Journal of Experimental Botany, Vol. 56, No. 414, pp. 1245–1253, April 2005
doi:10.1093/jxb/eri120 Advance Access publication 7 March, 2005
RESEARCH PAPER
Modified sucrose, starch, and ATP levels in two
alloplasmic male-sterile lines of B. napus
Rita Teresa Teixeira, Carina Knorpp and Kristina Glimelius*
Department of Plant Biology and Forest Genetics, Swedish University for Agricultural Sciences,
Box 7080, SE-750 07 Uppsala, Sweden
Received 13 August 2004; Accepted 20 January 2005
Abstract
Alloplasmic lines of Brassica napus with rearranged
Arabidopsis thaliana mitochondrial DNA are male sterile and vegetatively altered compared with B. napus cv.
Hanna. The CMS lines contain pure nuclear and plastid
genomes from B. napus. Cross-sections of leaves
revealed elevated starch accumulation and a higher
number of chloroplasts per cell area in CMS plants
compared with B. napus. The increase in chloroplast
density was found to be the result of the smaller
mesophyll cells. Sucrose concentration in the leaves
of the CMS lines was reduced both in green leaves as
well as in leaves from 2 d-etiolated plants. Flower
meristem, flower buds, and leaves from green and 2 detiolated plants were analysed for ATP and ADP contents. All CMS plant tissues, except for green leaves,
possessed lower ATP levels than B. napus. The results
indicate that the reduced availability of energy, i.e. ATP
and sucrose in the CMS plants, limits plant growth.
This is supported by the reduced levels of two D-type
cyclin transcripts and the reduced capacity of the CMS
plants to recover after etiolation.
Key words: ATP, B. napus, CMS, mitochondria, starch, sucrose.
Introduction
In plant cells, the nuclear, mitochondrial, and plastid
genomes interact in a highly co-ordinated manner that
is exemplified not only by nuclear regulation of the
mitochondria and chloroplast, but also by communication
between the two organelles. Such organelle interactions are
well known from cytoplasmic male sterile (CMS) plants,
maternally inherited non-chromosomal stripe (NCS) mutants (Marienfeld and Newton, 1994) and growth-deficient
tobacco cybrids (Zubko et al., 2001) where the aberrant
development was caused by the disturbed communications
between nuclei and mitochondria. Mutations in chloroplast
DNA can also interfere with mitochondrial activity and
gene expression (Hedtke et al., 1999). Chloroplasts and
mitochondria communicate through metabolites, exemplified by photorespiration and energy metabolism (reviewed
by Bowsher and Tobin, 2001). Mitochondria produce ATP
during both the day and night, while the chloroplasts
produce ATP only during the day. This energy is then used
by the organelle to fix carbon. The chloroplasts export
triose phosphates (triose-P) to the cytosol, which is used
for sucrose synthesis (reviewed by Raghavendra and
Padmasree, 2003). The mitochondria indirectly limit the
rate of sucrose-P synthesis by limiting production of the
ATP necessary for supplying the UTP required for UDPGlucose formation (Hanson, 1991). Inhibition of sucrose
synthesis also leads to the limitation of photosynthesis and
the stimulation of starch synthesis (Strand et al., 2000).
Sucrose has multiple functions. It regulates photosynthesis and respiration, serving as a key component for
storage compounds and helps to maintain the osmotic
pressure in the cytosol. However, the function of sucrose as
an important signalling molecule that regulates several
genes was recently recognized (reviewed by Sheen et al.,
1999; Ohto et al., 2001; Rolland et al., 2002). Thus,
sucrose molecules are reported to act as signalling substances and are proposed to have hormone-like functions as
primary messengers in signal transduction. Moreover,
sucrose molecules regulate gene expression at transcriptional and post-transcriptional levels (Sheen et al., 1999;
* To whom correspondence should be addressed: Fax: +46 18 67 32 79. E-mail: [email protected]
Abbreviations: CMS, cytoplasmic male sterility; mtDNA, mitochondrial DNA; ORFs, open reading frames; PCR, polymerase chain reaction; SEM, scanning
electron microscope; TEM, transmission electron microscope.
ª The Author [2005]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved.
For Permissions, please e-mail: [email protected]
1246 Teixeira et al.
Rolland et al., 2002). Their action mimics morphogens by
providing positional information to the cell cycle machinery and different developmental programmes (reviewed by
Rolland et al., 2002). A good example is the differential
regulation of expression of D-type cyclins by sucrose
(Riou-Khamlichi et al., 2000).
In the present work, two alloplasmic CMS lines of
Brassica napus containing rearranged Arabidopsis thaliana
mtDNA (Forsberg et al., 1998; Leino et al., 2003) have
been investigated and compared to the parental fertile B.
napus cultivar. Alloplasmic lines frequently display homeotic conversions that have been attributed to the disturbed
interactions between nuclei and mitochondria. However,
besides homeotic conversion of the anthers, vegetative
modifications are also characteristic of the material used
here. The comparisons performed in this study mainly
concern the vegetative modifications. The vegetative
growth of the CMS lines seems to be affected by reduced
levels of ATP and sucrose, that, in turn, leads to an extra
production of starch in the leaves. With the results reported,
new insights about the causes behind the modified developmental patterns obtained in alloplasmic CMS systems
are brought forward. These relate not only to flower
development but also to the vegetative changes throughout
the vegetative development.
