GENES, CHROMOSOMES & CANCER 47:614–624 (2008)
Concomitant Activation of Wnt Pathway and Loss of
Mismatch Repair Function in Human Melanoma
Daniele Castiglia,1* Silvia Bernardini,1 Ester Alvino,2 Elena Pagani,3 Naomi De Luca,1 Sabrina Falcinelli,3
Alberto Pacchiarotti,4 Enzo Bonmassar,5 Giovanna Zambruno,1 and Stefania D’Atri3
1
Laboratory of Molecular and Cell Biology,Istituto Dermopatico dell’Immacolata-IRCCS,Rome,Italy
Department of Medicine,Institute of Neurobiology and Molecular Medicine,CNR,Rome,Italy
3
Laboratory of Molecular Oncology,Istituto Dermopatico dell’Immacolata-IRCCS,Rome,Italy
4
Laboratory of Histopathology,Istituto Dermopatico dell’Immacolata-IRCCS,Rome,Italy
5
Department of Neurosciences,University of Rome‘‘Tor Vergata,’’Rome,Italy
2
Constitutive activation of the Wnt pathway plays a key role in the development of colorectal cancer and has also been implicated in the pathogenesis of other malignancies. Deregulation of Wnt signaling mainly occurs through genetic alterations of
APC, the b-catenin gene (CTNNB1), AXIN1 and AXIN2, leading to stabilization of b-catenin. Physiologically, AXIN2 is transcriptionally induced on Wnt signaling activation and acts as a negative feedback regulator of the pathway. In colorectal cancer,
mutations in CTNNB1 and AXIN2 occur preferentially in tumors with inactivation of the mismatch repair (MMR) genes MSH2,
MLH1, or PMS2. In this study, the expression of b-catenin and AXIN2, and the mutational status of CTNNB1, APC, and AXIN2
were evaluated in two MMR-deficient (PR-Mel and MR-Mel) and seven MMR-proficient human melanoma cell lines. Only PRMel and MR-Mel cells showed nuclear accumulation of b-catenin and expression of the AXIN2 gene, and hence, constitutive
activation of Wnt signaling. Mutational analysis identified a somatic heterozygous missense mutation in CTNNB1 exon three
and a germline heterozygous deletion within AXIN2 exon seven in PR-Mel cells, and a somatic biallelic deletion within APC in
MR-Mel cells. Deregulation of Wnt signaling and a defective MMR system were also present in the original tumor of PR and
MR patients. Thus, we describe additional melanomas with mutations in CTNNB1 and APC, identify for the first time a germline
AXIN2 mutation in a melanoma patient and suggest that inactivation of the MMR system and deregulation of the Wnt/b-cateC 2008 Wiley-Liss, Inc.
nin signaling pathway cooperate to promote melanoma development and/or progression. V
INTRODUCTION
The Wnt signaling pathway, acting via b-catenin, modulates a variety of cellular processes,
including proliferation, survival, apoptosis, differentiation, cell adhesion, and motility (reviewed in
Giles et al., 2003; Polakis, 2007). In the absence of
Wnt ligands, b-catenin essentially localizes at the
cell membrane, where it interacts with E-cadherin
and a-catenin. The excess of cytoplasmic b-catenin is incorporated into a multisubunit destruction
complex which includes AXIN1 and/or AXIN2,
the adenomatous polyposis coli (APC) tumor suppressor, protein phosphatase 2A, glycogen synthase
kinase-3b (GSK3B), and casein kinase (CK) 1a.
Phosphorylation of b-catenin at Ser45 by CK1a and
then at Ser33, Ser37, and Thr41 by GSK3B leads to
its ubiquitination and subsequent degradation by
the proteasome. The interaction of a Wnt protein
with its transmembrane frizzled receptor triggers a
cascade of events that leads to inhibition of
GSK3B activity, disruption of the APC/AXIN/
GSK3B complex, and accumulation of unphosphorylated b-catenin in the cytoplasm. This stabilized
C
V
2008 Wiley-Liss, Inc.
protein then translocates into the nucleus where it
activates the expression of a range of genes in association with T-cell factor (TCF) and lymphoidenhancing factor (LEF) transcription factors (Giles
et al., 2003; Polakis, 2007). Notably, in addition to
other genes, the b-catenin-TCF/LEF complex
activates MYC, CCND1, MYB, and AXIN2 (Yan
et al., 2001; Lustig et al., 2002; Giles et al., 2003).
Constitutive activation of Wnt/b-catenin signaling pathway is involved in the pathogenesis of a variety of malignancies (Giles et al., 2003; Polakis,
2007). In particular, germline and somatic loss-offunction mutations in APC are responsible for familial and sporadic forms of colorectal cancer (CRC),
respectively (reviewed in Gregorieff and Clevers,
2005; Segditsas and Tomlinson, 2006). ApproxiSupported by: Italian Ministry of Health.
*Correspondence to: Daniele Castiglia, Istituto Dermopatico dell’Immacolata-IRCCS, Via dei Monti di Creta 104, 00167 Rome,
Italy. E-mail: [email protected]
Received 28 November 2007; Accepted 3 March 2008
DOI 10.1002/gcc.20567
Published online 2 April 2008 in
Wiley InterScience (www.interscience.wiley.com).
615
WNT PATHWAY DEREGULATION IN MELANOMA
TABLE 1. MMR Status, CTNNB1, APC, and AXIN2 Mutations and b-Catenin Expression in the Melanoma Cell Lines
Mutations
Cell line
CN-Mel
CR-Mel
GR-Mel
LCP-Mel
M14
MR-Mel
PR-Mel
SK-Mel-28
SN-Mel
MMR Status
CTNNB1
APC
AXIN2
b-catenina
Proficient
Proficient
Proficient
Proficient
Proficient
Deficient
Deficient
Proficient
Proficient
–
–
–
–
–
–
p.S45F
–
–
–
–
–
–
–
Gross deletions
–
–
–
–
–
–
–
–
–
c.2013_2024del
–
–
Abs
Me 1 cy
Me 1 cy
Me 1 cy
Me 1 cy
Cy 1 nu
Cy 1 nu
Me 1 cy
Me 1 cy
a
The b-catenin expression in the melanoma cell lines was determined by indirect immunofluorescence. Abs, absent; me, membrane; cy, cytoplasm; nu,
nucleus.
mately 80–85% of sporadic CRC harbor truncating
mutations in APC. These mutations are usually
localized in a restricted region of the gene (the
mutation cluster region, MCR) and result in mutant polypeptides unable to bind b-catenin and/or
AXIN. Moreover, up to 50% of CRC without APC
inactivation, contain activating mutations (missense or deletion) in exon three of the b-catenin
gene (CTNNB1), resulting in the expression of a
protein refractory to degradation. Mutations in
other components of the Wnt pathway, mainly
AXIN1, AXIN2, and TCF4, have also been
described in CRC as well as in other tumor types,
either alone or in association with APC or CTNNB1
alterations (Liu et al., 2000; Fukushima et al.,
2001; Shimizu et al., 2002; Thorstensen et al.,
2005; Suraweera et al., 2006).
