Journal
of General Virology (2001), 82, 2621–2627. Printed in Great Britain
..........................................................................................................................................................................................................
SHORT COMMUNICATION
Interaction of picornavirus 2C polypeptide with the viral
negative-strand RNA
Rajeev Banerjee and Asim Dasgupta
Department of Microbiology, Immunology and Molecular Genetics, UCLA School of Medicine, University of California at Los Angeles,
Los Angeles, California, CA-90095, USA
The picornavirus membrane-associated polypeptide 2C is believed to be required for viral RNA
synthesis. Hepatitis A virus (HAV)- and human
rhinovirus (HRV)-encoded recombinant 2C proteins
have been expressed, purified and examined for
their ability to interact with the terminal sequences
of viral positive- and negative-strand RNAs. The
results demonstrate that both the HAV- and the
HRV-encoded 2C polypeptide specifically interact
with the 3h-terminal sequences of the negativestrand RNA, but not with the complementary sequences at the 5h terminus of the positive-strand
RNA. This interaction was detected by both mobility
gel shift and UV cross-linking assays. Furthermore,
complex formation exhibited dose-dependency and
competition assays confirmed specificity. These
results are consistent with our previous observation
using the poliovirus 2C protein. The implication of
the picornavirus 2C protein binding to the 3hterminal sequence of the negative-strand untranslated region in viral RNA synthesis is discussed.
Picornaviruses encompass a large group of medically
important viruses, including those that induce poliomyelitis
(polioviruses, PV), the common cold (human rhinoviruses,
HRV), infectious hepatitis (hepatitis A virus, HAV) and
myocarditis and encephalitis (coxsackieviruses). These viruses
contain single-strand, positive-sense RNA genomes. PV has
been used as the prototype of picornaviruses to understand the
molecular biology of replication of these viruses. The RNA
genome translates into a single large polyprotein that is
proteolytically processed into mature viral structural and
nonstructural polypeptides by the virus-encoded proteases.
Initial processing of the polyprotein produces three large
precursor polypeptides, termed P1, P2 and P3. Further
processing of P1 yields the structural proteins VP1, VP2, VP3
Author for correspondence : Asim Dasgupta.
Fax j1 310 206 3865. e-mail dasgupta!ucla.edu
0001-7795 # 2001 SGM
and VP4, while that of P2 and P3 produces all of the
nonstructural proteins, including the polymerase (3Dpol),
proteases (2Apro and 3Cpro) and VPg-3B, the genome-linked
protein (Kitamura et al., 1981). The 5h untranslated region
(UTR) of both PV and HRV type 14 (HRV-14) comprise two
distinct elements that appear to act independently : a cloverleaf
structure that is formed from the first 100 nucleotides and
which is required for replication and the remaining nucleotides
120–640 contain the ribosome entry site (IRES). In contrast to
PV and HRV-14, the 5h 100 nucleotides of HAV 5h UTR fold
into three separate stem–loop structures called SL-I, -IIa and
-IIb, which are followed by the polypyrimidine tract that
demarcates the IRES (Brown et al., 1991 ; Lemon & Robertson,
1993 ; Kusov & Gauss-Muller, 1997). The input viral RNA
replicates via synthesis of a complementary negative-strand
RNA, which serves as a template for the production of
progeny virion RNA. Most, if not all, of the nonstructural
polypeptides appear to be involved in viral RNA replication.
The 2C protein encoded by the P2 region of the
polyprotein is highly conserved among picornaviruses
(Gorbalenya et al., 1989). During PV infection, 2C and its
precursor 2BC migrate to the rough endoplasmic reticulum
where they induce the formation of smooth membrane vesicles
that bud off and become the site of viral RNA synthesis, the
replication complex (Bienz et al., 1987, 1992, 1990 ; Cho et al.,
1994 ; Teterina et al., 1997). 2C is a multifunctional protein
and some of these functions include ATPase and GTPase
(Rodriguez & Carrasco, 1993 ; Mirzayan & Wimmer, 1994 ;
Pfister & Wimmer, 1999), membrane-binding (Kusov et al.,
1998 ; Echeverri & Dasgupta, 1995 ; Aldabe & Carrasco, 1995)
and RNA-binding activities (Rodriguez & Carrasco, 1995).