Materials and methods
Plant material
Two alloplasmic lines 4:19 and 41:17, were derived from somatic
hybrids produced via protoplast fusion between B. napus and A.
thaliana var. Landsberg erecta by Forsberg et al. (1998). The hybrids
were backcrossed to B. napus cv. Hanna for eight generations
resulting in lines with the nuclear genome of B. napus. Southern
analysis (Leino et al., 2003) and RFLP analysis (data not shown)
demonstrated that the chloroplast genome was of B. napus while the
mitochondrial genome had rearranged DNA inherited from B. napus
and A. thaliana. Both lines are male sterile and display vegetative
aberrations that are stable through successive generations. Beside the
CMS-lines, B. napus cv. Hanna, the parental line, which served as
donor of the nuclear and plastid genomes of the CMS lines, was
included in the study. Plants were grown in pots under controlled
conditions in a climate chamber with 22/18 8C day/night temperatures
and a photoperiod of 16 h. Light intensity was 400 lmol mÿ2 sÿ1
and the air humidity was kept at 85%.
Measurements of cell number and cell size
Cell number and cell size were measured in the internodes of four
plants from each line. Sections of the epidermal layer were peeled from
the internode region between the third and fourth fully expanded
leaves. The epidermal peel was mounted on a slide and stained with
Toluidine blue, observed under the microscope and photographed
using the same magnification for all the investigations. The areas
investigated were equivalent for all lines. Cell size was measured by
using a micro-scale photographed in the same manner. The same
procedure was used for the investigation of leaves. Adaxial epidermal
sections were peeled from the middle region of the leaf (half the leaf
length) next to the mid-vein. The shape of the leaves was the same for
B. napus and the CMS lines so the leaf area was considered as a
rectangle (length3width). One-hundred leaf cells from four different
plants were measured. These values were used to calculate the
epidermal cell number. The same criteria described above were
applied to calculate the vacuole volume area. Measurements were
made from cross-sections of three independent green leaves from each
line. These cross-sections were also used for counting the chloroplast
number. Approximately 100 cells were randomly selected in each line.
Light microscopy, transmission and scanning electron
microscopy
For cytological observations, green leaves from the wild-type line
and the two CMS lines (41:17 and 4:19) were fixed with 2.5%
glutaraldehyde in 0.05 M phosphate buffer, pH 6.8 (buffer A) at room
temperature for 2 h, rinsed in buffer A, then post-fixed in 2% osmium
tetroxide (buffer A) for 2 h at room temperature. The samples were
rinsed with buffer A (three times). The material was dehydrated in
a graded ethanol series (20, 40, 60, 80, 95, and 100%) and then
gradually embedded in Spurr’s low viscosity resin. Polymerization of
the resin was carried out at 70 8C for 12 h.
For light microscopy, 1 lm thin sections were cut with a glass
knife on a Heidelberg HM 350 microtome, floated on drops of
distilled water and dried onto microscope slides. Sections were
stained with Toluidine blue O, pH 4.5 in acetate buffer. All micrographs were taken on a Nikon Digital Sight DS-5M-L1. For TEM
studies, thin sections (90 nm) were made, double-stained with uranyl
acetate and lead citrate and studied in a Philips CM 10 TEM. For
scanning electron microscopy, portions of green leaves were fixed as
described above until the dehydrating step. The material was then
critical point dried using CO2. After mounting of the biological
samples, the material was shadowed with gold and viewed with
a JOEL JSM-6320F scanning microscope.
Protoplast isolation
Seeds of B. napus and the two CMS plants were germinated and
cultured as in vitro plants on basal MS culture medium, supplemented
with 1% sucrose. Dark green leaves from shoots cultured for 2
weeks after transfer were used for protoplast isolation according to
Glimelius (1984). The culture medium was supplemented with 0.32
M, 0.22 M, and 0.05 M of sucrose to establish a series of osmotic
dilutions during cultivation of the protoplasts. Another set of experiments was performed using the same osmotic solutions during the
isolation of the protoplasts. Two independent experiments were
performed and for each one, two replicas were performed. Around
1000 protoplasts were counted in each experiment in order to
determine viable and collapsed protoplasts, respectively.
Starch and sucrose measurements
Plants grown in pots were etiolated by keeping 4-week-old-plants in
complete darkness for 2 d. Humidity and temperature conditions were
the same as for the plants growing under a 16 h light photoperiod as
described earlier. Three green and three etiolated leaves were selected
from three plants of the same line. The samples were dried using
a freeze-drying chamber (Edwards), ground in liquid N2 and
weighed. The starch and sucrose contents were measured according
to Hurry et al. (1995).