A possible involvement of deregulated Wnt signaling in melanoma was initially hypothesized
based on the identification of mutations in the Wnt
pathway genes CTNNB1 or APC in a significant
percentage (27%) of melanoma cell lines (Rubinfeld et al., 1997). Subsequent studies, however,
revealed that CTNNB1 and APC mutations are rare
events in this form of neoplasia although nuclear
and/or cytoplasmic expression of b-catenin can be
detected in a large proportion of melanoma specimens (Rimm et al., 1999; Omholt et al., 2001;
Demunter et al., 2002; Pollock and Hayward, 2002;
Reifenberger et al., 2002; Kielhorn et al., 2003;
Maelandsmo et al., 2003; Worm et al., 2004). These
findings have led to the hypothesis that molecular
alterations other than CTNNB1 and APC mutations
could cause dysregulation of Wnt pathway in this
tumor. On the other hand, it has also been suggested that nuclear and/or cytoplasmic expression
of b-catenin in melanomas harboring wild type
APC and CTNNB1 might reflect transient and
physiological activation of Wnt signaling. Actually,
nuclear and/or cytoplasmic localization of b-catenin has been described also in benign melanocytic
naevi (Silye et al., 1998; Kageshita et al., 2001;
Maelandsmo et al., 2003; Bachmann et al., 2005).
The aim of the present study was to investigate
further the relationship between the expression
and subcellular localization of b-catenin and Wnt
signaling dysregulation in melanoma. To this end,
the expression pattern of b-catenin, the mutational
status of CTNNB1, APC, and AXIN2, as well as
AXIN2 mRNA and protein levels were evaluated
in a panel of melanoma cell lines. Since previous
studies have shown that CTNNB1 and AXIN2
mutations occur preferentially in CRC displaying
high frequency microsatellite instability (MSI-H)
(Kitaeva et al., 1997; Mirabelli-Primdahl et al.,
1999; Miyaki et al., 1999; Liu et al., 2000; Fukushima et al., 2001; Shitoh et al., 2001; Johnson et al.,
2005; Thorstensen et al., 2005), a phenotype
linked to the inactivation of the mismatch repair
(MMR) genes MSH2, MLH1, or PMS2 (reviewed
in Lawes et al., 2003; Abdel-Rahman et al., 2006),
only melanoma cell lines characterized for the
functional status of the MMR system were
included in the panel.
MATERIALS AND METHODS
Cell Line and Biological Samples
Nine human melanoma cell lines were used in
this study (Table 1). GR-Mel and LCP-Mel were
derived from primary melanomas, while the
remaining cell lines were from metastatic lesions.
All melanoma cell lines, with the exception of
MR-Mel, had been previously characterized for
MMR activity. PR-Mel is MMR-deficient because
of biallelic somatic inactivation of MLH1 (Alvino
et al., 2002; Castiglia et al., 2003), while the other
cell lines are MMR-proficient (Alvino et al., 2002;
Genes, Chromosomes & Cancer DOI 10.1002/gcc
616
CASTIGLIA ET AL.
Pepponi et al., 2003). The MR-Mel cell line is
MMR-deficient, as reported in the present study.
The cell lines were cultured as previously
described (Pepponi et al., 2003).
The human colon cancer cell lines LoVo, HCT116, and SW48 were obtained from American Type
Culture Collection and cultured in DMEM (GIBCOTM, Invitrogen Corporation, Paisley, United
Kingdom) supplemented with 10% FCS (Hyclone
Laboratories, Logan, Utah), 2 mmol/L L-glutamine
and antibiotics (GIBCOTM). These cell lines are
known to carry mutations in CTNNB1 or APC
(Morin et al., 1997; Rowan et al., 2000) and to be
MMR-deficient due to genetic or epigenetic
defects in MSH2 or MLH1 genes (Papadopoulos
et al., 1994; Umar et al., 1994; Kane et al., 1997).
High levels of AXIN2 mRNA and protein were
previously described in LoVo and SW48 cell lines,
respectively (Yan et al., 2001; Lustig et al., 2002).
The tumor specimens from which MR-Mel and
PR-Mel cell lines were derived, as well as the primary melanoma of the PR patient were available
as paraffin-embedded tissue. Matched peripheral
blood mononuclear cells (MNC), collected from
the MR and PR patients at the time of metastasis
excision and cryopreserved, were also available.
The study was conducted following the Declaration of Helsinki guidelines. All biological material
was obtained with the patient’s informed consent.
Immunofluorescence and Immunohistochemistry
Studies
Melanoma cells growing on glass coverslips in
24-well tissue culture plates (Falcon, Becton and
Dickinson Labware, Franklin Lakes, New Jersey)
were fixed with 3% formaldehyde in PBS (pH 7.4)
for 20 min, and then permeabilized with 0.1% Triton X-100 in PBS for 3 min at room temperature.
The cells were then blocked with 1% BSA in PBS
for 30 min at room temperature, and incubated
with an anti-b-catenin mouse monoclonal antibody (mAb) (mAb 14, Transduction Laboratories,
Lexington, Kentucky) (1:250 dilution) for 1 hr
at room temperature. Immunoreactivity was
detected using a FITC-conjugated rabbit antimouse Ig secondary antibody (DAKO, Glostrup,
Denmark).
Immunohistochemical analysis of b-catenin
expression was performed on 4 lm-thickness sections from formalin-fixed, paraffin-embedded tumor specimens. Antigen retrieval was performed
by microwave treatment (650 W, 10 min in 0.01 M
citrate buffer, pH 6.0). The sections were then
sequentially treated with 3% H2O2 for 10 min and
Genes, Chromosomes & Cancer DOI 10.1002/gcc
with 10% horse serum for 1 hr. Incubation with the
anti-b-catenin mAb (1:100 dilution) was then performed for 1 hr at room temperature. A biotinylated anti-mouse Ig universal secondary antibody
(Vector Laboratories, Burlingame, California)
(1:150 dilution) was applied for 1 hr at room temperature, followed by a streptavidin/peroxidase
complex (Vectastain ABC kit, Vector Laboratories)
for 1 hr at room temperature. Diaminobenzidine
tetrahydrochloride (DAB, DAKO Corporation,
Carpinteria, California) or 3-amino-9-ethylcarbazole (AEC, DAKO Corporation) served as substrate for staining.
Immunohistochemical analysis of MSH6 protein
expression was performed as previously described
(Alvino et al., 2002).
Western Blot Analysis
To evaluate AXIN2 protein expression total cellular extracts were prepared as described previously (Caporali et al., 2004). Thirty microgram of
protein per sample were run on 8% SDS-polyacrylamide gels, transferred to nitrocellulose membranes (Hybond-C, Amersham Biosciences, Little
Chalfont, United Kingdom), and blocked in
50 mmol/L Tris-HCl, pH 7.5, 150 mmol/L NaCl,
0.1% Tween 20, and 5% nonfat dry milk for 1 hr at
378C. The membranes were then incubated in the
same solution overnight at 48C with a goat polyclonal antibody against AXIN2 (S-19, Santa Cruz Biotechnology, Santa Cruz, California) (1:300 dilution)
or an anti-actin mouse mAb (clone AC-40, Sigma,
St. Louis, MO) (1:1000 dilution). The latter mAb
was used as an internal standard for loading. Immunodetection was carried out by using appropriate
horseradish peroxidase-linked secondary antibodies and ECL detection reagents (Amersham Biosciences).