In a previous study, we have shown that PV-encoded 2C
and the precursor polypeptide 2BC specifically interact with
the 3h-terminal sequences of the negative-strand RNA, but not
with the corresponding 5h-terminal sequences of the positivestrand RNA (Banerjee et al., 1997, 2001). We have also
demonstrated that this interaction requires a stable stem–loop
structure to be present at the 3h terminus of the negative-strand
RNA. Because PV replication occurs in the cytoplasmic
membrane and the 2C protein is capable of interacting with
both the membrane and the viral negative-strand RNA, it was
hypothesized that the 2C protein anchors the negative-strand
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 01:59:09
CGCB
R. Banerjee and A. Dasgupta
Fig. 1. Expression and purification of virus-encoded 2C protein. The coding sequences of the proteins were aligned to data
published previously (Cohen et al., 1987 ; Stanway et al., 1984). Primer pairs incorporating either a HindIII or a BamHI enzyme
restriction site were designed to amplify HRV 2C (5h TAACGCCGGATCCAGCAAATGATGGATGGTTCT 3h and 3h
AGCGGGACTCGAGTTGAAACAGTGTTTCTAGG 5h) and 2BC (5h CGATTAAGGATCCGGGGCTGAGTGATTACATCA 3h and the
above reverse primer). To generate the HAV 2C clone, the primer pair 5h CGCGCAGGATCCGAGTTTTTCCAACTGGTTAA 3h and
3h CGAGCGCTCGAGCTGAGACCACAACTCCATGA 5h was used. The amplified, sequentially digested and gel-purified sequences
were inserted into the corresponding enzyme restriction sites of the pET expression vector (Novagen) using standard
protocols. E. coli BL21(DE3) cells harbouring recombinant pET with the 2C/2BC-coding sequence were induced by IPTG. Cells
were harvested 3n5 h post-induction and the proteins were isolated by metal-affinity chromatography. The Coomassie stain of
the expressed, isolated 2C proteins corresponding to either (A) HRV-14 or (B) HAV are shown. The identity of the purified
proteins was examined by Western blot analysis (chemiluminescence). (B) Either purified PV 2C (without the T7 tag, lane 1) or
HAV 2C (with the intact T7 tag, lane 2) was examined by immunoblot blot analysis using an antibody against the T7 tag.
RNA to the membrane. This anchoring may be crucial for the
synthesis of positive-strand RNA from the negative-strand
RNA template. Here, we have extended our 2C–RNA
interaction studies to demonstrate that the purified 2C proteins
from both HAV and HRV-14 also interact specifically with the
3h-terminal sequences of the corresponding negative-strand
RNAs.
To examine the RNA-binding properties of HAV- and
HRV-encoded 2C protein, plasmids containing the 2C-coding
sequences were expressed in Escherichia coli. The expressed
proteins had a T7 tag at the N terminus and a six residue
histidine tag at the C terminus for ease of purification. The
recombinant proteins were affinity purified through a Co#+charged resin, as reported previously (Banerjee et al., 2000). As
can be seen in Fig. 1, both HAV- and HRV-encoded 2C
polypeptides (molecular mass of approximately 45 kDa) were
purified to near homogeneity, as judged by Coomassie staining
after SDS–PAGE. Both proteins reacted with a monoclonal
antibody against the sequence of the T7 tag on Western blot.
However, the PV-encoded 2C protein lacking the T7 tag did
not react with the antibody, thus confirming the specificity of
this antibody (Fig. 1 B, compare lanes 1 and 2).