ATP and ADP measurements
Independent samples of B. napus and the two CMS lines were
collected from three green plants and three plants that had been
etiolated for 3 d. Inflorescences with flower buds up to stage 7
(according to Smyth et al., 1990), older flower buds (from stage 7 to
stage 12), as well as green and etiolated leaves were investigated.
ATP was measured using the firefly luciferase method according to
Bergman et al. (2000) and Lundquist et al. (2003).
Metabolic alterations in CMS plants
8
Internode length (cm)
7
comparisons were performed using the Tukey test. Each measurement was treated as an independent value.
B. napus
6
CMS 4:19
5
CMS 41:17
Results
4
Plant growth
3
2
a
a a
1
a
a a
a a
a a
a
0
1º internode
2º internode
3º internode
4º internode
5º internode
250
Cell area
200
150
a
a
100
50
b
1247
0
B. napus
CMS line 4:19
CMS line 41:17
Fig. 1. (a) Internode length in cm of the first five internodes from the
stem base of B. napus, CMS line 4:19, and CMS line 41:17. (b) Stem cell
area (in lm2) measured on the third internode. The differences between B.
napus and the CMS lines are significantly different at the probability level
P <0.05 (indicated by letters). Standard deviation values are shown for
n=10. Each measurement was treated as an independent value.
Real time RT-PCR
RNA was extracted from protoplast/cells cultivated for 166 h
and cDNA was synthesized using Superscript II RNase-Reverse
Transcriptase (Invitrogen, Carlsbad, CA) according to the instructions
of the manufacturer. Real time PCR reactions were carried out using an
ABI Prism 7000 Sequence Detector (Applied Biosystems, Foster City,
CA) in MicroAmp Optical 96-well reaction plates with optical covers,
according to the instructions of the manufacturer. PCR reactions (final
volume of 25 ll) contained gene-specific primers and the passive
reference dye ROX, in order to normalize fluorescence across the plate.
Two independent biological RNA extractions were obtained. Each
sample was repeated twice. Reaction conditions were: 50 8C for 2 min,
94 8C for 10 min, followed by 40 cycles of 94 8C for 15 s, 60 8C for
1 min. Primers were designed using Primer express software (Applied
Biosystems, Foster City, CA) to flank introns so genomic DNA
contamination would not be amplified. The CycD2 primers were:
CyD2-R1 59-GAGCAGCCCAATCCTTGTCTT; CyD2-R2 59GATTTGTCTGTTCGAAACCAAGCT and the CycD3 primers
were: CyD3-R1 59-TGGACCGCATCGGTTTACA; CyD3-R2 59ACTCGCTGACCACGAATCGT. Relative quantification values and
standard deviations were calculated using the standard curve method
according to the manufacturer’s instructions (ABI Prism 7000 Sequence Detection system User Guide). Values were normalized to the
B. napus line and results were analysed using Microsoft Excel
Software.
Statistical analysis
All data were analysed with one-way ANOVA using the general
linear model procedure in the MINITAB14 software. Pairwise
Several parameters were evaluated during plant growth,
including plant size, growth pattern, flower morphology,
cell number, and cell size. Of the three lines under study,
plants were very consistent within each line for each
parameter analysed. Comparisons between lines were conducted by investigating plants at the same age cultivated
under the same light, temperature, and humidity. The CMS
lines 4:19 and 41:17, are shorter, flower later, and display
male sterility when compared with the parental line,
Brassica napus cv. Hanna (Leino et al., 2003). However,
the alloplasmic plants do reach B. napus height at maturity
with a delay of 2 weeks (data not shown). Differences were
also recorded between the two CMS lines. At the same age,
41:17 plants were always shorter in height compared with
plants from 4:19.
In order to estimate growth, internodes were measured
on 4-week-old plants. The measured length of internodes
from CMS plants was always significantly reduced when
compared with B. napus (Fig. 1a). The increase in length
between the third and fourth internodes observed for B.
napus does not occur in CMS plants. Instead, consistent
length is maintained through all the internodes (Fig. 1a).
When analysing inflorescence growth in the CMS plants,
the same tendency as for internode elongation was found.
After 6 weeks of growth, all the lines had bolted and both
CMS lines had reduced inflorescence length compared to B.
napus (B. napus: 32.7612 cm; CMS 4:19: 6.8568.6 cm;
CMS 41:17; 3.2563 cm), with CMS line 41:17 demonstrating the most severe phenotype with all the flower buds
clustered together.
To investigate whether the differences in plant height
between the three lines were due to the number or size of
the cells, internode cells were measured. The area of CMS
internode cells was half that of B. napus (Fig. 1b), in
accordance with the values for the length of the three first
internodes.
The number and the area of leaf cells were also followed.
The mesophyll thickness was reduced as revealed by cross
sections of the CMS leaves (Fig. 2a–c). This was found to
be due to reductions in cell area (Table 1) and the absence
of one row of spongy cells (Fig. 2a–c).
