0022-3565/99/2903-1467$03.00/0
THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS
Copyright © 1999 by The American Society for Pharmacology and Experimental Therapeutics
JPET 290:1467–1474, 1999
Vol. 290, No. 3
Printed in U.S.A.
Retroviral-Mediated Expression of the P140A, but not P140A/
G156A, Mutant Form of O6-Methylguanine DNA
Methyltransferase Protects Hematopoietic Cells against
O6-Benzylguanine Sensitization to Chloroethylnitrosourea
Treatment1
RODNEY MAZE, CHANDRIKA KURPAD, ANTHONY E. PEGG, LEONARD C. ERICKSON, and DAVID A. WILLIAMS
Accepted for publication May 27, 1999
This paper is available online at http://www.jpet.org
ABSTRACT
O6-Benzylguanine (6-BG) inactivates mammalian O6-methylguanine DNA methyltransferase (MGMT), an important DNA
repair protein that protects cells against chloroethylnitrosourea
(CENU) cytotoxicity. 6-BG is being tested as an approach to
treat CENU-resistant tumors that overexpress endogenous
MGMT. However, in addition to restoring CENU tumor cell
sensitivity, 6-BG also increases the cytotoxic effects of CENUs
on hematopoietic cells. Several 6-BG-resistant human MGMT
mutants have been characterized in Escherichia coli and are
predicted to protect mammalian cells against the combination
of 6-BG and CENU treatment in vivo. Two mutants, P140A and
P140A/G156A, demonstrated 20- and 1200-fold more resistance to 6-BG depletion of MGMT activity compared with wildtype MGMT (WTMGMT). Here, we analyzed retroviral vectors
that express either WTMGMT, the P140A or P140A/G156A
O6-Methylguanine DNA methyltransferase (MGMT) directly repairs DNA damage at the O6-position of guanine
generated by chemotherapeutic agents such as the chloroethylnitrosoureas (CENUs; Pegg et al., 1995). Left unrepaired,
these adducts rearrange and lead to the formation of interstrand DNA cross-links, which are cytotoxic because they
disrupt DNA replication (Toorchen and Topel, 1983). MGMT
repairs the O6-adduct before the formation of a DNA crosslink by transferring the alkyl group to a cysteine residue
located within the acceptor site of the protein. Removal of the
Received for publication January 8, 1999.
1
This work was supported by National Cancer Institute Grants
PO1CA75426 (to D.A.W.) and CA45628 –10 (to L.C.E.).
mutant forms of MGMT. Retroviral-infected L1210 hematopoietic cells demonstrated similar levels of RNA in all transduced
clones. However, the amount of MGMT protein and DNA repair
activity was reduced in clones expressing the P140A/G156A
mutant compared with those expressing WTMGMT or P140A.
Expression of P140A was associated with a 4- to 8-fold increase in resistance to 6-BG depletion of MGMT in transduced
L1210 clones and a 1,3-bis(2-chloroethyl)-1-nitrosourea IC50 of
50 mM (compared with 27.5 mM for WTMGMT) in primary
murine hematopoietic cells. These results demonstrate the utility of screening 6-BG-resistant MGMT proteins in hematopoietic cells and provide evidence that the P140A mutant form of
MGMT generates 6-BG- and CENU-resistant hematopoietic
cells. Retrovirus vectors expressing this mutant may be useful
in future human gene therapy trials.
O6-alkyl lesion protects against CENU-induced cytotoxicity
(Pegg et al., 1995). Because this reaction is stoichiometric,
the cellular level of MGMT correlates with CENU resistance.
Several preclinical studies have demonstrated CENU-resistant blood cells after increasing the expression of MGMT
in the bone marrow (BM) via gene transfer. Retroviral-mediated expression of MGMT protects both murine and human
BM cells against CENU-induced cytotoxicity (Allay et al.,
1995, 1997; Moritz et al., 1995; Jelinek et al., 1996; Maze et
al., 1996, 1997; Reese et al., 1996; Davis et al., 1997). Our
laboratory has demonstrated that transduction of murine
hematopoietic stem cells with a retroviral vector encoding
the human MGMT cDNA protects progenitor cells in vitro
ABBREVIATIONS: MGMT, O6-methylguanine DNA methyltransferase; WTMGMT, wild-type O6-methylguanine DNA methyltransferase; 6-BG,
O6-benzylguanine; CENU, chloroethylnitrosourea; BCNU, 1,3-bis(2-chloroethyl)-1-nitrosourea; IC50, 50% inhibitory concentration; FN, fibronectin;
MSCV, Moloney stem cell virus; BM, bone marrow; CFU-GM, colony-forming unit-granulocyte macrophage; LTR, long terminal repeat.
1467
Downloaded from jpet.aspetjournals.org at ASPET Journals on September 11, 2016
Section of Pediatric Hematology/Oncology, Herman B Wells Center for Pediatric Research, Riley Hospital for Children, Indianapolis, Indiana
(R.M., D.A.W.); Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, Indiana (R.M., D.A.W.);
Department of Cellular and Molecular Physiology, Pennsylvania State University College of Medicine, The Milton S. Hershey Medical Center,
Hershey, Pennsylvania (A.E.P); Department of Pharmacology and Toxicology, Indiana University School of Medicine, Indianapolis, Indiana
(C.K., L.C.E.); and Howard Hughes Medical Institute, Indiana University School of Medicine, Indianapolis, Indiana (D.A.W.)
1468
Maze et al.
1997) in vitro after 10 mM 6-BG treatment. Expression of
G156A was also noted to result in less protein and repair
activity compared with WTMGMT (Reese et al., 1996). This
study, along with the observations noted above, raises questions about the stability and activity of MGMT mutants
expressed in hematopoietic cells. Therefore, we focused our
analysis on the P140A and P140A/G156A mutants, because
the stability of these mutants has never been reported in
hematopoietic cells. Our results clearly demonstrate that
retroviral-mediated expression of the P140A mutant form of
MGMT via a retroviral vector leads to a stable protein that
protects hematopoietic cells against 6-BG and BCNU treatment and demonstrates a potential approach to increase the
therapeutic index for the treatment of CENU-resistant
tumors.
Materials and Methods
Construction of Retroviral Vectors and Producer Cells.
Moloney stem cell virus (MSCV2.1) retroviral vectors were constructed to express the cDNA sequence for either WTMGMT,
MGMTP140A (P140A), or MGMTP140A/G156A (P140A/G156A) (Fig. 1).