Western blot analysis of MMR protein expression was performed as previously described (Alvino
et al., 2002).
Northern Blot Analysis
Total RNA was purified from cell lines using a
commercial kit (Mackerey-Nagel, Düren, Germany). For each sample, 20 lg of total RNA were
fractionated by electrophoresis on a 1.2% agarose/
formaldehyde gel and transferred to Hybond-N nylon membrane (Amersham Biosciences) as recommended by the supplier. Membranes were hybridized with a 32P-labeled cDNA probe corresponding to AXIN2 exon five, or to GAPDH as a control
for loading and transfer efficiency. Filters were
exposed to autoradiographic film for up to 5 days.
617
WNT PATHWAY DEREGULATION IN MELANOMA
Mutational Analysis
Genomic DNA was extracted from the cell lines,
MNC, and manually microdissected tumor tissues
using the DNeasy Tissue kit (Qiagen, Hilden, Germany). cDNA was obtained by reverse transcription of about 2.5 lg of total RNA purified from the
cell lines using 1 lL (200 U) of SuperScript RNase
H free reverse transcriptase (Invitrogen) and oligo
dT as primers.
All exons of MSH6 were amplified from genomic
DNA of MR-Mel cells using 16 primer pairs situated in flanking introns (Levati et al., 1998). Exon
three of CTNNB1 and the MCR (exon 15, codons
1256–1551) of APC were amplified from genomic
DNA of all melanoma cell lines using PCR conditions and oligonucleotide primers previously
described (Palacios and Gamallo, 1998; MorenoBueno et al., 2002). In selected melanoma cell
lines, the MCR of APC was also amplified from
cDNA. To check for mRNA integrity, amplification
of tyrosinase cDNA was also performed in the
same cell lines, using the primers HTYR 1 and
HTYR 2, as described by Curry et al. (1996). The
entire coding sequence of AXIN2 was amplified
from cDNA of melanoma cell lines using published oligonucleotides and PCR conditions (Wu
et al., 2001). Each PCR product was analyzed by
direct DNA sequencing using an ABI Prism 377
semiautomated sequencing system (Applied Biosystems, Foster City, California).
Mutations found in the PR-Mel and MR-Mel cell
lines were screened in the DNA of the matched
microdissected tumor tissues by PCR amplification
and sequencing analysis using the CTNNB1 exon 3and APC-specific primers reported above, and the following primer pairs: (F) 50 -TCTCCAGGCGAAC
GAGCCAG and (R) 50 -ACCTCAGCTAGCCTGC
GACA that amplify a 167-bp region of AXIN2 exon
seven (Tann 608C) (GenBank accession no.
AF078165); (F) 50 -AGCAGGTCATCTCTCTGCAG
and (R) 50 -TAGACTATGGTCCTACAGCC, and
(F) 50 -TTGGCTGTAGGACCATAGTC and (R) 50 ATAGAACAGTCGCCGCATGC that amplify a 243bp and a 229-bp region, respectively, of MSH6 exon
four (Tann 578C) (GenBank accession no. U73735).
High resolution agarose gel electrophoresis of
the 167-bp PCR fragment encompassing AXIN2
exon seven, and AlwI restriction endonuclease
(New England Biolabs, Beverly, Massachusetts)
digestion of the 229-bp PCR product spanning
MSH6 exon four were used to screen for the presence of mutations c.2013_2024del (AXIN2) and
p.T1008I (MSH6) in the germ line DNA of PR
patient (mutation c.2013_2024del) and normal
human controls (mutations c.2013_2024del and
p.T1008I).
PCRs were performed in 25 lL reaction volumes using the AmpliTaq Gold polymerase (2.0 U)
and standard reagents (Applied Biosystems-Roche
Molecular Diagnostics, Branchburg, New Jersey).
PCR was carried out in the presence of 15 lg of
BSA (Giambernardi et al., 1998) when genomic
DNA from tumor tissues was used. Mutations were
confirmed by repeated PCR and resequencing of
the PCR products in both orientations. Subcloning
of PCR products (TOPO-TA cloning kit, Invitrogen) was also used to define mutations.
RESULTS
Analysis of the Functional Status of the MMR
System in the MR-Mel Cell Line and
the Matched Tumor
To establish the functional status of the MMR
system in MR-Mel cells, we first performed a
Western blot analysis of MSH2, MSH3, MSH6,
MLH1, and PMS2 protein expression. The results
shown in Figure 1a demonstrate that all of the
polypeptides, with the exception of MSH6, were
present in the cell extract. The expression of
MSH6 was also evaluated by immunohistochemistry in the melanoma specimen from which the cell
line had been derived and no immunoreactivity
was observed in tumor cells (Fig. 1b). A mutational
analysis of the MSH6 sequence was therefore carried out. We detected two C-to-T transitions at nucleotide positions 2815 and 3023 of the MSH6 coding region (exon four) (Fig. 2a). The sequence variations result in the formation of the nonsense
codon p.Q939X and the missense codon p.T1008I,
respectively. No other changes were found in the
MSH6 coding sequence. Both alterations, which
affect opposite alleles as determined by sequencing of subcloned PCR products (Fig. 2a), were not
detected in the germline DNA of the MR patient
(Fig. 2a), but were identified in the DNA obtained
from the melanoma specimen (data not shown).
The T1008 residue is conserved through evolution
(Fig. 2b) and is located in the putative DNA-binding domain of the MSH6 polypeptide. The
p.T1008I mutation was not detected in 50 healthy
control subjects.
b-catenin Expression and Localization in the
Melanoma Cell Lines
Expression and subcellular localization of b-catenin in the melanoma cell lines were evaluated by
indirect immunofluorescence. The MR-Mel and
Genes, Chromosomes & Cancer DOI 10.1002/gcc
618
CASTIGLIA ET AL.
Figure 1. Expression of MMR proteins in the MR-Mel cell line and
the matched tumor specimen. (a) Eighty lg of whole cell extracts were
resolved on a 7% SDS-polyacrylamide gel, transferred to a nitrocellulose membrane and incubated with mAbs against MSH2, MSH3, MSH6,
MLH1, or PSM2. Incubation with anti-actin mAb was performed as a
loading control. The immune complexes were visualized using ECL.
LoVo cells, expressing MLH1 and PSM2 but not MSH2 and MSH6, and
HCT116 cells, expressing MSH2 and MSH6 but not MLH1 and PMS2,
were used as controls. (b) Immunoreactivity for MSH6 was evaluated in
the tumor specimen of MR patient and, as a positive control, in the
MMR-proficient tumor specimen of CN patient (Alvino et al., 2002).