Abnormal starch granule accumulation in
CMS chloroplasts
Ultrastructural sections of palisade cells showed a striking
difference between B. napus and the CMS lines in the accumulation of number and size of starch granules inside the
chloroplasts of the CMS lines (Fig. 3a–c). No differences
1248 Teixeira et al.
were found in stacking of the thylakoid membrane into
lamellae and grana structures (Fig. 3d–f). The mitochondria
observed in leaves of both B. napus and CMS plants
resemble each other (Fig. 3d–f). SEM studies made of
cross-sections of B. napus and CMS line 4:19 leaves confirm
the higher chloroplast density in the CMS line (Fig. 3h)
compared with B. napus (Fig. 3g). In both lines, the vacuole
occupies the centre of the cell with the chloroplast being
distributed along the internal cell wall (Fig. 3g–h).
The number of chloroplasts per cell was similar both in
the palisade and the spongy cells of the CMS lines and B.
napus (Table 1). However, when estimating cell size, which
was larger in B. napus compared with the CMS lines due to
the large vacuole area (Table 1), a higher chloroplast density
per cell area was obtained in the CMS lines (Table 1).
Alterations in starch and sucrose content observed in
CMS leaf cells
Upon observing the large starch granules present in the
chloroplasts of the CMS leaves, green leaves were subjected to starch and sucrose quantifications. The values of
starch concentrations were significantly increased in CMS
lines 4:19 and 41:17 compared with the levels in B. napus
(Fig. 4a). By contrast, the sucrose content in green leaves
was significantly lower in the CMS lines 4:19 and 41:17
when compared with B. napus (Fig. 4b).
Measurements of starch and sucrose contents were also
performed on leaves from plants etiolated for 2 d in order to
investigate whether the starch in the CMS plants could
be metabolized. During etiolation, leaf cells of B. napus
showed a strong reduction in starch content. The levels of
sucrose were also reduced. The two CMS lines demonstrated the same reduction in starch content upon etiolation
when compared with B. napus (Fig. 4a).
The consequence of the reduced sucrose levels in the
cytoplasm of the CMS lines with respect to the osmotic
pressure of the cells was indirectly investigated by exposing
protoplasts to media of different sucrose concentration and
by isolating protoplasts in solutions of different osmolarity.
Table 2 shows the percentage of protoplasts that expanded
and burst due to the reduction in osmotic pressure of the
medium by successive dilution of the sucrose content. The
CMS protoplasts were more stable than the protoplasts
from the B. napus line by sustaining a higher dilution of the
medium. When the sucrose concentration of the medium
was reduced to 0.22 M, 50% of the B. napus protoplast
membranes ruptured due to cell expansion during equilibration with the osmotic pressure in the medium. By
contrast, only 38% and 27% of the protoplasts from CMS
Fig. 2. Cross-sections of green leaves from (a) B. napus, (b) CMS line 4:19, and (c) CMS line 41:17. Asterisk, epidermis; pl, palisade layer; sl, spongy
layer. Bar: a–c=10 lm,
Table 1. Leaf cell areas were randomly investigated in mesophyll palisade and spongy cells, means 6SD (n=30)
The number of chloroplasts present in mesophyll cells of the palisade and spongy layers was determined in sections from three different leaf materials,
means 6SD (n=60). Vacuole volume (%) of the palisade and the spongy layers. Chloroplast density per cell area of the palisade and the spongy layers
was calculated from the measurements made; means 6SD (n=60). Different letters within each row indicate significant differences at the P <0.05
probability level. Each measurement was treated as an independent value.
B. napus
2
Cell area (lm )
Chloroplasts (No.)
Vacuole
(% of total volume)
Chloroplast density
(No. per cell area)
CMS 4:19
CMS 41:17
Palisade cells
Spongy cells
Palisade cells
Spongy cells
Palisade cells
Spongy cells
121.6665 a
12.7962.7 a
83.8648 a
10.0363.6 a
59.2615.5 b
11.2362.5 a
53.6619.6 b
11.4663.3 a
61.8614.2 c
12.1662.7 a
60.2617 c
11.9363.1 a
86.966.5 a
83.967.8 a
66.369.4 b
62.5613.4 b
55.3616.8 b
56.22612 b
2.3260.8 a
2.7160.8 a
3.9261.0 b
4.4761.0 b
4.0761.1 b
4.160.9 b
Metabolic alterations in CMS plants
18
Starch (nmol/gDW)
16
14
Green leaves
Two-days etiolated
leaves
a
a
12
10
8
6
4
0
a
a
2
a
1249
B. napus
CMS 4:19
CMS 41:17
Sucrose (nmol/gDW)
25
b
Fig. 3. TEM studies of cross-sections from green leaves. (a, d) B. napus;
(b, e) CMS line 4:19; and (c, f) CMS line 41:17. SEM studies performed
on cross-sectioned leaves from (g) Brassica napus, and (h) CMS plant
4:19. Note the larger portion of the cell occupied by the chloroplasts in
the CMS line (one asterisk). Two asterisks, osmiophilic droplet; mt,
mitochondria; sg, starch granule; v, vacuole. Bars: (a) 5 lm, (d) 2 lm.
lines 4:19 and 41:17, respectively, burst due to membrane
rupture induced by the low osmotic pressure (Table 2). The
percentage of burst protoplasts was significantly lower in
the CMS lines compared with B. napus when isolation was
performed in enzymatic solutions containing reduced levels
of sucrose (Table 2). All protoplasts isolated in 0.05 M
osmotic solutions were collapsed. These experiments demonstrate that the differences between the CMS lines and B.
napus reflect true differences in osmotic pressures in the
plant cells.
