Heart Differences in Cell-Type–Specific Responses to Angiotensin II Explain Cardiac Remodeling Differences in C57BL/6 Mouse Substrains Sophie Cardin, Marie-Pier Scott-Boyer, Samantha Praktiknjo, Saloua Jeidane, Sylvie Picard, Timothy L. Reudelhuber, Christian F. Deschepper Downloaded from http://hyper.ahajournals.org/ by guest on June 15, 2017 Abstract—Despite indications that hearts from the C57BL/6N and C57BL/6J mouse substrains differ in terms of their contractility and their responses to stress-induced overload, no information is available about the underlying molecular and cellular mechanisms. We tested whether subacute (48 hours) and chronic (14 days) administration of angiotensin II (500 ng/kg per day) had different effects on the left ventricles of male C57BL/6J and C57BL/6N mice. Despite higher blood pressure in C57BL/6J mice, chronic angiotensin II induced fibrosis and increased the left ventricular weight/body weight ratio and cardiac expression of markers of left ventricular hypertrophy to a greater extent in C57BL/6N mice. Subacute angiotensin II affected a greater number of cardiac genes in C57BL/6N than in C57BL/6J mice. Some of the most prominent differences were observed for markers of (1) macrophage activation and M2 polarization, including 2 genes (osteopontin and galectin-3) whose inactivation was reported as sufficient to prevent angiotensin II–induced myocardial fibrosis; and (2) fibroblast activation. These differences were confirmed in macrophage- and fibroblast-enriched populations of cells isolated from the hearts of experimental mice. When testing F2 animals, the amount of connective tissue present after chronic angiotensin II administration did not cosegregate with the inactivation mutation of the nicotinamide nucleotide transhydrogenase gene from C57BL/6J mice, thus discounting its possible contribution to differences in cardiac remodeling. However, expression levels of osteopontin and galectin-3 were cosegregated in hearts from angiotensin II–treated F2 animals and may represent endophenotypes that could facilitate the identification of genetic regulators of the cardiac fibrogenic response to angiotensin II. (Hypertension. 2014;64:1040-1046.) Online Data Supplement • Key Words: angiotensin II ■ endomyocardial fibrosis ■ macrophages ■ polymorphisms, genetic ■ ventricular remodeling T he highly used C57BL/6 mouse inbred strain is the preferred choice for mouse transgenic and knockout studies1 and was the first strain whose genome was fully sequenced.2 However, several C57BL6 substrains have emerged over the years, each showing genomic differences because of genetic drift and displaying various phenotypic differences.1,3 One example is the difference between the C57BL/6J and C57BL/6N substrains. The C57BL/6 strain was initially developed at The Jackson Laboratory, and mice from that colony are identified as C57BL/6J. In 1951, some mice were separated from the original colony to initiate a new colony at the National Institutes of Health, the latter being identified as C57BL/6N.1 Despite the recognition that genetic drift between mouse strains may compromise the reproducibility of experimental data over time and place,4 there are still many publications where the substrain of origin of C57BL/6 mice is not mentioned. However, a recent study reported that the cardiac output of C57BL/6N male mice is higher than that of their C57BL/6J counterparts.5 Likewise, the effects of transverse aortic constriction on survival and the remodeling of left ventricles (LV) are much greater in C57BL/6N than in C57BL/6J mice.6 Thus, evidence indicates that genetic drift can significantly alter cardiac phenotypes in the established C57BL/6 inbred strain. Despite indications that hearts from the C57BL/6N and C57BL/6J mouse substrains differ in terms of their contractility, as well as their responses to stress-induced overload (including survival rate, maintenance of cardiac function, and development of hypertrophy), no information is available about the underlying molecular and cellular mechanisms. We compared the effects of either subacute (48 hours) and chronic (14 days) infusions of angiotensin II (Ang II) on LV remodeling in both substrains. As we observed substrainspecific differences in expression for some genes known to be specific for particular cell-types, we further confirmed Received June 12, 2014; first decision June 26, 2014; revision accepted July 8, 2014. From the Institut de Recherches Cliniques de Montréal (IRCM), Montréal, Québec, Canada; and Department of Medicine, Université de Montréal, Montréal, Québec, Canada. The online-only Data Supplement is available with this article at http://hyper.ahajournals.org/lookup/suppl/doi:10.1161/HYPERTENSIONAHA. 114.04067/-/DC1. Correspondence to Christian F. Deschepper, IRCM, 110 Ave des Pins Ouest, Montréal, Québec, Canada H2W 1R7. E-mail [email protected] © 2014 American Heart Association, Inc. Hypertension is available at http://hyper.ahajournals.org DOI: 10.1161/HYPERTENSIONAHA.114.04067 1040 Cardin et al Cardiac Remodeling in C57BL/6 Substrains 1041 our observations by measuring gene expression in cytofluorometry-sorted cell-specific populations. Finally, expression of some differentially expressed genes was further tested in hearts from Ang II–treated individuals from a hybrid F2 C57BL/6J/C57BL/6N population, to test whether they cosegregated in that genetic cross. Material and Methods Animals Experiments were conducted following approval by the animal ethic committee of the Institut de Recherches Cliniques de Montréal (IRCM) and in agreement with the guidelines of the Canadian Council for Animal Care. C57BL6/J and C57BL6/N mice were purchased from The Jackson Laboratory (Bar Harbor, MN) and Harlan (Indianapolis, IN), respectively, and housed in the animal care facility of IRCM. Physiological and genetic procedures are as described in Methods in the online-only Data Supplement. Downloaded from http://hyper.ahajournals.org/ by guest on June 15, 2017 Isolation and Characterization of Enriched Cell Populations Enzymatic digestion and cell enrichment procedures are as described in Methods in the online-only Data Supplement. Statistical Analyses Data were presented as mean±SEM. To test whether substrain origin interacted with the effects of treatments in C57BL6/J and C57BL6/N mice, data were analyzed by 2-way ANOVA, followed by Sidak post hoc analysis for multiple comparisons. Comparisons of the effects of treatments in multiple strains were performed by 1-way ANOVA, followed by Sidak post hoc analysis for multiple comparisons. Results Genotyping with 89 polymorphic markers confirmed the purity of each strain (Table S1 in the online-only Data Supplement). Several end points of remodeling of LV were examined in C57BL/6J and C57BL/6N male mice 14 days after implantation of minipumps delivering either Ang II (500ng/kg per day) or vehicle. Chronic Ang II increased the abundance of both histologically stained connective tissue and Col1a1 mRNA to a greater extent in C57BL/6N male mice than in their C57BL/6J counterparts (Figure 1). Likewise, chronic Ang II increased the LV weight/body weight ratio to a greater extent in C57BL/6N than in C57BL/6J mice, and the LV abundance of Nppa and Myh7 mRNA was increased only in C57BL/6N mice (Figure 1). In contrast, mean arterial pressure was in average 15 mm Hg lower in that strain than in C57BL/6J mice, with Ang II increasing blood pressure to the same extent in both strains and at all times during administration (from 16% to 35% for daytime values and from 6% to 28% for night-time values; Figure S1). Diastolic and systolic pressure showed strain- and time-dependent differences of similar magnitude (results not shown). Changes in cardiac gene expression have been reported to occur as early as 24 hours after the onset of Ang II administration.7,8 Because differences in early rapid responses may be ultimately responsible for downstream differences in the chronic effects of Ang II, we compared the profiles of gene expression in hearts of C57BL/6N and C57BL/6J mice harvested 48 hours after implantation