DNA sequences were amplified from pINAGT (Crone et al., 1994)
expression plasmids containing the respective cDNAs by polymerase
chain reaction. Briefly, a 59-oligonucleotide sequence (GGCCGCGAATTCATGGACAAGGATTGTGAAATG) containing an EcoRI restriction site and a 39-oligonucleotide (CCGCTCGAGTCAGTTTCGGCCAGCAGGCGGGGA) containing an XhoI restriction site were
used to amplify the 623-base pair human MGMT cDNAs. The amplified products were purified with a Qiaex II gel extraction kit
(Qiagen Inc., Chatsworth, CA), cut with EcoRI and XhoI, and cloned
into EcoRI-XhoI restriction sites of MSCV2.1. Positive clones were
identified by diagnostic restriction analysis and sequenced to confirm both the presence of the desired mutation and the lack of other
mutations that may have arisen during polymerase chain reaction.
Retroviral producer lines were generated for each construct by transfecting plasmid DNA into GP1envAm12 (Markowitz et al., 1988a) with
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate, according to the manufacturer’s recommendation (Boehringer
Mannheim, Indianapolis, IN). Transient virus, harvested 24 to 36 h
after transfection, was used to infect GP 1 E-86 cells (Markowitz et al.,
1988b) in the presence of 8 mg/ml Polybrene (Aldrich Chemical Co.,
Milwaukee, WI). GP 1 E-86 cells, split 1:40 in a six-well plate, were
infected once every 24 h for 5 days with fresh virus and replated in
limiting dilution in the presence of 0.75 mg/ml G418 (dry powder;
GIBCO-BRL, Gaithersburg, MD). After 10 to 12 days of culture, G418resistant clones were individually picked and expanded. Clones were
screened both for viral titer by standard methods (Hanenberg et al.,
1996), and for MGMT repair activity as described below (performed on
Fig. 1. Schematic diagram of WT, P140A,
and P140A/G156A retroviral vectors constructed in MSCV2.1. Relevant restriction sites are noted. Proviral size is 3.4 kb.
Expression of the MGMT cDNA is via the
59-LTR (arrow). MSCV2.1 contains a neomycin (neo)-selectable marker cloned under the control of the phosphoglycerate
kinase (Pgk) promoter.
Downloaded from jpet.aspetjournals.org at ASPET Journals on September 11, 2016
and long-term repopulating myeloid and lymphoid cells in
vivo against 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU)-induced cytotoxicity (Moritz et al., 1995; Maze et al., 1996).
Many primary tumors have demonstrated an increase in
MGMT and CENU resistance compared with corresponding
normal tissue (Preuss et al., 1996; Silber et al., 1998). MGMT
can be rapidly depleted by 6-BG, which irreversibly binds to
MGMT via the formation of S-benzylcysteine (Dolan et al.,
1990a,b). Once benzylated, MGMT is degraded (Pegg et al.,
1991). Several preclinical studies have demonstrated that
6-BG can restore CENU tumor cell sensitivity in vitro and in
a variety of human tumor xenografts in vivo by depleting
tumor cell MGMT activity (Futscher et al., 1989; Dolan et al.,
1990a,b, 1991; Mitchell et al., 1992; Gerson et al., 1993;
Marathi et al., 1994; Phillips et al., 1997). As a result, 6-BG
is currently being tested in clinical trials (Koc et al., 1996).
Because hematopoietic cells express low levels of endogenous MGMT protein, the addition of 6-BG could further potentiate the degree of CENU-induced myelosuppression observed in vivo (Gerson et al., 1985; Gerson et al., 1986; Moritz
et al., 1995; Reese et al., 1996). Several MGMT mutants have
previously been generated, by site-directed and random mutagenesis techniques, and have been shown to confer resistance to 6-BG (Crone et al., 1994; Loktionova and Pegg, 1996;
Encell et al., 1998; Xu-Welliver et al., 1998). Crone et al.
(1994) demonstrated that two mutants, one containing an
amino acid substitution of alanine for proline at position 140
(P140A) and another containing an amino acid substitution
of alanine for glycine at position 156 (G156A), were 20- and
240-fold more resistant to 6-BG inactivation of MGMT compared with wild-type MGMT (WTMGMT). In addition, a double mutant containing both the P140A and G156A mutations
(P140A/G156A) conferred 1200-fold more resistance to 6-BG
compared with WTMGMT (Crone et al., 1994). Loktionova
and Pegg (1996) further demonstrated that expression of
either P140A or G156A protected Chinese hamster ovary
cells against 6-BG sensitization to BCNU in vitro. Similarly,
Hickson et al. (1996) observed that expression of P140A/
G156A protected hamster fibroblast cells against 6-BG and
mitozolomide treatment in vitro, while noting that the
P140A/G156A protein demonstrated a 10-fold decrease in
repair activity in these cells.
More recently, investigators have demonstrated that retroviral expression of G156A in hematopoietic cells was associated with a 2-fold shift in the BCNU IC50 for human (Reese
et al., 1996) and a 5-fold shift for mouse BM cells (Davis et al.,
Vol. 290
1999
P140A Mutant Form of MGMT Protects Hematopoietic Cells
nitrocellulose (Nitro ME MSI, Westboro, MA) and incubated in a 5 ml
volume of a 1:200 dilution of MT3.1 monoclonal antibody overnight
at 4°C. The presence of MT3.1 antibody was detected by chemiluminescence (Amersham, Little Chalfont, Buckinghamshire, England).
MGMT protein activity was determined, as previously described
(Wu et al., 1987), with a custom-synthesized radiolabeled 18-base
pair oligonucleotide containing an O6-methylguanine base within a
methylation-sensitive PvuII restriction site. Cells (1.5 3 106) were
centrifuged, washed once in PBS, and resuspended in 400 ml of fresh
assay buffer (50 mM Tris, pH 8.0, 1 mM dithiothreitol, 1 mM EDTA,
and 5% glycerol). After sonicating each sample on ice (five bursts of
5 s duration), total cellular protein was quantitated with a Bio-Rad
protein assay (Bio-Rad Laboratories). Cellular extract containing 25
mg of total protein from each L1210 clone was incubated at 37°C for
2 h with 0.2 pmol of the 32P-end-labeled 18 base-pair oligonucleotide
in 150 ml of assay buffer. After incubation, the DNA substrate from
this reaction was extracted with phenol/chloroform, precipitated
with ethanol, centrifuged in a 1.5-ml Microfuge tube (12,000 rpm, 30
min), and air dried. DNA was resuspended in 17 ml of dH2O and
incubated for 1 h at 37°C in the presence of 10 U of PvuII (Boehringer
Mannheim) in salt solution according to the manufacturer’s instructions. The reactions were terminated by adding 9 ml of 95% formamide dye (containing 0.1% bromophenol blue and 80% xylene cyanol). After a 5-min incubation at 95°C, the samples were briefly
cooled on ice and electrophoresed through a 20% denaturing polyacrylamide, 6 M urea sequencing gel at 26 mA, 50°C for 1 h.