Magnification: 3100.
Figure 3. b-catenin expression in melanoma cell lines as detected
by indirect immunofluorescence. The MR-Mel and PR-Mel cells show
strong nuclear and cytoplasmic expression of b-catenin in the absence
of membranous staining; M14 cells express b-catenin in the membrane
and show a weak cytoplasmic staining; CN-Mel cells do not show immunoreactivity for b-catenin. Magnification: 3200.
Figure 2. Identification of somatic mutations in the MSH6 gene. (a)
Direct DNA sequencing of exon 4 amplified from genomic DNA of MR-Mel
cells reveals two heterozygous C > T transitions at nucleotides 2815 (upper
left panel) and 3023 (lower left panel) resulting in the p.Q939X nonsense
and p.T1008I missense mutations, respectively. Germline DNA from the MR
patient’s MNC does not show any of these two mutations (right panels).
Involved codons are underlined. The presence of the two mutations on opposite alleles was confirmed by plasmid subcloning of the PCR product and
sequencing of individual clones (middle panels). (b) Multiple alignment of the
MSH6 amino acid sequence involved in mutation p.T1008I. Threonine conservation is highlighted in red. Sequences were taken from SwissProt
P52701 (human MSH6), P54276 (mouse MSH6), Q803S7 (zebra fish MSH6),
Q9VUM0 (drosophila melonogaster MSH6), O04716 (arabidopsis thaliana
MSH6) and from GenBank EDMO2631 (rat MSH6).
PR-Mel cell lines showed a strong nuclear and
cytoplasmic accumulation of b-catenin in the absence of membrane staining (Table 1 and Fig. 3).
Genes, Chromosomes & Cancer DOI 10.1002/gcc
b-catenin expression was totally absent in the CNMel cells, while the remaining six cell lines
expressed b-catenin in the membrane and showed
additional weak cytoplasmic staining (Table 1, Fig.
3 and data not shown).
Expression of AXIN2 in the Melanoma Cell Lines
Previous studies demonstrated that AXIN2 is a
direct target of Wnt signaling (Yan et al., 2001;
Lustig et al., 2002). To correlate the expression
and subcellular localization of b-catenin with activation of the Wnt pathway, we evaluated the
AXIN2 expression in the melanoma cell lines.
High levels of AXIN2 mRNA, comparable with
those observed in the LoVo colon cancer cells,
WNT PATHWAY DEREGULATION IN MELANOMA
used as a positive control, were observed exclusively in the PR-Mel and MR-Mel cell lines (Fig.
4a), both displaying nuclear and cytoplasmic accumulation of b-catenin. Consistent with this finding,
Figure 4. AXIN2 expression in melanoma cell lines. (a) Twenty
microgram of total RNA were fractionated by electrophoresis on a
1.2% agarose/formaldehyde gel and transferred to a nylon membrane.
The membranes were then hybridized with a 32P-labeled cDNA probe
corresponding to AXIN2 exon 5, or to GAPDH as a control for loading
and transfer efficiency. Filters were exposed to autoradiographic film
for up to five days. LoVo cells were used as a positive control. (b) Thirty
lg of whole cell extracts were resolved on an 8% SDS-polyacrylamide
gel, transferred to a nitrocellulose membrane and incubated with a goat
polyclonal antibody against AXIN2 or an anti-actin mouse mAb as a
control for loading. The immune complexes were visualized using ECL.
SW48 cells were used as a positive control.
Figure 5. Identification of genetic defects in Wnt/b-catenin pathway
genes. (a) Direct DNA sequencing of exon 3 of CTNNB1 amplified from
genomic DNA of the PR-Mel cells and the primary melanoma of the PR
patient reveals a hemizygous C > T transition at nucleotide 134 (left
and middle panels) leading to the p.S45F missense mutation. This mutation was not detected in the germline DNA purified from the patient’s
MNC (right panel). Codon 45 is underlined. (b) Agarose gel electrophoresis of RT-PCR products amplified from total RNA of the melanoma
cell lines using a primer pair spanning the MCR of APC. No PCR product
was obtained using MR-Mel cDNA, whereas a wild type fragment (380
bp) was generated in all of the remaining samples (upper panel). Amplifi-
619
high amounts of AXIN2 protein were detected
only in these two cell lines (Fig. 4b).
Mutational Analysis of CTNNB1, APC, and AXIN2
in the Melanoma Cell Lines
To correlate the activation of Wnt signaling
observed in the PR-Mel and MR-Mel cell lines
with genetic defects in components of the Wnt
pathway, we determined the mutational status of
APC, CTNNB1, and AXIN2 in these two melanoma
cell lines.
We first amplified and sequenced a 200-bp fragment from CTNNB1 exon three, encoding the Nterminal b-catenin degradation box, and three
overlapping segments corresponding to a portion of
APC exon 15 (codons 1256–1551), which covers the
MCR. A somatic C-to-T transition in CTNNB1
exon three, resulting in Ser45 ? Phe substitution
(p.S45F), was identified in the PCR product
obtained from the PR-Mel cells (Fig. 5a). The
mutation is hemizygous, due to a deletion of the
chromosome region 3p21-24 in the other chromosome three homologue (Castiglia et al., 2003)
which contains both the MLH1 and CTNNB1 loci.
The MR-Mel cell line showed evidence of a
large somatic genomic deletion in both alleles of
APC. Indeed, amplifications of MR-Mel genomic
DNA over the MCR produced no PCR fragments
cation of tyrosinase cDNA (TYR, 284 bp) was used as a control for
RNA quality in each sample (lower panel). (c) High resolution agarose
gel electrophoresis of the PCR products spanning AXIN2 exon 7. Two
bands of 167 and 155 bp are generated using genomic DNA of both PRMel cells and MNC of the corresponding patient (lane 1 and 5), whereas
a single wild type fragment (167 bp) is amplified from germ line DNA of
healthy donors (lanes 2–4 and 6–11). Subcloning and sequencing of
these two fragments revealed a 12-bp deletion (2013_2024del mutation) within the 155-bp fragment, whereas the 167-bp band corresponded to a wild type sequence.
Genes, Chromosomes & Cancer DOI 10.1002/gcc
620
CASTIGLIA ET AL.
(data not shown). PCR amplifications with two
primer pairs designed outside the MCR, and
encompassing the 50 and 30 ends of exon 15, also
resulted in no PCR products (data not shown). Further analysis of genomic DNA for SNPs in exons
11, 13, and 15 (codons 486, 545, and 1493, respectively) showed that the germline DNA of MR
patient was heterozygous for all these polymorphisms (data not shown). In contrast, SNPs in exon
11 and 13 were found to be homozygous in the
MR-Mel genomic DNA (data not shown). These
findings indicate that both APC alleles were present in the constitutive DNA of the patient and
demonstrate the occurrence of a large somatic
deletions in MR-Mel cells involving at least the
entire APC exon 15 on one allele, and exon 15 plus
the upstream exons 11–14 on the other allele. To
confirm further the occurrence of the biallelic deletion at mRNA level, a PCR amplification spanning
the MCR was repeated using MR-Mel cDNA. As
illustrated in Figure 5b for one of the three MCR
fragments, no PCR product was obtained with
MR-Mel cDNA, whereas the expected fragment
was generated with cDNAs obtained from melanoma cell lines used as positive controls. In addition, PCR amplification of tyrosinase cDNA produced the expected fragment in all cell lines
tested, indicating that no mRNA degradation had
occurred in MR-Mel sample (Fig. 5b).