CMS plants recover at a slower rate after etiolation
After 6 d of etiolation, all plants had yellowish leaves and
reduced plant height compared with light-grown plants. B.
napus plants started to bolt in darkness even though only 5–
6 leaves were formed. They reached half the height of B.
napus growing under normal light conditions. The flowers
that developed from the apical inflorescence never reached
maturity. They became yellow and died before opening. At
the same time, CMS plants reached half the height of the
etiolated B. napus plants and never showed any signs of
flower bud formation (data not shown). When etiolated
Green leaves
Two-days etiolated leaves
20
15
a
a
10
a
a
5
0
B. napus
CMS 4:19
CMS 41:17
Fig. 4. (a) Starch measurement from freeze-dried leaves obtained from 4week-old plants and from 2 d-etiolated leaves (the two measurements
were made on the same plants before and after dark treatment). (b)
Sucrose measurement from freeze-dried green leaves obtained from 4week-old plants and from 2 d-etiolated plant leaves (the two measurements were made on the same plant as above). The differences between B.
napus and the CMS lines are significantly different at the probability level
P <0.05 (indicated by letters). Standard deviation values are shown for
n=9. Each measurement was treated as an independent value for n=9.
plants were returned to regular 16 h photoperiod conditions,
one week later, the B. napus plants had recovered the green
colour of their leaves. During the same time period, CMS
lines were unable to resume chlorophyll synthesis and
recover from etiolation (Fig. 5b). However, they were still
alive. After 2 weeks of recuperation at normal photoperiod
conditions, B. napus flowers reached full maturity, while
the CMS plants only had started to develop small green
leaves (Fig. 5c).
Protoplast culture and CycD2 and CycD3 genes
expression
Owing to the reduction in cell size and cell number of the
CMS plants, cell divisions were followed in protoplasts
cultured for 7 d. The percentage of cells entering division
was determined every day at the same hour. B. napus
protoplasts always presented the highest number of dividing cells compared with the CMS lines (Table 3).
CMS plants had a reduced number of cells entering
division and a lower sucrose concentration. Thus, the
expression levels of CycD2 and CycD3 genes were analysed in protoplast samples cultivated for 166 h by real time
RT-PCR. Both CycD2 and CycD3 expression levels were
1250 Teixeira et al.
Table 2. Percentage of collapsed protoplasts obtained in the different osmotic pressures used in the enzyme solutions during
protoplast isolation (isolated) and in the culture media during cell culture (cultured)
Means 6SD (n=4) and different letters within each row are statistically different at the P <0.05 probability level.
B. napus
0.32 M
0.22 M
0.005 M
CMS 4:19
CMS 41:17
Isolated
Cultured
Isolated
Cultured
Isolated
Cultured
10.461.2 a
67.662.9 a
10060.0 a
6.360.5 a
50.461.9 a
88.561.6 a
6.160.7 b
55.862.4 b
10060.0 a
3.160.1 b
38.260.3 b
87.761.6 a
5.861.1 c
43.161.0 c
10060.0 a
3.360.2 c
27.162.9 c
81.661.4 a
Table 3. Percentage of protoplasts undergoing cell division
Means 6SD (n=3) and different letters within columns are significantly
different at the P <0.05 probability level.
Cell line
120 h
144 h
168 h
B. napus
CMS 4:19
CMS 41:17
8.9560.6 a
1.460.4 b
0.9660.3 c
11.3262.9 a
4.2561 b
3.1361.1 c
19.664.3 a
5.960.5 b
5.360.4 c
Discussion
Fig. 5. (a) Four-week-old plants. Vegetative growth of (from left to right)
Brassica napus cv. Hanna, CMS line 4:19, and CMS line 41:17 under
normal photoperiod conditions. The plants were subjected to 6 d of
etiolation. (b) Etiolated plants after 1 week with normal photoperiod
conditions. (c) The same plants as in (b) after 2 weeks under normal
photoperiod conditions.
significantly reduced in the two CMS lines compared with
B. napus (Fig. 6) with the lowest transcript levels of the two
cyclins in CMS line 41:17 (Fig. 6a, b).
ATP measurements in different tissues
The alterations in starch and sucrose in the CMS lines made
it interesting to study whether an alteration in oxidative
phosphorylation could be observed. For this reason and
because the plant growth rate is slower in CMS lines,
several tissues were investigated for their ATP and ADP
contents. Flower meristems, flower buds, green leaf tissues,
and leaf tissue from 2 d-etiolated plants of the three lines
were analysed for ATP and ADP contents. All tissues
revealed a significantly higher ATP content in B. napus
than in the CMS lines with the exception of green leaves.