6-BG Inactivation of MGMT Activity and BCNU Treatment.
Resistance of expressed MGMT protein to 6-BG was determined in
L1210 clones by incubating 5 3 106 cells with 0, 5, 10, 20, or 40 mM
6-BG (kindly provided by Dr. R Moschel, Frederick Cancer Research
Center, Frederick, MD) for 1 h at 37°C and assaying each sample for
residual MGMT O6-methylguanine DNA repair activity. Resistance
to 6-BG depletion of MGMT was also determined by incubating 2 3
105 L1210 cells or 1 3 106 transduced primary murine BM cells with
20 mM 6-BG for 1 h at 37°C, followed by subsequent exposure of
treated cells to 0, 25, 50, or 75 mM BCNU (Drug Synthesis and
Chemistry Branch, Developmental Therapeutics Program, Division
of Cancer Treatment, National Cancer Institute, Bethesda, MD) for
1 h at 37°C. Treated L1210 cells were centrifuged, washed twice with
media, resuspended, and plated in agar as described above. Treated
primary murine BM cells were centrifuged, washed two times with
media, and resuspended; and 5 3 104 cells/ml were plated in a 0.6%
agar supplemented with 100 ng/ml recombinant rat stem cell factor
and 50 ng/ml recombinant murine granulocyte, monocyte-colony
stimulating factor. Cultures were incubated at 37°C in a humidified
environment at 5% O2 and 10% CO2 for 7 days. BCNU survival was
determined by dividing the number of colonies surviving 6-BG and
BCNU treatment at each dose by the number of colonies scored in
untreated plates and multiplying by 100.
Results
Retroviral-Mediated Expression of 6-BG-Resistant
MGMT Mutants. Expression of 6-BG-resistant MGMT mutants was determined in individual clones of L1210 cells, a
murine hematopoietic cell line, after transduction with either
WTMGMT, P140A or P140A/G156A vectors (Fig. 1). L1210
cells were used as targets for retroviral transduction because
they lack endogenous MGMT and are extremely sensitive to
BCNU treatment. Northern blot analysis of total cellular
RNA isolated from a WTMGMT-transduced clone (clone 14;
lanes 4), four P140A-transduced clones (19.2, 19.7, 43.2, and
43.4; lanes 5– 8), and four P140A/G156A-transduced clones
(clones 24.42, 31.31, 42.7, and 48.11; lanes 9 –12) demonstrated similar levels of viral MGMT RNA transcripts of the
expected 3.4-kb size (Fig. 2). WTMGMT-transduced clone 3
Downloaded from jpet.aspetjournals.org at ASPET Journals on September 11, 2016
G418-resistant NIH/3T3 populations). Retroviral producers used to infect L1210 cells (WT; clone 2, P140A; clones 19, 21, 43, and 62, P140A/
G156A; clones 24, 31, 42, 48) were identified and had titers 9 3 102 to
6 3 104 G418r colony-forming units (CFU)/ml. High titer producer
clones (61.19 and 33.5) used to infect primary murine BM cells were
generated by ping-pong with GP 1 envAm12 and had titers of .1 3 105
(Moritz et al., 1995). All producer lines were maintained in Dulbecco’s
modified Eagle’s medium (GIBCO-BRL) supplemented with 10% calf
serum (Summit Biotechnology, Ft. Collins, CO), 2% (v/v) penicillinstreptomycin (GIBCO-BRL).
Retroviral Transduction of Cell Lines and Primary BM.
L1210 cells (American Type Culture Collection, Rockville, MD) were
maintained in 1630 RPMI supplemented with 15% calf serum (Summit Biotechnology), 2% penicillin-streptomycin, and 1% glutamine
(GIBCO-BRL). L1210 cells were infected by incubating 1.5 3 106
cells with 2 ml of filtered virus supernatant overnight at 37°C on
plates precoated with 8 mg/cm2 of fibronectin (FN) fragment CH296
(RetroNectin; Takara Shuzo, Biotechnology Group, Otsu, Japan).
G418-resistant L1210 clones were generated after infection by plating 1 3 103 cells/ml in 0.6% agar (Difco Bacto-agar; Difco Laboratories, Detroit, MI) in the presence of 1 mg/ml G418 for 7 days at 37°C.
Individual G418-resistant L1210 colonies were harvested with a
drawn Pasteur pipette with an inverted microscope, transferred to
96-well plates, and amplified for additional analysis. No mock-transduced cells survived G418 concentrations greater than 0.75 mg/ml
after 7 days. B16 melanoma and Lewis lung (LL) carcinoma cells
(American Type Culture Collection), maintained in Dulbecco’s modified Eagle’s medium (GIBCO-BRL) supplemented with 10% calf
serum (Summit Biotechnology) and 2% penicillin-streptomycin
(GIBCO-BRL), were infected in the presence of 8 mg/ml Polybrene
(Aldrich Chemical Co, Milwaukee, WI) without FN CH296. Twentyfour hours after infection, cells were washed in PBS (GIBCO-BRL),
trypsinized at 37°C, and plated in media supplemented with 1 mg/ml
G418 (dry powder; GIBCO-BRL) for 7 days at 37°C. Primary murine
BM cells were transduced in the presence of FN CH296. Briefly, BM
was harvested from the hind limbs of 8- to 10-week-old female
C57BL/6J mice (The Jackson Laboratory, Bar Harbor, ME) 48 h after
i.p. injection with 5-fluorouracil (150 mg/kg b.wt.; SoloPak Laboratories, Franklin Park, IL). These cells were prestimulated for 48 h at
37°C in 5% CO2 with 100 U/ml recombinant human interleukin-6
(Pepro Tech Inc., Rock Hill, NJ), and 100 ng/ml recombinant rat stem
cell factor (Amgen, Thousand Oaks, CA) in a-modified Eagle’s medium (GIBCO-BRL), supplemented with 20% fetal calf serum (Summit Biotechnology). Prestimulated BM cells were transduced by incubating 5 3 106 cells with 2 ml of filtered virus supernatant
overnight at 37°C on plates precoated with 8 mg/cm2 FN CH296, as
previously described (Hanenberg et al., 1996).