of minipumps. A total of 2323 genes showed significant responses to subacute Ang II in the C57BL/6N substrain, in contrast to only 127 genes in C57BL/6J mice. When testing the 2-way interaction between treatment and strain, we found that substrain interacted significantly with the effect of Ang II for 372 genes. Among the latter, 344 and 19 genes showed responses that were exclusive to either C57BL/6N or C57BL/6J mice, respectively, whereas another 28 genes showed responses that were significantly different because of either differences in the Figure 1. Effects of chronic 14-day treatments with angiotensin II (Ang II) on either connective tissue content (as quantified after Masson Trichrome staining), left ventricle (LV)/body weight (BW) ratios, and LV mRNA abundance of Col1a1, Nppa, and Myh7 (by reverse transcriptase-quantitative polymerase chain reaction). For each gene, values for LV mRNA abundance corresponded to 2(−ΔΔCt) values, representing relative expression vs that of the Rps16 normalizing gene. A, Representative images of histological sections. B–F, For each graph, the results of the 2-way ANOVA analysis for either treatment, strain, or the strain×treatment interaction are as indicated. The bars represent mean±SEM. For LV/BW values, n=10; for other variables, n=4 to 5. *P<0.05, **P<0.01 ***P<0.001, ****P<0.0001, by post hoc Sidak comparisons. 1042 Hypertension November 2014 Downloaded from http://hyper.ahajournals.org/ by guest on June 15, 2017 amplitude or in the direction of the effect. Among these 372 genes, we further examined the 200 ones showing the greatest absolute changes in C57BL/6N mice (Table S4). Functional Annotation Clustering analysis of these genes revealed that the categories with the highest enrichment scores corresponded to (1) blood vessel development; (2) extracellular region; (3) lysosome; and (4) immune responses (Table S5). Among the top 40 of these 200 genes (as ranked on the basis of their responses in C57BL/6N), enrichments were observed mostly for the blood vessel and extracellular region functional clusters (Table S6). Moreover, several of the genes on the top of that list are well known to be associated with specific biological processes: Tissue-inhibitor of metalloprotease-1 (Timp1), Tenascin (Tnc), and Lysyl-oxidase (Lox) are important regulators of fibrosis9–11; osteopontin (Spp1) is a marker of the activation of monocytes into macrophages12; and arginase-1 (Arg1) and galectin-3 (Lgals3) are prototypical markers of macrophage M2 polarization.13,14 In contrast to these differentially expressed fibrosis- and macrophageassociated genes, subacute Ang II induced the expression of Myh7 and Col1a1 (all well-known markers of hypertrophic cardiac remodeling) to the same extent in both strains. For some of the above genes, the strain-specific effects of Ang II (500 ng/kg per day) were confirmed by reverse transcriptasequantitative polymerase chain reaction (Figure 2). Additional experiments showed that Ang II increased the expression of Nppa, Lgals3, and Spp1 in a dose–response fashion (from 500 to 1500 ng/kg per day) in C57BL/6J, whereas maximal responses were already observed with the lowest dose of Ang II in C57BL/6N mice (Figure S2). The differences in sensitivity to Ang II did not seem to result from differences in basic components of the Ang II signaling pathway, as we detected no difference in the expression of the genes coding for either angiotensin type 1-receptor or Galpha-q/11 (the latter representing the major G-protein–coupled transducing the signals for angiotensin type 1 receptor–mediated gene regulation; Figure S3).15 In regards to the macrophage-specific genes, differences in their expression level in LV tissue may result from either an increase in the number of these cells or from qualitative changes in their gene expression profiles. By enzymatically digesting LVs and counting cells by flow cytofluorometry, we found that subacute Ang II increased the number of double-positive CD11b–F4/80 cells in LVs from C57BL/6J and C57BL/6N to the same extent in both substrains (Figure S4). To delineate the cellular targets of the Ang II–induced gene response further, we digested LVs from C57BL/6J mice to prepare 4 different populations of cells enriched for specific cardiac cell types. The efficiency of the cell fractionations was verified by reverse transcriptase-polymerase chain reaction for specific cell markers (Table S7). Additional reverse transcriptase-polymerase chain reaction allowed us to confirm further that Spp1, Arg1, and Lgals3 were much more abundantly expressed in CD11b(+) cells than in any other cell population, whereas Timp1, Tnc, and Lox were mostly restricted to fibroblasts (Table S8). We further used our sorted cell populations to test whether the expression of genes within sorted macrophages and fibroblasts themselves was affected by Ang II in a strain-specific manner. We found that subacute Ang II increased the expression of a marker of macrophage activation (Spp1) and 2 markers of M2 polarization (Arg1 and Lgals3) to a much greater extent in myocardial macrophages from C57BL/6N than in C57BL/6J (Figure 3). Likewise, Ang II induced a decrease in the expression of Nos2 in these cells although the effect was of similar magnitude in both strains. Strain-specific effects were observed in fibroblasts as well, as Ang II affected the expression of Timp1, Tnc, and Col1a1 to a greater extent in myocardial fibroblasts from C57BL/6N than in C57BL/6J (Figure 3). One known major difference between the 2 substrains concerns the inactivation mutation of the Nnt gene in the C57BL/6J strain.1 To test the possible contribution of the Nnt mutation to our observed substrain-specific differences, we produced an F2 progeny from a cross between the parental C57BL/6N and Figure 2. Effects of 2-day treatments with angiotensin II (Ang II) on left ventricular (LV) mRNA abundance of 6 genes. For each graph, the results of the 2-way ANOVA analysis for either treatment, strain, or the strain×treatment interaction are as indicated. The bars represent mean±SEM, n = 4. *P<0.05, **P<0.01 ***P<0.001, by post hoc Sidak comparisons. Cardin et al Cardiac Remodeling in C57BL/6 Substrains 1043 Downloaded from http://hyper.ahajournals.org/ by guest on June 15, 2017 Figure 3. A–D, Abundance of mRNA of Spp1, Lgals3, Arg1, and Nos2 in a macrophage-enriched cell population isolated from left ventricles (LVs) of C57BL/6J and C57BL/6N mice receiving either sham or angiotensin II (Ang II) treatment for 48 hours. E–H, Abundance of mRNA of Spp1, Timp1, Tnc, and Col1a1 in a fibroblast-enriched cell population isolated from LVs of C57BL/6J and C57BL/6N mice receiving either sham or Ang II treatment for 48 hours. For all graphs, results of the 2-way ANOVA analysis for either treatment or strain×treatment interaction are as indicated. The bars represent mean±SEM, n=5. *P<0.05, **P<0.01 ***P<0.001, by post hoc Sidak comparisons. C57BL/6J lines, and tested whether strain-specific differences cosegregated with the Nnt genotypes (either J/J if both alleles originated from C57BL/6J or N/N if both alleles originated from C57BL/6N). The effects of chronic Ang II on induction of Col1a1 expression and myocardial fibrosis in F2 animals were not different from that in C57BL/6J animals, regardless of their genotype at the Nnt locus (Figure S5); likewise, the Nnt genotype had no effect on the abundance of either Spp1 or Lgals3 mRNA after subacute Ang II. Nonetheless, there was a tight and significant correlation in the expression of both genes in hearts from Ang II–treated F2 mice (Figure 4), indicating that post-Ang II expression levels of these 2 genes cosegregated in the F2 progeny. The H2 broad sense heritability index (representing the ratio of genetic:phenotypic variance) for post-Ang II levels of gene expression was calculated to be 0.80 and 0.91 for Spp1 and Lgals3, respectively. We further tested to what extent the response of this gene in C57BL/6N mice differed from that seen in other laboratory mouse strains: subacute Ang II increased the expression of Spp1 to the same extent in LVs from