The complete coding region of AXIN2 was then
amplified from cDNA of both PR-Mel and MRMel cell lines to generate seven overlapping
cDNA fragments. Each PCR product was subjected to direct sequencing. Overlapping sequence
traces were detected in the chromatogram of the
region spanning codon 645–712 in the PR-Mel cell
line (data not shown).
Sequencing of individual subcloned fragments
revealed
an
in-frame
12-bp
deletion
(c.2013_2024del) within AXIN2 exon seven, which
results in the deletion of amino acid residues 672–
675 (delTTPR) (data not shown). To confirm the
presence of the c.2013_2024del mutation at
genomic level, DNA purified from the PR-Mel
cells and the patient’s MNC was PCR-amplified to
generate a 167-bp fragment encompassing the
region involved in the deletion. The resulting
PCR products were subjected to high resolution
gel electrophoresis to separate wild-type from mutant deleted fragments. The expected 167-bp band
and a 155-bp deleted fragment were detected in
both the PR-Mel cells and the MNC of patient PR
(Fig. 5c, left panel). The 155-bp fragment amplified from the germline DNA was subcloned and
Genes, Chromosomes & Cancer DOI 10.1002/gcc
the mutation identity determined by sequencing
of individual clones (Fig. 5c, right panel). The possibility that the c.2013_2024del mutation in AXIN2
might represent a neutral gene polymorphism was
evaluated by screening AXIN2 exon seven in 93
control, ethnically matched, individuals. The
mutation was not detected in any of these subjects.
Mutational analysis of CTNNB1, APC, and
AXIN2 was also performed in the seven melanoma
cell lines displaying no activation of Wnt pathway,
and no mutations were found (data not shown).
Mutational Status of CTNN1B and APC, and
b-catenin Expression in the Melanoma Specimens
To establish whether the CTNNB1 mutation
detected in the PR-Mel cells and the biallelic deletion within APC identified in the MR-Mel cells
arose in culture or were already present in the tumor specimens, genomic DNA was extracted from
the corresponding tumor blocks and subjected to
Figure 6. Immunohistochemical detection of b-catenin in the tumor
specimens of the PR and MR patients. Cytoplasmic and nuclear immunoreactivity for b-catenin is present in the majority of melanoma cells
in both tumor samples. For PR patient, the primary melanoma is shown.
A similar immunostaining pattern was observed in the metastatic lesion.
Note that keratinocytes of uninvolved skin of the PR specimen display
only membranous immunoreactivity (inset). Magnification: 350 (PR),
3200 (MR).
WNT PATHWAY DEREGULATION IN MELANOMA
mutational analysis of either CTNNB1 exon three
or APC MCR, as described for melanoma cell lines.
Moreover, b-catenin expression in the tumor tissue
was evaluated by immunohistochemistry. The
mutational analysis confirmed the presence of the
CTNNB1 p.S45F mutation in both the primary and
metastatic melanoma of the PR patient (Fig. 5a
and data not shown). Moreover, both tumor specimens displayed a strong cytoplasmic and nuclear
staining for b-catenin in neoplastic cells as compared with the membrane pattern showed by normal epidermis (Fig. 6 and data not shown). The
biallelic deletion within APC was not clearly
detected in the metastatic lesion of the MR
patient, most likely as the result of a residual contamination of DNA from non-cancerous cells present in the tumor specimen. However, the immunohistochemical analysis of b-catenin expression performed on the lesion showed a nuclear and
cytoplasmic accumulation of b-catenin in neoplasic
cells comparable with that observed in PR patient’s
lesion (Fig. 6), thus indicating dysregulation of
Wnt pathway.
DISCUSSION
The Wnt/b-catenin pathway plays a fundamental role in melanocyte development and dysregulation of the pathway has been proposed to be implicated in melanocyte malignant transformation
(reviewed in Weeraratna, 2005; Larue and Delmas,
2006). We investigated the Wnt/b-catenin pathway
status in two MMR-deficient and seven MMR-proficient cell lines. Among the latter, one, CN-Mel,
was completely negative for b-catenin expression,
while the remaining six expressed the protein in
the membrane and, although weakly, in the cytoplasm. In agreement with this finding, Wnt signaling was not activated in these cell lines, as demonstrated by the absence of AXIN2 gene expression;
furthermore, none harbored mutations in the genes
screened. The complete loss of b-catenin detected
in the CN-Mel cells has been previously described
in a number of melanoma specimens (Kageshita
et al., 2001; Omholt et al., 2001; Kielhorn et al.,
2003), and might be due to CTNNB1 aberrations
outside exon three or to the loss of E-cadherin
expression (Herlyn et al., 2000; Haass et al., 2005).
In contrast, the two MMR-deficient cell lines displayed Wnt pathway activation due to either a somatic heterozygous mutations in CTNNB1 (PRMel) or a somatic biallelic deletion within APC
(MR-Mel). In addition, PR-Mel cells also carried a
germline heterozygous mutations in AXIN2.
621
The somatic p.S45F mutation in b-catenin
detected in the PR-Mel cell line stabilizes the protein within the cell, as phosphorylation of Ser45 by
CK1a in the absence of Wnt signals is essential for
protein degradation. The same mutation has previously been described in CRC (Ruckert et al., 2002;
Shimizu et al., 2002), in endometrial cancer
(Moreno-Bueno et al., 2002), and in one primary
melanoma along with its matched metastasis
(Omholt et al., 2001). Importantly, the CTNNB1
mutation detected in the PR-Mel cells was confirmed in the primary melanoma and the metastatic
lesion of the PR patient, suggesting a pathogenic
role of the mutation in tumor development.
Previous studies have shown that oncogenic bcatenin mutations are significantly more common
in CRC displaying MSI-H than in CRC showing
microsatellite stable (MSS) or low-frequency MSI
(MSI-L) phenotype (Kitaeva et al., 1997; Mirabelli-Primdahl et al., 1999; Miyaki et al., 1999;
Fukushima et al., 2001; Shitoh et al., 2001; Johnson
et al., 2005). The MSI-H phenotype is associated
with inactivation of the MSH2, MLH1, or PMS2
genes. Interestingly, the PR-Mel cell line is MMRdefective due to a biallelic somatic inactivation of
MLH1, and displays MSI-H (Alvino et al., 2002;
Castiglia et al., 2003). This suggests that CTNNB1
mutations may occur preferentially in MSI-H melanomas. In this regard, it is worth nothing that
although the MMR status of the previously identified melanoma cell lines and specimens harboring
CTNNB1 mutations was not investigated, Kitaeva
et al. (1997) failed to detect CTNNB1 mutations in
eight MSS melanoma cell lines.