Analysis of MGMT Expression and Protein. Expression of
retroviral vector-derived MGMT was determined by Northern and
Western blot analysis and an O6-guanine repair assay. RNA was
isolated and purified from infected and G418-selected L1210 clones
with TriPure isolation reagent (Boehringer Mannheim) and resuspended in diethylpyrocarbonate (Sigma, St. Louis, MO)-treated water. Six micrograms of total RNA was electrophoresed through a
0.9% agarose gel containing 6% formaldehyde and 13 3-(N-morpholino)propanesulfonic acid. RNA was subsequently transferred to nitrocellulose filters, hybridized to a 32P-end-labeled EcoRI-XhoI WTMGMT cDNA fragment derived from MSCV2.1WTMGMT, and
exposed to X-ray film at 270°C. Filters were probed with a 32P-endlabeled actin probe to ensure equivalent loading of RNA.
Western blots were performed with MT3.1 monoclonal antibody
(Chemicon International Inc., Temecula, CA), which recognizes human WTMGMT protein. Infected and G418-resistant L1210 clones
were harvested, washed with PBS, and centrifuged; and the pellet
was resuspended and denatured in 23 protein loading dye. Total
cellular protein was quantitated using Bio-Rad Protein Assay (BioRad Laboratories, Hercules, CA) and 20 mg of protein was electrophoresed through a 12% SDS polyacrylamide gel, transferred to
1469
1470
Maze et al.
also demonstrated similar levels of RNA compared with the
other clones (clone 3; lane 3). However, a smaller transcript
was observed. RNA transcripts will vary in size because the
MSCV vector contains a splice donor and an acceptor site 39
of the 59-long terminal repeat (LTR), which allows for alternatively spliced RNA species (Hawley et al. 1994). No
MGMT-hybridizing RNA bands were noted in uninfected
L1210 (Fig. 2, lane 1) or in G418-resistant L1210 cells infected with an empty MSCV2.1 virus (1 3 106 G418r CFU/ml
titer on NIH/3T3 cells) used as a control (Fig. 2, lane 2). The
same blot was reprobed with actin to demonstrate similar
RNA loading (Fig. 2, lanes 1–12, lower panel).
Protein Content and Activity of 6-BG-Resistant
MGMT Mutants. To examine the content of MGMT protein
in infected and G418-resistant L1210 cells, we analyzed
L1210 clones by immunoblotting with a monoclonal antibody
that recognizes the 21-kDa human MGMT (MT3.1) (Fig. 3).
Similar levels of human MGMT protein were detected in
clones expressing either WTMGMT (Fig. 3, lane 1) or P140A
(Fig. 3, lanes 2–5). However, the amount of P140A/G156A
protein was reduced in P140A/G156A-transduced L1210
clones compared with WTMGMT and P140A (Fig. 3, lanes
6 –9). Densitometric analysis of the ratio of MGMT protein
with an endogenous protein, equally present in every lane,
demonstrated a ratio of 1.9 for WTMGMT-3 and 1.3 6 0.26
for P140A-transduced L1210 clones. In contrast, these same
Fig. 3. Western blot analysis of MGMT protein in L1210 clones. Twenty
micrograms of total protein was loaded in each lane, electrophoresed, and
subjected to Western blot analysis. Arrow, the 21-kDa MGMT protein.
Labeling above each lane represents clone numbers. Lane 1, WT clone 3;
lanes 2–5, P140A clones 19.2, 19.7, 43.2, and 43.4l lanes 6 –9, P140A/
G156A clones 24.42, 31.31, 42.7, and 48.11.
ratios were 0.55 6 0.10 for L1210 clones expressing the
P140A/G156A protein. In addition, MGMT protein activity
was analyzed with an O6-methylguanine DNA repair activity
assay as previously described (Wu et al., 1987). As shown in
Fig. 4, MGMT protein activity was low or absent in P140A/
G156A-transduced L1210 clones (Fig. 4, lanes 9 –12) compared with cells infected with WTMGMT (lanes 3 and 4) or
P140A (lanes 5– 8). Little to no P140A/G156A O6-methylguanine DNA repair activity was observed in cell extracts from
any of the P140A/G156A-transduced clones, even after assaying 20-fold more protein (data not shown). In contrast, L1210
clones expressing the P140A single mutant demonstrated
levels of repair activity to similar to those of WTMGMTtransduced clones. As expected, neither L1210 nor L1210
cells infected with an empty MSCV2.1 vector demonstrated
any detectable O6-methylguanine DNA repair activity (Fig.
3, lanes 1 and 2).
Activity of the P140A/G156A Mutant Form of MGMT
in Other Mammalian Cells. To determine whether the
reduced amount of P140A/G156A protein and O6-methylguanine DNA repair activity in L1210 clones was specific for
hematopoietic cells, B16 melanoma and LL carcinoma cells,
which also lack endogenous MGMT activity, were infected
with retroviral supernatant, selected in G418, and analyzed
for MGMT repair activity. Consistent with the results observed in L1210 cells, no O6-methylguanine DNA repair activity was detectable in either P140A/G156A-transduced B16
or LL cells (Fig. 5, lanes 4 and 8). In contrast, P140A-transduced B16 and LL cells (Fig. 5, lanes 3 and 7) demonstrated
levels of repair activity similar to those of WTMGMT-transduced cells (Fig. 5, lanes 2 and 6).
P140A-Transduced L1210 Clones and Primary Murine BM Cells Are Resistant to 6-BG Depletion and
BCNU Treatment. To examine the resistance of P140Atransduced L1210 cells to 6-BG inactivation of MGMT, we
analyzed the level of MGMT repair activity with and without
pretreatment with 6-BG. In these experiments, L1210 cells
transduced with either WTMGMT or P140A were exposed to
5 to 40 mM 6-BG for 1 h. Figure 6 shows that two separate
clones of L1210 cells transduced with WTMGMT (clone 3,
Fig. 6A, and clone 14, Fig. 6B) could be depleted of MGMT
repair activity in a dose-dependent fashion. A demonstratable reduction in repair activity (i.e., the lack of appearance
of the 8-base pair band) was observed after exposure to 5 mM
Fig. 4. O6-methylguanine DNA repair activity in L1210 clones. Repair
activity was assayed by the conversion of the 18-bp band to the 8-bp band.
The level of activity correlates with the ratio of these bands. Labeling
above each lane represents clone numbers. Lanes 3 and 4, WT clones 3
and 14; lanes 528, P140A clones 19.2, 19.7, 43.2, and 43.4; lanes 9 –12,
P140A/G156A clones 24.42, 31.31, 42.7, and 48.11. Uninfected L1210
(lane 1) and L1210 cells infected with an empty MSCV2.1 virus (lane 2)
were used as negative controls.