The first 100 nucleotides at the 5h end of the positive-strand
RNAs of HAV and HRV-14 have a high probability of folding
into secondary structures (Fig. 2 A). A similar type of
stem–loop structure is also predicted to form at the 3h end of
CGCC
the negative-strand RNA, which is complementary to the 5h
100 nucleotides of the positive-strand RNA. In PV, the
cloverleaf structure at the 5h end of positive-strand RNA plays
an important role in viral RNA synthesis (Andino et al., 1990,
1993). Two viral proteins, 3C and 3D (or the precursor
polypeptide 3CD), and a ribosome-associated cellular protein
(p36) bind to this structure. To investigate the interaction of
HAV and HRV 2C with the predicted stem–loop structures at
the 5h end of positive-strand RNA and the 3h end of negativestrand RNA, the corresponding labelled UTR sequences were
synthesized in vitro. The affinity purified 2C protein was
incubated with gel-eluted positive- and negative-strand RNA
probes in a binding reaction and the RNA–protein complexes
were examined by a gel shift assay. The typical binding
reaction contained 5 mM HEPES (pH 7n9), 25 mM KCl, 2 mM
MgCl , 5 % glycerol, 20 mM DTT, 2 mM ATP, 12 µg of
#
purified yeast t-RNA, RNasin (30 U) and 100 ng of purified 2C
in a total volume of 25 µl. The free negative-strand RNA
probes derived from both HAV and HRV were found to have
more than one form under nondenaturing conditions, which
could be due to the formation of various secondary structures
(Fig. 2 B, lane 3) (Banerjee et al., 1997, 2001). The positivestrand RNA probes also exhibited forms that migrated more
slowly, but to a lesser extent. However, both the negative- and
positive-strand RNA probes showed single bands that corresponded to full-length transcripts when analysed by denaturing
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 01:59:09
Picornavirus 2C–RNA interaction
Fig. 2. (A) Schematic representation of the viral 5h and 3h UTRs used in the present analysis. The sequence and the predicted
structure of the first 100 nucleotides of the positive-strand UTR (5h UTR100) from the two picornaviruses are shown (adapted
from Rohll et al., 1994 ; Brown et al., 1991 ; Cohen et al., 1987). The negative-strand 3h UTR100 is predicted to form a similar
structure with complementary sequences of the bases indicated. The UTR sequences were amplified from the template cDNAs
using the primer pairs R-f, 5h CAGCTTGAATTCTTAAAACAGCGGATG 3h, and R-r, 3h CTTAGCAAGCTTAAGGAAGGGTGGTTG 5h,
for HRV and A-f, 5h GTAGCCGAATTCTTCAAGAGGGGTCTCC 3h, and A-r, 3h GCGCCGAAGCTTAATTTAGCCTATAGC 5h, for HAV.
The UTR sequences were then ligated into the pGEM-3 vector (Promega) at the HindIII and EcoRI sites (underlined). Probes
were generated using the appropriate RNA polymerase, along with [32P]UTP (0n1 PBq/mmol) (Amersham) in the transcription
reaction. A filter binding assay was used to determine the counts of radioactivity incorporated. Probes used later during the
binding assay were diluted to either 20 000 (for gel shift analysis) or 100 000 c.p.m./µl (for UV cross-linking analysis) with
nuclease-free water for each reaction. The filter assay was repeated after dilution to ensure that similar counts were added to
individual reactions. (B) Binding analysis of HRV and HAV 2C proteins to the cognate UTR100 RNA probe. Gel-purified, 32Plabelled RNA probes corresponding to the 5h UTR100 of the positive-strand RNA or the 3h-terminal sequence of the negativestrand RNA were incubated for 15 min at 30 mC with purified 2C/2BC and the binding reaction components (as described in
the text). The specific RNA–protein complexes formed were analysed by electrophoretic mobility gel shift assay. The positions
of the free probe (labelled F) and the retarded nucleoprotein complex (labelled C) are indicated. Lanes 1 and 2 correspond to
the binding reactions with the HRV positive-strand UTR100 probe and lanes 3–6 are reactions incubated with the negativestrand RNA probe. The gel shown on the right represents reactions that contain either positive- (lanes 7 and 8) or negativestrand (lanes 9 and 10) HAV RNA probes. The unevenly numbered lanes represent control reactions with no viral protein and
the evenly numbered lanes contained approximately 100 ng of either the 2C or the 2BC polypeptide, as indicated. Reactions in
lanes 1–6 contained HRV 2C/2BC, whereas lanes 7–10 contained HAV 2C recombinant protein. (C) Dose-dependent
interaction between the 2C protein and the negative-strand UTR100 probe. Increasing concentrations (10, 20, 40, 60, 80 and
100 ng) of the purified 2C protein from either HRV or HAV were added to the binding reactions, as above, and incubated with
the appropriate 3h UTR100 probe. The specific nucleoprotein complex (labelled C) formed was analysed, as described in an
earlier experiment. In both sets, lanes 1 represent control reactions with no protein. The RNA–protein complexes observed with
HRV 2C migrating more slowly are indicated by a dot and an asterisk.
