Journal of Biogeography, 29, 1179–1185
The taxonomic status of the ‘sea trout’
from the north Adriatic Sea, as revealed by
mitochondrial and nuclear DNA analysis
Aleš Snoj1,*, Bojan Marčeta2, Simona Sušnik3, Enver Melkič1, Vladimir Meglič3 and Peter
Dovč1 1University of Ljubljana, Biotechnical Faculty, Department of Animal Science,
Groblje, Domžale, Slovenia, 2National Institute of Biology, Večna pot, Ljubljana, Slovenia
and 3Agricultural Institute of Slovenia, Hacquetova, Ljubljana, Slovenia
Abstract
Aim Unclassified salmonids, generally named ‘sea trout’, have been spotted on occasion
in the north Adriatic Sea, although autochthonous salmonids have not been reported in
the Mediterranean Sea. On the basis of their phenotype, these fish were regarded as the
rainbow trout or salmon-like fish. The aim of the study was to determine the taxonomic
status of the ‘sea trout’ and its origin.
Location The specimens originate from the coastal waters of the Gulf of Trieste,
northern Adriatic Sea, and from hatchery-reared stock of brown trout (Salmo trutta),
derived from Trentino fish-farm.
Methods Meristic measurements, nucleotide identity-test of mitochondrial DNA
(mtDNA) (control region) and polymerase chain reaction-restriction fragment length
polymorphism (PCR-RFLP) analysis of nuclear DNA (lactate dehydrogenase C1* gene)
were performed.
Results Morphological characters of the ‘sea trout’ specimens analysed, correspond best
with those used for S. trutta and S. marmoratus. Genetic tests denoted explicit similarity
between the ‘sea trout’ and hatchery-reared brown trout. Mitochondrial DNA analysis
of the ‘sea trout’ revealed 100% nucleotide identity with brown trout of the Atlantic
phylogeographical lineage. Results inferred from nuclear DNA analysis, confirmed the
Atlantic descent of the ‘sea trout’ and demonstrated also a certain level of introgression
with the brown trout of Danubian lineage.
Main conclusions Using mtDNA and nuclear DNA analysis it was concluded, that the
Adriatic ‘sea trout’ belong to species S. trutta and is most likely derived from hatcheryreared brown trout population.
Keywords
Salmo trutta, sea trout, mitochondrial DNA, lactate dehydrogenase, morphology,
Adriatic Sea.
INTRODUCTION
The Salmonidae family consists of many salt water tolerant
species (Salmo sp., Salvelinus sp., Oncorhynchus sp.). Some
of them are obligatory anadromous (majority of salmons),
whereas the others [e.g. trout species (Salmo trutta) of the
*Correspondence: University of Ljubljana, Biotechnical Faculty, Department
of Animal Science, Groblje 3, 1230 Domžale, Slovenia.
E-mail: ales.snoj@ bfro.uni-lj.si
2002 Blackwell Science Ltd
Atlantic drainage] exhibit either sea-run migratory or
freshwater residential behaviour (Skala & Nævdal, 1989;
Hindar et al., 1991; Northcote, 1992). This variation in life
history is primarily governed by crucial environmental
conditions, such as accessibility to sea, its temperature and
salinity, although a hereditary component may also be
involved (Kottelat, 1997).
According to Tortonese (1970), salmonids are unknown
in the Mediterranean Sea, most likely because of high salt
concentration (38&) and temperature which may rise to
over 25 C during the summer.
1180 A. Snoj et al.
Nevertheless, few historical data exist, indicating a sporadic occurrence of trout-like fish in the Adriatic Sea,
generally referred to as S. cenerinus (Chiereghini, 1818) or
Trutta adriatica (Kolombatović, 1890; Ninni, 1912; Ninni,
1930). However, original descriptions were very vague and
could apply to about any salmonid and both names are now
questionably valid (Kottelat, 1997).
Marine fishermen do catch on occasion undefined salmonids in the north Adriatic Sea, generally called ‘sea trout’.