Downloaded from jpet.aspetjournals.org at ASPET Journals on September 11, 2016
Fig. 2. Northern blot analysis of MGMT transgene expression in L1210
clones. Six micrograms of total RNA was loaded, electrophoresed, blotted,
and probed as described in Materials and Methods. Labeling above each
lane represents clone numbers. Lane 1, uninfected L1210 cells; lane 2,
L1210 cells infected with an empty MSCV2.1 virus; lanes 3 and 4, WT
clones 3 and 14, lanes 5– 8, P140A clones 19.2, 19.7, 43.2, and 43.4; lanes
9 –12, P140A/G156A clones 24.42, 31.31, 42.7, and 48.11. The lower panel
shows the same blot probed with actin to demonstrate equivalent RNA
levels in each lane.
Vol. 290
1999
P140A Mutant Form of MGMT Protects Hematopoietic Cells
1471
rophage (CFU-GM) and the IC50 for BCNU derived from mock-,
WTMGMT-, or P140A-transduced BM with and without 6-BG
pretreatment. WTMGMT-transduced CFU-GM demonstrated
only 20% survival and an IC50 for BCNU of 27.5 mM after
treatment with 20 mM 6-BG and 40 mM BCNU. In contrast,
P140A-transduced CFU-GM demonstrated 77.0% survival and
an IC50 for BCNU of 50.0 mM.
Discussion
Fig. 6. 6-BG depletion of O6-methylguanine DNA repair activity in L1210
clones. L1210 cells infected with either WT (clone 3) or P140A (clones 19.2
and 43.2) shown in A, were treated with 5, 10, 20, or 40 mM 6-BG as
described in Material and Methods and analyzed for MGMT repair activity. B shows L1210 cells infected with either WT (clone 14) or P140A
(clones 19.7 and 43.4) which were treated in a similar manner. Labeling
above each lane represents clone number and 6-BG concentration.
6-BG. No repair activity was apparent after exposure to 10
mM or higher concentrations of 6-BG (Fig. 6, A and B). In
contrast, all four L1210 clones (19.2, 43.2, 19.7, and 43.4)
transduced with P140A that were analyzed maintained
MGMT repair activity even at 20 to 40 mM 6-BG (Fig. 6, A
and B). We next analyzed the ability of retroviral-mediated
P140A MGMT expression in these cells to protect against
6-BG sensitization to BCNU. After treatment with 20 mM
6-BG, cells were exposed to increasing concentrations of
BCNU, and survival was determined by using a clonogenic
assay. All four of the P140A-transduced L1210 clones tested
(Fig. 7B) were significantly more resistant to the combination
of 6-BG and BCNU than clones expressing either WTMGMT
(Fig. 7A) or P140A/G156A (data not shown). The IC50 for
BCNU in P140A-transduced L1210 clones (Fig. 7B) averaged
21.2 mM after 6-BG treatment compared with 7.5 mM for
WTMGMT-transduced L1210 clones (Fig. 7A), and these mutants continued to show resistance even after treatment with
50 mM BCNU. Similar to transduced L1210 cells, primary
murine hematopoietic cells expressing the P140A mutant
form of MGMT were significantly more resistant (p , .05) to
6-BG inactivation of MGMT and sensitization to BCNU than
mock- or WTMGMT-transduced cells (Table 1). Table 1 shows
both the percentage survival for murine CFU-granulocyte mac-
CENUs are commonly used alkylating agents with moderate activity in brain tumor therapies. CENUs are cytotoxic to
both hematopoietic stem and progenitor cells, and intensive
use of these agents in humans leads to cumulative bone
marrow toxicity, delayed myelosuppression, pancytopenia,
and immune suppression (Schabel, 1976; Botnick et al., 1978;
Neben et al., 1993; Kay et al., 1995; Maze et al., 1997). Our
laboratory and other investigators have previously demonstrated the ability to generate blood cells resistant to CENUs
by using retroviral-mediated gene therapy. Transduction of
both murine and human hematopoietic cells with a retroviral
vector encoding the human MGMT cDNA protects BM cells
in vitro and in vivo against BCNU-induced cytotoxicity
(Moritz et al., 1995; Allay et al., 1996, 1997; Jelinek et al.,
1996; Maze et al., 1996, 1997; Davis et al., 1997). We previously reported that mice reconstituted with WTMGMTtransduced stem cells demonstrated significantly high survival after a myelosuppressive regimen of five weekly doses
of 40 mg/kg BCNU as compared with control transplanted
animals.
High levels of MGMT activity have been demonstrated in
multiple human tumors and cell lines (Pegg et al., 1995;
Dolan and Pegg, 1997). 6-BG, which binds to and inactivates
MGMT, has been shown to deplete tumor cell MGMT repair
activity and to sensitize human tumors to CENU treatment
both in vitro and in vivo (Futscher et al., 1989; Dolan et al.,
1990a,b, 1991; Mitchell et al., 1992; Gerson et al., 1993;
Marathi et al., 1994; Phillips et al., 1997). In this regard, we
have recently demonstrated that continuous exposure to
6-BG results in a more prolonged inactivation of xenograft
tumor MGMT repair activity in vivo compared with bolus
6-BG infusions (C. Kurpad, unpublished observations). Such
prolonged inactivation of MGMT may be a critical component
of tumor cell kill in vivo, because regeneration of repair
activity would likely lead to reacquisition of the resistance
phenotype.
Genetic approaches to expressing a 6-BG-resistant form of
MGMT in hematopoietic cells provide a unique way to protect
blood cells in vivo from CENU toxicity in the setting of
pharmacological manipulation of primary resistant tumors.
6-BG will potentiate CENU-induced hematopoietic cytotoxicity in vivo (Gerson et al., 1996; Davis et al., 1997). Harris et
al. (1995) have analyzed retroviral-mediated expression of
ada, the bacterial homolog of MGMT, in murine hematopoietic cells. Compared with mammalian MGMT, this particular
homolog is naturally resistant to 6-BG due to differences in
the primary and secondary structure surrounding the adduct-binding site (Goodtzova et al., 1997). Retroviral expression of ada in murine hematopoietic cells after gene transfer
was associated with only modest protection against 6-BG and
BCNU treatment in vivo (Harris et al., 1995). Concerns regarding the expression of ada in mammalian cells, such as
Downloaded from jpet.aspetjournals.org at ASPET Journals on September 11, 2016
Fig. 5. O6-Methylguanine DNA repair activity in cell lines. B16 melanoma (B16) (lanes 1– 4) and Lewis Lung (LL) cells (lanes 5 and 6) were
infected and selected in G418 as described in Material and Methods, and
analyzed for repair activity. Lane 1, uninfected B16 cells; lane 2, WTtransduced B16 cells; lane 3, P140A-transduced B16 cells; lane 4, P140A/
G156A-transduced B16 cells; lane 5, uninfected LL cells; lane 6, MSCV2.1
WTMGMT-transduced LL cells; lane 7, P140A-transduced LL cells; lane
8, P140A/G156A-transduced LL cells.