AXIN2 binds several components of the canonical Wnt pathway and promotes phosphorylation of
b-catenin. AXIN2 is transcriptionally induced as a
consequence of Wnt signaling activation and acts
as a negative feedback regulator of the pathway
(Lustig et al., 2002; Giles et al., 2003). Heterozygous insertions/deletion mutations in AXIN2 have
been described in a relatively high proportion (20–
25%) of CRC characterized by the absence of
MLH1 or MSH2 expression and/or MSI-H (Liu
et al., 2000; Thorstensen et al., 2005). All of the
observed mutations, which are considered a consequence of MMR deficiency, affect the mononucleotide repeat sequences located in AXIN2 exon
seven, and result in frameshifts leading to truncated polypeptides devoid of the COOH-terminal
DIX (disheveled and AXIN) domain. Heterozygous AXIN2 mutations in exon seven have also
been detected in one endometrioid adenocarcinoma (Wu et al., 2001) and in two hepatocellular
Genes, Chromosomes & Cancer DOI 10.1002/gcc
622
CASTIGLIA ET AL.
carcinomas (Taniguchi et al., 2002). Interestingly,
one of the two mutations reported by Taniguchi
et al., (2002) is the same 12-bp deletion
(c.2013_2024del) found in the PR-Mel cells. The
endometrioid adenocarcinoma with mutant
AXIN2 had been previously found to exhibit
MSI-H (Wu et al., 1999), suggesting a possible
link between mutations affecting AXIN2 mononucleotide repeats and a defective MMR also in
tumors other than CRC. To date, the mutational
status of AXIN2 in melanomas has not been
investigated. The PR-Mel cell line and the
matched tumors represent therefore the first melanoma samples with a documented mutation in
this gene. However, the c.2013_2024del mutation
is clearly not a consequence of tumor cell MMRdeficiency, since it was already present in the PR
patient’s germline DNA.
Presently, the functional consequence of AXIN2
mutation is still uncertain. The study by Liu et al.,
(2000) suggests that mutant AXIN2 can alter the
Wnt pathway through a dominant-negative effect.
However, other investigations support the hypothesis that heterozygous mutation of AXIN2 alone is
not sufficient to activate Wnt signaling, and that
other genes controlling the pathway have to be
mutated as well (Taniguchi et al., 2002; Thorstensen et al., 2005). The results of our study suggest
that an AXIN2 mutation alone is not sufficient to
activate the Wnt pathway. Indeed, strong nuclear
accumulation of b-catenin is detected in the PRMel cells and PR patient’s melanomas, which harbor germline AXIN2 and somatic CTNNB1 mutations. In contrast, only membranous expression of
the protein can be detected in the patient’s skin
keratinocytes carrying the AXIN2 mutation alone.
Interestingly, Lammi et al., (2004) identified a
germline AXIN2 nonsense mutation (p.R656X) in
eleven members of a Finnish four-generation family. All mutation carriers showed oligodontia along
with high incidence of CRC or colon precancerous
lesions. Dental records of the PR patient were not
directly available, but accordingly to information
obtained from her family, she was not affected by
oligodontia. Furthermore, the PR patient died
from metastatic melanoma in the absence of other
concomitant neoplastic diseases, and had no family
history of melanoma or other malignancies. Her
daughters did not inherit the mutation, as shown
by DNA sequencing of AXIN2 exon seven.
Unfortunately, germline DNA from the patient’s
parents was not available. These results leave open
the question of whether germline AXIN2 mutations may predispose to melanoma.
Genes, Chromosomes & Cancer DOI 10.1002/gcc
APC is generally considered a tumor suppressor
gene, as both alleles must be inactivated for loss of
growth-suppressive activity. To our knowledge, only
three studies have thus far addressed the mutational
status of APC in melanomas. APC disruption was
identified in three out of 66 melanoma cell lines
(Rubinfeld et al., 1997; Worm et al., 2004), whereas a
missense APC mutation associated with focal nuclear
b-catenin expression was detected in one primary
melanoma of 37 primary and metastatic lesions
screened (Reifenberger et al., 2002).
In this study, we describe an additional melanoma cell line with APC inactivation. The biallelic
gross deletion within the gene observed in the
MR-Mel cells is expected to eliminate the b-catenin binding region from the APC protein, thus promoting b-catenin stabilization and activation of
Wnt signaling. Although we were unable to confirm APC genomic deletions in the metastatic
lesion of the MR patient, the tumor specimen displayed a strong nuclear accumulation of b-catenin,
suggesting that inactivation of the gene had
occurred in vivo. Interestingly, Wnt deregulation
was associated with a MMR-deficiency also in
the MR-Mel cells and the matched tumor. Thus,
the present study suggests that inactivation of the
MMR system and deregulation of the Wnt/b-catenin signaling pathway cooperate to promote melanoma development and/or progression.
It is noteworthy, from a clinical point of view,
that MMR-deficient malignant cells, almost
always, are highly resistant to the cytotoxic effects
of DNA methylating agents such as triazene
compounds (Jiricny, 2006). Indeed, both MMR-deficient melanoma lines used in the present study
have been found to be resistant to in vitro treatment with temozolomide (Pepponi et al., 2003;
and data not shown).
In conclusion, our study provides additional support to the role of Wnt pathway deregulation in the
pathogenesis of at least a subset of melanomas.
Moreover, we describe for the first time the occurrence of a germline AXIN2 mutation in a melanoma patient. Our investigation also suggests that
the expression level of AXIN2 can be monitored to
identify melanomas with Wnt pathway activation.
However, additional studies are required to address
further whether constitutive activation of Wnt signaling occurs preferentially in MMR-deficient
melanomas.
ACKNOWLEDGMENTS
We thank Dr. G. Zupi (Regina Elena Cancer
Institute, Rome, Italy) for providing the M14 cell
WNT PATHWAY DEREGULATION IN MELANOMA
line, Dr. F. Guadagni (IRCCS San Raffaele Pisana,
Rome, Italy) for providing the LCP-Mel cell line,
and Maurizio Inzillo for the artwork.
REFERENCES
Abdel-Rahman WM, Mecklin JP, Peltomaki P. 2006. The genetics
of HNPCC: Application to diagnosis and screening. Crit Rev
Oncol Hematol 58:208–220.
Alvino E, Marra G, Pagani E, Falcinelli S, Pepponi R, Perrera C,
Haider R, Castiglia D, Ferranti G, Bonmassar E, Jiricny J, Zambruno G, D’Atri S. 2002. High-frequency microsatellite instability
is associated with defective DNA mismatch repair in human melanoma. J Investig Dermatol 118:79–86.
Bachmann IM, Straume O, Puntervoll HE, Kalvenes MB, Akslen
LA. 2005. Importance of P-cadherin, beta-catenin, and Wnt5a/
frizzled for progression of melanocytic tumors and prognosis in
cutaneous melanoma. Clin Cancer Res 11:8606–8614.