The catches are very rare, limited to coastal waters and
restricted to springtime. These fish have been on the basis of
their external appearance (e.g. silvery coloration), considered as a rainbow trout (O. mykiss; Bussani, 1992; Zei,
1996; Bettoso et al., 2000), sea-trout (S. truta f. trutta,
Bettoso et al., 2000), or a ‘salmon-like fish’ (Medved S.,
pers. comm.). These taxonomic assignments have been
reasoned by the fact, that at the beginning of the twentieth
century many peri-Adriatic tributaries were stocked with
non-native Salmo and Oncorhynchus species (Chiappi,
1927; Tortonese, 1935; Gridelli, 1936; Povž, 1995; Povž
et al., 1996). It is believed that they have a potential to
migrate into the sea. Besides, in the Adriatic Sea, several
attempts have been made to rear some of non-native
salmonid species in marine conditions (i.e. O. kisutch,
Teskeredžić & Edwards, 1987; O. mykiss, Teskeredžić
et al., 1989; O. masou, Teskeredžić & Teskeredžić, 1990).
Rearing experiments were successful and the fish left in cages
during the summer survived, showing no significant increase
of mortality. These facts along with previously mentioned
phenotypic observations indicated that the ‘sea trout’ may
have stemmed from stocked or reared fish of non-native
origin. However, classification based only on external
features of the ‘sea trout’ has been due to phenoplasticity,
which is characteristic for most salmonids, unreliable and
cannot be decisive.
The purpose of this study was taxonomical classification of
the ‘sea trout’, because no systematic investigation has been
performed so far to determine its real taxonomic status.
Taxonomic classification was performed on the basis of
morphological measurements and genetic analysis. Nucleotide sequence of mitochondrial DNA (mtDNA) control region
was determined and compared with the GenBank sequence
data of the brown trout, rainbow trout and Atlantic salmon
for genetic sequence based identification. In addition, taxonomic identification based on nuclear DNA markers was
performed, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of lactate
dehydrogenase (LDH)-C1* gene that enables discrimination
between phylogeographical lineages of S. trutta.
MATERIALS AND METHODS
Eleven specimens of the ‘sea trout’, caught by local fishermen
in the coastal waters of the Bay of Piran and Koper (Gulf of
Trieste; Fig. 1) during the subsequent spring seasons from
1998 to 2002, were collected and analysed. Additionally,
fourteen hatchery-reared specimens from a fish-farm (Ente
tutela Pesca del Friuli-Venezia Giulia), representing the stock
Figure 1 Approximate locations, where the ‘sea trout’ specimens
were caught.
destined for supportive stocking of the Rivers Soča and
Tagliamento, were also included in the molecular DNA
analysis.
Morphology
Total length, weight and several meristic measurements
[number of the dorsal fin rays (D), anal fin rays (A), pelvic fin
rays (V), pectoral fin rays (P) and gill rakers (GR)] were
performed on eight specimens (Table 1).
DNA isolation
Total DNA was obtained from fin tissue, according to the
protocol for DNA isolation from hair (Bowling et al., 2000).
Fin tissue 1–2 mm2 was placed in 50 lL of 200 mM NaOH
and heated at 97 C for 10 min. The tissue lysis was
neutralized using 50 lL of 200 mM HCl and 100 mM Tris–
HCl, pH 8.5, with thorough mixing.
Amplification and sequencing of mtDNA control region
Polymerase chain reaction amplification of c. 400 bp
segment of the 5¢-end of mtDNA control region was
performed using primers 28r (5¢-CACCCTTAACTCCCAAAGCTAAG-3¢), located in tRNAPro gene and HF
(CCTGAAGTAGGAACCAGATG) in central conserved region. A thermal profile with 53 C annealing temperature
was used. The amplified fragment of mtDNA was sequenced
using primer 28r and BigDye Terminator Ready Reaction
Mix (PE Applied Biosystems, Foster city, CA) according to
manufacturer’s recommendations. The amplified, fluorescently labelled and terminated DNA was precipitated with
sodium acetate and ethanol and analysed on the ABI Prism
310 sequencer (PE Applied Biosystems).