Despite the fact that B. napus green leaves had a higher
value for ATP, the difference between B. napus and the two
CMS lines was not significant (Table 4). The CMS tissues
under study also had a reduction in ADP content resulting
in similar ATP/ADP ratios to those of B. napus.
Detailed studies of the vegetative development of the two B.
napus CMS lines revealed that the CMS lines displayed
several vegetative differences from the parental line B.
napus cv. Hanna. The CMS plants are shorter in stature, due
to the reduced size of internode cells and the leaves also have
smaller and fewer cells. When plants bolt, inflorescence
length is markedly reduced. Due to the economical importance of CMS plants for hybrid seed production, only CMS
lines that display normal growth, development and productivity are of practical importance (Levings, 1993).
Owing to this, reports describing vegetative alterations in
CMS plants are not common. Nevertheless, reduced plant
height and retarded vegetative growth have been reported in
plants from other alloplasmic CMS systems such as B.
juncea (Malik et al., 1999), N. tabacum (+Hyoscyamus
niger) cybrids (Zubko et al., 2001), alloplasmic N. tabacum
lines (I Farbos, unpublished results), and T. aestivum (Ikeda
and Tsunewaki, 1996). Of relevance is that two N. sylvestris
CMS plants characterized by large mtDNA deletions leading
to the absence of the NAD7 subunit of complex I, developed
slowly. These plants were characterized both by smaller
vegetative and floral organs (Li et al., 1988; Gutierres et al.,
1997). Furthermore, tobacco plants transformed with
orf239, which is associated with male sterility in common
bean, displayed a reduced vegetative growth compared with
non-transformed tobacco (He et al., 1996).
Histological studies of the CMS lines revealed that starch
granules inside the chloroplasts, were elevated both in
number and size, an observation confirmed by the starch
levels. Green leaves from the CMS plants also showed
reduced sucrose concentration when compared with the
Metabolic alterations in CMS plants
values measured in B. napus. The experiment using protoplasts subjected to differential osmotic dilutions also
demonstrated an inability of the B. napus cells to compensate for the reduced sucrose concentrations in the medium
compared with the cells in the CMS lines. This suggests
that the cytoplasm of the CMS plants possesses a reduced
osmotic pressure.
Sucrose synthesis takes place in the cytosol using
compounds such as triose-P exported from the chloroplast
and converted to hexose phosphates using ATP produced
by the mitochondria (Krömer et al., 1993; Raghavendra and
Padmasree, 2003; Chia et al., 2004). The available cytosolic pool of ATP thus regulates the sucrose levels. Indeed,
in accordance with the low sucrose levels in the CMS lines,
the ATP levels were significantly reduced in all CMS
tissues analysed compared with B. napus, except in green
CycD2 relative expression
1,4
a
1,2
1
0,8
a
0,6
0,4
a
0,2
0
B. napus
CMS4:19
CMS41:17
CycD3 relative expression
1,4
b
1,2
1
a
0,8
0,6
a
0,4
0,2
0
B. napus
CMS4:19
CMS41:17
Fig. 6. Results from real time RT-PCR amplification of RNA isolated
from 166 h protoplast cell culture experiments. (a) Relative expression of
CycD2 mRNA amplification and (b) relative expression CycD3 mRNA
amplification. Standard deviation values are shown for n=4.
1251
leaves. In this last material, the ATP produced by chloroplasts may make up a higher proportion of cellular ATP in
the CMS material. However, the ATP produced in the
chloroplast is not exported to the cytosol (Leon et al.,
1998), creating a demand for mitochondrial ATP under
both photosynthetic and non-photosynthetic conditions.
Etiolated CMS plants had reduced ATP levels after 2 d of
total darkness, supporting the theory that the ATP values
observed in CMS green leaves were elevated due to the
chloroplast ATP pool. During normal light conditions,
starch production in CMS plants is increased and sucrose
concentration is reduced. Considering that the levels of the
cytoplasmic ATP limits the rate of sucrose synthesis in the
CMS lines, the final amount of adenylates and sucrose
available in the cytosol will be a stimulus for starch
production. In the work of Strand et al. (2000), the reduction of sucrose synthesis in the cell was followed by an
increased starch production in plants with decreased expression of two enzymes involved in the sucrose biosynthesis pathway.
The similar ATP/ADP ratios in all tissues analysed
between the three lines indicate a correct utilization of
ATP, even though the total amounts of ATP and ADP in the
cell were reduced. A reduced availability of energy in the
CMS cells is further supported by the delayed recuperation
of the plants from etiolation.
