1. How many milliliters of 2.00 M copper(II) sulfate solution must be added to 165 mL of water to
achieve a 0.300 M copper(II) sulfate solution?
2. Calculate the volume of solution prepared by diluting 6.929 mL of 3.555 M solution to 0.8229 M.
3. Calculate the concentration of formaldehyde (CH2O) in a solution prepared by mixing 125 mL of 6.13
M CH2O and 175 mL of 4.34 M CH2O and diluting the mixture to 500.0 mL.
4. Calculate the following quantity: volume of 2.48 M calcium chloride that must be diluted with water
to prepare 356.0 mL of a 0.0586M chloride ion solution. (give answer in mL)
5. Concentrated sulfuric acid is 98.0% H2SO4 by mass and has a density of 1.84 g/mL (MW 98g/mole).
Determine the volume of acid required to make 1.00 L of 0.100 M H2SO4 solution.
6. What is the [NO3¯] in 200 mL of 0.350 M Al(NO3)3?
7. What is the [NO3¯] in the above solution after adding 200.0 mL of 0.150 M Ca(NO3)2
8. You have the following stock solutions 1M Tris, 2M NaCl, 3.2M boric acid, and water. You
wish to prepare a solution with the following final concentrations: 0.25M Tris, 0.25M NaCl,
and 2.0M boric acid.
a) What volume of each ingredient would you need to add to 160 mL of 1M Tris to
obtain the desired concentrations?
b) What would be the final volume of the solution?
9. A linear fragment of DNA (7.5 kb) is cleaved with the individual restriction enzymes
HindIII and SmaI and then with a combination of the two enzymes. The fragments obtained
are:
HindIII :
2.5 kb, 5 kb
Sma1:
2.0 kb, 5.5 kbs
HindIII and SmaI:2.5 kb, 3.0 kb, 2.0 kb.
a. Draw the restriction map.
b. The mixture of fragments produced by the combined enzymes is cleaved with the enzyme
EcoRI, resulting in the loss of the 3-kb fragment (band stained with ethidium bromide on an
agarose gel) and the appearance of a band stained with ethidium bromide representing a 1.5-kb
fragment. Mark the EcoRI cleavage site on the restriction map.
10. Construct a restriction map of a linear fragment of DNA, using the following data. Your
map should indicate the relative positions of the restriction sites along with distances from
the ends of the molecule to the restriction sites and between restriction sites:
DNA
1. uncut DNA
2. DNA cut with EcoRI
3. DNA cut with HindIII
4. DNA cut with BamHI
5. DNA cut with EcoRI + HindIII
6. DNA cut with EcoRI + BamHI
7. DNA cut with HindIII + BamHI
1
2
3
4
Sizes of Fragments (bp)
5
6
7
1000 bp
900
800
700
600
500
400
300
200
100
11. Construct a restriction map of a circular DNA plasmid, using the following data. Your map
should indicate the relative positions of the restriction sites along with distances between
restriction sites:
DNA
uncut DNA
DNA cut with BglII
DNA cut with EcoRI
DNA cut with HpaI
DNA cut with BglII + EcoRI
DNA cut with BglII + HpaI
DNA cut with EcoRI + HpaI
Sizes of Fragments
(bp)
7950
7950
7950
7950
5416, 2534
6632, 1318
4098, 3852
12. You are studying DNA synthesis using a biochemical assay. Your assay system contains everything
DNA polymerase needs to synthesize DNA. The double-stranded DNA molecule used for your assay
has the following sequence:
5’ AAATTGGGCCATCATTTCGAGTATTCGACTCCCTAGATCC... 3’
You denature the above molecule and cool it down in the presence of the primer
5’TTTGGGAGTCGAAT 3’. Write the complete sequence of the new single strand of DNA that will be
synthesized in the above reaction. Be sure to label the 5’ and 3’ ends of this sequence.
13. Design PCR primers that would allow the directional cloning and expression of the yeast gene
CDC26 in the pUC19 vector. Your answer must include the following information:



Primer sequences written 5’ to 3’
Restriction sites which would be used for primers and vector.
A short explanation of your choice of restriction sites.
CDC26 gene
ATGATCAGAAGGGCCCCTACCACCTTGCAGCTCAGTCACGACGACGTAACCTCTCTGATCGATGACCTGAACGAGC
AGAAACTCAAGCAGCAGCTGAATATCGAGAAGACAAAATACTTCCAAGGAAAAAATGGCGGATCGCTGCACTCCA
ATACAGACTTTCAGGACACATCGCAGAATATCGAAGACAACAATAACGATAACGATAACGATATCGATGAAGATG
ACGACATGTCATCTTACAACGACAAAGCAGCCTCGGTAGCGCACACCAGAGTCCTCAATTCCTTGCATCTGTCCACC
GACAGCAATACCGCCCACGAGACGTCCAATGCAAACGACAACCACAACCCCTTCTACATCCGCGAGGAATAA
14. You wish to amplify a 22,345 base pair region of mouse DNA using the polymerase chain reaction.
You design a pair of primers that are 20 and 22 bases in length (respectively) and have identical
melting temperatures. However, when you run your reaction it fails. What is the most likely
reason?
15. A PCR primer is 18 bases in length. Approximately how many times will it bind to the human
genome (Size of human genome: 3.3 X 109 bp)?
16. What is the purpose of the antibiotic resistance gene in pUC18?
17. Why is it important that restriction sites within the MCS are unique (found only once in the
plasmid)?
18. If you want to express a protein from a cloned gene, why is it advantageous to use two different
restriction enzymes, rather than a single restriction enzyme, in the cloning procedure to insert your
gene into the MCS?