2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185
‘Brown trout’ in the north Adriatic Sea 1181
Table 1 Morphological data [total length (TL; mm), weight (W; g), number of dorsal fin rays (D), anal fin rays (A), pelvic fin rays (V), pectoral
fin rays (P) and gill rakers (GR)] and molecular genetic data of the ‘sea trout’ specimens, designated with ID numbers. Available meristic data
of Salmo cenerinus*, S. marmoratus , S. truttaà,§, S. salarà,§ and Oncorhynchus mykissà are also listed
Morphology
Genetics
ID/species
TL
W
D
A
V
P
GR
mtDNA
LDH-C1* gene
M1
7619
7620
7621
11995
11996
11997
11998
18893
18894
18896
226
213
202
232
212
197
504
/
/
233
86
99
77
113
91
65
1230
/
/
124
12
12
12
12
13
13
12
/
/
13
10
9
10
9
11
11
10
/
/
8
9
9
9
9
9
9
9
/
/
11
12
14
13
13
13
/
14
/
/
14
14
16
14
15
17
16
18
/
/
16
At
At
At
At
At
At
At
At
At
At
At
90/90
90/90
90/90
90/90
90/90
90/90
90/100
90/90
100/100
90/90
90/90
Range
S. cenerinus
S. marmoratus
S. trutta trutta
S. salar
O. mykiss
/
/
/
/
/
/
/
/
/
/
12–13
8–11
9–11
12–14
14–18
13
13–15
10–15
11–15
10–12
9
9–13
9–14
10–14
8–12
9
8–9
7–10
8–11
10
16
13–15
11–16
11–16
14–16
/
/
13–19
17–24
17–22
*Chiereghini (1818).
Povž et al. (1996).
à
FishBase (1997).
§
Svetovidov (1984).
The computer program ClustalX Multiple sequence Alignment Program, Version 1.8 (Thompson et al., 1997) was used
to align DNA sequences. A phylogenetic tree was generated
from the aligned sequences using the quartet-puzzling, maximum likelihood procedure in the PUZZLE program, version
5.0 (Strimmer & von Haeseler, 1996). It was performed under
the HKY model of sequence evolution (Hasegawa et al.,
1985). Support values for each internal branch were obtained
with the construction of 1000 intermediate trees. For the
graphical representations of tree topologies the Treeview
program, version 1.6.5 (Page, 1996) was applied.
Amplification, digestion and sequencing of LDH-C1*
gene
Polymerase chain reaction amplification of an c. 440 bp long
fragment of LDH-C1* gene, comprised of 43 bp of exon 3,
77 bp of exon 4 and intron 3 of variable length, was
performed as described elsewhere (McMeel et al., 2001),
using primers LDHxon4R and LDHxon4R.
From 5 to 10 lL of PCR product was digested with BslI
restriction enzyme (New England Biolabs Inc., Beverly, MA)
in a total volume of 20 lL according to manufacturer’s
instructions. The resultant fragments were separated by
electrophoresis on a 2% agarose gel.
The DNA sequencing was performed as described in
previous paragraph, using primer LDHxon4R.
2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185
RESULTS
Morphological data
All the ‘sea trout’ specimens were equally coloured: the
back was silvery-grey, becoming lighter and more silvery
towards the flanks. The belly was almost white. The dorsal,
adipose and caudal fins were grey, whereas the pelvic and
anal fins were almost white. The specimens were heavily
spotted with irregularly shaped black spots, evenly distributed on the back and flanks both above and below the
lateral line, on the gill cover and the dorsal fin. With an
exception of one specimen, the adipose fin was spotless.
One sample (ID 11997) lacked the pectoral fins. Meristic
characteristics are summarized in Table 1. They exhibited
moderate intrasample variability and the results considerably overlapped with data referred to four Salmo species
and O. mykiss, showing no distinctive differences between
them. Nevertheless, morphological characters of the specimens analysed correspond best with those quoted for
S. trutta and S. marmoratus.
Molecular data
Mitochondrial DNA
For all the specimens analysed, a 420-bp nucleotide
sequence of the 5¢-end of mtDNA control region was
determined.