gel electrophoresis (see Fig. 3 C and D, lower panel). Although
of identical length, the HRV positive-strand RNA probe
always migrated slightly faster than the negative-strand RNA
probe (Fig. 2 B, compare lanes 1 and 3). Both HAV and HRV
2C proteins formed distinct gel-retarded complexes when
incubated with the corresponding negative-strand RNA probe
(Fig. 2 B, labelled C in lanes 4 and 10). A distinct RNA–protein
complex was also detected when HRV 2BC (a precursor of 2C)
was incubated with the corresponding negative-strand RNA
probe (Fig. 2 B, lane 6). In contrast, almost no RNA–protein
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 01:59:09
CGCD
R. Banerjee and A. Dasgupta
complexes could be detected when either HAV or HRV 2C
was incubated with the appropriate positive-strand RNA
probe (Fig 2 B, lanes 2 and 8).
The formation of the RNA–protein complex increased
almost linearly with increasing concentrations of the purified
2C protein. Results presented in Fig. 2 (C, lanes 1–7) show that
at the highest concentration of HAV 2C (approximately
100 ng), almost 50 % of the probe was converted into an
RNA–protein complex. With the HRV 2C, the intensity of the
major complex (Fig. 2 C, indicated by a C) increased up to a
certain level with increasing protein ; however, at higher
concentrations of 2C, minor, but larger, complexes that
migrated more slowly than the major complexes were detected
(Fig. 2 C, indicated by an asterisk and a dot).
The specificity of RNA–protein complex formation was
examined by competition gel retardation analyses. The
addition of increasing quantities of unlabelled, homologous,
negative-strand HAV RNA (3h UTR ) inhibited the formation
"!!
of labelled RNA–protein complexes to approximately 10 % of
the control, while the addition of the same concentrations of an
unlabelled, heterologous RNA of a similar size did not affect
the formation of RNA–protein complexes (Fig. 3 A, compare
lanes 3 and 4 with lanes 5 and 6). The possibility that the
heterologous RNA is less stable than the homologous
competitor was ruled out by comparing its half-life with that of
the homologous RNA (data not shown). These results suggest
that the HAV 2C protein specifically binds to the 3h-terminal
sequence of the negative-strand UTR. Similar results were
observed for the HRV 2C protein (Fig. 3 B).
UV cross-linking studies were performed to confirm the
results obtained by gel retardation analysis. The nucleoprotein
complex that was formed between the HRV 2C protein and the
3h negative- or 5h positive-strand RNA probes was subjected
to UV irradiation and the resulting complex was analysed by
SDS–PAGE, as detailed earlier (Banerjee et al., 2000). As can be
seen in Fig. 3 (C), a distinct UV cross-linked band was detected
with the 3h negative-strand RNA probe (3h UTR ) when the
"!!
binding reaction contained the 2C protein (Fig. 3 C, compare
lanes 4 and 3). A very faint protein–nucleotidyl complex was
detected when the protein was incubated with the 5h positivestrand RNA probe (Fig. 3 C, lane 2). To examine the stability of
the RNA probes, labelled nucleoprotein complexes formed
after incubation were deproteinized and analysed by denaturing gel electrophoresis. As shown in Fig. 3 (C, lower
panel), both the positive- and negative-strand RNA probes
were equally stable in either the absence or the presence of 2C.