1472
Maze et al.
Vol. 290
Fig. 7. Retroviral-mediated expression
of P140A protects L1210 clones in vitro
against 6-BG and BCNU treatment.
L1210 cells were infected with either WT
(clones 3 and 4) or P140A (clones 19.2,
19.7, 43.2, and 43.4) or empty retrovirus
(MSCV) and analyzed for 6-BG inactivation of MGMT and BCNU resistance in
vitro. The data are plotted as percentage
survival versus BCNU dose and represent the averages from three independent experiments.
Values are means 6 S.E. of data obtained from four independent experiments.
Survival at 4 mM
BCNU (%)
IC50 for BCNU (mM)
Survival at 20 mM
6-BG and 40 mM
BCNU (%)
IC50 for 6-BG and
BCNU (mM)
a
b
c
Control
WTMGMT
P140A
20.4 6 19.3a
62.0 6 15.0b
74.0 6 22.0b
26.4
19.0 6 3.0
45.1b
20.0 6 4.0c
51.4b
77.0 6 22.0b
25.0
27.5c
50.0b
Data from Moritz et al. (1995).
p , .05 versus control.
Not significant versus control.
nuclear targeting and its ability to possibly evoke an immune
response in vivo, have prompted our laboratory and others to
pursue the use of 6-BG-resistant human MGMT mutants.
Crone et al. (1994) previously studied the ability to generate
6-BG-resistant human MGMT protein in O6-guanine repairdeficient bacterial cells by introducing specific amino acid substitutions around the active site that mimic ada. Several mutations provided significant resistance against 6-BG inactivation of
MGMT. Cells expressing single mutations P140A or G156A
were shown to be .20- and 240-fold more resistant to inactivation by 6-BG compared with WTMGMT. In addition, the expression of a double mutant form of MGMT containing both the
P140A and G156A mutations (P140A/G156A) demonstrated
1200-fold more resistance to 6-BG.
In this report, we demonstrated that retroviral-mediated
expression of P140A/G156A in transduced L1210 clones did
not protect against the combination of 6-BG and BCNU.
Molecular analysis of these clones demonstrated that, despite having similar levels of MGMT RNA compared with
transduced L1210 cells expressing WTMGMT or the P140A
mutant, P140A/G156A-transduced L1210 clones expressed
less protein and little to no O6-methylguanine DNA repair
activity. Hickson et al. (1996) have previously demonstrated
that P140A/G156A protected cells against 6-BG inactivation
of MGMT and sensitization to mitozolomide. Interestingly,
they also observed a greater than 10-fold decrease in P140A/
G156A repair activity compared with WTMGMT protein in
both bacterial and Chinese hamster lung fibroblast cells. The
ability of P140A/G156A to protect bacterial and Chinese
hamster lung fibroblast cells, despite the reduction in repair
activity and stability, may be due in part to the level of
expression, because in these studies P140A/G156A was expressed via the human cytomegalovirus promoter, which has
very strong transcriptional activity in cell lines compared
with an MSCV2.1 59-LTR promoter. Our results extend these
observations to hematopoietic cells, where expression via a
variety of viral promoters has been problematic. Taken together with the data previously reported, our data suggest
that the P140A/G156A double mutant may be unstable in
mammalian cells. Thus, this instability may be a major impediment to its use in modulating resistance to 6-BG in
hematopoietic cells in vivo.
We have also demonstrated that retroviral-mediated expression of the P140A mutant form of MGMT in L1210 clones
leads to similar RNA, protein, and O6-methylguanine DNA
repair activity levels compared with WTMGMT. Expression
of P140A resulted in a 4-fold increase in resistance to 6-BG
depletion of O6-methylguanine DNA repair activity, which
correlated with protection against the combination of 6-BG
and BCNU in vitro. As shown in Fig. 7, L1210 clones demonstrated a 2.7-fold increase in the IC50 value for BCNU after
6-BG treatment, compared with WTMGMT. The expression
and activity of P140A in L1210 clones were consistent with
its activity in other mammalian cell types, such as B16 melanoma, LL cells (Fig. 5), and Chinese hamster ovary cells
(Loktionova and Pegg, 1996). In addition, we report that gene
transfer of P140A into primary murine hematopoietic progenitor cells protected against 6-BG depletion of MGMT and
BCNU treatment. Expression of P140A correlated with a
BCNU IC50 of 48 mM, after treatment with 20 mM 6-BG. As
shown in Table 1, we observed greater than 70% survival of
murine hematopoietic progenitor cells after treatment with
20 mM 6-BG and 40 mM BCNU. These results are similar to
results obtained with the G156A MGMT mutant by Davis et
al. (1997), who reported a 50% clonogenic survival with 25
Downloaded from jpet.aspetjournals.org at ASPET Journals on September 11, 2016
TABLE 1
P140A protects murine CFU-GM against 6-BG sensitization to BCNU
in vitro after retroviral gene transfer
1999
P140A Mutant Form of MGMT Protects Hematopoietic Cells
References
Allay JA, Davis BM and Gerson SL (1997) Human alkyltransferase-transduced
murine myeloid progenitors are enriched in vivo by BCNU treatment of transplanted mice. Exp Hematol 25:1069 –1076.
Allay JA, Dumenco LL, Koc ON, Liu L and Gerson SL (1995) Retroviral transduction
and expression of the human alkyltransferase cDNA provides nitrosourea resistance to hematopoietic cells. Blood 85:3342–3351.
Allay JA, Koc ON, Davis BM and Gerson SL (1996) Retroviral-mediated gene
transduction of human alkyltransferase complementary DNA confers nitrosourea
resistance to human hematopoietic progenitors. Clin Cancer Res 2:1353–1359.
Botnick LE, Hannon EC and Hellman S (1978) Multisystem stem cell failure after
apparent recovery from alkylating agents. Cancer Res 38:1942–1947.
Crone TM, Goodtzova K, Edara S and Pegg AE (1994) Mutations in human O6alkylguanine-DNA alkyltransferase imparting resistance to O6-benzylguanine.
Cancer Res 54:6221– 6227.
Davis BM, Reese JS, Koc ON, Lee K, Schupp JE and Gerson SL (1997) Selection for
G156A O6-methylguanine DNA methyltransferase gene-transduced hematopoietic
progenitors and protection from lethality in mice treated with O6-benzylguanine
and 1,3-bis(2-chloroethyl)-1-nitrosourea. Cancer Res 57:5093–5099.