1182 A. Snoj et al.
Figure 2 Nucleotide sequence alignment of 420 bp fragment of mtDNA control region of the ‘sea trout’, S. trutta (haplotype At1), O. mykiss
and S. salar (GenBank accession No. M97969, M81755 and U12143). The sequences correspond to the L-strand. Identity is denoted by an
asterisk and deletions by a dash.
By surveying nucleotide sequences from the samples of the
‘sea trout’ and specimens, originating from the fish farm, no
differences were found between them. A hundred percent
nucleotide sequence identity was found between the haplotype of analysed specimens and the haplotype of the brown
trout, originating from the Atlantic basin. Nucleotide
identity between the ‘sea trout’ specimens and other phylogeographical lineages of S. trutta (Danubian, Adriatic,
Mediterranean and marmoratus) was c. 99%. Phylogenetic
relationship between the ‘sea trout’ and main S. trutta
lineages are depicted in Fig. 3. Alignment of the ‘sea trout’
DNA sequence with the sequences from the GenBank
database revealed 90% and 93% identity between the
sequence analysed and appropriate DNA fragments, derived
from the Atlantic salmon and the rainbow trout, respectively
(Fig. 2).
LDH-C1* gene
The phylogeographical identity of analysed specimens was
determined by PCR-RFLP analysis of LDH-C1* coding
region, enabling discrimination between Atlantic (LDHC1*90) and other phylogeographical lineages of S. trutta
(i.e. *100 and *120) allozyme alleles. Among the ‘sea
trout’ specimens, three different genotypes were detected:
seven homozygotes indicating allele *90, one (ID 18893)
carrying non-Atlantic alleles (*100 or *120), and one
heterozygote (ID 11997), carrying *90 and *100 or *120
allele.
2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185
‘Brown trout’ in the north Adriatic Sea 1183
Figure 3 Maximum likelihood tree relating five major mtDNA
evolutionary lineages of S. trutta (At – Atlantic, Da – Danubian, Me
– Mediterranean, Ad – Adriatic and Ma – marmoratus) and the ‘sea
trout’. Confidence statements (as a percentage) estimated from 1000
puzzling steps are shown between the nodes.
The hatchery-reared samples were monomorphic for the
allele 90, with an exception of one sample exhibiting
heterozygous genotype (*90/*100 or *120).
The phylogeographical identity of non-Atlantic lineages
was determined according to diagnostic point mutations in
the intron 4, which enable discrimination between the
Danubian, Adriatic and marmoratus phylogeographical
lineages (Snoj, unpublished data). On the basis of these
mutations, non-Atlantic alleles found in the ‘sea trout’ and
hatchery-reared brown trout specimens as well, were recognized as Danubian.
DISCUSSION
On the basis of mtDNA sequence identity, the analysed
specimens belong to the S. trutta rather than to either the
S. salar or the Oncorhynchus sp. This is clearly demonstrated by the mtDNA nucleotide divergence data, nuclear DNA
analysis and supported also by morphological measurements. DNA sequence variation of the 5¢-mtDNA control
region among geographically remote brown trout populations has already been studied and revealed five major
phylogenetic assemblages (Danubian, Adriatic, Mediterranean, Atlantic and marmoratus), that exhibit diagnostic
haplotypes, differing by mean sequence divergence estimates
from 0.96 to 1.44% (Bernatchez et al., 1992). All five
groups showed a strong spatial pattern of distribution,
significantly reflecting their geographical partitioning, and
were proposed to be recognized as the basic evolutionary
2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185
significant units within S. trutta (Bernatchez, 2001). On the
basis of these facts we demonstrated that the ‘sea trout’
belong to the Atlantic lineage. In the Adriatic region only
marmoratus, Adriatic and Mediterranean phylogenetic lineages of S. trutta are autochthonous (Giuffra et al., 1994;
Apostolidis et al., 1997; Snoj et al., 2000) and the appearance of the Atlantic lineage is therefore exclusively the
outcome of stocking activities.