UV cross-linking analysis with the purified HAV 2C protein
using the viral UTR sequence from the positive- as well as the
negative-strand RNA also showed that HAV 2C interacted
with the 3h negative-strand UTR more efficiently than with the
5h positive-strand UTR (Fig. 3 D). To prove that the polypeptide bound to the 3h negative-strand UTR probe during gel
retardation analysis was indeed 2C, the HRV 2C complex was
excised from the native gel (Fig. 2 B) and resolved by second
CGCE
dimension SDS–PAGE, followed by silver-staining and simultaneous Western blot analysis using an antibody against the
N-terminal T7 tag epitope. As can be seen in Fig. 3 (E), the
RNA–protein complex was resolved into a single polypeptide
that reacted to the antibody directed against the T7 tag
epitope and also migrated to the range of the expected
molecular mass.
The results presented in this communication suggest
strongly that, like the PV 2C protein, both HRV- and HAVencoded 2C polypeptides are capable of forming specific
complexes with the 3h-terminal negative-strand RNA. Very
little, if any, complex was detected when HRV and HAV 2C
protein was incubated with the complementary positive-strand
RNA.
Previous results from our laboratory have shown that Nterminal sequences of PV 2C encompassing amino acids 21–54
and containing the putative amphipathic helix appear to play
an important role in membrane binding both in vitro and in vivo
(Echeverri & Dasgupta, 1995 ; Echeverri et al., 1998). The
inherent capacity of this protein to bind both the membrane
and the 3h end of viral negative-strand RNA suggests that 2C
may be involved in anchoring negative-strand RNA to the
virus-induced membranous complex. Such an anchoring mechanism may be essential to keep the 3h end of the negativestrand RNA immobilized so that other viral and host proteins
complexed to the 5h positive-strand cloverleaf structure
(3CD–3AB–p36) may be transferred to the 3h end of the
negative-strand RNA (Andino et al., 1993 ; Xiang et al.,
1995 ; Harris et al., 1994 ; Parsley et al., 1997). In turn, this
would facilitate the initiation of positive-strand RNA synthesis
from the membrane-anchored negative-strand RNA. Results
published recently have shown that the HAV 2C\2BC protein
induces membrane rearrangement and is capable of binding
eukaryotic membranes and, also, that this membrane-binding
ability resides within the N-terminal amphipathic helix of 2C
(Kusov et al., 1998 ; Monika et al., 1988 ; Teterina et al., 1992,
1997). Thus, like its PV counterpart, HAV 2C is capable also of
interacting with both 3h-terminal negative-strand RNA sequences (this report) and cellular membranes. These observations, therefore, reinforce our view that the 2C protein may
be involved in anchoring negative-strand RNA into the
intracellular membrane structures (membranous replication
complexes) and aid in the initiation of positive-strand RNA
synthesis. In contrast to our findings, a recent report has shown
that the 2C protein from echovirus type 9, also a picornavirus,
exhibits nonspecific binding when an RNA sequence (371
bases) was used in the assay (Klein et al., 2000). The precise
reason for this discrepancy is not known, but it could be due to
the fact that no nonspecific RNA was used in the binding
reaction.