The reduced leaf cell number, the reduced internode cell
elongation and the lower CycD2 and CycD3 expression
levels registered in the CMS plants compared with the
levels in B. napus seem to reflect the lower values of
cytoplasmic sucrose, since these are traits that are directly
regulated by sucrose availability in the cell by, for example,
controlling CycD2 and CycD3 transcript levels (RiouKhamlichi et al., 2000). While sucrose may be affecting
these traits through its pivotal role in carbohydrate and
energy metabolism, it may also be acting as a hormone-like
messenger in signal transduction (Jang et al., 1997; Rolland
et al., 2002; Seifert et al., 2004). Indeed, transition to
flowering is delayed in A. thaliana at low sucrose concentrations (Ohto et al., 2001). Delayed flowering time was
also registered in the CMS plants studied in the present
work (Leino et al., 2003). The expression levels of CycD2
and CycD3 measured by real time RT-PCR support the
observation of slower cell division rates in CMS plants.
Table 4. ATP, ADP and ATP/ADP measurements from flower meristems, flower buds, green leaves, and 2 d-etiolated leaves
Means 6SD (n>9) with different letters within each row are significantly different at the P <0.05 probability level; values in nmol gÿ1 FW.
B. napus
CMS 4:19
ATP
Flower meristem
Flower buds
Green leaves
2 d-etiolated leaves
18.962.1
14.961.2
2.260.3
0.860.1
a
a
a
a
CMS 41:17
ADP
ATP/ADP
ATP
ADP
ATP/ADP
ATP
ADP
ATP/ADP
13.561.0 a
8.361.4 a
3.560.4 a
0.260.03 a
1.560.2 a
1.860.2 a
0.660.1 a
4.060.06 a
12.560.5 b
11.761.0 b
1.760.2 a
0.560.04 b
7.660.7 b
7.561.0 a
3.460.2 a
0.160.02 b
1.760.2 a
1.760.2 a
0.560.05 a
5.060.1 a
13.960.5 c
8.660.7 c
2.060.1 a
0.660.04 c
8.560.7 c
6.060.6 a
4.660.5 a
0.160.02 c
1.760.2 a
1.460.05 a
0.560.05 a
6.060.07 a
1252 Teixeira et al.
Nevertheless, they were able to reach the same height of
B. napus when fully mature. By contrast, plants expressing
CycD2 constitutively have an accelerated growth rate, but
a normal morphology (Cockcroft et al., 2000).
Alloplasmic CMS lines are excellent systems for studying mechanisms affected by impaired mitochondrial function. This work indicates that the reduced ATP levels in the
cytoplasm of leaf cells do not support the normal rate of
sucrose synthesis. A reduction in the rate of sucrose
synthesis, in turn, promotes additional starch production.
Due to the low sucrose levels in the cytoplasm, cell division
and cell elongation are affected, resulting in phenotypic
alterations of the CMS plants such as reduced plant height
and slower growth rate.
In conclusion, this work shows that nuclear–mitochondrial
interactions not only cause aberrations of male organ
formation, but also affect key metabolic pathways that
influence vegetative growth and development.
Acknowledgements
We are grateful to I Eriksson and G Rönnqvist for excellent
laboratory assistance, A Axén and H Ekwall for the skilled electron
microscopy support, M Leino for all the statistical treatments, and I
Farbos for providing initial ideas for the work. This work was
supported by the Swedish Research Council (VR), the Swedish
research Council for Environment, Agricultural Sciences and Spatial
Planning (FORMAS). RT Teixeira was supported by a fellowship
from Fundacxão para a Ciência e a Tecnologia – Ministério da
Ciência e do Ensino Superior, Portugal.
References
Bergman P, Edqvist J, Farbos I, Glimelius K. 2000. Male-sterile
tobacco display abnormal mitochondrial atp 1 transcript accumulation and reduced floral ATP/ADP ratio. Plant Molecular Biology
42, 531–544.
Bowsher CG, Tobin AK. 2001. Compartmentation of metabolism
within mitochondria and plastids. Journal of Experimental Botany
52, 513–527.
Chia T, Thorneycroft D, Chapple A, Messerli G, Chen J,
Zeeman SC, Smith SM, Smith A. 2004. A cytosolic glucosyltransferase is required for conversion of starch to sucrose in
Arabidopsis leaves at night. The Plant Journal 37, 853–863.
Cockcroft CE, den Boer BGW, Healy JMS, Murray JAH.
2000. Cyclin D control of growth rate in plants. Nature 405,
575–579.
Forsberg J, Dixelius C, Lagercrantz U, Glimelius K. 1998. UV
dose-dependent DNA elimination in asymmetric hybrids between
Brassica napus and Arabidopsis thaliana. Plant Science 131,
65–76.
Glimelius K. 1984. High growth rate and regeneration capacity
of hypocotyl protoplasts in some Brassicaceae. Physiologia
Plantarum 61, 38–44.
Gutierres S, Sabar M, Lelandais C, Chetrit P, Diolez P,
Degand H, Boutry M, Vedel F, Kouchkovsky Y, De Paepe R.
1997. Lack of mitochondrial and nuclear-encoded subunits of
complex I and alteration of the respiratory chain in Nicotiana
sylvestris mitochondrial deletions mutants. Proceedings of the
National Academy of Sciences, USA 94, 3436–3441.