Dolan ME, Mitchell RB, Mummert C, Moschel RC and Pegg AE (1990a) Modulation
of mammalian O6-alkylguanine-DNA alkyltransferase in vivo by O6-benzylguanine and its effect on the sensitivity of a human glioma tumor to 1-(2-chloroethyl)3-(4-methylcyclohexyl)-1-nitrosourea. Cancer Commun 2:371–377.
Dolan ME, Mitchell RB, Mummert C, Moschel RC and Pegg AE (1991) Effect of
O6-benzylguanine analogues on sensitivity of human tumor cells to the cytotoxic
effects of alkylating agents. Cancer Res 51:3367–3372.
Dolan ME, Moschel RC and Pegg AE (1990b) Depletion of mammalian O6alkylguanine-DNA alkyltransferase activity by O6-benzylguanine provides a
means to evaluate the role of this protein in protection against carcinogenic and
therapeutic alkylating agents. Proc Natl Acad Sci USA 87:5368 –5372.
Dolan ME and Pegg AE (1997) O6-Benzylguanine and its role in chemotherapy. Clin
Cancer Res 3:837– 847.
Encell LP, Coates MM and Loeb LA (1998) Engineering human DNA alkyltransferases for gene therapy using random sequence mutagenesis. Cancer Res 58:
1013–1020.
Futscher BW, Micetich KC, Barnes DM, Fisher RI and Erickson LC (1989) Inhibition
of a specific DNA repair system and nitrosourea cytotoxicity in resistant human
cancer cells. Cancer Commun 1:65–73.
Gerson S, Miller K and Berger N (1985) O6-Alkylguanine-DNA alkyltransferase
activity in human myeloid cells. J Clin Invest 76:2106 –2114.
Gerson SL, Phillips W, Kastan M, Dumenco LL and Donovan C (1996) Human
CD341 hematopoietic progenitors have low cytokine-unresponsive O6-alkylguanine-DNA alkyltransferase and are sensitive to O6-benzylguanine plus BCNU.
Blood 88:1649 –1655.
Gerson SL, Trey JE, Miller K and Berger NA (1986) Comparison of O6-alkylguanineDNA alkyltransferase activity based on cellular DNA content in human, rat and
mouse tissues. Carcinogenesis 7:745–749.
Gerson SL, Zborowska E, Norton K, Gordon HH and Willson JKV (1993) Synergistic
efficacy of O6-benzylguanine and 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) in a
human colon cancer xenograft completely resistant to BCNU alone. Biochem
Pharmacol 45:483.
Goodtzova M, Kanugula S, Edara S, Pauly GT, Moschel RC and Pegg AE (1997)
Repair of O-6-benzylguanine by the Escherichia coli ada and ogt and the human
O6-alkylguanine-DNA alkyltransferases. J Biol Chem 272:8332– 8339.
Hanenberg H, Xiao XL, Dilloo D, Hashino K, Kato I and Williams DA (1996)
Colocalization of retrovirus and target cells on specific fibronectin fragments
increases genetic transduction of mammalian cells. Nat Med 2:876 – 882.
Harris LC, Marathi UK, Edwards CC, Houghton PJ, Srivastava DK, Vanin EF,
Sorrentino BP and Brent TP (1995) Retroviral transfer of a bacterial alkyltransferase gene into murine bone marrow protects against chloroethylnitrosourea
cytotoxicity. Clin Cancer Res 1:1359 –1368.
Hawley RG, Lieu FHL, Fong AZC and Hawley TS (1994) Versatile retroviral vectors
for potential use in gene therapy. Gene Ther 1:136 –138.
Hickson I, Fairbairn LJ, Chinnasamy N, Dexter TM, Margison GP and Rafferty JA
(1996) Protection of mammalian cells against chloroethylating agent toxicity by an
O6-benzylguanine-resistant mutant of human O6-alkylguanine-DNA alkyltransferase. Gene Ther 3:868 – 877.
Jelinek J, Fairbairn LJ, Dexter TM, Rafferty JA, Stocking C, Ostertag W and
Margison GP (1996) Long-term protection of hematopoiesis against the cytotoxic
effects of multiple doses of nitrosourea by retrovirus-mediated expression of human O6-alkylguanine-DNA-alkyltransferase. Blood 87:1957–1961.
Kay NE, Oken MM, Kyle R, Van Ness B, Kalish L, Leong T and Greipp P (1995)
Sequential phenotyping of myeloma patients on chemotherapy: Persistence of
activated T-cells and natural killer cells. Leuk Lymphoma 16:351–354.
Koc ON, Allay JA, Lee K, Davis BM, Reese JS and Gerson SL (1996) Transfer of drug
resistance genes into hematopoietic progenitors to improve chemotherapy tolerance. Semin Oncol 23:46 – 65.
Loktionova NA and Pegg AE (1996) Point mutations in human O6-alkylguanineDNA alkyltransferase prevent the sensitization by O6-benzylguanine to killing by
N,N9-bis(2-chloroethyl)-N-nitrosourea. Cancer Res 56:1578 –1583.
Marathi UK, Dolan ME and Erickson LC (1994) Anti-neoplastic activity of sequenced
administration of O6-benzylguanine, streptozotocin, and 1,3-bis(2-chloroethyl)-1nitrosourea in vitro and in vivo. Biochem Pharmacol 48:2127–2134.
Markowitz D, Goff S and Bank A (1988a) Construction and use of a safe and efficient
amphotropic packaging cell line. J Virol 167:400 – 406.
Markowitz D, Goff S and Bank A (1988b) A safe packaging line for gene transfer:
Separating viral genes on two different plasmids. J Virol 62:1120 –1124.
Maze R, Carney JP, Kelley MR, Glassner BJ, Williams DA and Samson L (1996)
Increasing DNA repair methyltransferase levels via bone marrow stem cell transduction rescues mice from the toxic effects of 1,3-bis(2-chloroethyl)-1-nitrosourea,
a chemotherapeutic alkylating agent. Proc Natl Acad Sci USA 93:206 –210.
Maze R, Kapur R, Kelley MR, Hansen WK, Oh SY and Williams DA (1997) Reversal
of 1,3-bis(2-chlorethyl)-1-nitrosourea-induced severe immunodeficiency by transduction of murine long-lived hematopoietic progenitor cells using O6-methylguanine DNA methyltransferase complementary DNA. J Immunol 158:1006 –1013.
Mitchell RB, Moschel R and Dolan ME (1992) Effect of O6-benzylguanine on the
sensitivity of human tumor xenografts to 1,3-bis(2-chloroethyl)-1-nitrosourea and
on DNA interstrand cross-link formation. Cancer Res 52:1171–1175.