Atlantic descent of the ‘sea trout’ was confirmed also by
LDH-C1* gene analysis. The LDH C1* has been, particularly in brown trout, already proven as informative marker
at the protein level (Allendorf et al., 1977) and the nucleotide sequence and PCR-RFLP routine screening for differentiation between *90 and other alleles (*100 and *120) has
been recently established (McMeel et al., 2001). The allele
*100 is found throughout the brown trout range, allele *90
is naturally restricted to the northwest Europe (Atlantic
drainage; Hamilton et al., 1989) and less abundant allele
*120 has been so far detected only in marmoratus phylogenetic lineage (Berrebi et al., 2000). Most of the hatchery
stocks in Europe are fixed for *90 allele (McMeel et al.,
2001). The marker for the allele *90 forms a convenient tool
for following the presence of brown trout of hatchery origin
(the Atlantic lineage), particularly in areas where it does not
occur naturally. The result of PCR-RFLP analysis indicated
the prevalence of the Atlantic lineage within the ‘sea trout’,
although some introgression of the Da lineage was also
detected. This lineage is also allochthonous in the Adriatic
river system, where it has been successfully introduced. No
aboriginal alleles were detected in the specimens analysed,
which indicated non-native, hatchery origin of the ‘sea
trout’. This view is additionally corroborated by the morphological observation, which revealed an absence of the
pectoral fins in one specimen; this anatomical abnormality is
often observed among farmed fish, and can be explained as a
consequence of their territorial behaviour.
The ‘sea trout’ may originate from the tributaries of the
north Adriatic Sea, from where it might run into the sea
upon river swelling. This usually happens in the springtime
as a consequence of the snow melt in the mountains.
Interestingly, this is as well the season when the brown trout
is most frequently observed in the north Adriatic Sea. It is
also possible that the sea-run migratory behaviour, characteristic for many brown trout population originating from
the Atlantic river basin, may contribute to the migration of
S. trutta into the Adriatic Sea. A dispersal would be the most
likely explanation for the occurrence of the brown trout in
the north Adriatic Sea.
Therefore, the north Adriatic ‘sea trout’ may originate
from a hatchery-reared population of the brown trout,
migrating to the sea from the Rivers Rižana, Soča or
Tagliamento. The population genetic structure of S. trutta
from Rižana has been described as very heterogeneous,
exhibiting almost one-half of autochthonous (Ma/Ad) markers (Snoj, unpublished data) and therefore probably does not
represent the origin of the ‘sea trout’. The Rivers Soča and
Tagliamento seem to be a more probable source of the ‘sea
trout’. Both rivers have been massively stocked with brown
1184 A. Snoj et al.
trout originating from the fish farm (Associazione Troticoltori Trentini; G. Magrini, pers. comm.), rearing brown trout
of the Atlantic origin. The result of molecular analysis of the
hatchery-reared specimens, destined for the Soča and
Tagliamente stocking (performed by Ente tutela Pesca del
Friuli-Venezia Giulia fish farm) are consistent with those of
the ‘sea trout’, corroborating its proposed origin.
With the present investigation we tried to explain recent
occurrence of the brown trout in the north Adriatic. On the
other hand, we failed to explain the occurrence of the ‘sea
trout’, already described in the nineteenth century (Chiereghini, 1818; Kolombatović, 1890), when fish-farming in
the peri-Adriatic region was minimal or null. It could be
proposed that the existing ‘sea trout’ and the historical one
do not represent the same lineage.
It can be deduced from our study that translocated
allochthonous population can not only interfere with local
population but may also invade habitats previously unoccupied with incipient population. Furthermore, it was revealed
that it can develop even a new ecotype, representing a
biological factor with an unpredictable impact on the newly
subsistent habitat.
ACKNOWLEDGMENTS
Authors are thankful to Matjaž Červek, Srečko Medved
and Giulio Magrini for providing samples and valuable
information, and also Patrick Berrebi and Peter Trontelj
for helpful comments on earlier version of this manuscript.
REFERENCES
Allendorf, F.W., Mitchell, N., Ryman, N. & Ståhl, G. (1977)
Isozyme loci in brown trout (Salmo trutta L.): detection and
interpretation from population data. Hereditas, 86, 179–190.