C57BL/6J, A/J, and FVB/N mice, whereas C57BL/6N mice differed from the other 3 strains by a response of much greater amplitude (Figure 4). Discussion We observed that infusions of Ang II at the dose of 500ng/kg per day had both chronic and subacute effects that differed between the C57BL/6J and C57BL/6N mouse substrains. Chronic Ang II increased LV fibrosis and LV expression of Nppa and Myh7 in C57BL/6N but not in C57BL/6J mice. In contrast, mean arterial pressure was consistently higher in C57BL/6J than in C57BL/6N mice (both before and after Ang II administration), in keeping with a recent report where blood pressure was measured in the same 2 substrains using a tail-based technique.16 It is also likely that these substraindependent differences are not limited to the model of Ang II infusion because transverse aortic constriction has recently been reported to induce LV remodeling to a greater extent in C57BL/6N substrains than in their C57BL/6J counterparts.6 Although no strain-dependent differences were observed in the effects of subacute Ang II on LV expression of Myh7 Figure 4. A, Abundance of Spp1 mRNA in left ventricles (LVs) from several inbred mouse strains (C57BL/6J, A/J, FVB/N, and C57BL/6N). All data were obtained by reverse transcriptase-quantitative polymerase chain reaction by calculating −2(ΔΔCT) and normalizing values by that obtained for the S16 housekeeping gene; n=5. B, Linear regression analysis of the relative abundance of Spp1 and Lgals3 mRNA (log2 normalized values) in LVs from 100 F2 mice each receiving subacute Ang II treatment; r2=0.87; P<0.0001. 1044 Hypertension November 2014 Downloaded from http://hyper.ahajournals.org/ by guest on June 15, 2017 and Col1a1, this treatment induced a C57BL/6N-selective increase in the expression of several genes that were expressed preferentially in noncardiomyocytes, the most prominent ones being (1) for macrophages, Lgals3 (which codes for galectin-3, also known as Mac-2); (2) for fibroblasts, Tnc (which codes for tenascin); and (3) for both celltypes, Spp1 (which codes for osteopontin). These differences occurred despite no evidence for differential expression of basic components of the Ang II signaling pathway. The differential effect of Ang II (500 ng/kg per day) on these genes may be sufficient to explain its substrain-specific differences on LV fibrosis, because (1) inactivation of either Spp117,18 or Lgals319 are sufficient to prevent Ang II–induced myocardial fibrosis; and (2) recombinant galectin-3 induces fibroblast proliferation and collagen production in whole hearts when administered in the pericardial sac.20 In fact, the effects of Spp1 might be mediated by Lgals3 because inactivation of just Spp1 leads to dramatic reductions in myocardial expression of Lgals3.21 At the cellular level, activated macrophages produce galectin-3, whereas fibroblasts have galectin3–binding sites.20 Our own data confirmed that among several cardiac cell populations, Lgals3 is expressed at highest levels in CD11b(+) cells (ie, macrophages), and that Ang II induced Lgals3 to a greater extent in CD11b(+) cells from C57BL/6N hearts than in their counterparts from C57BL/6J. This was accompanied by proportional differences in the activation of fibroblasts because Ang II induced Tnc (a marker of fibroblast activation) to a greater extent in fibroblast-enriched cells from C57BL/6N mice. Interestingly, previous studies in another model of Ang II–dependent LV remodeling (the outbred renin-overexpressing Ren-2 rats) have shown that (1) the genetic background is an important determinant of the sensitivity of the LVs to the effects of Ang II; (2) some cardiac genes show differential expression in the hearts of rats progressing to heart failure in comparison with compensated rats; and (3) many of the latter genes (including Spp1 and Lgals3) are in fact the same as the ones responding to a greater extent in the LV remodelingprone C57BL/6N strain (Table S4).22 It has been argued that these background-dependent differences in the progression to heart failure represent differences in the sensitivity of LVs to Ang II. Accordingly, our own dose–response experiments with Ang II showed that the strain-dependent differences observed with the low dose (500 ng/kg per day) are no longer apparent when using higher doses (1500 ng/kg per day). Of note, mice are less sensitive than rats to administered Ang II exogenously.23 Although Ang II is typically administered to rats at doses averaging 100 to 200 ng/kg per day,24 the doses used in mice have generally been much higher (up to 3 μg/ kg per day).17 The dose at which we have observed substraindependent differences was chosen as the lowest one causing reliable increases in blood pressure, to avoid doses whose pathophysiological relevance was unclear. On activation by environmental cues, monocytes and naïve macrophages can differentiate into different types of activated macrophages each having specific properties and functions.25 Within the spectrum of possible forms of macrophage activation, 2 extremes have been defined as either M1 polarized (or classically activated) or M2 polarized (or alternatively activated) macrophages, each expressing specific sets of genes.26 Because Lgals3 expression is considered to be a marker of M2 polarization,14 we further tested the effect of Ang II on the expression of either NOS2 or Arg1 (ie, markers of either M1 or M2 macrophages), respectively.27 Ang II decreased the expression of Nos2 in macrophages from the hearts of both strains, indicating that macrophages departed from the M1 phenotype in both strains. However, polarization into M2 macrophages seemed to be more pronounced in C57BL/6N mice because Ang II induced the expression of Arg1 to a significantly greater extent than in cells from C57BL/6J. Findings from previous studies underscore the critical roles played by macrophages and their precursors in Ang II–induced fibrosis in either hearts8,28 or kidneys.29,30 In our hands, although Ang II increased the number of CD11b(+) cells to the same extent in both C57BL/6J and C57BL/6N hearts, the strains differed in terms of the effects of Ang II on M2 polarization. This indicates that qualitative differences in the characteristics of activated macrophages (rather than quantitative differences in the number of macrophages infiltrating the heart) are responsible from strain-specific differences in LV remodeling. This notion is compatible with the generally held view associating M2 polarized macrophages with tissue remodeling and fibrosis.31–33 Because C57BL/6N mice have gene expression responses that set them apart from either C57BL/6J mice and 2 other inbred mouse strains, it is possible that the divergent response of C57BL/6N mice is a consequence of one of the private mutations that have developed in that strain and is not present in either the C57BL/6J or the other laboratory mouse strains.16 Of note, 1 major difference between the 2 substrains concerns the inactivation mutation of the Nnt gene, which seemed to have occurred in C57BL/6J mice at The Jackson Laboratory after 1971.1 The protein encoded by Nnt is located in the inner mitochondrial membrane, where it plays important roles in mitochondrial peroxide metabolism,34 the latter being potentially involved in LV ventricular remodeling.35 However, the possible contribution of the Nnt mutation was discounted on the basis of the observation that the differences in the effects of chronic Ang II on collagen accumulation and of subacute Ang II on Spp1 and Lgals3 expression did not cosegregate with the mutation at the Nnt locus. However, expression levels of Spp1 and Lgals3 were cosegregated in hearts of Ang II–treated individuals from a F2 hybrid cross. Perspectives C57BL/6J and C57BL/6N mice show marked differences in their responses to the LV remodeling effects of Ang II, probably as the result of natural genetic variants that have accumulated over time between colonies and differentiate both substrains. Of note, naturally occurring allelic variants in inbred strains have a special interest: unlike genetically modified mouse models (which often represent extreme perturbations, such as complete loss of function of a targeted gene), they may mimic more closely the more subtle variations that are thought to be responsible for many human diseases and may be major contributors to phenotypic diversity.36 Despite their high level of genetic relatedness, recent mouse genome resequencing efforts have revealed the existence of several Cardin et al Cardiac Remodeling in C57BL/6 Substrains 1045 single nucleotide polymorphisms between the C57BL/6J and C57BL/6N substrains (http://www.sanger.ac.uk/resources/ mouse/genomes). As recently demonstrated, these single nucleotide polymorphisms are also sufficiently numerous to allow the discovery functional genetic variants in hybrid F2 C57BL/6J/C57BL/6N crosses.37 Our data show that the differential responses of Spp1 and Lgals3 to subacute Ang II might represent endophenotypes that may facilitate the identification of genetic regulators of the cardiac fibrogenic response to infusions of Ang II in such crosses. Of note, fibrogenesis is increasingly becoming recognized as a major cause of morbidity and mortality in many chronic diseases,38,39 but for which no specific therapies are available yet. The discovery of genetic variants regulating this process would, therefore, be of great clinical interest. Acknowledgments Downloaded from http://hyper.ahajournals.org/ by guest on June 15, 2017 We thank Manon Laprise, Éric Massicotte, Julie Lord, and Dominique Lauzier for their expert technical help, and Drs Kumar and Takahashi for their help with the genotyping of our strains. Sources of Funding This work was supported by grant MOP-93583 from the Canadian Institutes for Health Research. S. Cardin was supported, in part, by a post-doctoral fellowship by the Heart and Stroke Foundation of Canada. Disclosures None. References 1. Zurita E, Chagoyen M, Cantero M, Alonso R, González-Neira A, LópezJiménez A, López-Moreno JA, Landel CP, Benítez J, Pazos F, Montoliu L. Genetic polymorphisms among C57BL/6 mouse inbred strains. Transgenic Res. 2011;20:481–489. 2. Mouse Genome Sequencing Consortium, Waterston RH, Lindblad-Toh K, et al. Initial sequencing and comparative analysis of the mouse genome. Nature. 2002;420:520–562. 3. Mekada K, Abe K, Murakami A, Nakamura S, Nakata H, Moriwaki K, Obata Y, Yoshiki A. Genetic differences among C57BL/6 substrains. Exp Anim. 2009;58:141–149. 4.Taft RA, Davisson M, Wiles MV. Know thy mouse. Trends Genet. 2006;22:649–653. 5. Vaillant F, Lauzier B, Poirier I, Gélinas R, Rivard M-E, Frayne IR, Thorin E, Rosiers CD. Mouse strain differences in metabolic fluxes and function of ex vivo working hearts. Am J Physiol Heart Circ Physiol. 2014;306:H78–H87. 6.Garcia-Menendez L, Karamanlidis G, Kolwicz S, Tian R. Substrain specific response to cardiac pressure overload in C57BL/6 mice. Am J Physiol Heart Circ Physiol. 2013;305:H397–H402. 7. Larkin JE, Frank BC, Gaspard RM, Duka I, Gavras H, Quackenbush J. Cardiac transcriptional response to acute and chronic angiotensin II treatments. Physiol Genomics. 2004;18:152–166. 8. Sopel MJ, Rosin NL, Lee TD, Légaré JF. Myocardial fibrosis in response to Angiotensin II is preceded by the recruitment of mesenchymal progenitor cells. Lab Invest. 2011;91:565–578. 9. Lovelock JD, Baker AH, Gao F, Dong JF, Bergeron AL, McPheat W, Sivasubramanian N, Mann DL. Heterogeneous effects of tissue inhibitors of matrix metalloproteinases on cardiac fibroblasts. Am J Physiol Heart Circ Physiol. 2005;288:H461–H468. 10. Carey WA, Taylor GD, Dean WB, Bristow JD. Tenascin-C deficiency attenuates TGF-ß-mediated fibrosis following murine lung injury. Am J Physiol Lung Cell Mol Physiol. 2010;299:L785–L793. 11. Zibadi S, Vazquez R, Moore D, Larson DF, Watson RR. Myocardial lysyl oxidase regulation of cardiac remodeling in a murine model of diet-induced metabolic syndrome. Am J Physiol Heart Circ Physiol. 2009;297:H976–H982. 12.Krause SW, Rehli M, Kreutz M, Schwarzfischer L, Paulauskis JD, Andreesen R. Differential screening identifies genetic markers of monocyte to macrophage maturation. J Leukoc Biol. 1996;60:540–545. 13. Munder M, Eichmann K, Modolell M. Alternative metabolic states in murine macrophages reflected by the nitric oxide synthase/arginase balance: competitive regulation by CD4+ T cells correlates with Th1/Th2 phenotype. J Immunol. 1998;160:5347–5354. 14.Novak R, Dabelic S, Dumic J. Galectin-1 and galectin-3 expression profiles in classically and alternatively activated human macrophages. Biochim Biophys Acta. 2012;1820:1383–1390. 15. Lee MH, El-Shewy HM, Luttrell DK, Luttrell LM. Role of beta-arrestinmediated desensitization and signaling in the control of angiotensin AT1a receptor-stimulated transcription. J Biol Chem. 2008;283:2088–2097. 16. Simon MM, Greenaway S, White JK, et al. A comparative phenotypic and genomic analysis of C57BL/6J and C57BL/6N mouse strains. Genome Biol. 2013;14:R82. 17. Collins AR, Schnee J, Wang W, Kim S, Fishbein MC, Bruemmer D, Law RE, Nicholas S, Ross RS, Hsueh WA. Osteopontin modulates angiotensin II-induced fibrosis in the intact murine heart. J Am Coll Cardiol. 2004;43:1698–1705. 18.Matsui Y, Jia N, Okamoto H, Kon S, Onozuka H, Akino M, Liu L, Morimoto J, Rittling SR, Denhardt D, Kitabatake A, Uede T. Role of osteopontin in cardiac fibrosis and remodeling in angiotensin II-induced cardiac hypertrophy. Hypertension. 2004;43:1195–1201. 19. Yu L, Ruifrok WP, Meissner M, Bos EM, van Goor H, Sanjabi B, van der Harst P, Pitt B, Goldstein IJ, Koerts JA, van Veldhuisen DJ, Bank RA, van Gilst WH, Silljé HH, de Boer RA. Genetic and pharmacological inhibition of galectin-3 prevents cardiac remodeling by interfering with myocardial fibrogenesis. Circ Heart Fail. 2013;6:107–117. 20. Sharma UC, Pokharel S, van Brakel TJ, van Berlo JH, Cleutjens JP, Schroen B, André S, Crijns HJ, Gabius HJ, Maessen J, Pinto YM. Galectin-3 marks activated macrophages in failure-prone hypertrophied hearts and contributes to cardiac dysfunction. Circulation. 2004;110:3121–3128. 21.Psarras S, Mavroidis M, Sanoudou D, Davos CH, Xanthou G, Varela AE, Panoutsakopoulou V, Capetanaki Y. Regulation of adverse remodelling by osteopontin in a genetic heart failure model. Eur Heart J. 2012;33:1954–1963. 22. Schroen B, Heymans S, Sharma U, et al. Thrombospondin-2 is essential for myocardial matrix integrity: increased expression identifies failureprone cardiac hypertrophy. Circ Res. 2004;95:515–522. 23. Cholewa BC, Meister CJ, Mattson DL. Importance of the renin-angiotensin system in the regulation of arterial blood pressure in conscious mice and rats. Acta Physiol Scand. 2005;183:309–320. 24.Polichnowski AJ, Griffin KA, Long J, Williamson GA, Bidani AK. Blood pressure-renal blood flow relationships in conscious angiotensin II- and phenylephrine-infused rats. Am J Physiol Renal Physiol. 2013;305:F1074–F1084. 25. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nat Rev Immunol. 2008;8:958–969. 26.Gordon S. Alternative activation of macrophages. Nat Rev Immunol. 2003;3:23–35. 27. Classen A, Lloberas J, Celada A. Macrophage activation: classical vs. alternative. In: Reiner NE, ed. Macrophages and Dendritic Cells. Totowa, NJ: Humana Press; 2009:29–43. 28. Huang XR, Chung AC, Yang F, Yue W, Deng C, Lau CP, Tse HF, Lan HY. Smad3 mediates cardiac inflammation and fibrosis in angiotensin II-induced hypertensive cardiac remodeling. Hypertension. 2010;55:1165–1171. 29.Lin SL, Castaño AP, Nowlin BT, Lupher ML Jr, Duffield JS. Bone marrow Ly6Chigh monocytes are selectively recruited to injured kidney and differentiate into functionally distinct populations. J Immunol. 2009;183:6733–6743. 30. Braga TT, Correa-Costa M, Guise YF, Castoldi A, de Oliveira CD, Hyane MI, Cenedeze MA, Teixeira SA, Muscara MN, Perez KR, Cuccovia IM, Pacheco-Silva A, Gonçalves GM, Camara NO. MyD88 signaling pathway is involved in renal fibrosis by favoring a TH2 immune response and activating alternative M2 macrophages. Mol Med. 2012;18:1231–1239. 31. Murray PJ, Wynn TA. Protective and pathogenic functions of macrophage subsets. Nat Rev Immunol. 2011;11:723–737. 