Moritz T, Mackay W, Glassner BJ, Williams DA and Samson L (1995) Retroviralmediated expression of a DNA repair protein in bone marrow protects hematopoi-
Downloaded from jpet.aspetjournals.org at ASPET Journals on September 11, 2016
mM 6-BG and 40 mM BCNU after gene transfer into murine
hematopoietic cells. Although, the increase in 6-BG resistance (compared with WTMGMT) is statistically significant,
the level of this resistance will need to be examined in vivo to
determine whether it is sufficient to prevent depletion of
activity after pharmacological manipulation with 6-BG.
These experiments are currently under way in our laboratory
in a mouse model.
These results demonstrate that retroviral-mediated expression of the 6-BG-resistant P140A mutant form of MGMT
in hematopoietic cells protects against in vitro 6-BG depletion of MGMT and sensitization to BCNU. We are currently
testing the ability of P140A to protect murine hematopoietic
cells against 6-BG and BCNU in vivo after gene transfer. In
addition, Pegg and coworkers (Xu-Welliver et al., 1998) have
recently demonstrated that other amino acid substitutions at
position 140, such as P140K, confer significantly greater
resistance to 6-BG compared with mutations P140A, G156A,
or P140A/G156A. The median inhibitory dose (ID50) for 6-BG
against these 6-BG-resistant mutant forms of MGMT varies
from 60 to 300 mM, as opposed to 0.25 mM for WTMGMT
(Dolan et al., 1990a,b). These doses are well above the concentrations required to achieve in vivo biochemical modulation of MGMT expressed in human tumor cell xenografts. If
more resistance to 6-BG is necessary, mutants such as
P140K, which is more than 100 times more resistant than
P140A, may be more logical to pursue than double mutants,
which are likely to give problems with expression level and
poor activity due to lack of stability or mis-folding.
These mutants may also be of importance with respect to
the possible use of MGMT as a dominant selectable gene. We
have previously reported that mice transplanted with
MGMT-transduced hematopoietic stem cells demonstrated
an enrichment of transduced cells in the lymphoid compartment after multiple doses of 40 mg/kg BCNU in vivo (Maze et
al., 1997). Likewise, Allay et al. (1997), using WTMGMT, and
Davis et al. (1997), using G156A, have observed an enrichment of transduced cells in the myeloid compartment in vivo
after gene transfer of MGMT and BCNU treatment. Thus,
MGMT may potentially be used to enrich for hematopoietic
stem cells transduced with a retroviral vector containing a
second nonselectable therapeutic gene, such as b-globin, in a
nonablative setting, as suggested by Davis et al. (1997). Expression of a significantly greater 6-BG-resistant human
MGMT mutant, such as P140K, may prove to be more advantageous in minimizing the BCNU dose necessary for enrichment after 6-BG treatment, thus reducing any possible
BCNU-related systemic toxicity.
In summary, this report demonstrates that retroviral-mediated expression of P140A protects hematopoietic cells
against cytotoxic doses of BCNU after 6-BG depletion and
provides an approach to protect blood cells whereas treating
CENU-resistant tumors.
1473
1474
Maze et al.
etic cells from nitrosourea-induced toxicity in vitro and in vivo. Cancer Res 55:
2608 –2614.
Neben S, Hemman S, Montegomery M, Ferrera J and Mauch P (1993) Hematopoietic
stem cell deficit of transplanted bone marrow previously exposed to cytotoxic
agents. J Exp Hematol 21:156 –162.
Pegg AE, Dolan ME and Moschel RC (1995) Structure, function, and inhibition of
O6-alkylguanine-DNA alkyltransferase. Prog Nucleic Acid Res Mol Biol 51:167–223.
Pegg AE, Wiest L, Mummert C, Stine L, Moschel RC and Dolan ME (1991) Use of
antibodies to human O6-alkylguanine-DNA alkyltransferase to study the content
of this protein in cells treated with O6-benzylguanine or N-methyl-N9-nitro-Nnitrosoguanidine. Carcinogenesis 12:1679 –1683.
Phillips WP Jr, Willson JKV, Markowitz SD, Zborowska E, Zaidi NH, Liu L, Gordon
NH and Gerson SL (1997) O6-Methylguanine-DNA methyltransferase (MGMT)
transfectants of a 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU)-sensitive colon cancer cell line selectively repopulate heterogeneous MGMT1 /MGMT2 xenografts
after BCNU and O6-benzylguanine plus BCNU1. Cancer Res 57:4817– 4823.
Preuss I, Haas S, Eichhorn U, Eberhagen I, Kaufmann M, Beck T, Eibl RH, Dall P,
Bauknecht T, Hengstler J, Wittig B, Dippold W and Kaina B (1996) Activity of the
DNA repair protein O6-methylguanine-DNA methyltransferase in human tumor
and corresponding normal tissue. Cancer Detect Prev 20:1996.
Reese JS, Koc O, Lee KM, Liu L, Allay J, Phillips W and Gerson SL (1996) Retroviral
transduction of a mutant methylguanine DNA methyltransferase gene into human
Vol. 290
6
CD34 cells confers resistance to O -benzylguanine plus 1,3-bis(2-chloroethyl)-1nitrosourea. Proc Natl Acad Sci USA 93:14088 –14093.
Schabel Jr FM (1976) Nitrosoureas: A review of experimental antitumor activity.
Cancer Treat Rep 60:665– 698.
Silber JR, Bobola MS, Ghatan S, Blank A., Kolstoe DD and Berger MS (1998)
O6-Methylguanine-DNA methyltransferase activity in adult glimos: Relation to
patient and tumor characteristics. Cancer Res 58:1068 –1073.
Toorchen D and Topel MD (1983) Mechanisms of chemical mutagenesis and carcinogenesis: Effects on DNA replication of methylation at the O6-guanine position of
dGTP. Carcinogenesis 4:1591.
Wu RS, Hurst-Calderone S and Kohn KW (1987) Measurement of O6-alkylguanineDNA alkyltransferase activity in human cells and tumor tissues by restriction
endonuclease inhibition. Cancer Res 47:6229 – 6235.
Xu-Welliver M, Kanugula S and Pegg AE (1998) Isolation of humanO6- alkylguanine-DNA alkyltransferase mutants highly resistant to inactivation by O6benzylguanine. Cancer Res 58:1936 –1945.
Send reprint requests to: David A. Williams, M.D., Howard Hughes Medical
Institute, Cancer Research Institute, Indiana University School of Medicine,
1044 W. Walnut St., Indianapolis, IN 46202-5225. E-mail: [email protected]
Downloaded from jpet.aspetjournals.org at ASPET Journals on September 11, 2016