Hanson MR. 1991. Plant mitochondrial mutations and male sterility.
Annual Review of Genetics 25, 461–486.
He S, Abad AR, Gelvin SB, Mackenzie SA. 1996. A cytoplasmic
male sterility-associated mitochondrial protein causes pollen disruption in transgenic tobacco. Proceedings of the National
Academy of Sciences, USA 93, 11763–11768.
Hedtke B, Wagner I, Börner T, Hess WR. 1999. Inter-organellar
crosstalk in higher plants: impaired chloroplast development
affects mitochondrial gene and transcript levels. The Plant Journal
19, 635–643.
Hurry VM, Strand Å, Tobiæson M, Gardeström P, Öquist G.
1995. Cold hardening of spring and winter wheat and rape results
in differential effects on growth, carbon metabolism, and carbohydrate content. Plant Physiology 109, 697–706.
Ikeda TM, Tsunewaki K. 1996. Deficiency of coxI gene expression
in wheat plants with Aegilops columnaris cytoplasm. Current
Genetics 30, 509–514.
Jang J, León P, Zhou L, Sheen J. 1997. Hexokinase as a sugar
sensor in higher plants. The Plant Cell 9, 5–19.
Krömer S, Malmberg G, Gardeström P. 1993. Mitochondrial
contribution to photosynthetic metabolism. Plant Physiology 102,
947–955.
Leino M, Teixeira R, Landgren M, Glimelius K. 2003. Brassica
napus lines with rearranged Arabidopsis mitochondria display
CMS and a range of developmental aberrations. Theoretical and
Applied Genetics 106, 1156–1163.
Leon P, Arroyo A, Mackenzie S. 1998. Nuclear control of
plastid and mitochondrial development in higher plants. Annual
Review of Plant Physiology and Plant Molecular Biology 49,
453–480.
Levings III CS. 1993. Thoughts on cytoplasmic male sterility in
cms-T maize. The Plant Cell 5, 1285–1290.
Li XQ, Chetrit P, Mathieu C, Vedel F, De Paepe R, Remy R,
Ambard-Bretteville F. 1988. Regeneration of cytoplasmic male
sterile protoclones of Nicotiana sylvestris with mitochondrial
variations. Current Genetics 13, 261–266.
Lundquist P, Näsholm T, Huss-Danell K. 2003. Nitrogenase
activity and root nodule metabolism in response to O2 and shortterm N2 deprivation in dark-treated Frankia–Alnus incana plants.
Physiologia Plantarum 119, 244–252.
Malik M, Vyas P, Rangaswamy NS, Shivanna KR. 1999.
Development of two new cytoplasmic male-sterile lines in
Brassica juncea through wide hybridisation. Plant Breeding
118, 75–78.
Marienfeld JR, Newton KJ. 1994. The maize NCS2 abnormal
growth mutant has a chimeric nad4-nad7 mitochondrial gene and
is associated with reduced complex I function. Genetics 138,
855–863.
Ohto M, Onai K, Furukawa Y, Aoki E, Araki T, Nakamura K.
2001. Effects of sugar on vegetative development and floral
transition in Arabidopsis. Plant Physiology 127, 252–261.
Raghavendra AS, Padmasree K. 2003. Beneficial interactions of
mitochondrial metabolism with photosynthetic carbon assimilation. Trends in Plant Science 8, 546–553.
Riou-Khamlichi C, Menges M, Healy JMS, Murray JAH.
2000. Sugar control of the plant cell cycle: differential regulation
of Arabidopsis D-type cyclin gene expression. Molecular and
Cellular Biology 20, 4513–4521.
Rolland F, Moore B, Sheen J. 2002. Sugar sensing and signaling in
plants. The Plant Cell 14, S185–S205.
Seifert GJ, Barber C, Wells B, Roberts K. 2004. Growth
regulators and the control of nucleotide sugar flux. The Plant
Cell 16, 723–730.
Metabolic alterations in CMS plants
Sheen J, Zhou L, Jang J-C. 1999. Sugars as signalling molecules.
Current Opinion in Plant Biology 2, 410–418.
Smyth DR, Bowman JL, Meyerowitz EM. 1990. Early flower development in Arabidopsis. The Plant Cell. 2, 755–767.
Strand Å, Zrenner R, Trevanion S, Stitt M, Gustafsson P,
Gardeström P. 2000. Decreased expression of two key enzymes
in the sucrose biosynthesis pathway, cytosolic fructose-1,6-biphosphatase and sucrose phosphate synthase, has remarkably
1253
different consequences for photosynthetic carbon metabolism
in transgenic Arabidopsis thaliana. The Plant Journal 23,
759–770.
Zubko MK, Zubko EI, Ruban AV, Adler K, Mock H, Misera S,
Gleba YY, Grimm B. 2001. Extensive developmental and
metabolic alterations in cybrids Nicotiana tabacum (+Hyoscyamus
niger) are caused by complex nucleo-cytoplasmic incompatibility.
The Plant Journal 25, 627–639.