32. Yang M, Zheng J, Miao Y, Wang Y, Cui W, Guo J, Qiu S, Han Y, Jia L, Li H, Cheng J, Du J. Serum-glucocorticoid regulated kinase 1 regulates alternatively activated macrophage polarization contributing to angiotensin II-induced inflammation and cardiac fibrosis. Arterioscler Thromb Vasc Biol. 2012;32:1675–1686. 33. Li Y, Zhang C, Wu Y, Han Y, Cui W, Jia L, Cai L, Cheng J, Li H, Du J. Interleukin-12p35 deletion promotes CD4 T-cell-dependent macrophage differentiation and enhances angiotensin II-Induced cardiac fibrosis. Arterioscler Thromb Vasc Biol. 2012;32:1662–1674. 1046 Hypertension November 2014 34. Ronchi JA, Figueira TR, Ravagnani FG, Oliveira HC, Vercesi AE, Castilho RF. A spontaneous mutation in the nicotinamide nucleotide transhydrogenase gene of C57BL/6J mice results in mitochondrial redox abnormalities. Free Radic Biol Med. 2013;63:446–456. 35. Tsutsui H, Kinugawa S, Matsushima S. Mitochondrial oxidative stress and dysfunction in myocardial remodelling. Cardiovasc Res. 2009;81:449–456. 36. Svenson KL, Gatti DM, Valdar W, Welsh CE, Cheng R, Chesler EJ, Palmer AA, McMillan L, Churchill GA. High-resolution genetic mapping using the Mouse Diversity outbred population. Genetics. 2012;190:437–447. 37. Kumar V, Kim K, Joseph C, Kourrich S, Yoo SH, Huang HC, Vitaterna MH, de Villena FP, Churchill G, Bonci A, Takahashi JS. C57BL/6N mutation in cytoplasmic FMRP interacting protein 2 regulates cocaine response. Science. 2013;342:1508–1512. 38. Zeisberg M, Kalluri R. Cellular mechanisms of tissue fibrosis. 1. Common and organ-specific mechanisms associated with tissue fibrosis. Am J Physiol Cell Physiol. 2013;304:C216–C225. 39. Wynn TA, Ramalingam TR. Mechanisms of fibrosis: therapeutic translation for fibrotic disease. Nat Med. 2012;18:1028–1040. Novelty and Significance What Is New? • Although C57BL/6 mice represent the most commonly used strain for Downloaded from http://hyper.ahajournals.org/ by guest on June 15, 2017 generation and analysis of transgenic and knockout mice, substrains show marked differences in left ventricular remodeling responses to angiotensin II. • The differential responses of osteopontin and galectin-3 represent endophenotypes that may facilitate the identification of genetic regulators of the cardiac fibrogenic response to infusions of angiotensin II in C57BL/6J/C57BL/6N crosses. What Is Relevant? • Cardiac fibrosis represents an important component of hypertensionrelated end-organ damage. • Fibrogenesis represents a major cause of morbidity and mortality in many chronic diseases, but no specific therapies are currently available to halt or reverse fibrosis. Summary We have identified an animal model and a subphenotype that will facilitate the identification of genetic regulators of the cardiac fibrogenic response. Differences in Cell-Type−Specific Responses to Angiotensin II Explain Cardiac Remodeling Differences in C57BL/6 Mouse Substrains Sophie Cardin, Marie-Pier Scott-Boyer, Samantha Praktiknjo, Saloua Jeidane, Sylvie Picard, Timothy L. Reudelhuber and Christian F. Deschepper Downloaded from http://hyper.ahajournals.org/ by guest on June 15, 2017 Hypertension. 2014;64:1040-1046; originally published online July 28, 2014; doi: 10.1161/HYPERTENSIONAHA.114.04067 Hypertension is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231 Copyright © 2014 American Heart Association, Inc. All rights reserved. Print ISSN: 0194-911X. Online ISSN: 1524-4563 The online version of this article, along with updated information and services, is located on the World Wide Web at: http://hyper.ahajournals.org/content/64/5/1040 Data Supplement (unedited) at: http://hyper.ahajournals.org/content/suppl/2014/07/28/HYPERTENSIONAHA.114.04067.DC1 Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Hypertension can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: http://www.lww.com/reprints Subscriptions: Information about subscribing to Hypertension is online at: http://hyper.ahajournals.org//subscriptions/ SUPPLEMENTARY MATERIAL Differences in cell-type specific responses to angiotensin II explain cardiac remodeling differences in C57BL/6 mouse substrains Sophie Cardin, Marie-Pier Scott-Boyer, Samantha Praktiknjo, Saloua Jeidane, Sylvie Picard, Timothy L. Reudelhuber, and Christian F. Deschepper 1 SUPPLEMENTARY METHODS Animal physiologic and genetic procedures: Mice were held on 12-hours daylight cycle with access to food and water at libitum. Males (10 to 11 week-old) were implanted with subcutaneous microosmotic pumps (Alzet, models 1002 and 1003D). The pumps were filled with either saline or a solution of Ang II (Sigma, A9525) calibrated to deliver 500ng/kg/day. Mice were killed either 48 hours or 14 days after pump implantation and tissues were immediately excised for subsequent analyses. Blood pressure was recorded in two month-old C57Bl/6J and C57Bl/6N mice (n=4) via a pressure-sensing implantable mouse radio-transmitter (TA11PA-C10, Data Science International, Minneapolis, Minnesota, USA), as described previously. Day-time systemic blood pressure (SBP) was calculated as the averaged of SBP recordings between 10AM and 4PM, while night-time SBP was the averaged of SBP recordings between 10PM and 4AM. In a subset of 14-days treated mice (n=10), left ventricular weight (LVW) was measured after removal of large vessels and atria, and corrected by whole body weight (BW). For calculation of connective tissue content in interstitial area, transverse sections (5μm) of the ventricles were stained with Masson’s Trichrome reagent, and area covered by connective tissue in each section was estimated using the Northern Eclipse software (Empix Imaging; Ontario, Canada). For genotyping, genomic DNA was extracted from the spleens of 2 individuals from the C57Bl/6J and C57Bl/6N strains, as well as from 2 individuals from F1 intercrosses between both strains. DNA samples were sent to Drs Vivek Kumar and Joseph S. Takahashi (University of Texas Southwestern Medical Center, Dallas (TX), USA). Using Taqman probes designed by ABI and tested on the Fluidigm platform, they tested a total of 89 SNPs confirmed to be polymorphic between C57BL/6J (stock number 000664, obtained from Jackson Laboratory, Bar Harbor, ME) and C57BL/6N mice (obtained from NCI-Frederick, Stock 01C55), as described previously.1 For generation of F2 progenies, the parental inbred C57Bl/6J and C57Bl/6N strains were first crossed to generate F1 hybrids, and the latter were further crossed to generate F2 animals. Mice were genotyped at the nicotinamide nucleotide transhydrogenase (Nnt) locus by PCR amplification of genomic DNA, using two sets of primers as previously described (Table S2).2. For the Ang II-induced levels of expression of the Spp1 and Lgals3 genes, we calculated the H2 “broad sense heritability” as the ratio of genetic to phenotypic variance (i.e. Vg/Vp). The calculations were based on the following definitions: 1) the value of Vp corresponded to the variance to the phenotypes (i.e. the expression levels of each gene) in the F2 population; 2) the environmental variance (VE) was defined as the sum of the variance of the phenotypes in each parental strain, divided by 2; 3) the value of Vg was defined as Vg = Vp - VE . RNA analyses: Total RNA was extracted from samples using RNeasy Micro kits (Qiagen, Canada, Mississauga, ON). RNA concentration and quality were estimated by optical density using a Nanodrop instrument (Thermo Scientific). For extracts from isolated cardiac cells, RNA concentration was estimated using the RNA 6000 Pico Kit (Agilent Technologies, Germany). Only high quality 2 samples with an RNA integrity number ≥8 were selected for further experiments. For gene expression profiling, total RNA was extracted from the LVs of four animals per group (C57Bl/6J and C57Bl/6N, 48 hours after pumps delivering either Ang II or vehicle), and used for hybridization to Illumina MouseRef-8 v2.0 Beadchips (which cover 19,728 well-annotated Refseq sequences) as we described previously.3 Raw and normalized data have been deposited into the Gene Expression Omnibus (GEO) public depository (submission GSE53269), in accordance with MIAME standards. The significance