The results presented here do not rule out the possibility
that the interaction of other viral or host cell proteins with the
5h- and 3h-terminal sequences of viral positive- and\or
negative-strand RNA is important for viral genome replication.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 01:59:09
Picornavirus 2C–RNA interaction
Fig. 3. (A) Specificity of HAV interaction with the corresponding UTR100 RNA probe. Increasing quantities of cold, homologous
RNA representing the 3h-terminal 100 bases (of the negative-strand) and a comparably sized heterologous RNA (obtained from
a standard in vitro transcription reaction) were used in the competition assay. This nonspecific RNA was derived from a clone
containing a partial hepatitis C virus 5h UTR sequence (Banerjee & Dasgupta, 2001). The integrity of the cold RNAs was
confirmed prior to their use. The resulting retarded nucleoprotein complex (labelled C) formed in the presence of competing
specific or nonspecific RNAs was analysed, as described in earlier experiments. Lane 1 represents a reaction with no protein,
whereas 100 ng of HAV 2C was added to the reactions shown in lanes 2–6. Lanes 3–6 contain 100 and 200 ng of either
specific (lanes 3 and 4) or nonspecific (lanes 5 and 6) competing RNA. (B) Specificity of HRV 2C. Lane 1 is a control reaction
with no competitor RNA, while lanes 2–5 contain 150 and 250 ng of either nonspecific (lanes 2 and 3) or specific (lanes 4
and 5) unlabelled RNA. Lane 6 represents a reaction with no protein. HRV 32P-labelled RNA probe was used as the labelled
probe in all lanes. The position of the free probe (labelled F) is indicated. (C, D) UV cross-linking analysis of HRV and HAV 2C
interaction with the positive- and negative-strand UTR100 probes. UV cross-linking and 32P-label transfer to purified 2C,
following incubation, was carried out as described earlier (Banerjee et al., 2000). Samples were mixed with 2i SDS sample
buffer (1 : 1 v/v) and resolved on a 14 % denaturing gel. The unevenly numbered lanes represent control reactions and the
evenly numbered lanes represent reactions to which HRV (C) or HAV (D) 2C has been added. Lanes 1 and 2 indicate
reactions with the positive-strand probe, while lanes 3 and 4 represent reactions containing the negative-strand RNA probe.
The labelled proteins in (C) were derived from the HRV RNA, while HAV RNA probes were used in (D). The migration of the
[35S]methionine-labelled (in vitro translated) HRV or HAV 2C proteins (obtained from the same expression clone) is shown in
the lanes marked R. The numbers on the side of the gels correspond to the migration positions of pre-stained molecular mass
markers (kDa). The specific UV-induced ribonucleoprotein complex formed is indicated by the arrow. The lower gel panels in
both (C) and (D) show the stability of the two RNA probes used in the presence or absence of 2C analysed on a denaturing
gel (8 % acrylamide : 8 M urea sequencing gel). (E) Analysis of the 2C–UTR interaction. The specific complex observed
between the HRV 2C protein and the UTR100 RNA probes (as in Fig. 2) was excised and analysed for the presence of 2C. The
complexes from three independent binding reactions were pooled and resolved by second dimension SDS–PAGE. A portion of
the gel was silver-stained and an identical portion was probed with a monoclonal antibody against the N-terminal T7 tag,
following transfer to nitrocellulose. The molecular mass marker proteins were also resolved alongside during the staining
process.
In fact, interaction of HAV 3AB and 3ABC with the 5h- and 3htermini of the HAV RNA as well as binding of host cell
proteins to rhinovirus 3h-terminal sequences have been reported (Kusov et al., 1997 ; Todd et al., 1995 ; Mellits et al.,
1998). Future studies will be directed towards understanding
the precise role of the 2C protein in virus replication and
mapping the sequence contributing towards the specificity.
This work was supported by the NIH grants AI-27451 and AI-45733.
We are grateful to Drs Jeffery Cohen (NIH) and Ronald Ruckert
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 01:59:09
CGCF
R. Banerjee and A. Dasgupta
(University of Wisconsin) for providing us with the cDNA clones used
for the amplification of the UTR and the corresponding 2C region. We
would also like to thank Weimin Tsai for the illustration and Winnie Kim
for her help during the initial part of this study.
References
Aldabe, R. & Carrasco, L. (1995). Induction of membrane proliferation
by poliovirus proteins 2C and 2BC. Biochemical and Biophysical Research
Communications 206, 64–76.
Andino, R., Rieckhof, G. E. & Baltimore, D. (1990). A functional
ribonucleoprotein complex forms around the 5h end of poliovirus RNA.
Cell 63, 369–380.
Andino, R., Rieckhof, G. E., Achacoso, P. L. & Baltimore, D. (1993).
Poliovirus RNA synthesis utilizes an RNP complex formed around the 5hend of viral RNA. EMBO Journal 12, 3587–3598.
Banerjee, R. & Dasgupta, A. (2001). Specific interaction of hepatitis C
virus protease\helicase NS3 with the 3h-terminal sequences of the viral
positive- and negative-strand RNA. Journal of Virology 75, 1708–1721.
