. 1993.
Some recent progress with methods for evolutionary trees.
New Zealand Journal of Botany 31: 275-288.
Fbzas J, Rozas R. 1999. DnaSP version 3 an integrated
program for molecular population genetics and molecular
evolution analysis. Bioinforrnatics 15: 174-175.
Schneider CR. 1976. Schistosomiasis in Cambodia: a review.
South East Asian Journal of Tropical Medicine & Public
Health 7: 155-166.
Snyder SD, Loker ES. 2OOO. Evolutionary relationships
among the Schistosomatidae (Platyhelminthes: Digenea)
and an Asian origin for Schistosoma. Journal of Parasitology 8 6 283-288.
Spolsky C, Davis GM, Yi Z. 1996. Sequencing methodology
and phylogenetic analysis: cytochrome b gene sequence
reveals significant diversity in Chinese populations of Oncomelania (Gastropoda: Pomatiopsidae). Malacologia 38:
213-221.
Staub KC, Woodruff DS, Upatham ES, Viyanant V. 1990.
41
Genetic variation in Neotricula aperta, the intermediate
host of Schistosoma mekongi: allozyme differences reveal
a group of sibling species. American Malacological Bulletin
7: 93-103.
Steel MA, Hendy MD, Penny D. 1993. Parsimony can be
consistent! Systematic Biology 4 2 581-587.
Tajima F. 1983. Evolutionary relationship of DNA sequences
in finite populations. Genetics 105 437460.
Tajima F. 1989. Statistical methods for testing the neutral
mutation hypothesis by DNA polymorphism. Genetics 123:
585-595.
Tapponier P, Peltzer G, Armijo R. 1986. On the mechanics
of the collision between India and Asia. In: Coward MF‘, Reis
AC, eds. Collision Tectonics. London: Geological Society of
London, 115-157.
Tapponier P, Peltzer G, Le Dain AY, Armijo R, Cobbold
P. 1982. Propagating extrusion tectonics in Asia, new insights from simple experiments with plasticene. Geology
1 0 611416.
Temcharoen P. 1971. New aquatic molluscs from Laos.
Archiv f i r Molluskenkunde 101: 91-109.
Templeton AR. 1993. The “Eve” hypothesis: a genetic critique and reanalysis. American Anthropology 9 5 51-72.
Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL
W improving the sensitivity of progressive multiple
sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic
Acids Research 22: 46734680.
Upatham ES, Sornmani S, Thirachantra S, Sitaputra
P. 1980. Field studies on the bionomics of alpha and gamma
races of Tricula aperta in the Mekong river of Khemmarat,
Ubol Ratchathani Province, Thailand. In: Bruce JI,
Sornmani S, Asch HL, Crawford KA, eds. The Mekong
Schistosome. Malacological Review, Suppl. 2, 239-261.
Voge M, Bruckner D, Bruce JI. 1978. Schistosoma mekongi
sp. n. from man and animals, compared with four geographic strains of Schistosoma japonicum. Journal of Parasitology 64:577-584.
Woodruff DS, Carpenter MP, Upatham ES, Viyanant V.
1999.Molecular phylogeography of Oncomelania lindoensis
(Gastropoda: Pomatiopsidae), the intermediate host of
Schistosoma japonicum in Sulawesi. Journal of Molluscan
Studies 6 5 21-32.
Winnepenninck B, Backeljau T, De Wachter R. 1993.
Extraction of high molecular weight DNA from molluscs.
Trends in Genetics 9 407.
Workman DR. 1977. Geology of Laos, Cambodia, south
Vietnam and the easternpart of Thailand. London: Institute
of Geological Sciences.
Xu R. 1981. Geological and ecological studies of QinghaiXizang Plateau. In: Liu DS, ed. Vegetationalchanges in the
past and the uplift of the Qinghai-Xizang Plateau. Beijing:
Science Press, 139-144.
Yuan HC, Upatham ES, Kruatrachue M, Khunborivan
V. 1984. Susceptibility of snail vectors to oriental antbropophilic Schistosoma. South East Asian Journal of
Tropical Medicine & Public Health 15: 86-94.