Apostolidis, A.P., Triantaphyllidis, C., Kouvatsi, A. &
Economidis, P.S. (1997) Mitochondrial DNA sequence variation and phylogeography among Salmo trutta L. (Greek
brown trout) populations. Molecular Ecology, 6, 531–542.
Bernatchez, L. (2001) The evolutionary history of brown trout
(Salmo trutta L.) inferred from phylogeographic, nested clade
and mismatch analyses of mitochondrial DNA variation.
Evolution, 55, 351–379.
Bernatchez, L., Guyomard, R. & Bonhomme, F. (1992) DNA
sequence variation of the mitochondrial control region among
geographically and morphologically remote European brown
trout Salmo trutta populations. Molecular Ecology, 1,
161–173.
Berrebi, P., Povž, M., Jesenšek, D., Cattaneo-Berrebi, G. &
Crivelli, A.J. (2000) The genetic diversity of native, stocked
and hybrid populations of marble trout in the Soča river,
Slovenia. Heredity, 3, 277–287.
Bettoso, N., Moro, G.A. & Cassetti, P. (2000) La fauna marina
del porticciolo di S. Croce (Golfo di Trieste). Hydrores
Information, 16 (Annuario, 1999), 7–19.
Bowling, A.T., Del Valle, A. & Bowling, M. (2000) A pedigreebased study of mitochondrial D-loop DNA sequence variation among Arabian horses. Animal Genetics, 31, 1–7.
Bussani, M. (1992) Ricomparsa nel Golfo di Trieste di alcune
specie ittiche. Hydrores Information, 9, 5–7.
Chiappi, T. (1927) La Trota marina in Adriatico. Bollettino Di
Pesca, Di Piscicoltura E Di Idrobiologia, 3, 10–12.
Chiereghini, Ab S. (1818) Descrizione de¢ crostacei, de¢ testacei
e de’pesci che abitano le lagune e golfo Veneto. Op. ms.,
p. 128.
FishBase (1997) FishBase. 97 CD-ROM. ICLARM, Manila.
Giuffra, E., Bernatchez, L. & Guyomard, R. (1994) Mitochondrial control region and protein coding genes sequence
variation among phenotypic forms of brown trout Salmo
trutta from northern Italy. Molecular Ecology, 3, 161–171.
Gridelli, E. (1936) I pesci d’acqua dolce della Venezia Giulia.
Tipografia Domenico del Bianco e figlio, Udine.
Hamilton, K.E., Fergusson, A., Taggart, J.B., Tomason, T.,
Walker, A. & Fahy, E. (1989) Post-glacial colonization of
brown trout, Salmo trutta L. Ldh-5 as a phylogenetic marker
locus. Journal of Fish Biology, 35, 651–664.
Hasegawa, M., Kishino, H. & Yano, K. (1985) Dating of the
human-ape splitting by a molecular clock of mitochondrial
DNA. Journal of Molecular Evolution, 22, 160–174.
Hindar, K., Jonsson, B., Ryman, N. & Ståhl, G. (1991) Genetic
relationship among landlocked, resident, and anadromous
brown trout, Salmo trutta L. Heredity, 66, 83–91.
Kolombatović, J. (1890) Notizie ittiologiche. I. Seconda trotta
marina pescata nel mare di Vranjic Trutta adriatica n. sp.
Glasnik Hrvatskog Naravoslovnog Društva Zagreb, 5,
165–167.
Kottelat, M. (1997) European freshwater fishes. Biologia, 52
(Suppl. 5), 1–237.
McMeel, O.M., Hoey, E.M. & Ferguson, A. (2001) Partial
nucleotide sequences, and routine typing by polymerase
chain reaction-restriction fragment length polymorphism,
of the brown trout (Salmo trutta) lactate dehydrogenase,
LDH-C1*90 and *100 alleles. Molecular Ecology, 10,
29–34.
Ninni, E. (1912) Catalogo Dei Pesci Del Mare Adriatico.
C. Bertotti, Venezia.
Ninni, E. (1930) Sopra la Trutta adriatica (Kolomb.). Bulletin
de la Société Zoologique de France, 55, 446–451.