Banerjee, R., Echeverri, A. & Dasgupta, A. (1997). Poliovirus-encoded
2C polypeptide specifically binds to the 3h-terminal sequences of viral
negative-strand RNA. Journal of Virology 71, 9570–9578.
Banerjee, R., Igo, M., Izumi, R., Datta, U. & Dasgupta, A. (2000). In
vitro replication of RNA viruses. In RNA Viruses : A Practical Approach, pp.
158–164. Edited by A. J. Cann. New York : Oxford University Press.
Banerjee, R., Tsai, W., Kim, W. & Dasgupta, A. (2001). Interaction of
poliovirus-encoded 2C\2BC polypeptide with the 3h terminus negativestrand cloverleaf requires an intact stem–loop b. Virology 280, 41–51.
Bienz, K., Egger, D. & Pasamontes, L. (1987). Association of polioviral
proteins of the P2 genomic region with the viral replication complex and
virus-induced membrane synthesis as visualized by electron microscopic
immunocytochemistry and autoradiography. Virology 160, 220–226.
Bienz, K., Egger, D., Troxler, M. & Pasamontes, L. (1990). Structural
organization of poliovirus RNA replication is mediated by viral proteins
of the P2 genomic region. Journal of Virology 64, 1156–1163.
Bienz, K., Egger, D., Pfister, T. & Troxler, M. (1992). Structural and
functional characterization of the poliovirus replication complex. Journal
of Virology 66, 2740–2747.
Brown, E. A., Day, S. P., Jansen, R. W. & Lemon, S. M. (1991). The 5h
nontranslated region of hepatitis A virus RNA : secondary structure and
elements required for translation in vitro. Journal of Virology 65,
5828–5838.
Cho, M. W., Teterina, N. L., Egger, D., Bienz, K. & Ehrenfeld, E.
(1994). Membrane rearrangement and vesicle induction by recombinant
poliovirus 2C and 2BC in human cells. Virology 202, 129–145.
Cohen, J. I., Ticehurst, J. R., Purcell, R. H., Buckler-White, A. &
Baroudy, B. M. (1987). Complete nucleotide sequence of wild-type
hepatitis A virus : comparison with different strains of hepatitis A virus
and other picornaviruses. Journal of Virology 61, 50–59.
Echeverri, A. C. & Dasgupta, A. (1995). Amino-terminal region of
poliovirus 2C protein mediates membrane binding. Virology 208,
540–553.
Echeverri, A. C., Banerjee, R. & Dasgupta, A. (1998). Amino terminal
region of poliovirus 2C is sufficient for membrane binding. Virus Research
54, 217–223.
Harris, K. S., Xiang, W., Alexander, L., Lane, W. S., Paul, A. V. &
Wimmer, E. (1994). Interaction of poliovirus polypeptide 3CDpro with
the 5h and 3h termini of the poliovirus genome. Identification of viral and
cellular cofactors needed for efficient binding. Journal of Biological
Chemistry 269, 27004–27014.
Kitamura, N., Semler, B. L., Rothberg, P. G., Larsen, G. R., Adler, C. J.,
Dorner, J. A., Emini, E. A., Hanecak, R., Lee, J. J., van der Werf, S.,
Anderson, C. W. & Wimmer, E. (1981). Primary structure, gene
organization and polypeptide expression of poliovirus RNA. Nature 291,
547–553.
Klein, M., Eggers, H. J. & Nelsen-Salz, B. (2000). Echovirus-9 protein
2C binds single-stranded RNA unspecifically. Journal of General Virology
81, 2481–2484.
Kusov, Y. Y. & Gauss-Muller, V. (1997). In vitro RNA binding of the
hepatitis A virus proteinase 3C (HAV 3Cpro) to secondary structure
elements within the 5h terminus of the HAV genome. RNA 3, 291–302.
Kusov, Y. Y., Morace, G., Probst, C. & Gauss-Muller, V. (1997).
Interaction of hepatitis A virus (HAV) precursor proteins 3AB and 3ABC
with the 5h and 3h termini of the HAV RNA. Virus Research 51, 151–157.