of effects from strain, treatment and their interaction was tested by appropriate contrasts in an F-test between groups in a factorial ANOVA design. P-values were calculated by performing 1000 permutation of samples to break their association to expression values, then corrected for multiple comparisons by adaptive false discovery rate (FDR) transformation.4 We used an FDR cutoff of 5% for simple comparisons (between treated and sham animals), and the more liberal FDR cutoff of 10% for two-way comparison of the interactions between treatment and strains. All computations were done with the R/Maanova package v.1.16.0.5 For Real-Time quantitative PCR (RT-qPCR), samples containing 250-500ng of total RNA were reverse-transcribed (RT) using 200U of Superscript II reverse transcriptase (InVitrogen), as per the manufacturer’s protocol. For samples containing smaller amounts of RNA, cDNA was generated from 10 ng of total RNA using the QuanTitect® reverse transcription kit (Qiagen). RT-qPCR was performed with Quantifast SYBR green (Qiagen) in 96-well plates, using a MX3000P QPCR system (Stratagene) for amplification and signal reading. Primer sequences are provided in Table 1. Values of relative expression vs. that of a normalizing housekeeping gene (Rps16) were performed as described previously.6 In short, after determining in each sample the cycle threshold (Ct) for the gene of interest and that of Rps16, we calculated ΔCt values (Ct gene – Ct Rps16), and expressed values as 2(ΔCt) . Outline of end-points: summarized in Table S3. The outline of experimental animals used for the above experiments is Digestion of hearts for isolation of non-cardiomyocytes: After sequential perfusion of hearts with physiological solutions, the hearts were digested by perfusion for 8-9 min (flow rate of 2.0 ml/min) with physiological solution supplemented with 50 µM Ca2+, 1mg/ml BSA, 0.3mg/ml Collagenase II 0.3 mg/ml, 0.3 mg/ml hyaluronidase and Dispase (Worthington, Lakewood, NJ). At the end of perfusion, the LV was removed, minced in physiological solution containing 50 µM Ca2+ and 1mg/ml BSA, and cells were released by gentle agitation. Incompletely digested tissue fragments were transferred in fresh enzymatic solution and put in a shaker bath at 37°C to continue tissue digestion. Every 6-8 minutes, digestion solution containing released cells was collected, replaced with fresh enzymatic solution. These digestion cycles were repeated up to 3 times, until complete dissociation of cells from tissue. All collected cells were pooled, centrifuged for 3min at 2,000 g, and re-suspended in ice-cold physiological solution. Isolation and characterization of enriched cell populations: Cardiomyocytes were isolated from hearts with an aortic retrograde perfusion system, as described previously.7 After perfusion, the cardiomyocytes were isolated from debris and other smaller cells by sedimentation on a cushion of physiological solution containing 1% BSA. For non-cardiomyocytes, the hearts first underwent 5 min of retrograde perfusion with physiological solution supplemented with 1mM Ca2+, then 5 min of retrograde perfusion using a Ca2+-free physiological solution. Cells were further digested as detailed in Supplemental Methods. 3 Fluorescently labeled primary antibodies used to characterize and/or sort macrophages were the following: anti-mouse CD11b (also known as Mac1) coupled to Alexa Fluor 488 (clone M1/70; eBioscience) and anti-mouse F4/80 coupled to Alexa Fluor 647 (clone BM8; eBioscience). For labeling, all cells incubated for one hour at 4°C in 0.4ml phosphate buffered saline supplemented with 5% bovine serum albumin (PBS-BSA) and 25 g of fluorescently labeled antibodies, rinsed three times with PBS, and resuspended in 2 ml of PBS-BSA. To count the number of macrophages in LV digests, aliquots of 50 l of AccuCount Fluorescent Particles (Spherotech Inc, Illinois), which corresponded to a total of 50,850 beads, were added to the solution. The suspensions were then processed in a FACSCalibur system (Beckton-Dickinson) equipped with a blue (488nm) and a red diode (635nm) lasers. Counting was performed using the associated Cellquest Pro program, whereby cellular debris was excluded based on forward and side scatter. Cells that showed high levels of fluorescence for both F4/80 and CD11b were counted as macrophages. The total number of double positive cells present in the original total volume of 2 ml was estimated by pursuing the counting until a total of 15,000 beads were detected, and then counting the number of double positive cells in the equivalent volume. Cell sorting was performed using a MoFlo Legacy cell sorter (Beckman Coulter) equipped with a blue laser (488nm), a red laser (642nm), a 530/30 filter for detection of Alexa488, and a 660/20 filter for detection of APC. For endothelial cells, we used anti-mouse CD31 (also known as PECAM) coupled to the APC fluorochrome (clone 390; eBioscience). After exclusion of debris, we prepared 3 different populations of non-cardiomyocyte cells: 1) CD11b+/CD31- cells (macrophage-enriched); 2) CD11b/CD31+ cells (endothelial cell-enriched); and 3) CD11b-/CD31- cells (comprising mostly fibroblasts). The F4/80 was not used for cell sorting, because all CD11b+ cells were also positively stained by F4/80. To further characterize each cell population, total RNA was extracted from both purified cardiomyocytes and cell-sorted populations, and RT-qPCR was performed to measure the mRNA abundance of the following cell-specific markers: 1) for macrophages, integrin alpha M (Itgam, which codes for CD11b/Mac1); 2) for endothelial cells, von Willebrand factor (Vwf); 3) for fibroblasts, collagen 1 alpha (Col1a); and 4) for cardiomyocytes, myosin heavy chain- (Myh6). References: 1. Kumar V, Kim K, Joseph C, Kourrich S, Yoo S-H, Huang HC, Vitaterna MH, Villena FP-M de, Churchill G, Bonci A, Takahashi JS. C57BL/6N Mutation in Cytoplasmic FMRP interacting protein 2 Regulates Cocaine Response. Science. 2013;342:1508–1512. 2. Huang T-T, Naeemuddin M, Elchuri S, Yamaguchi M, Kozy HM, Carlson EJ, Epstein CJ. Genetic modifiers of the phenotype of mice deficient in mitochondrial superoxide dismutase. Hum Mol Genet. 2006;15:1187–1194. 3. Verdugo RA, Deschepper CF, Muñoz G, Pomp D, Churchill GA. Importance of randomization in microarray experimental designs with Illumina platforms. Nucl Acids Res. 2009;37:5610–5618. 4. Benjamini Y, Hochberg Y. On the Adaptive Control of the False Discovery Rate in Multiple Testing With Independent Statistics. J Educ Behav Statistics. 2000;25:60–83. 4 5. Wu H, Kerr MK, Cui X, Churchill GA. MAANOVA: A Software Package for the Analysis of Spotted cDNA Microarray Experiments [Internet]. In: Parmigiani G, Garrett ES, Irizarry RA, Zeger SL, editors. The Analysis of Gene Expression Data. Springer New York; 2003; p. 313–341. 6. Llamas B, Verdugo RA, Churchill GA, Deschepper CF. Chromosome Y variants from;different inbred mouse strains are linked to differences in the morphologic and molecular responses of cardiac cells to postpubertal testosterone. BMC Genomics. 2009;10:150. 7. Llamas B, Bélanger S, Picard S, Deschepper CF. Cardiac mass and cardiomyocyte size are governed by different genetic loci on either autosomes or chromosome Y in recombinant inbred mice. Physiol Genomics. 2007;31:176–182. 8. Schroen B, Heymans S, Sharma U, et al. Thrombospondin-2 Is Essential for Myocardial Matrix Integrity Increased Expression Identifies Failure-Prone Cardiac Hypertrophy. Circ Res 2004;95:515–522. 