Northcote, T.G. (1992) Migration and residency in stream
Salmonids-some ecological considerations and evolutionary
consequences. Nordic Journal of Freshwater Research, 67,
5–17.
Page, R.D. (1996) TREEVIEW: an application to display
phylogenetic trees on personal computers. Computer Applications in the Bioscience, 12, 357–358.
Povž, M. (1995) Status of freshwater fishes in the Adriatic
catchment of Slovenia. Biological Conservation, 72,
171–177.
Povž, M., Jesenšek, D., Berrebi, P. & Crivelli, A.J. (1996) The
Marble trout Salmo trutta marmoratus, Cuvier 1817, in the
Soča River basin, Slovenia. Tour du Valat Publication, Arles.
Skala, Ø. & Nævdal, G. (1989) Genetic differentiation between
freshwater resident and anadromous brown trout, Salmo trutta,
within watercourses. Journal of Fish Biology, 34, 597–605.
Snoj, A., Jug, T., Melkič, E., Sušnik, S., Jesenšek, D., Budihna,
N., Pohar, J. & Dovč, P. (2000) Mitochondrial and microsatellite DNA analysis of marble trout in Slovenia. Journal of
Freshwater Biology (Quaderni ETP), 29, 5–11.
2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185
‘Brown trout’ in the north Adriatic Sea 1185
Strimmer, K. & von Haeseler, A. (1996) Quartet puzzling: a
quartet maximum likelihood method for reconstructing tree
topologies. Molecular Biology and Evolution, 13, 964–969.
Svetovidov, A.N. (1984) Salmonidae. Fishes of the north-eastern
Atlantic and the Mediterranean, Vol. 1 (eds P.J.P. Whitehead,
M.L. Bauchot, J.C. Hureau, J. Nielsen and E. Tortonese),
pp. 373–385. UNESCO, Paris.
Teskeredžić, E. & Edwards, D. (1987) Coho thrive in Adriatic
trials. Fish Farmer, 10, 36–37.
Teskeredžić, E. & Teskeredžić, Z. (1990) A successful rearing
experiment with amago salmon (Oncorhynchus masou
rhodurus) in floating cages in the Adriatic Sea. Aquaculture,
86, 201–208.
Teskeredžić, E., Teskeredžić, Z., Tomec, M. & Hacmanjek, M.
(1989) Culture of coho salmon (Oncorhynchus kisutch) and
rainbow trout (Salmo gairdneri) in the Adriatic Sea. World
Aquaculture, 20, 56–57.
Tortonese, E. (1935) Elenco dei pesci italiani con annotazioni
sistematiche. Bollettino Di Pesca, Di Piscicoltura E Di
Idrobiologia, 11, 211–254.
Tortonese, E. (1970) Osteichthyes (Pesci ossei). Parte prima:
Fauna D’italia, Vol. 10. Edizioni Calderini, Bologna, pp. 1–
565.
Zei, M. (1996) Ribe severnega Jadrana. Narava Slovenije, stanje
in perspektive. Zbornik prispevkov o naravni dediščini
Slovenije (ed. J. Gregori), pp. 356–361. Društvo ekologov
Slovenije, Ljubljana.
2002 Blackwell Science Ltd, Journal of Biogeography, 29, 1179–1185
BIOSKETCHES
The paper is a part of research, in which genetic
background and phylogeography of salmonids from the
Adriatic river system are studied.
Aleš Snoj is Research Associate at the University of
Ljubljana, Department of Animal Science. He is particularly engaged in phylogeography and conservation
genetics of endangered salmonids inhabiting the Adriatic
drainage of western Balkan Peninsula. His latest research
publications are associated with genetic characterization
of two endemic salmonids in the north Adriatic drainage
area, marble trout and Adriatic grayling.
Bojan Marčeta is a marine biologist at the National
Institute of Biology. He works on fishery biology and
marine fish ecology. He is a Slovene representative for
International Bottom Trawl Survey programme (MEDITS) and regional FAO-AdriaMed project. His latest
research interest deals with monitoring of the fishery
resources in the Adriatic Sea. He is the author of the
‘Determination Key’ for Slovene marine teleosts.