Kusov, Y. Y., Probst, C., Jecht, M., Jost, P. D. & Gauss-Muller, V.
(1998). Membrane association and RNA binding of recombinant
hepatitis A virus protein 2C. Archives of Virology 143, 931–944.
Lemon, S. M. & Robertson, B. H. (1993). Current perspectives in the
virology and molecular biology of hepatitis A virus. Seminars in Virology
4, 285–295.
Mellits, K. H., Meredith, J. M., Rohll, J. B., Evans, D. J. & Almond, J. W.
(1998). Binding of a cellular factor to the 3h untranslated region of the
RNA genomes of entero- and rhinoviruses plays a role in virus replication.
Journal of General Virology 79, 1715–1723.
Mirzayan, C. & Wimmer, E. (1994). Biochemical studies on poliovirus
polypeptide 2C : evidence for ATPase activity. Virology 189, 176–187.
Monika, J., Probst, C. & Gauss-Muller, V. (1988). Membrane permeability induced by HAV proteins 2B and 2BC and proteolytic
processing of HAV 2BC. Virology 252, 218–227.
Parsley, T. B., Towner, J. S., Blyn, L. B., Ehrenfeld, E. & Semler, B. L.
(1997). Poly(rC) binding protein 2 forms a ternary complex with the 5h-
terminal sequences of poliovirus RNA and the viral 3CD proteinase.
RNA 3, 1124–1134.
Pfister, T. & Wimmer, E. (1999). Characterization of the nucleoside
triphosphatase activity of poliovirus protein 2C reveals a mechanism by
which guanidine inhibits poliovirus replication. Journal of Biological
Chemistry 274, 6992–7001.
Rodriguez, P. L. & Carrasco, L. (1993). Poliovirus protein 2C has
ATPase and GTPase activities. Journal of Biological Chemistry 268,
8105–8110.
Rodriguez, P. L. & Carrasco, L. (1995). Poliovirus protein 2C contains
two regions involved in RNA binding activity. Journal of Biological
Chemistry 270, 10105–10112.
Rohll, J. B., Percy, N., Ley, R., Evans, D. J., Almond, J. W. & Barclay,
W. S. (1994). The 5h-untranslated region of picornavirus RNAs contain
independent functional domains essential for RNA replication and
translation. Journal of Virology 68, 4384–4391.
Stanway, G., Hughes, P. J., Mountford, C. R., Minor, P. D. & Almond,
J. W. (1984). The complete nucleotide sequence of a common cold virus :
human rhinovirus 14. Nucleic Acid Research 12, 7859–7875.
Gorbalenya, A. F., Blinov, V. M., Donchenko, A. P. & Koonin, E. V.
(1989). An NTP-binding motif is the most conserved sequence in a
Teterina, N. L., Kean, K. M., Gorbalenya, A. E., Agol, V. I. & Girard, M.
(1992). Analysis of the functional significance of amino acid residues in
highly diverged monophyletic group of proteins involved in positive
strand RNA viral replication. Journal of Molecular Evolution 28, 256–268.
the putative NTP-binding pattern of the poliovirus 2C protein. Journal of
General Virology 73, 1977–1980.
CGCG
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 01:59:09
Picornavirus 2C–RNA interaction
Teterina, N. L., Bienz, K., Egger, D., Gorbalenya, A. G. & Ehrenfeld, E.
(1997). Induction of intracellular membrane rearrangements by HAV
proteins 2C and 2BC. Virology 237, 66–77.
Xiang, W., Harris, K. S., Alexander, L. & Wimmer, E. (1995). Interaction
between the 5h-terminal cloverleaf and 3AB\3CDpro of poliovirus is
essential for RNA replication. Journal of Virology 69, 3658–3667.
Todd, S., Nguyen, J. H. & Semler, B. L. (1995). RNA–protein
interactions directed by the 3h end of the human rhinovirus genomic
RNA. Journal of Virology 69, 3605–3614.
Received 11 April 2001 ; Accepted 31 July 2001
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 01:59:09
CGCH