5 Table S1 : Genotyping results for 89 polymorphic markers for 2 individuals from the C57BL/6N strain (B6N), the C57BL/6J strain (B6J), and the F1 intercross between the two. Marker rs id Chr bp position F1 51068 F1 49858 B6N 51093 B6N 51045 B6J 51087 B6J 50262 rs31362610 1 42,424,440 H H N N J J rs13475886 1 61,228,463 H H N N J J rs32481241 1 78,483,338 H H N N J J rs6327099 1 131,282,938 H H N N J J rs6341208 1 165,062,830 H H N N J J rs13476348 2 11,092,478 H H N N J J rs33064547 2 38,802,132 H H N N J J rs33488914 2 44,998,528 H H N N J J rs13476554 2 67,080,320 H H N N J J rs33162749 2 78,639,333 H H N N J J rs13476801 2 138,305,756 H H N N J J rs29818510 2 152,936,750 H H N N J J rs13476956 3 5,370,727 H H N N J J rs13477019 3 23,723,842 H H N N J J rs30557586 3 55,568,652 H H N N J J rs31154737 3 73,922,455 H H N N J J rs31321678 3 107,273,295 H H N N J J rs31594267 3 151,882,540 H H N N J J rs13477622 4 28,249,560 H H N N J J rs13477746 4 65,605,269 H H N N J J rs3680956 4 109,547,100 H H N N J J rs6397070 4 155,284,926 H H N N J J rs33367397 5 18,216,206 H H N N J J rs33508711 5 41,153,028 H H N N J J rs13478320 5 71,133,300 H H N N J J rs33249065 5 92,510,104 H H N N J J rs3662161 5 117,909,356 H H N N J J rs13478542 5 135,358,216 H H N N J J rs30032909 6 25,337,386 H H N N J J rs30314218 6 40,029,337 H H N N J J rs13478783 6 60,541,373 H H N N J J rs6157367 6 67,237,174 H H N N J J rs13478995 6 117,420,898 H H N N J J rs31221380 7 38,216,957 H H N N J J rs13479233 7 55,071,694 H H N N J J rs32060039 7 78,961,795 H H N N J J rs13479522 7 136,179,208 H H N N J J rs13479605 8 10,521,755 H H N N J J rs13479672 8 30,207,547 H H N N J J 6 rs32729089 8 77,477,256 H H N N J J rs33601490 8 94,031,516 H H N N J J rs33219858 8 112,622,271 H H N N J J rs32577205 8 126,154,896 H H N N J J rs13480122 9 30,964,211 H H N N J J rs29644859 9 52,593,224 H H N N J J rs29934845 9 81,281,343 H H N N J J rs29332012 10 17,969,433 H H N N J J rs13480575 10 33,372,829 H H N N J J rs13480619 10 57,472,268 H H N N J J rs13459122 10 80,258,110 H H N N J J rs13480759 10 108,815,683 H H N N J J rs3659787 11 4,408,733 H H N N J J rs29473246 11 33,448,367 H H N N J J rs13481014 11 47,930,884 H H N N J J rs13481117 11 79,065,732 H H N N J J rs29411641 11 94,820,571 H H N N J J rs29158719 12 5,967,934 H H N N J J rs13481403 12 40,215,580 H H N N J J rs6385807 12 56,859,360 H H N N J J rs13481569 12 86,986,287 H H N N J J rs13481634 12 108,071,865 H H N N J J rs13481734 13 27,129,019 H H N N J J rs3722313 13 41,538,155 H H N N J J rs3702296 13 101,979,187 H H N N J J rs31187642 14 10,769,899 H H N N J J rs30264676 14 74,815,528 H H N N J J rs31059846 14 100,024,215 H H N N J J rs31273189 14 109,059,068 H H N N J J rs13459145 15 7,117,980 H H N N J J rs31810918 15 37,392,168 H H N N J J rs3702158 15 56,992,041 H H N N J J rs31858887 15 71,462,981 H H N N J J rs4165065 16 17,412,172 H H N N J J rs4186435 16 51,172,069 H H N N J J rs4214728 16 87,819,874 H H N N J J rs4137196 17 5,332,903 H H N N J J rs29512740 17 25,523,395 H H N N J J rs33334258 17 39,307,300 H H N N J J rs13483055 17 60,459,368 H H N N J J rs13483071 17 65,343,195 H H N N J J rs13483221 18 15,408,257 H H N N J J rs13483296 18 35,366,160 H H N N J J 7 rs13483369 18 54,774,495 H H N N J J rs29690544 18 84,686,237 H H N N J J rs30709918 19 16,676,708 H H N N J J rs30608930 19 52,433,860 H H N N J J rs6368704 20 55,120,804 J J N N J J rs6275359 20 90,945,246 J J N N J J rs31259892 20 98,418,215 J J N N J J rs31266096 20 147,904,667 J J N N J J H: heterozygous / N: C57BL/6N allele / J: C57BL/6J allele 8 Table S2 : List of primer sequences used for RT-PCR Genotyping primers (Nnt) Forward primer sequence Reverse primer sequence Exon 11 Exon 12_L1‐Exon 6_L4 GGCTGCCTTGACTTTGGATA GTAGGGCCAACTGTTTCTGC CCTCCTCCTACCTGCAATGT TCCCCTCCCTTCCATTTAGT RT‐qPCR primers Gene symbol Forward primer sequence Reverse primer sequence Acta2 Agtr1 Arg1 Col1a1 Gnaq Itgam Lgals3 Myh6 Myh7 Nppa Spp1 Timp1 Tnc S16 Vwf CTTCCTCCCTGGAGAAGAGC CAACTGCCTGAACCCTCTGT GTAGACAAGCTGGGGATTGG GACTGGCAACCTCAAGAAGG ACCCCGACAGTGACAAAATC GGCAGGAGTCGTATGTGAGG TGGGGAAAGGAAGAAAGACA GCCACTTATAGGGTTGACG GGCCCAGAAACAAGTGAAGA ATTGGAGCCCAGAGTGGAC TGATTCTGGCAGCTCAGAGG GCGTACTCTGAGCCCTGCT CTCTACCATCGCCACCAAGT GCTACCAGGGCCTTTGAGATG GCACATCCTCGACGTCAATG 9 ATAGGTGGTTTCGTGGATGC AGGAGAGCGTGCTCATTTTC CATCAAAGCTCAGGTGAATCG GACTGTCTTGCCCCAAGTTC TTCAGGTTCAGCTGCAGGAT CAGCAGTGATGAGAGCCAAG TCATCCGATGGTTGTACTGC ACCCAAGTTCGACAAGATCG GGCGATGTTCTCTTTCAGGT ACAGTGGCAATGTGACCAAG CTGTGGCGCAAGGAGATTCT TAGTCCTCAGAGCCCACGA CACAGATTCATAGACCAGGA AGGAGCGATTTGCTGGTGTGG GCAAAGACATCACAGCCAAG Table S3: Outline of animals used for each specific end‐points Duration Ang II End-point 14 days 48 hours F2 (Nnt NN) C57BL/6J MAP (telemetry) LV/BW Masson’s staining Col1a1 Nppa / Myh7 Illumina microarray Spp1 / Lgals3 Myh7/ Nppa / Tnc / Col1a1 Macrophage count 10 F2 (Nnt JJ) C57BL/6N F2 (all) Table S4: List of 200 genes showing significant interaction between treatment and strain (ranked according to fold change observed in C57BL/6N) FC.Trt_BN Timp1 Spp1 Tnc Lox Lgals3 Hist1h2ad Arg1 Prc1 Hist1h2af Myh7 Hist1h2ao Hist1h2ah Ankrd2 Hmox1 Hist1h2an Col1a1 Top2a Cd52 Psat1 Aa467197 Birc5 Erdr1 Tgfbi Srpx2 Actn1 Ano10 Bcat1 S100a11 Trem2 Tubb2b 1110032e23rik Fkbp11 Fcer1g Cotl1 Cd68 Col5a1 Enpp1 Mcm5 Abcc3 Vim Nme1 Tmsb10 Loc100043257 14.94 13.73 7.82 5.28 4.88 4.86 4.60 4.40 4.32 4.22 4.19 4.11 3.63 3.61 3.52 3.51 3.38 3.13 3.09 3.01 2.84 ‐2.68 2.65 2.62 2.62 ‐2.58 2.56 2.56 2.55 2.53 2.50 2.50 2.48 2.45 2.42 2.38 2.37 2.35 2.31 2.30 2.30 2.29 2.28 4.98 1.74 2.04 2.43 1.65 1.94 ‐1.09 2.09 2.04 1.99 1.84 1.85 1.32 1.29 1.87 1.02 1.49 1.01 1.56 1.09 1.47 1.06 1.21 1.33 1.40 ‐1.34 1.25 1.24 1.06 1.50 1.20 1.36 1.10 1.19 1.14 1.51 1.43 1.29 1.28 1.31 1.20 ‐1.27 1.34 Gene symbol FC.Trt_BJ X X X X X X X X X X X X X X X 11 Functional annotation clusters EC region blood vessels Immune resp X X Arhgdig Ift81 Ifi30 Lyz2 Gpr176 Cdc20 Rbp1 Sh3bgrl3 Ces3 Sprr1a Wisp2 Kdelr3 Ms4a7 Kif22 Cstb Msn Lpxn Lcp1 Aldh1a2 5430435g22rik Fbln2 Tyrobp Tspo E2f1 Serpinb1a Dpep2 Sparc Clec4n Olfml3 Ensmusg00000043795 Clec4a1 Aurka Cytip Tuba1b Gdf15 Lyz Rtn4 Wnk2 Cpeb3 Fah Sla Itga5 Loc100044439 Cdca3 Ncaph Loc100046650 Rab15 Selplg Ly86 2.27 ‐2.26 2.22 2.22 2.21 2.20 2.20 2.20 ‐2.18 2.16 2.16 2.16 2.13 2.12 2.11 2.11 2.09 2.07 2.05 2.04 2.03 2.03 2.01 1.99 1.98 1.96 1.96 1.95 1.95 1.95 1.93 1.93 1.93 1.92 1.92 1.92 1.91 ‐1.91 ‐1.89 ‐1.88 1.88 1.88 1.87 1.87 1.85 1.84 1.84 1.83 1.83 1.09 ‐1.40 1.09 ‐1.01 1.26 1.26 1.39 1.07 ‐1.09 1.03 1.36 1.32 1.13 1.26 1.06 1.07 1.19 ‐1.09 1.30 ‐1.06 1.36 1.16 1.14 1.18 ‐1.00 1.10 1.11 1.07 1.16 1.08 ‐1.32 1.19 1.04 1.22 ‐1.02 1.10 1.17 ‐1.01 ‐1.09 ‐1.17 1.12 1.03 1.11 1.13 1.16 ‐1.01 1.17 1.02 ‐1.02 X X X X X X X X X X 12 X Ass1 Decr1 Gfpt2 Pla2g12a Tmem97 Lgmn Emr1 Slc39a13 Cyb5r3 Vkorc1 Gpx7 Arrb2 Rpl3l 4732473b16rik Rab32 Figf Msr2 Aspscr1 Tmem119 2610002j02rik Lst1 Gm889 Hmha1 Fyb Maged2 Rnf166 Lat2 Lmna Dlat Bdh2 9330129d05rik Chaf1a Mad2l1 2610528e23rik Arl11 Fkbp10 Ltb4r1 Fscn1 Fcgr4 Gpt1 Ipo4 Kcmf1 Loc333331 Mlxipl Gsta3 Eif4el3 Rps16 H2‐ab1 Slc6a6 1.82 ‐1.80 ‐1.79 ‐1.78 1.78 1.78 1.78 1.77 1.77 1.76 1.75 1.74 ‐1.73 1.73 1.73 1.73 1.73 1.72 1.72 1.72 1.72 ‐1.71 1.71 1.71 1.70 ‐1.70 1.70 1.70 ‐1.70 1.68 ‐1.67 1.67 1.66 ‐1.66 1.66 1.66 1.66 1.66 1.65 ‐1.64 1.64 ‐1.64 ‐1.64 ‐1.64 ‐1.63 1.63 1.63 1.62 1.62 ‐1.05 1.20 1.36 ‐1.10 ‐1.04 ‐1.11 1.09 ‐1.06 ‐1.13 1.01 1.09 ‐1.14 ‐1.13 1.10 1.09 ‐1.26 1.05 ‐1.03 1.18 1.10 ‐1.13 ‐1.18 ‐1.12 1.02 1.13 ‐1.17 1.06 1.18 ‐1.14 1.11 1.00 ‐1.04 1.14 ‐1.07 ‐1.02 ‐1.10 1.05 ‐1.59 ‐1.12 1.01 ‐1.05 ‐1.20 ‐1.03 1.17 ‐1.10 1.03 1.02 ‐1.50 1.10 X X X X X X 13 X Fbp2 Eg433224 H2‐dma Steap2 By080835 Rmnd1 Bckdhb Rrbp1 Rad54l Ppia Gnb1 Ephx2 Pafah1b3 H2afz Ccbp2 Napsa Stxbp2 Arhgdib Loc641240 Klrd1 Apobec1 Ptpn6 Vav1 Gm2a Eif6 Pfn1 Arpc4 Tmem176a Hk3 Rdm1 Prcp Pold4 Mcm3 Cpt1b D9ertd392e Hey1 Olfm1 Unc93b1 Loc100046457 Tlr7 Chst12 Fam102a Loc674706 Foxn3 Mipep Tmbim1 Sox18 Camk1 Bdh1 ‐1.62 ‐1.62 1.61 1.61 ‐1.61 ‐1.61 ‐1.60 1.59 1.59 1.59 1.59 ‐1.59 1.59 1.58 ‐1.57 1.57 1.57 1.57 1.57 1.56 1.56 1.56 1.56 1.56 1.55 1.55 1.54 1.54 1.54 ‐1.54 1.53 1.52 1.52 ‐1.52 ‐1.52 ‐1.52 1.51 1.51 1.51 1.50 1.50 ‐1.50 1.50 ‐1.50 ‐1.50 1.49 ‐1.49 1.49 ‐1.49 ‐1.05 ‐1.08 ‐1.26 1.03 1.05 ‐1.09 1.08 1.05 1.02 1.05 1.10 1.01 1.02 1.03 1.11 1.04 ‐1.05 ‐1.05 ‐1.54 ‐1.14 ‐1.26 ‐1.04 ‐1.00 ‐1.14 1.08 1.02 ‐1.10 ‐1.34 ‐1.03 ‐1.14 1.08 ‐1.11 1.01 ‐1.02 ‐1.01 1.07 ‐1.05 ‐1.20 ‐1.01 1.07 ‐1.20 1.08 1.03 1.02 1.01 1.06 1.31 ‐1.11 1.09 X X X X X X X X X 14 Loc100039571 Csf1r Eef1a1 Bicc1 Dap Cyp4f18 Cd276 Ugt1a10 Vegfa 1.49 1.49 1.49 1.49 1.48 1.48 1.48 1.48 ‐1.48 ‐1.08 ‐1.02 1.06 ‐1.12 1.14 1.08 ‐1.18 ‐1.18 1.11 X FC: fold-change; EC: extracellular 15 X X Table S5: Functional annotation clustering of genes affected differentially by Ang II in LVs from C57BL/6N and C57BL/6J mice Annotation cluster GO Term description #1 (Enrichment Score: 2.12) # of genes % of genes P‐Value blood vessel development (GO:0001568) 10 0.51 0.001 RTN4, ALDH1A2, HEY1, HMOX1, VEGFA, SOX18, COL1A1, LOX, FIGF, COL5A1 vasculature development (GO:0001944) 10 0.51 0.001 RTN4, ALDH1A2, HEY1, HMOX1, VEGFA, SOX18, COL1A1, LOX, FIGF, COL5A1 angiogenesis (GO:0001525) 5 0.26 0.050 RTN4, HMOX1, VEGFA, SOX18, FIGF blood vessel morphogenesis (GO:0048514) 6 0.31 0.055 RTN4, HEY1, HMOX1, VEGFA, SOX18, FIGF #2 (Enrichment Score: 1.86) extracellular matrix part (GO:0044420) 7 0.36 4.02E‐04 proteinaceous extracellular matrix (GO:0005578) 10 0.51 0.004 LGALS3, FBLN2, TNC, VEGFA, TGFBI, SPARC, COL1A1, LOX, COL5A1, TIMP1 extracellular matrix (GO:0031012) 10 0.51 0.005 LGALS3, FBLN2, TNC, VEGFA, TGFBI, SPARC, COL1A1, LOX, COL5A1, TIMP1 extracellular region part (GO:0044421) 17 0.87 0.007 LGALS3, ENPP1, LY86, TNC, SPARC, COL5A1, TIMP1, ARG1, FBLN2, TGFBI,VEGFA, COL1A1, LOX, GDF15, FIGF, OLFM1, SPP1 basement membrane (GO:0005604) 5 0.26 0.007 TNC, VEGFA, SPARC, COL5A1, TIMP1 extracellular region (GO:0005576) 25 1.28 0.069 ENPP1, TNC, LY86, TIMP1, ARG1, PFN1, OLFML3, WISP2, PLA2G12A, TGFBI,LOX, GPX7, FIGF, OLFM1, SPP1, LGALS3, SPARC, COL5A1, SRPX2, PPIA, FBLN2, VEGFA, COL1A1, TREM2, GDF15 5 0.26 0.069 LGALS3, TNC, TGFBI, LOX, COL5A1 4 0.21 0.088 LGALS3, TGFBI, LOX, COL5A1 10 0.51 0.088 ARG1, ENPP1, LY86, VEGFA, TGFBI, LOX, GDF15, FIGF, OLFM1, SPP1 lysosome (GO:0005764) 7 0.36 0.011 5430435G22RIK, CD68, GM2A, LGMN, PRCP, IFI30, H2‐DMA lytic vacuole (GO:0000323) 7 0.36 0.011 5430435G22RIK, CD68, GM2A, LGMN, PRCP, IFI30, H2‐DMA vacuole (GO:0005773) 7 0.36 0.020 5430435G22RIK, CD68, GM2A, LGMN, PRCP, IFI30, H2‐DMA #4 (Enrichment Score: 1.37) immune response (GO:0006955) 13 0.67 0.00365666 PTPN6, LST1, ENPP1, LY86, H2‐AB1, VAV1, TLR7, CLEC4N, LAT2 LOC641240, VEGFA, FCER1G, H2‐DMA, LCP1 mast cell activation (GO:0045576) 3 0.15 0.01027554 FYB, LAT2, FCER1G cell activation (GO:0001775) 8 0.41 0.01426611 FYB, LAT2, LST1, FCER1G, H2‐DMA, VAV1, LCP1, TIMP1 immune effector process (GO:0002252) 5 0.26 0.04216651 PTPN6, LAT2, FCER1G, H2‐DMA, TLR7 myeloid leukocyte activation (GO:0002274) 3 0.15 0.05090782 FYB, LAT2, FCER1G leukocyte activation (GO:0045321) 6 0.31 0.07792622 FYB, LAT2, FCER1G, H2‐DMA, VAV1, LCP1 lymphocyte activation (GO:0046649) 4 0.21 0.31835598 LAT2, H2‐DMA, VAV1, LCP1 T cell activation (GO:0042110) 3 0.15 0.3393948 H2‐DMA, VAV1, LCP1 extracellular structure organization (GO:0043062) extracellular matrix organization (GO:0030198) extracellular space (GO:0005615) #3 (Enrichment Score: 1.86) Gene symbols TNC, VEGFA, SPARC, COL1A1, LOX, COL5A1, TIMP1 GO: Gene Ontology. In each enrichment cluster, the particular GO term containing the largest number of genes has been highlighted. 16 Table S6: List of 40 genes showing the highest fold changes in C57BL/6N mice response to Ang II Gene symbol FC B6/N FC B6/J fibrosis M2 M Timp1* Spp1* 14.94 13.73 4.98 1.74 X X Tnc* 7.82 2.04 X X Lox 5.28 2.43 Lgals3* 4.88 1.65 Hist1h2ad 4.86 1.94 Related biological processes Annotation cluster membership activated M EC region blood vessels X X X X X X X Arg1 4.60 ‐1.09 X Prc1 4.40 2.09 Hist1h2af 4.32 2.04 Myh7 4.22 1.99 Hist1h2ao 4.19 1.84 Hist1h2ah 4.11 1.85 Ankrd2 3.63 1.32 Hmox1* 3.61 1.29 Hist1h2an 3.52 1.87 Col1a1* 3.51 1.02 Top2a 3.38 1.49 Cd52 3.13 1.01 Psat1 3.09 Aa467197 Birc5 Erdr1 X X X X X X 1.56 3.01 1.09 2.84 1.47 ‐2.68 1.06 Tgfbi 2.65 1.21 X Srpx2 2.62 1.33 X X Actn1 2.62 1.40 Ano10 ‐2.58 ‐1.34 Bcat1 2.56 1.25 S100a11* 2.56 1.24 Trem2 2.55 1.06 Tubb2b 2.53 1.50 Fam198b 2.50 1.20 Fkbp11 2.50 1.36 Fcer1g* 2.48 1.10 Cotl1 2.45 1.19 Cd68 2.42 1.14 Col5a1 2.38 1.51 Enpp1 2.37 1.43 Mcm5 2.35 Abcc3 2.31 Vim Nme1 X X X X X 1.29 1.28 2.30 1.31 2.30 1.20 X Immune resp X X FC: fold change; B6/N: C57BL/6N; B6/J: C57BL6/J; M: macrophage; EC: extracellular. Genes previously reported in the outbred renin-overexpressing Ren-2 rats to be differentially expressed in the hearts of rats progressing to heart failure in comparison to compensated rats are indicated by an asterisk.8 17 Table S7: Relative expression ratios (cell population vs whole LV) of cell‐specific genes in four populations of cells enriched for specific cell types Gene CD31 (+) CD11b(+) CD31(-) / CD11b (+) Cardiocytes Vwf 10.2 0.3 1.0 1.9 Itgam 1.0 30.0 0.7 1.0 Col1a1 0.2 0.1 4.6 0.8 Myh6 n.d. n.d. n.d. 1.3 The abundance of mRNA abundance is greatly increased (compared to its concentration in whole LV) for Vwf in CD31(+) cells (endothelial cells), for Itgam in CD11b(+) cells (macrophages), and for Col1a1 in CD31(‐) / CD11b (+) (mostly fibroblasts). Expression of Myh6 was detected only in cardiocytes. 18 Table S8: Relative expression ratios (cell population vs whole LV) of genes in four populations of cells enriched for specific cell types Gene cardio CD11b+ CD31+ CD11b‐/CD31‐ Spp1 0.25 8 1 1 Lgals3 ND 5.25 0.5 1.4 Arg1 ND present ND ND Tnc 0 2 1 6.4 Col1A1 0.7 0.35 0.35 2.8 Timp1 0.7 1 1 32 Lox 0.17 0.5 ND 11.5 Relative expression in cell fractions vs. whole LV tissue were calculated on the basis of the (Ct) of the RT‐qPCR analysis. ND: non‐detectable. For expression of Arg1 in CD11b+ cells, the ratios could not be calculated, as these cells represented the only fraction where expression of the gene was detected. 19 Fig. S1 MAP). Top p: the tracinggs represent tthe average of Telemetry recording of mean arteriaal pressure (M N and C57BL L/6J mice. B Bottom: aveerage values obtained duuring values obtaiined in eitherr C57BL/6N either day-tiime or night-time at diffferent period ds either befoore ar after ppump implanntation. N = 8 up to 7 days after pump implaantation; n = 5 for days 8-13 8 after puump implanttation. 20 Fig. S2 Lgals3 4 ratio 3 2 1 0 C57BL/6J C57BL/6N Nppa relative expression relative expression 15 10 5 0 C57BL/6J C57BL/6N Effects of 48 h treatment with either vehicle (sham) or Ang II at 3 different doses (500, 1000 or 1500 ng/kg/day). The abundance of mRNA for either Nppa, Spp1 or Lgals3 was measured by RT-qPCR by calculating -2(ΔΔCT), using the normalizing housekeeping Rps16 gene; n = 4-6 per group. 21 Fig. S3 relative expression relative expression Expression of Agtr1 (left panel) and Gnaq (right panel) mRNA abundance in LVs from C57Bl/6J and C57Bl/6N mice after subacute treatment with either vehicle or Ang II. All data were obtained by RTqPCR by calculating -2(ΔΔCT), using the normalizing housekeeping Rps16 gene; n = 5. 22 Fig. S4 phages (doub ble positive cells c for bothh Cd11b andd F4/80) in L LVs from C557BL/6J Left: numbeer of macrop and C57BL//6N receivin ng either sham m or Ang II treatment foor 48 h. Thee results of thhe two-way ANOVA an nalysis for eitther treatment or strain x treatment iinteraction aare as indicatted. Middlee: Scatterplot of o fluorescen nce intensity y values of ceells for CD111b (x axis) vvs. F4/80 (y axis); the ovval represents th he area seleccted to countt double positive cells. R Right: Scattterplot of baackground fluorescencee intensity values (autofl fluorescence)). 23 Fig. S5 Effects of chronic and subacute Ang II on responses of F2 hybrid animals whose genotype at the Nnt locus is homozygous for either the C57BL/6J or the C57BL/6N allele (J/J and N/N, respectively). Panel A: relative changes in Col1a1 abundance after chronic Ang II. The values were calculated by dividing the values in individual treated animals by the average of values obtained for sham-treated animals in the same group; **P < 0.01 by post-hoc Sidak comparisons. Panel B: connective tissue content (as quantified after Masson’s Trichrome staining) in heart of mice after chronic Ang II. **P < 0.01 by post-hoc Sidak comparisons; Panel C and D: LV abundance of mRNA of either Spp1 (panel C) or Lgals3 (panel D) after 48 hours of Ang II administration. The values represent log2 normalized 2(-ΔΔCt) values. In all groups, the number of experimental animals is indicated in the corresponding bar. 24
© Copyright 2026 Paperzz