Caporali S, Falcinelli S, Starace G, Russo MT, Bonmassar E, Jiricny
J, D’Atri S. 2004. DNA damage induced by temozolomide signals
to both ATM and ATR: Role of the mismatch repair system. Mol
Pharmacol 66:478–491.
Castiglia D, Pagani E, Alvino E, Vernole P, Marra G, Cannavo E, Jiricny J, Zambruno G, D’Atri S. 2003. Biallelic somatic inactivation
of the mismatch repair gene MLH1 in a primary skin melanoma.
Genes Chromosomes Cancer 37:165–175.
Curry BJ, Smith MJ, Hersey P. 1996. Detection and quantitation of
melanoma cells in the circulation of patients. Melanoma Res
6:45–54.
Demunter A, Libbrecht L, Degreef H, de Wolf-Peeters C, van den
Oord JJ. 2002. Loss of membranous expression of beta-catenin is
associated with tumor progression in cutaneous melanoma and
rarely caused by exon 3 mutations. Mod Pathol 15:454–461.
Fukushima H, Yamamoto H, Itoh F, Horiuchi S, Min Y, Iku S, Imai
K. 2001. Frequent alterations of the beta-catenin and TCF-4
genes, but not of the APC gene, in colon cancers with high-frequency microsatellite instability. J Exp Clin Cancer Res 20:553–
559.
Giambernardi TA, Rodeck U, Klebe RJ. 1998. Bovine serum albumin reverses inhibition of RT-PCR by melanin. Biotechniques
25:564–566.
Giles RH, van Es JH, Clevers H. 2003. Caught up in a Wnt storm:
Wnt signaling in cancer. Biochim Biophys Acta 1653:1–24.
Gregorieff A, Clevers H. 2005. Wnt signaling in the intestinal epithelium: From endoderm to cancer. Genes Dev 19:877–890.
Haass NK, Smalley KS, Li L, Herlyn M. 2005. Adhesion, migration
and communication in melanocytes and melanoma. Pigment Cell
Res 18:150–159.
Herlyn M, Berking C, Li G, Satyamoorthy K. 2000. Lessons from
melanocyte development for understanding the biological events
in naevus and melanoma formation. Melanoma Res 10:303–312.
Jiricny J. 2006. The multifaceted mismatch-repair system. Nat Rev
Mol Cell Biol 7:335–46.
Johnson V, Volikos E, Halford SE, Eftekhar Sadat ET, Popat S,
Talbot I, Truninger K, Martin J, Jass J, Houlston R, Atkin W,
Tomlinson IP, Silver AR. 2005. Exon 3 beta-catenin mutations are
specifically associated with colorectal carcinomas in hereditary
non-polyposis colorectal cancer syndrome. Gut 54:264–267.
Kageshita T, Hamby CV, Ishihara T, Matsumoto K, Saida T, Ono T.
2001. Loss of beta-catenin expression associated with disease progression in malignant melanoma. Br J Dermatol 145:210–216.
Kane MF, Loda M, Gaida GM, Lipman J, Mishra R, Goldman H,
Jessup JM, Kolodner R. 1997. Methylation of the hMLH1 promoter correlates with lack of expression of hMLH1 in sporadic
colon tumors and mismatch repair-defective human tumor cell
lines. Cancer Res 57:808–811.
Kielhorn E, Provost E, Olsen D, D’Aquila TG, Smith BL, Camp
RL, Rimm DL. 2003. Tissue microarray-based analysis shows
phospho-beta-catenin expression in malignant melanoma is associated with poor outcome. Int J Cancer 103:652–656.
Kitaeva MN, Grogan L, Williams JP, Dimond E, Nakahara K, Hausner P, DeNobile JW, Soballe PW, Kirsch IR. 1997. Mutations in
beta-catenin are uncommon in colorectal cancer occurring in occasional replication error-positive tumors. Cancer Res 57:4478–4481.
Lammi L, Arte S, Somer M, Jarvinen H, Lahermo P, Thesleff I, Pirinen S, Nieminen P. 2004. Mutations in AXIN2 cause familial
tooth agenesis and predispose to colorectal cancer. Am J Hum
Genet 74:1043–1050.
623
Larue L, Delmas V. 2006. The Wnt/Beta-catenin pathway in melanoma. Front Biosci 11:733–742.
Lawes DA, SenGupta S, Boulos PB. 2003. The clinical importance
and prognostic implications of microsatellite instability in sporadic cancer. Eur J Surg Oncol 29:201–212.
Levati L, Marra G, Lettieri T, D’Atri S, Vernole P, Tentori L, Lacal
PM, Pagani E, Bonmassar E, Jiricny J, Graziani G. 1998. Mutation
of the mismatch repair gene hMSH2 and hMSH6 in a human Tcell leukemia line tolerant to methylating agents. Genes Chromosomes Cancer 23:159–166.
Liu W, Dong X, Mai M, Seelan RS, Taniguchi K, Krishnadath KK,
Halling KC, Cunningham JM, Boardman LA, Qian C, Christensen E, Schmidt SS, Roche PC, Smith DI, Thibodeau SN. 2000.
Mutations in AXIN2 cause colorectal cancer with defective mismatch repair by activating beta-catenin/TCF signalling. Nat
Genet 26:146–147.
Lustig B, Jerchow B, Sachs M, Weiler S, Pietsch T, Karsten U, van
de Wetering M, Clevers H, Schlag PM, Birchmeier W, Behrens J.
2002. Negative feedback loop of Wnt signaling through upregulation of conductin/axin2 in colorectal and liver tumors. Mol Cell
Biol 22:1184–1193.
Maelandsmo GM, Holm R, Nesland JM, Fodstad O, Florenes VA.
2003. Reduced beta-catenin expression in the cytoplasm of
advanced-stage superficial spreading malignant melanoma. Clin
Cancer Res 9:3383–3388.
Mirabelli-Primdahl L, Gryfe R, Kim H, Millar A, Luceri C, Dale D,
Holowaty E, Bapat B, Gallinger S, Redston M. 1999. Beta-catenin
mutations are specific for colorectal carcinomas with microsatellite
instability but occur in endometrial carcinomas irrespective of
mutator pathway. Cancer Res 59:3346–3351.
Miyaki M, Iijima T, Kimura J, Yasuno M, Mori T, Hayashi Y, Koike
M, Shitara N, Iwama T, Kuroki T. 1999. Frequent mutation of
beta-catenin and APC genes in primary colorectal tumors from
patients with hereditary nonpolyposis colorectal cancer. Cancer
Res 59:4506–4509.
Moreno-Bueno G, Hardisson D, Sanchez C, Sarrio D, Cassia R,
Garcia-Rostan G, Prat J, Guo M, Herman JG, Matias-Guiu X,
Esteller M, Palacios J. 2002. Abnormalities of the APC/beta-catenin pathway in endometrial cancer. Oncogene 21:7981–7990.
Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B,
Kinzler KW. 1997. Activation of beta-catenin-Tcf signaling in
colon cancer by mutations in beta-catenin or APC. Science
275:1787–1790.
Omholt K, Platz A, Ringborg U, Hansson J. 2001. Cytoplasmic and
nuclear accumulation of beta-catenin is rarely caused by
CTNNB1 exon 3 mutations in cutaneous malignant melanoma.
Int J Cancer 92:839–842.
Palacios J, Gamallo C. 1998. Mutations in the beta-catenin gene
(CTNNB1) in endometrioid ovarian carcinomas. Cancer Res
58:1344–1347.
Papadopoulos N, Nicolaides NC, Wei YF, Ruben SM, Carter KC,
Rosen CA, Haseltine WA, Fleischmann RD, Fraser CM, Adams
MD, Venter JC, Hamilton SR, Petersen GM, Watson P, Lynch
HT, Peltomäki P, Mecklin J-P, de la Chapelle A, Kinzler KW,
Vogelstein B. 1994. Mutation of a mutL homolog in hereditary colon cancer. Science 263:1625–1629.
Pepponi R, Marra G, Fuggetta MP, Falcinelli S, Pagani E, Bonmassar E, Jiricny J, D’Atri S. 2003. The effect of O6-alkylguanineDNA alkyltransferase and mismatch repair activities on the sensitivity of human melanoma cells to temozolomide, 1,3-bis(2-Chloroethyl)1-nitrosourea, and cisplatin. J Pharmacol Exp Ther
304:661–668.
Polakis P. 2007. The many ways of Wnt in cancer. Curr Opin Genet
Dev 17:45–51.
Pollock PM, Hayward N. 2002. Mutations in exon 3 of the betacatenin gene are rare in melanoma cell lines. Melanoma Res 12:
183–186.
Reifenberger J, Knobbe CB, Wolter M, Blaschke B, Schulte KW,
Pietsch T, Ruzicka T, Reifenberger G. 2002. Molecular genetic
analysis of malignant melanomas for aberrations of the Wnt signaling pathway genes CTNNB1, APC, ICAT and BTRC. Int J
Cancer 100:549–556.
Rimm DL, Caca K, Hu G, Harrison FB, Fearon ER. 1999. Frequent
nuclear/cytoplasmic localization of beta-catenin without exon 3
mutations in malignant melanoma. Am J Pathol 154:325–329.
Rowan AJ, Lamlum H, Ilyas M, Wheeler J, Straub J, Papadopoulou
A, Bicknell D, Bodmer WF, Tomlinson IP. 2000. APC mutations
in sporadic colorectal tumors: A mutational ‘‘hotspot’’ and interdependence of the ‘‘two hits’’. Proc Natl Acad Sci USA 97:3352–
3357.
Genes, Chromosomes & Cancer DOI 10.1002/gcc
624
CASTIGLIA ET AL.
Rubinfeld B, Robbins P, el-Gamil M, Albert I, Porfiri E, Polakis P.
1997. Stabilization of beta-catenin by genetic defects in melanoma cell lines. Science 275:1790–1792.
Ruckert S, Hiendlmeyer E, Brueckl WM, Oswald U, Beyser K, Dietmaier W, Haynl A, Koch C, Ruschoff J, Brabletz T, Kirchner T,
Jung A. 2002. T-cell factor-4 frameshift mutations occur frequently in human microsatellite instability-high colorectal carcinomas but do not contribute to carcinogenesis. Cancer Res
62:3009–3013.
Segditsas S, Tomlinson I. 2006. Colorectal cancer and genetic alterations in the Wnt pathway. Oncogene 25:7531–7537.
Shimizu Y, Ikeda S, Fujimori M, Kodama S, Nakahara M, Okajima
M, Asahara T. 2002. Frequent alterations in the Wnt signaling
pathway in colorectal cancer with microsatellite instability. Genes
Chromosomes Cancer 33:73–81.
Shitoh K, Furukawa T, Kojima M, Konishi F, Miyaki M, Tsukamoto
T, Nagai H. 2001. Frequent activation of the beta-catenin-Tcf signaling pathway in nonfamilial colorectal carcinomas with microsatellite instability. Genes Chromosomes Cancer 30:32–37.
Silye R, Karayiannakis AJ, Syrigos KN, Poole S, van Noorden S,
Batchelor W, Regele H, Sega W, Boesmueller H, Krausz T, Pignatelli M. 1998. E-cadherin/catenin complex in benign and malignant melanocytic lesions. J Pathol 186:350–355.
Suraweera N, Robinson J, Volikos E, Guenther T, Talbot I, Tomlinson I, Silver A. 2006. Mutations within Wnt pathway genes in sporadic colorectal cancers and cell lines. Int J Cancer 119:1837–
1842.
Taniguchi K, Roberts LR, Aderca IN, Dong X, Qian C, Murphy
LM, Nagorney DM, Burgart LJ, Roche PC, Smith DI, Ross JA,
Liu W. 2002. Mutational spectrum of beta-catenin, AXIN1, and
Genes, Chromosomes & Cancer DOI 10.1002/gcc
AXIN2 in hepatocellular carcinomas and hepatoblastomas. Oncogene 21:4863–4871.
Thorstensen L, Lind GE, Lovig T, Diep CB, Meling GI, Rognum
TO, Lothe RA. 2005. Genetic and epigenetic changes of components affecting the Wnt pathway in colorectal carcinomas stratified by microsatellite instability. Neoplasia 7:99–108.
Umar A, Boyer JC, Thomas DC, Nguyen DC, Risinger JI, Boyd J,
Ionov Y, Perucho M, Kunkel TA. 1994. Defective mismatch
repair in extracts of colorectal and endometrial cancer cell lines
exhibiting microsatellite instability. J Biol Chem 269:14367–
14370.
Weeraratna AT. 2005. A Wnt-er wonderland–the complexity of Wnt
signaling in melanoma. Cancer Metastisis Rev 24:237–250.
Worm J, Christensen C, Gronbaek K, Tulchinsky E, Guldberg P.
2004. Genetic and epigenetic alterations of the APC gene in malignant melanoma. Oncogene 23:5215–5226.
Wu R, Connolly DC, Ren X, Fearon ER, Cho KR. 1999. Somatic
mutations of the PPP2R1B candidate tumor suppressor gene at
chromosome 11q23 are infrequent in ovarian carcinomas. Neoplasia 1:311–314.
Wu R, Zhai Y, Fearon ER, Cho KR. 2001. Diverse mechanisms of
beta-catenin deregulation in ovarian endometrioid adenocarcinomas. Cancer Res 61:8247–8255.
Yan D, Wiesmann M, Rohan M, Chan V, Jefferson AB, Guo L, Sakamoto D, Caothien RH, Fuller JH, Reinhard C, Garcia PD, Randazzo FM, Escobedo J, Fantl WJ, Williams LT. 2001. Elevated
expression of axin2 and hnkd mRNA provides evidence that Wnt/
beta -catenin signaling is activated in human colon tumors. Proc
Natl Acad Sci USA 98:14973–14978.